sign in sign up
<<
Home , Abraxas (moth), Abraxas grossulariata, Abraxas sylvata, Abraxini, Aethalura, Aethalura punctulata

CSIRO PUBLISHING Invertebrate Systematics, 2017, 31, 427–441 http://dx.doi.org/10.1071/IS17005

A molecular phylogeny of the Palaearctic and Oriental members of the ( : Geometridae : )

Nan Jiang A,D, Xinxin Li A,B,D, Axel Hausmann C, Rui Cheng A, Dayong Xue A and Hongxiang Han A,E

AKey Laboratory of Zoological Systematics and , Institute of Zoology, Chinese Academy of Sciences, No. 1 Beichen West Road, Chaoyang District, Beijing 100101, China. BUniversity of Chinese Academy of Sciences, 19A Yuquan Road, Shijingshan District, Beijing 100049 China. CSNSB – Zoologische Staatssammlung München, Münchhausenstraße 21, Munich 81247, Germany. DThese authors contributed equally to this work. ECorresponding author. Email: [email protected]

Abstract. Owing to the high diversity and the lack of a modern revision, the phylogenetic relationships within the tribe Boarmiini remain largely unexplored. In this study, we reconstruct the first molecular phylogeny of the Palaearctic and Oriental members of Boarmiini, and infer the relationships among tribes within the ‘boarmiine’ lineage. One mitochondrial (COI) and four nuclear (EF-1a, CAD, RpS5, GAPDH) genes for 56 genera and 96 species of Boarmiini mostly from the Palaearctic and Oriental regions were included in the study. Analyses of Bayesian inference and maximum likelihood recovered largely congruent results. The of Boarmiini is supported by our results. Seven and seven subclades within Boarmiini were found. The molecular results coupled with morphological studies suggested the synonymisation of Zanclopera Warren, 1894, syn. nov. with Moore, 1868. The following new combinations are proposed: Krananda straminearia (, 1897) (comb. nov.), Krananda falcata (Warren, 1894) (comb. nov.), and Krananda fulva (Yazaki, 1994) (comb. nov.).Our results also supported themonophyly of the ‘boarmiine’ lineage. Boarmiini were recovered as sister to the remaining taxa within the ‘boarmiine’ lineage, and were recovered as sister to , Eutoeini and Cassymini.

Additional keywords: ‘boarmiine’ lineage, new combinations, new synonym, systematics, .

Received 11 January 2017, accepted 10 March 2017, published online 23 June 2017

Introduction Holloway (1994, 1997)andBeljaev(2006a, 2006b, 2016) The geometrid Ennominae is the largest subfamily of proposed a morphology-based hypothesis about the tribal Geometridae, which contains over 10 000 described species system of the Ennominae. However, the tribal relationships placed in approximately 1100 genera (Scoble 1999; Pitkin within the Ennominae are poorly understood in all present 2002; Scoble and Hausmann 2007). The monophyly of the studies (Skou and Sihvonen 2015). Ennominae is well supported by recent morphological and Boarmiini is the most species-rich tribe within the molecular studies (Wahlberg et al. 2010; Sihvonen et al. 2011; ‘boarmiine’ lineage, currently comprising more than 150 Skou and Sihvonen 2015). Within Ennominae, the tribes can be genera and 5000 species globally, mainly distributed across divided into two groups based on the structure of the pupal the Palaearctic and Oriental biogeographic regions (Wehrli cremaster: the ‘boarmiine’ lineage including Boarmiini, 1938–1954; Holloway 1994; Scoble 1999; Pitkin 2002; Scoble Macariini, Abraxini, Eutoeini, Cassymini (cremaster with setae and Hausmann 2007). D1,SD1 and L1 reduced, D2 fused into a stem) and the ‘ennomine’ Some species of the tribe are polyphagous, but others are lineage including , , , highly specialised (Holloway 1994). Many species of Boarmiini and so on (cremaster with setae D1,SD1,L1 and D2 present, D2 are considered serious crop or forest pests, such as separated) (Forbes 1948; McGuffin 1977; Viidalepp et al. selenaria (Denis & Schiffermüller, 1775), panterinaria 2007). This morphology-based hypothesis was later supported (Bremer & Grey, 1853) and obliqua (Prout, 1915). by some recent molecular studies (Viidalepp et al. 2007;Wahlberg Several morphological characters have been used to define et al. 2010;Õunapet al. 2011; Sihvonen et al. 2011). In addition, Boarmiini: the male forewing usually has a fovea; the male

Journal compilation CSIRO 2017 www.publish.csiro.au/journals/is 428 Invertebrate Systematics N. Jiang et al. abdomen usually has a transverse comb of setae on the third sequence data from seven nuclear and one mitochondrial loci, sternite; in the male genitalia, the uncus is usually tapered and and showed that the Boarmiini were characterised by polytomies triangular; the socii are usually weak or absent; the cucullus of resulting from a rapid radiation. In addition, little phylogenetic the valva is usually well developed and strongly covered with signal was found in their morphological study. Considering the setae; the sacculus often has sclerotised structures; a pair of recent progress in understanding the higher-level systematics of cristae is often well developed, consisting of dense tufts in the other groups of Lepidoptera (e.g. Sihvonen et al. 2011, 2015; anellus, near the base of the valva; the coremata are usually not Zahiriet al. 2011, 2012, 2013;Regieret al. 2015; Wang et al. 2015; developed; the signum of the female genitalia is variable Rota et al. 2016;Õunapet al. 2016), it is clear that molecular (Holloway 1994; Pitkin 2002; Young 2008). However, no characters are a valuable tool for resolving the phylogeny of the universal character has been identified that uniquely defines Boarmiini (Wahlberg et al. 2010). the tribe (Holloway 1994; Pitkin 2002). In addition, the delimitation and taxonomic positions of The Boarmia Treitschke, 1825 was established some genera of Boarmiini have remained unclear. For example, based on Geometra roboraria Schiffermüller, 1775 from a recent morphological study has indicated that Zanclopera Austria, which was designated as the type species by Warren, 1894 may be a synonym of Krananda Moore, 1868 Duponchel (1829). The genus Hübner, 1821 was (Holloway 1994). established based on umbrosaria Hübner, 1813 Our main goal here is to test the monophyly and composition from North America. Later, Boarmia was considered as a of Boarmiini, examine the relationships among some genera of synonym of Hypomecis by Inoue (1982a, 1982b). Hampson Boarmiini from the Palaearctic and Oriental regions and test (1895) presented a wider concept of Boarmia, and included 27 hypotheses regarding the groups previously proposed within genera from India. Pierce (1914) treated this group as Boarmiinae, the tribe, to infer the relationships among tribes within the and illustrated the genitalia of 10 genera and 17 species from the ‘boarmiine’ lineage. These results, taken together, will provide British Islands. Prout (1912–1916) mainly followed Hampson’s the first basis for a thorough revision of the classification of treatment, and divided Palaearctic Boarmia into eleven sections, Boarmiini, and a phylogenetic framework for studying the mainly based on the male antennae and the wing venation. evolutionary history of Boarmiini species. Wehrli (1938–1954) considered Prout’s sections as subgenera and described nine new subgenera on the basis of external Materials and methods characters and the male genitalia. Later, many subgenera were Taxon sampling raised to generic rank (e.g. Inoue 1956, 1982a, 1982b; Herbulot ‘ ’ 1963). McGuffin(1977) gave a detailed description of 17 genera A total of 111 species from 67 genera of the boarmiine lineage of Nearctic Boarmiini, and presented the first graphic illustration were included for this study, covering all the tribes previously ‘ ’ of a hypothesis on the phylogeny of Boarmiini based on the included within the boarmiine lineage. This sample includes morphological characters of the immature stages and adults. Sato 27 species from 24 genera that had been used previously for (1984) carried out a taxonomic study on the genus Hypomecis constructing the phylogenies of Wahlberg et al. (2010) and and its allied genera from Japan. He divided 27 genera of Sihvonen et al.(2011). The present study is restricted to Boarmiini into six genus-groups based on the characters of egg, Palaearctic and Oriental samples, with a few exceptions. The , and adults. Pitkin (2002) reviewed the Neotropical tribe Boarmiini is represented by 96 species assigned to 56 genera of the Ennominae, and 20 genera were included in genera, Macariini by three genera and three species, Cassymini fi fi Boarmiini. Recently, many new genera and species of Boarmiini by ve genera and ve species, Eutoeini by two genera and four were described from the Oriental region (Sato 1995a, 1995b, 1996, species, and Abraxini by one genus and three species. The 1999, 2002, 2005, 2008, 2013, 2014, 2016; Sato and Wang 2004, outgroup included 10 species from 10 genera, among them six 2005, 2006, 2007, 2016;SatoandFu2010). species from Gnophini, one species from Ourapterygini, one Holloway (1994) proposed a broad concept of the tribe species from Ennomini, and two species from . Boarmiini, including the taxa Amphidasini, Ascotini, , A list of taxa with the collecting localities, voucher codes and Braccini, Bupalini, Cheimatobiini, Cleorini, Eubyjini, Gnophini, GenBank accession numbers is provided in Table 1. Hyberniini, Melanolophini, Milioniini, Selidosemini, Sionini and fi Theriini. The broad concept was supported by the morphological DNA extraction, ampli cation and sequencing study of Beljaev (2000). Later, Gnophini and Theriini were Total genomic DNA was extracted from one or two legs that had excluded from Boarmiini in recent morphological and molecular been dried or freshly preserved in anhydrous ethanol, using studies (Beljaev 2006b;Viidaleppet al. 2007;Wahlberget al. the DNeasy Blood and Tissue Kit (Qiagen, Beijing, China) 2010;Õunapet al. 2011; Sihvonen et al. 2011). Young (2006, following the protocol suggested by the manufacturers. One 2008) constructed a phylogeny for the Australian Ennominae, mitochondrial DNA marker, cytochrome c oxidase subunit I using DNA sequence data from two nuclear loci and (COI) and four nuclear DNA markers, elongation factor-1 a morphological data and including 10 species from 10 genera. In (EF-1a), carbamoylphosphate synthetase domain protein his study, Boarmiini were found to be monophyletic. At present, (CAD), ribosomal protein S5 (RpS5) and glyceraldehyde-3- the most complete taxonomic coverage for molecular analyses phosphate dehydrogenase (GAPDH) were selected. All these of Boarmiini was achieved by Wahlberg et al.(2010), who markers have proven to be valuable in phylogenetic studies of included 28 species from 21 genera of Holarctic Boarmiini. Lepidoptera (Zahiri et al. 2011, 2012, 2013; Sihvonen et al. 2011, They presented a phylogenetic study of fightlessness among 2015; Wang et al. 2015; Rota et al. 2016). All amplifications female Ennominae based on morphological data and DNA were performed in a 25-mL reaction volume containing 12.5 mL Phylogeny of Boarmiini Invertebrate Systematics 429

Table 1. List of specimens and GenBank accession numbers Notes: Sequences that were not newly generated are marked with an asterisk (*). Type species are marked with a dagger (†). Classification follows Forum Herbulot (2003)

Subfamily/tribes Species Voucher code Collecting locality COI EF1a RpS5 GAPDH CAD Geometrinae Geometrini kina IOZ LEP M 17078 Tibet, China KX951589 KX950212 KX950396 KX950304 KX950121 Swinhoe, 1893 Geometrini Chloroglyphica sp. IOZ LEP M 13771 Tibet, China KX951573 KX950196 KX950380 KX950288 KX950106 Ennominae Ourapterygini sambucaria MM06863 Finland JF784760* JF785380* JF784996* – JF785243* (Linnaeus, 1758)† Ennomini alniaria MM07823 Finland JF784763* JF785383* JF784999* JF785451* JF785249* (Linnaeus, 1758) Gnophini (Denis MM12840 Finland JF784777* JF785397* JF785012* JF785457* JF785261* & Schiffermüller, 1775)† Gnophini scripturaria IOZ LEP M 14497 Yunnan, China KX951582 KX950205 KX950389 KX950297 KX950115 (Walker, 1866)† Gnophini Loxaspilates fixseni IOZ LEP M 16307 Tibet, China KX951588 KX950211 KX950395 KX950303 KX950120 (Alphéraky, 1892) Gnophini sp. IOZ LEP M 00110 Yunnan, China KX951502 KX950126 KX950308 KX950216 KX950036 Gnophini Phthonandria atrilineata IOZ LEP M 10572 Beijing, China KX951552 KX950176 KX950359 KX950267 KX950086 (Butler, 1881)† Gnophini szetschwana IOZ LEP M 14303 Yunnan, China KX951578 KX950201 KX950385 KX950293 KX950111 (Wehrli, 1953) Macariini clathrata MM00584 Finland JF784729* JF785349* ––JF785208* (Linnaeus, 1758)† Macariini fusca (Thunberg, NS13 Finland GU580786* GU580817* – GU580822* – 1782)† Macariini sp. IOZ LEP M 16070 Tibet, China KX951585 KX950208 KX950392 KX950300 KX950118 Cassymini Ballantiophora GB-CR-S-1187 Costa Rica JF784672* JF785297* JF784932* – JF785159* gibbiferata (Guenée, 1858)† Cassymini Hydatocapnia marginata IOZ LEP M 15625 Shaanxi, China KX951584 KX950207 KX950391 KX950299 KX950117 (Warren, 1893)† Cassymini marginata MM01247 Finland JF784731* JF785351* JF784975* JF785434* JF785212* (Linnaeus, 1758)† Cassymini Peratophyga hyalinata IOZ LEP M 13796 Tibet, China KX951574 KX950197 KX950381 KX950289 KX950107 (Kollar, 1844)† Cassymini torrida AH3604 Israel JF784653* JF785278* JF784915* – JF785142* Fletcher, 1794 Eutoeini Calletaera obliquata IOZ LEP M 13689 Tibet, China KX951572 KX950195 KX950379 KX950287 KX950105 (Moore, 1888) Eutoeini mitorrhaphes IOZ LEP M 16113 Tibet, China KX951586 KX950209 KX950393 KX950301 – Prout, 1925 Eutoeini Luxiaria amasa (Butler, IOZ LEP M 16239 Tibet, China KX951587 KX950210 KX950394 KX950302 KX950119 1878) Eutoeini Luxiaria phyllosaria MM14752 Malaysia JF784793* JF785410* JF785023* JF785460* JF785272* (Walker, 1860)† Abraxini grossulariata MM06725 Finland JF784757* JF785377* – JF785447* JF785240* (Linnaeus, 1758)† Abraxini Abraxas illuminata IOZ LEP M 18877 Guangxi, China KX951592 KX950215 KX950399 KX950307 KX950125 Warren, 1894 Abraxini (Scopoli, NS24 Finland GU580762* GU580800* GU580668* GU580830* – 1763) Boarmiini Abaciscus tristis Butler, IOZ LEP M 10019 Fujian, China KX951535 KX950159 KX950342 KX950250 KX950069 1889† Boarmiini Abaciscus ferruginis Sato IOZ LEP M 10020 Fujian, China KX951536 KX950160 KX950343 KX950251 KX950070 & Wang, 2004 Boarmiini chinensis Sato IOZ LEP M 05055 Shaanxi, China KX951522 KX950146 KX950328 KX950236 KX950056 & Wang, 2004 (continued next page ) 430 Invertebrate Systematics N. Jiang et al.

Table 1. (continued )

Subfamily/tribes Species Voucher code Collecting locality COI EF1a RpS5 GAPDH CAD Boarmiini NS36 Estonia GU580751* GU580790* GU580679* GU580839* – (Denis & Schiffermüller, 1775) Boarmiini marginaria NS32 Estonia GU580753* GU580792* GU580675* GU580835* – (Fabricius, 1776) Boarmiini NS06 Finland GU580752* GU580791* GU580659* –– (Hübner, 1799) Boarmiini decussata (Moore, IOZ LEP M 00563 Yunnan, China KX951506 KX950130 KX950312 KX950220 KX950040 1868) Boarmiini Alcis repandata NS39 Estonia GU580754* GU580793* GU580682* GU580842* – (Linnaeus, 1758)† Boarmiini Alcis semiusta IOZ LEP M 10830 Hainan, China KX951556 KX950180 KX950363 KX950271 KX950090 (Bastelberger, 1909) Boarmiini Amblychia angeronaria IOZ LEP M 01290 Zhejiang, China KX951514 KX950138 KX950320 KX950228 KX950048 Guenée, 1858† Boarmiini Amblychia insueta (Butler, IOZ LEP M 10213 Guangdong, China KX951545 KX950169 KX950352 KX950260 KX950079 1878) Boarmiini asahinai (Inoue, IOZ LEP M 05807 Guangxi, China KX951523 KX950147 KX950329 KX950237 KX950057 1964) Boarmiini Amraica superans (Butler, IOZ LEP M 11420 Hubei, China KX951563 KX950187 KX950370 KX950278 KX950097 1878) Boarmiini Antipercnia albinigrata IOZ LEP M 18868 Guangxi, China KX951591 KX950214 KX950398 KX950306 KX950124 (Warren, 1896)† Boarmiini Antipercnia belluaria IOZ LEP M 17372 Yunnan, China KU964830 KU965304 – KU965462 KX950122 (Guenée, 1858) Boarmiini cinerarius IOZ LEP M 07923 Gansu, China KX951529 KX950153 KX950335 KX950243 KX950063 (Erschoff, 1874) Boarmiini NS28 Lithuania GU580757* GU580796* GU580672* –– (Denis & Schiffermüller, 1775)† Boarmiini Arbomia kishidai Sato & IOZ LEP M 10248 Guangdong, China KX951546 KX950170 KX950353 KX950261 KX950080 Wang, 2004† Boarmiini mandshuriaria IOZ LEP M 13345 Beijing, China KX951569 KX950192 KX950376 KX950284 KX950102 (Bremer, 1864) Boarmiini Arichanna sinica (Wehrli, IOZ LEP M 14444 Yunnan, China KX951579 KX950202 KX950386 KX950294 KX950112 1933) Boarmiini Arichanna tientsuena IOZ LEP M 14023 Yunnan, China KX951576 KX950199 KX950383 KX950291 KX950109 (Wehrli, 1933) Boarmiini (Denis & IOZ LEP M 10577 Beijing, China KX951553 KX950177 KX950360 KX950268 KX950087 Schiffermüller, 1775)† Boarmiini (Hufnagel, NS33 Finland GU580759* GU580797* GU580676* GU580836* – 1767)† Boarmiini Biston betularia IOZ LEP M 14462 Yunnan, China KX951580 KX950203 KX950387 KX950295 KX950113 (Linnaeus, 1758) Boarmiini Biston falcata (Warren, IOZ LEP M 01105 Yunnan, China KX951512 KX950136 KX950318 KX950226 KX950046 1893) Boarmiini IOZ LEP M 10001 Fujian, China KP238768* KX950156 KX950339 KX950247 KX950066 (Bremer & Grey, 1853) Boarmiini Blepharoctenucha IOZ LEP M 00655 Yunnan, China KX951509 KX950133 KX950315 KX950223 KX950043 virescens (Butler, 1880)† Boarmiini piniaria MM08584 Finland JF784767* JF785387* JF785003* – JF785253* (Linnaeus, 1758)† Boarmiini Calicha nooraria Sato & IOZ LEP M 11203 Shaanxi, China KX951561 KX950185 KX950368 KX950276 KX950095 Wang, 2004 Boarmiini Chorodna fulgurita IOZ LEP M 00625 Yunnan, China KX951508 KX950132 KX950314 KX950222 KX950042 (Walker, 1860) Boarmiini Chorodna mauraria IOZ LEP M 00526 Yunnan, China KX951505 KX950129 KX950311 KX950219 KX950039 (Guenée, 1858) (continued next page ) Phylogeny of Boarmiini Invertebrate Systematics 431

Table 1. (continued )

Subfamily/tribes Species Voucher code Collecting locality COI EF1a RpS5 GAPDH CAD Boarmiini alienaria (Walker, IOZ LEP M 11045 Hainan, China KX951560 KX950184 KX950367 KX950275 KX950094 1860) Boarmiini (Denis & MM01298 Finland JF784734* JF785354* – JF785435* JF785215* Schiffermüller, 1775)† Boarmiini Cleora fraterna (Moore, IOZ LEP M 07157 Vietnam KX951528 KX950152 KX950334 KX950242 KX950062 1888) Boarmiini Cleora repulsaria IOZ LEP M 06779 Guangxi, China KX951525 KX950149 KX950331 KX950239 KX950059 (Walker, 1860) Boarmiini Coremecis IOZ LEP M 10549 Jiangxi, China KX951551 KX950175 KX950358 KX950266 KX950085 leukohyperythra (Wehrli, 1925) Boarmiini Coremecis nigrovittata IOZ LEP M 10062 Fujian, China KX951538 KX950162 KX950345 KX950253 KX950072 (Moore, 1868) Boarmiini Cusiala stipitaria IOZ LEP M 10842 Hainan, China KX951557 KX950181 KX950364 KX950272 KX950091 (Oberthür, 1880) Boarmiini apicata Moore, IOZ LEP M 10053 Fujian, China KX951537 KX950161 KX950344 KX950252 KX950071 1868† Boarmiini Dalima patularia (Walker, IOZ LEP M 10098 Fujian, China KX951539 KX950163 KX950346 KX950254 KX950073 1860) Boarmiini Darisa fratercula Moore, IOZ LEP M 18693 Tibet, China KX951590 KX950213 KX950397 KX950305 KX950123 1888 Boarmiini ribeata NS23 Estonia GU580765* GU580803* GU580667* GU580829* – (Clerck, 1759)† Boarmiini Dilophodes elegans IOZ LEP M 07155 Vietnam KX951526 KX950150 KX950332 KX950240 KX950060 (Butler, 1878)† Boarmiini Diplurodes spinivalva IOZ LEP M 14479 Yunnan, China KX951581 KX950204 KX950388 KX950296 KX950114 Sato, 1999 Boarmiini Duliophyle majuscularia IOZ LEP M 13674 Tibet, China KX951571 KX950194 KX950378 KX950286 KX950104 (Leech, 1897) Boarmiini Ectropis crepuscularia NS21 Finland GU580767* GU580804* GU580666* GU580827* – (Denis & Schiffermüller, 1775)† Boarmiini Ectropis excellens (Butler, IOZ LEP M 10120 Fujian, China KX951540 KX950164 KX950347 KX950255 KX950074 1884) Boarmiini Ectropis sp. IOZ LEP M 10821 Hainan, China KX951555 KX950179 KX950362 KX950270 KX950089 Boarmiini atomaria NS43 Estonia GU580769* GU580806* GU580686* GU580845* – (Linnaeus, 1758)† Boarmiini tiliaria (Harris, NS30 USA GU580771* GU580808* GU580673* GU580834* – 1841) Boarmiini Erebomorpha fulguraria IOZ LEP M 09879 Sichuan, China KX951531 KX950154 KX950337 KX950245 KX950064 (Walker, 1860)† Boarmiini Gasterocome pannosaria IOZ LEP M 00334 Yunnan, China KX951503 KX950127 KX950309 KX950217 KX950037 (Moore, 1868)† Boarmiini Hypomecis catharma IOZ LEP M 01219 Zhejiang, China KX951513 KX950137 KX950319 KX950227 KX950047 (Wehrli, 1943) Boarmiini Hypomecis diffusaria IOZ LEP M 01434 Zhejiang, China KX951516 KX950140 KX950322 KX950230 KX950050 (Leech, 1897) Boarmiini Hypomecis eosaria IOZ LEP M 10903 Hainan, China KX951559 KX950183 KX950366 KX950274 KX950093 (Walker, 1863) Boarmiini IOZ LEP M 10503 Jiangxi, China KX951547 KX950171 KX950354 KX950262 KX950081 (Scopoli, 1763) Boarmiini MM01469 Finland JF784740* JF785360* – JF785439* JF785221* (Denis & Schiffermüller, 1775) Boarmiini altiviolescens IOZ LEP M 02449 Hainan, China KX951519 KX950143 KX950325 KX950233 KX950053 Holloway, 1994 Boarmiini Hyposidra infixaria IOZ LEP M 02461 Hainan, China KX951520 KX950144 KX950326 KX950234 KX950054 (Walker, 1860) (continued next page ) 432 Invertebrate Systematics N. Jiang et al.

Table 1. (continued )

Subfamily/tribes Species Voucher code Collecting locality COI EF1a RpS5 GAPDH CAD Boarmiini bituminaria IOZ LEP M 10595 Beijing, China KX951554 KX950178 KX950361 KX950269 KX950088 (Lederer, 1853) Boarmiini Jankowskia fuscaria IOZ LEP M 10533 Jiangxi, China KX951550 KX950174 KX950357 KX950265 KX950084 (Leech, 1891) Boarmiini Krananda latimarginaria IOZ LEP M 02281 Hainan, China KX951517 KX950141 KX950323 KX950231 KX950051 Leech, 1891 Boarmiini Krananda lucidaria IOZ LEP M 10531 Jiangxi, China KX951549 KX950173 KX950356 KX950264 KX950083 Leech, 1897 Boarmiini Krananda IOZ LEP M 02364 Hainan, China KX951518 KX950142 KX950324 KX950232 KX950052 oliveomarginata Swinhoe, 1894 Boarmiini Krananda orthotmeta IOZ LEP M 09123 Yunnan, China KX951530 – KX950336 KX950244 – Prout, 1926 Boarmiini Krananda semihyalina IOZ LEP M 10016 Fujian, China KX951534 KX950158 KX950341 KX950249 KX950068 Moore, 1868† Boarmiini Lassaba albidaria IOZ LEP M 10133 Fujian, China KX951542 KX950166 KX950349 KX950257 KX950076 (Walker, 1866) Boarmiini Lassaba contaminata IOZ LEP M 13524 Tibet, China KX951570 KX950193 KX950377 KX950285 KX950103 Moore, 1888† Boarmiini Lophobates yazakii Sato & IOZ LEP M 10010 Fujian, China KX951533 KX950157 KX950340 KX950248 KX950067 Wang, 2004 Boarmiini lapponaria NS08 Finland GU580780* GU580815* GU580660* –– (Boisduval, 1840) Boarmiini Lycia hirtaria (Clerck, NS15 Estonia GU580779* AY948509* GU580662* GU580823* – 1759)† Boarmiini sp. AH3852 Brazil JF784656* JF785281* JF784918* –– Boarmiini Microcalicha melanosticta IOZ LEP M 10140 Fujian, China KX951543 KX950167 KX950350 KX950258 KX950077 (Hampson, 1895) Boarmiini basalis Walker, IOZ LEP M 11835 Guangdong, China KX951567 KX950190 KX950374 KX950282 KX950100 1854 Boarmiini Monocerotesa abraxides IOZ LEP M 12898 Hubei, China KX951568 KX950191 KX950375 KX950283 KX950101 (Prout, 1914) Boarmiini Monocerotesa sp. IOZ LEP M 13856 Tibet, China KX951575 KX950198 KX950382 KX950290 KX950108 Boarmiini Myrioblephara duplexa IOZ LEP M 00581 Yunnan, China KX951507 KX950131 KX950313 KX950221 KX950041 (Moore, 1888) Boarmiini albosignaria IOZ LEP M 11511 Henan, China KX951564 KX950188 KX950371 KX950279 KX950098 (Bremer & Grey, 1853) Boarmiini Ophthalmitis irrorataria IOZ LEP M 00986 Yunnan, China KX951511 KX950135 KX950317 KX950225 KX950045 (Bremer & Grey, 1853) Boarmiini Ophthalmitis IOZ LEP M 05819 Guangxi, China KX951524 KX950148 KX950330 KX950238 KX950058 xanthypochlora (Wehrli, 1924) Boarmiini Parapercnia giraffata IOZ LEP M 15581 Shaanxi, China KX951583 KX950206 KX950390 KX950298 KX950116 (Guenée, 1858)† Boarmiini sp. IOZ LEP M 01420 Zhejiang, China KX951515 KX950139 KX950321 KX950229 KX950049 Boarmiini fumidaria Leech, IOZ LEP M 10127 Fujian, China KX951541 KX950165 KX950348 KX950256 KX950075 1897 Boarmiini secundaria NS38 Estonia EF206684* EF206676* GU580681* GU580841* – (Denis & Schiffermüller, 1775) Boarmiini Phthonosema IOZ LEP M 11236 Shaanxi, China KX951562 KX950186 KX950369 KX950277 KX950096 serratilinearia (Leech, 1897) Boarmiini Pogonopygia nigralbata IOZ LEP M 11681 Guangxi, China KX951565 KX950189 KX950372 KX950280 KX950099 Warren, 1894† Boarmiini Pogonopygia pavida IOZ LEP M 07156 Vietnam KX951527 KX950151 KX950333 KX950241 KX950061 (Bastelberger, 1911) Boarmiini Psilalcis diorthogonia IOZ LEP M 09894 Sichuan, China KX951532 KX950155 KX950338 KX950246 KX950065 (Wehrli, 1925) (continued next page ) Phylogeny of Boarmiini Invertebrate Systematics 433

Table 1. (continued )

Subfamily/tribes Species Voucher code Collecting locality COI EF1a RpS5 GAPDH CAD Boarmiini Psilalcis galsworthyi Sato, IOZ LEP M 11805 Guangdong, China KX951566 – KX950373 KX950281 – 1996 Boarmiini boarmiaria IOZ LEP M 10858 Hainan, China KX951558 KX950182 KX950365 KX950273 KX950092 (Guenée, 1858)† Boarmiini Rikiosatoa sp. IOZ LEP M 03400 Yunnan, China KX951521 KX950145 KX950327 KX950235 KX950055 Boarmiini Sysstema semicirculata IOZ LEP M 00817 Yunnan, China KX951510 KX950134 KX950316 KX950224 KX950044 (Moore, 1868)† Boarmiini dholaria IOZ LEP M 00516 Yunnan, China KX951504 KX950128 KX950310 KX950218 KX950038 Moore, 1868† Boarmiini Xandrames latiferaria IOZ LEP M 10529 Jiangxi, China KX951548 KX950172 KX950355 KX950263 KX950082 (Walker, 1860) Boarmiini Xenoplia foraria (Guenée, IOZ LEP M 14213 Yunnan, China KX951577 KX950200 KX950384 KX950292 KX950110 1858)† Boarmiini Zanclopera straminearia IOZ LEP M 10141 Fujiang, China KX951544 KX950168 KX950351 KX950259 KX950078 Leech, 1897 of TSINGKE Mater Mix, 0.5 mL of each primer (10 mM), from one genus to another in this study, we have maintained the 0.5 mL of genomic DNA and 11 mL of ddH2O. All primers and combination that was previously in use on the trees of Fig. 1. annealing temperatures used in this study are listed in Table 2. Results and discussion Phylogenetic analyses The multilocus phylogenies in this study cover about one-third of the genera of the tribe Boarmiini, rendering this study the All original sequences and those downloaded from GenBank most comprehensive phylogenetic analysis to date of the were aligned using Clustal W implemented in MEGA 5.2 Boarmiini. In the following, the robustness of recovered clades (Tamura et al. 2011). The full lengths of the targeted gene is presented as either posterior probabilities (PP, for the BI fragments were as follows: 660 bp of COI, 1038 bp of CAD, analysis) or bootstrap values (BS, for the ML analysis). Major 958 bp of EF-1a, 691 bp of GAPDH and 617 bp of RpS5.The topologies obtained from the BI and ML tree searches were phylogenetic relationships were reconstructed on the basis of almost consistent with each other (Fig. 1). Incongruence Bayesian inference (BI) using MrBayes 3.2.6 (Ronquist et al. between the BI and ML trees was restricted to a few nodes 2012) on the CIPRES Science Gateway (Miller et al. 2010) that were very weakly supported in both analyses. and maximum-likelihood (ML) methods using RAxML 7.7.1 (Stamatakis et al. 2008) on the RAxML online platform (http:// embnet.vital-it.ch/raxml-bb/index.php). Prior to data analysis, Phylogenetic relationships of Boarmiini nucleotide data from all gene fragments were concatenated into Our results robustly recover the monophyly of Boarmiini a single 3964-bp dataset. Prior to the phylogenetic analyses, the (PP = 1, BS = 96), which is concordant with the results in program TIGER 1.02 (Cummin and McInerney 2011; Rota and Wahlberg et al.(2010), Õunap et al.(2011) and Sihvonen et al. Wahlberg 2012)wasfirst used to divide the data into 31 subsets (2011). However, no unique morphological synapomorphies for (bins) according to their evolutionary rates. Thereafter, all Boarmiini species could be identified (Wahlberg et al. 2010). PARTITIONFINDER 1.1.1 (Lanfear et al. 2012) was used to The relationships within Boarmiini are still unresolved (its choose the most effective partitioning scheme according to the nodes having weak support). It seems reasonable that Boarmiini is Bayesian information criterion using the bins defined by a polytomy caused by rapid diversification during the Oligocene TIGER. We used branchlengths = linked, models = raxml, model_ (Wahlberg et al. 2010). Within Boarmiini, there are seven clades selection = BIC and search = greedy options for the ML analysis, and seven subclades (labelled with capital letters in Fig. 1)with andbranchlengths = linked,models = mrbayesandsearch = greedy strong to weak support. options for the BI analysis. The partition schemes and substitution In our study, the ‘Cleora group’ (Cleora Curtis, 1825, Ascotis models are listed in Table 3. Hübner, 1825 and Cusiala Moore, 1887) was proposed on the For BI analysis, four simultaneous Markov chains (one cold basis of the developed crest on the first abdominal segment, the and three heated) were run for 50 million generations with trees elongate ovipositor, and the similar coloration and pattern of sampled every 5000 generations and the first 25% of sampled the first-instar larvae (Sato 1984). Hampson (1895) included trees were discarded as burn-in. Convergence and effective Cusiala in his wide concept of Biston Leach, 1815. Wehrli sample size of the runs were also checked using Tracer 1.5 (1938–1954) considered Cleora, Ascotis and Cusiala as (Rambaut and Drummond 2010). For ML analysis, the dataset subgenera of Boarmia, and mentioned the similar shape of the was divided into eight subsets following the suggestions by harpe in male genitalia of Cleora and Ascotis. Fletcher (1967) PARTITIONFINDER. The GTR+G model was implemented noted the close relationship between Cleora and Ascotis, and on all the subsets. All the operations were performed as their larger differences from Cusiala in genitalia structures. Our default for RAxML. For those taxa that have been transferred results support the grouping of Cleora and Ascotis in the 434 Invertebrate Systematics N. Jiang et al.

Table 2. Primers used to amplify and sequence the genes in this study

Region Primer pairs Sequence (50–30) Annealing Reference temperature (C) COI LepF1 ATTCAACCAATCATAAAGATATTGG 45 and 51 Hebert et al.(2004) LepR1 TAAACTTCTGGATGTCCAAAAAATCA Hebert et al.(2004) EF1a EF1aLepF2 ACAAATGCGGTGGTATCGACAA 58 Yamamoto and Sota (2007) EF1aR ATTTACCRGWACGACGRTC Kawakita et al.(2004) RpS5 RpS5f ATGGCNGARGARAAYTGGAAYGA 50 Wahlberg and Wheat (2008) RpS5r CGGTTRGAYTTRGCAACACG Wahlberg and Wheat (2008) RpS5151126F1 ATGGCNGARGARAAYTGGAATGA 53 This study RpS5151126R1 TTRGAYTTRGCAACACGCTCCAACTC This study RpS5151126R4 CACAGCARCCAGATRGCYTGRTT This study RpS5151126F2 GARATCATTCATYTGCTRACTGGAGAGAA 53 This study RpS5151126R2 TTRGAYTTRGCAACACGCTCCAACTC This study CAD CAD150519F YATAGTYGTWGCACCTAGTCAAAC 47 This study CAD150519R1 ATKCGGTACACTCCTGAYCCAAGWACCAT This study CAD150519R2 ARTAAAGMCKATCRCTCATATCGTAGTC This study GAPDH GAPDH-F3 CAAGGCTGGTGCTGAATACGTC 62 This study GAPDH-R3 CTTGGTCTGGATGTACTTGATGAGAT This study

Table 3. Partition schemes and substitution models for MrBayes Boarmia, and stated the wing pattern of Myrioblephara to be similar to that of Diplurodes. Our molecular phylogeny Partition Best model for MrBayes Bins from the results of TIGER confirms the monophyly of the Aethalura group ( B; PP = 1, BS = 100). The genus Parectropis Sato, 1980 was not 1 F81+I Bin 1 2 GTR Bins 2–20 placed into any genus-group by Sato (1984), as it shows several 3 SYM Bins 21–23 unusual characters, such as the tufts of long hairs on the seventh 4 SYM Bins 24–25 and eighth male abdominal sternites, the large and horn-shaped 5 GTR+G Bins 26–27 cornutus in male genitalia, and the fold-like signum in female 6 GTR+G Bin 28 genitalia. In our study, Parectropis is recovered as a sister of 7 GTR+G Bin 29 the Aethalura group with moderate support in the BI analysis 8 GTR+G Bin 30 and weak support in the ML analysis (PP = 0.97, BS = 52). In 9 GTR+G Bin 31 addition, Chrysoblephara Holloway, 1994, Necyopa Walker, 1861, Ectropidia Warren, 1895, Satoblephara Holloway, 1994 and Nigriblephara Holloway, 1994 are probably close to ‘Cleora group’, as the two genera form the monophyletic Clade A Myrioblephara and Diplurodes, as most of these genera share (PP = 1, BS = 100). The two genera share many morphological the presence of the paired intersegmental coremata on the male characters: the discal spots of both wings are pale centrally; a abdomen and the bowl-shaped signum (Holloway 1994). process is present on the sacculus; the ovipositor and the The present study recovered Ophthalmitis xanthypochlora apophyses posteriores are elongate (Sato 1984; Holloway 1994). Wehrli, 1924 as sister to a clade comprising other species of In our study, Cusiala is not placed in the Cleora group but Ophthalmitis Fletcher, 1979 and Parapercnia giraffata (Guenée, found to be closely related to Biston and Erannis Hübner, 1825 1858) (Clade C; PP = 1, BS = 100). Wehrli (1938–1954) placed (Clade I; PP = 1, BS = 93). Although Erannis is different from Ophthalmitis xanthypochlora in the subgenus Ophthalmodes Biston in the presence of a harpe on the valva of the male Guenée, 1858 of Boarmia, and mentioned its systematic position genitalia (Viidalepp et al. 2007), it grouped with Biston in to be still uncertain as the genitalia were not examined. Later, Jiang previous molecular studies (Viidalepp et al. 2007; Wahlberg et al.(2011) found the male genitalia of O. xanthypochlora to be et al. 2010; Sihvonen et al. 2011). And the close relationship quite different from those of other congeners. Future morphological between Biston and Erannis was also supported by our ML and biological study might show that a new genus is required for result (PP = 0.94, BS = 73). In addition, Cusiala was considered O. xanthypochlora (D. Stüning, pers. comm.). to be a member of the Biston complex by the morphological The genus Parapercnia Wehrli, 1939 was originally studies of Hampson (1895) and Holloway (1994), which is in established as a subgenus of Percnia Guenée, 1858, and was agreement with our study. later on raised to generic level by Inoue (1992). Traditionally, Sato (1984) proposed the ‘Aethalura group’ (Myrioblephara Parapercnia was considered to be closely related to Percnia, Warren, 1893, Diplurodes Warren, 1896, Aethalura McDunnough, Metapercnia Wehrli, 1939, Xenoplia Warren, 1894 and 1920) on the basis of the similar larval characters, wing venation, Antipercnia Inoue, 1992 (Wehrli 1938–1954; Inoue 1992). and the bowl-shaped signum of the female genitalia. Wehrli Ophthalmitis was considered to be a subgenus of Boarmia by (1938–1954) treated these three genera as subgenera of Wehrli (1938–1954), and was not placed into any group by Sato Phylogeny of Boarmiini Invertebrate Systematics 435

Geometrinae Ourapteryx sambucaria 1/100 Ourapterygini Ennomini 1/94 Menophra sp. Phthonandria atrilineata 1/99 Psyra szetschwana 1/100 Gnophini 1/79 Loxaspilates fixseni 1/66 Hirasa scripturaria 1/100 Charissa obscurata Macaria fusca 1/92 Semiothisa sp. 0.93/52 Chiasmia clathrata Macariini 1/98 Ballantiophora gibbiferata 0.95/- Cassymini 1/100 Abraxas illuminata 1/98 1/96 Abraxas sylvata Abraxini 1/- Calletaera obliquata 1/98 Luxiaria mitorrhaphes 1/100 Luxiaria amasa 1/78 Eutoeini 0.72 Luxiaria phyllosaria 1/53 Peratophyga hyalinata Zamarada torrida 1/79 Hydatocapnia marginata Cassymini 1/100 Lomaspilis marginata

1/100 A 1/100 1/100 1/94 1/100 0.99/59 0.61/50 1/100 0.84

1/100 0.89/52

1/96 0.97/52 B 1/100 1/100 1/76

C 1/100 1/100 1/65 Arichanna mandshuriaria 0.96/-

0.99/- 1/100

0.82 /- 1/100 1/100

0.87/- D 1/100 0.71/- 0.95 1/89 /63 E 1/96 1/100 0.87 F 0.99/59 1/87 1/100 1/100 0.51

G 1/80 1/100 1/100 0.94 1/100

0.88 0.86 1/100 0.85 H 1 /100 Boarmiini 1/86 1/100 1/95 1/100

I 1/93 0.94/73 1/100 1/100 1/100 1/-

1/72

J 1/100 1/100 1/99 1/100 1/70 1/100 1/98 1/100 1/99 L 1/100 0.98/56 1/100 1/100 1/98 1/96 0.95/54 1/60 1/100 M 1/100 K 1/88 1/82

1/99 1/95 0.88/94 0.99/- 1/100

0.99/-

N 1/100 1/89 1/100 0.99/81 1/95 1/100 1/100 1/99

Fig. 1. Bayesian tree resulting from the BI analysis. Posterior probabilities and bootstrap values to the maximum likelihood tree with identical topology are indicated at the nodes as PP/BS. Bootstrap values lower than 50 are not shown. 436 Invertebrate Systematics N. Jiang et al.

(1984), as it shows some unusual larval characters, the antennae Krananda, with 10 species, and Zanclopera, with three of the female are bipectinate, and the eighth sternite of the species, are mainly distributed in the Oriental region (Scoble male is notched posteriorly. In our study, Percnia, Antipercnia 1999). Prout (1912–1916) and Wehrli (1938–1954) considered and Xenoplia form a monophyletic group (Subclade F; PP = 1, Zanclopera to be a section or subgenus of Trigonoptila BS = 87), while Parapercnia grouped with Ophthalmitis Warren, 1894, and supposed Trigonoptila to be closely related (Clade C; PP = 1, BS = 100). Our results are conflicting with to Krananda judged from external features. Holloway (1994) the traditional view, and reveal a close relationship between synonymised Trigonoptila with Krananda, but considered Parapercnia and Ophthalmitis. In addition, the two genera Zanclopera as a separate genus. In the present work, share many morphological characters: the discal spots of both Krananda is found to be paraphyletic (Subclade H; PP = 1, wings are pale-centred; the eighth sternite of the male abdomen BS = 100), since Zanclopera straminearia Leech, 1897 is is notched posteriorly; the phallus shows a pair of sclerotised nested within Krananda species (including the type species, spines at tip; the dorsal margin of the sacculus is long and curved; Krananda semihyalina Moore, 1867). In addition, based on the lamella postvaginalis of the female genitalia is well our examination of morphological characters, we find that the developed; the first abdominal segment of the larva is strongly type species of Zanclopera and Krananda are very similar in the dilated (Sato 1984; Yamamoto et al. 1987; Inoue 1992; Jiang following characters: the fasciculate-setose antennae of the et al. 2011). male, the falcate apex of the forewing, the excavate apex of Arichanna Moore, 1868 is a large genus, including more than the hindwing, the fovea of the forewing of the male, the distinct 70 species in the Palearctic and Oriental regions (Scoble 1999). postmedial lines of both wings, a central setose lobe of the In the present analysis, Arichanna is revealed to be polyphyletic. male valva, the large and pyriform corpus bursae and the Arichanna mandshuriaria (Bremer, 1864) is recovered as a structure of the signum (Holloway 1994). Holloway (1994) sister of Melanolophia sp. with weak support in the BI proposed that Zanclopera may be a synonym of Krananda, analysis (PP = 0.96). However, two other species of Arichanna but he was unable to confirm whether the sub-basal process grouped together within Clade D. The present results strongly from the costa of the valva is homologous with the process in suggest that the current taxonomy of Arichanna still awaits a the same position in K. oliveomarginata Swinhoe, 1894. revision. Although the type species of Zanclopera, Zanclopera falcata Clade D contains four well supported subclades (E, F, G and Warren, 1894, is not included in the molecular study, in H) and six genera Agriopis Hübner, 1825, Bupalus Leach, 1815, consideration of the morphological data, we synonymise Arichanna, Blepharoctenucha Warren, 1895, Erebomorpha Zanclopera (type species: Zanclopera falcata Warren, 1894) Walker, 1860, Amblychia Guenée, 1858 (PP = 0.95, BS = 63). with Krananda (type species: Krananda semihyalina Moore, However, the basal relationships within the clade are unresolved. 1867) (syn. nov.) (included species: Krananda straminearia Dalima Moore, 1868, Duliophyle Warren, 1894, Xandrames (Leech, 1897) (comb. nov.), Krananda falcata (Warren, 1894) Moore, 1868 and Racotis Moore, 1887 form a monophyletic (comb. nov.), Krananda fulva (Yazaki, 1994) (comb. nov.)). group (Subclade E; PP = 1, BS = 89). Prout (1912–1916) and Type species of both genera are illustrated in Figs 2 and 3. Wehrli (1938–1954) did not subordinate Dalima and Xandrames In the present study, the genera previously placed in under Boarmia, and considered Duliophyle as a section or Bistonini are nested in different clades of Boarmiini. Biston subgenus of Xandrames. Racotis Moore was treated as a and Erannis form a monophyletic group with Cusiala (Clade subgenus of Boarmia by Wehrli (1938–1954) on the basis of I; PP = 1, BS = 93). Apocheima Hübner, 1825 is located in the external and genitalic characters. Holloway (1994) included Clade L (PP = 0.98, BS = 56). Lycia Hübner, 1825 is recovered Dalima, Xandrames and Racotis in the Boarmiini. A close as sister to Phthonosema Warren, 1894 within Clade J (PP = 1, relationship among Dalima, Duliophyle, Xandrames and BS = 100). Agriopis is located apart from Biston, Erannis, Racotis has never been proposed in previous studies. Apocheima and Lycia, as a sister to a diverse clade comprising, However, these four genera form a monophyletic group in our for example, Bupalus, Arichanna, Duliophyle Warren and analysis. According to the descriptions of Holloway (1994) and Xandrames Moore (PP = 0.95, BS = 63). Therefore, the Sato (2002), we find that the members of the group share the bifid inclusion of Bistonini in Holloway’s broad concept of uncus and the weak or absent signum. Boarmiini was supported by our study. Arbomia Sato & Wang, 2004, Gasterocome Warren, 1894, In the current study, Calicha Moore, 1888, Microcalicha Dilophodes Warren, 1894 and Pogonopygia Warren, 1894 form a Sato, 1981, Jankowskia Oberthür, 1884 and Phthonosema monophyletic group (Subclade G; PP = 1, BS = 80). Dilophodes Warren, 1894 form a monophyletic group together with was considered to be closely related to Pogonopygia on the basis Hyposidra Guenée, 1858, Amraica Moore,1888 and Lycia of morphological studies (Prout 1912–1916; Wehrli 1938–1954; (Clade J; PP = 1, BS = 100). The ‘Calicha group’ was Holloway 1994). The wing pattern of Gasterocome is similar to proposed on the basis of the reduced tongue and the characters that of Alcis Curtis (Holloway 1994). Arbomia was described of larva and pupa, including Microcalicha, Calicha, Jankowskia as a monotypic genus by Sato & Wang, 2004, and was related and Phthonosema (Sato 1984). Prout (1912–1916) and Wehrli to Hypomecis in appearance. Our study shows that Arbomia (1938–1954) subordinated Calicha, Jankowskia and and Gasterocome have a close relationship with Dilophodes Phthonosema under their wide concepts of Boarmia. and Pogonopygia. Although the wing pattern of Arbomia and Microcalicha closely related to Calicha was established by Gasterocome is quite different from that of Dilophodes and Sato (1981). Thus, our results indicate that the Calicha group Pogonopygia, the four genera share the square apex of the is a monophyletic entity and suggest that it should include uncus and the similar shape of the valva. Hyposidra, Amraica and Lycia. Phylogeny of Boarmiini Invertebrate Systematics 437

(A)(B)(C)(D)

Fig. 2. Adults. (A) , male; (B) , male; (C) Krananda semihyalina, syntype, female; (D) Zanclopera falcata, male, holotype. Scale bars, 1 cm.

In our phylogeny, Clade K contains three subclades (L, Rikiosatoa, Monocerotesa Wehrli, 1937, Peribatodes Wehrli, M and N). Hypomecis is recovered as paraphyletic within 1943 and Psilalcis form a monophyletic clade (Subclade M; Subclade L (PP = 1, BS = 100), as Ematurga atomaria PP = 1. 00, BS = 88), which supports the placement of Alcis, (Linnaeus, 1758) forms an assemblage together with Hypomecis Rikiosatoa and Psilalcis in the Alcis group and suggests (not including the type species). Ematurga Lederer, 1853, a small that Peribatodes and Monocerotesa should be included in the Holarctic genus, was established on Ematurga atomaria from group. Europe. It was placed in ‘Boarmiinae’ (Boarmiini) by Pierce The genus Monocerotesa was established for Chiasmia (1914) on the basis of the structure of the male genitalia. Prout strigata Warren, 1893 and placed in Boarmiini by Holloway (1912–1916) and Wehrli (1938–1954) did not place it under their (1994). We suggest that Monocerotesa isapossiblesynonymof wide concept of Boarmia.Prout(1912–1916) suggested a close Psilalcis. This view is supported by our phylogenetic results, relationship between Ematurga and Hübner, 1823 as Psilalcis is recovered as paraphyletic (PP = 1, BS = 95) and (Macariini), but their genitalia are quite different. Forbes (1948) Monocerotesa is nested within Psilalcis.Inaddition, placed Ematurga in Boarmiini. Recently, Wahlberg et al. Monocerotesa and Psilalcis share similar genitalic structures, (2010) recovered Ematurga as a sister of Hypomecis on the such as the vestigial or specialised gnathus, the setose ampulla, basis of molecular data. They interpreted the morphological the valva often being partially cleft with saccular process; the differentiation of Ematurga from other members of Boarmiini developed sterigma (Holloway 1994;Sato1996, 2007). However, as likely being the result of the diurnal activity of the adults. In morphological study of the type species of the two genera is our study, Ematurga is nested within Hypomecis (Subclade L), needed to address this question. and the type species of the two genera have similar male Chorodna Walker, 1860, Darisa Moore, 1888, Deileptenia genitalia: the tegumen bears a pair of posterior processes (very ribeata Clerck, 1759, Coremecis Holloway, 1994 and Lassaba small in Ematurga atomaria); the spinose harpe is present in Moore, 1888 form a monophyletic group (PP = 1, BS = 95) within the central and medio-ventral region of valva; the juxa is Subclade N. Most species of the group were placed under the extremely narrow in the terminal half, rounded and broad at its genus Medasina Moore, 1887 (Hampson 1895; Wehrli base. According to the description and illustrations of 1938–1954). Holloway (1994) treated Medasina as a synonym H. umbrosaria (Rindge 1973;McGuffin 1977), in the female, of Chorodna, revived Lassaba, and established Coremecis. they share the following characters: the ovipositor and the Our results suggest that Chorodna, Darisa, Coremecis and apophyses posteriores are elongate, the sterigma has a rounded Lassaba are closely related, in agreement with previous and sclerotised median area; the ductus bursae is not differentiated morphological studies. In addition, is also from the corpus bursae; and the signum is absent. Type species placed in this group. Sato (1984) grouped Deileptenia with of both genera are illustrated in Figs 2 and 3. The present Hypomecis on the basis of the similar wing venation, the molecular phylogeny and morphological studies indicate that coloration and pattern of the first-instar larvae, the male Ematurga may need to be synonymised with Hypomecis,which and the female signum. However, he did not include is in agreement with the morphological study of Velyaev and the species of Chorodna, Darisa, Coremecis and Lassaba in Beljaev (2016). his morphological study. The inclusion of Sysstema Warren, Alcis, Rikiosatoa Inoue, 1982 and Psilalcis Warren, 1893 1899 and Lophobates Warren, 1899 into Boarmiini, as were placed in the ‘Alcis group’ by Sato (1984) together with proposed by Holloway (1994), is confirmed by our results. In four other genera mainly based on the specialised cristae hairs our study, Sysstema and Lophobates are recovered as sister to in the anellus, near the base of the valva. In our analysis, Alcis, the above group within Subclade N. The close relationship 438 Invertebrate Systematics N. Jiang et al.

(A) (B)

(C) (D)

(E) (F)(G)

Fig. 3. (A–D) Male genitalia. (A) Hypomecis umbrosaria;(B) Ematurga atomaria;(C) Krananda semihyalina;(D) Zanclopera falcata.(E–G) Female genitalia. (E) Ematurga atomaria;(F) Krananda semihyalina;(G) Zanclopera falcata. Scale bars, 1 mm. Details of illustrated specimens are given in the supplementary material. Phylogeny of Boarmiini Invertebrate Systematics 439 among them has never been found in previous morphological and the monophyly of Abraxini in the broad concept (Abraxini, or molecular studies. Eutoeini and Cassymini) is strongly supported in the BI analysis (PP = 1). We therefore suspect that Eutoeini and Cassymini may Phylogenetic relationships among tribes be included in Abraxini. A more extensive taxon sampling and within the ‘boarmiine’ lineage morphological study are needed to study the relationships among the Abraxini, Eutoeini and Cassymini. The ‘boarmiine group’ was proposed by Forbes (1948) based The tribe Cassymini was defined mainly on the basis of the on the structure of the cremaster of the pupae, including Abraxini, reduced number of radial veins of the forewing, the slender and Macariini (as ‘Semiothisini’), Boarmiini, Melanolophiini and curved dorsal process of the valva and the developed coremata Bistonini. Holloway (1994) mentioned that the genera that had (Fletcher 1974; Holloway 1994; Pitkin 2002). However, the been placed in the Abraxini by Forbes (1948) should be placed former two characters are not unique (Holloway 1994), and in his new tribe Cassymini. He assigned Cassymini together with the coremata are absent in some species (Skou and Sihvonen the other new tribe Eutoeini to the ‘boarmiine’ lineage and 2015). It is most widely distributed in the Oriental tropics, but is considered that ‘Abraxini, Gonodontini and Thinopterygini’ also present in the Palaearctic, Afrotropical, Nearctic and may be related to that group. He also suggested that Boarmiini Neotropical regions (Holloway 1994; Pitkin 2002). In our should include Melanolophiini, Bistonini, Gnophini and Theriini phylogeny, Cassymini is revealed to be polyphyletic. Four together with 11 other taxa that had been proposed at tribal representative genera form a monophyletic lineage with very rank. Choi et al.’s(1998) morphology-based cladistic analysis strong support in the BI analysis and moderate support in the revealed Cassymini to be polyphyletic, since Peratophyga ML analysis (PP = 1, BS = 79). However, Ballantiophora hyalinata (Kollar, 1844) grouped with Abraxas Leach, 1815, gibbiferata (Guenée, 1858) and Abraxini form an assemblage and he therefore suggested that Abraxini should include with weak support in the BI analysis (PP = 0.95). The wing Abraxini, Cassymini and Eutoeini. Beljaev (2006b) proposed pattern of Ballantiophora gibbiferata may be interpreted as the supertribus Gnophidii, including Gnophini, Boarmiini similar to that of the species of Abraxas, but the coremata are (in Holloway’s broad concept except Gnophini), and Macariini well developed, while it is absent in the species of Abraxini in his broad concept (including Abraxini, Eutoeini, Cassymini (Holloway 1994; Pitkin 2002). Because of the definition of and Macariini). Cassymini remaining unclear, we still treat Ballantiophora Recent studies based on molecular data (Wahlberg et al. Butler, 1881 as a member of Cassymini. In addition, the close 2010; Õunap et al. 2011) supported the monophyly of the relationship between Peratophyga hyalinata and Abraxas ‘boarmiine’ lineage (including Bistonini), and placed Theriini suggested by Choi et al.(1998) is not supported by our study. and Gnophini in the ‘ennomine’ lineage. These results were The results of this study provide insight into the phylogenetic confirmed by Sihvonen et al.(2011). In their study, the clade relationships among some Palaearctic and Oriental members comprising Abraxini, Macariini, Cassymini and Eutoeini was of Boarmiini and the related tribes in the ‘boarmiine’ lineage. recovered as sister to Boarmiini; however, the relationships Although our sampling is incomplete, and the results might be within the clade were still unclear. In addition, their results did biased and oversimplified, this preliminary phylogenetic not suggest close relationships between Thinopterygini and the hypothesis serves as the first step in the study of the evolution ‘boarmiine’ lineage, conflicting with the findings of Holloway of Boarmiini species. More comprehensive taxon and gene (1994). sampling as well as additional morphological data need to In the present study, Gnophini, Macariini, Abraxini, be included to resolve the complex tree. Due to the extremely Eutoeini, Cassymini, and Boarmiini form a monophyletic group high diversity of Boarmiini, that will be a highly challenging task. (PP = 1, BS = 98), which supports the supertribus Gnophidii proposed by Beljaev (2006b). This taxon is characterised by the Acknowledgements absence of the sclerites homologous to lateral lobes of the anellus; tegumen and vinculum are fused to a complete and broad We cordially thank Dr Dieter Stüning (Zoological Research Museum Alexander Koenig, Bonn), for his constant help on our work and ring, without lateral narrowing (Beljaev 2006b). As the numerous competent and helpful comments on the phylogeny of nominotypical genus of Gnophini, Treitschke, 1825 Boarmiini, and thank Dr Marianne Espeland (Zoological Research was not included in the present study, the delimitation and Museum Alexander Koenig, Bonn), and Dr Pasi Sihvonen (University of systematic position of Gnophini is a subject of further study. Helsinki, Helsinki) for providing valuable comments on our manuscript. Our results are concordant with those of Wahlberg et al. We sincerely appreciate Dr Niklas Wahlberg (Lund University, Lund) and (2010), Õunap et al.(2011)andSihvonenet al.(2011), as they an anonymous referee for constructive comments on the manuscript. We also support the monophyly of the ‘boarmiine’ lineage (Boarmiini, thank Dr Rikio Sato (Niigata, Japan) for sending us valuable literature. We Macariini, Abraxini, Eutoeini and Cassymini) (PP = 1, BS = 100). express our sincere thanks to Sir Anthony Galsworthy, and the Trustees and Within the ‘boarmiine’ lineage, the monophyly of the clade formed staff of the Natural History Museum, London, for preparation of the data of by Abraxini, Eutoeini, Cassymini and Macariini is strongly BMNH material and for allowing the examination of the material under their curation. We are grateful to all collectors whose contributions made supported (PP = 1, BS = 98), and the clade is recovered as sister our work possible. This work was supported by the National Science to Boarmiini in our analysis. Our study provides molecular Foundation of China (Nos 31402004, 31372176, 31172127), the Ministry support for Beljaev’s Macariini in his broad concept. The of Science and Technology of the People’s Republic of China (MOST deeply divided valva is synapomorphic for this clade (Beljaev Grant No. 2013FY111200), and the China Scholarship Council (No. 2006b, 2016). In addition, Cassymini appear to be polyphyletic 201504910189). 440 Invertebrate Systematics N. Jiang et al.

References Jiang, N., Xue, D. Y., and Han, H. X. (2011). A review of Ophthalmitis Fletcher, 1979 in China, with descriptions of four new species Beljaev, E. A. (2000). Remarkable new genus and new species of the (Lepidoptera: Geometridae, Ennominae). Zootaxa 2735,1–22. geometrid from central Asia, related to the genus Desertobia Kawakita, A., Takimura, A., Terachi, T., Sota, T., and Kato, M. (2004). Viidalepp, 1989 (Lepidoptera, Geometridae, Ennominae) with notes on Cospeciation analysis of an obligate pollination mutualism: have the taxonomy of the Desertobiini. Tinea 16, 240–245. Glochidion trees (Euphorbiaceae) and pollinating Epicephala moths Beljaev, E. A. (2006a). A morphological approach to the Ennominae () diversified in parallel? Evolution 58, 2201–2214. (Lepidoptera: Geometridae). Spixiana 29, 215–216. Lanfear, R., Calcott, B., Ho, S. Y. W., and Guindon, S. (2012). Beljaev, E. A. (2006b). Alternative , tentative tribal system of Ennominae PartitionFinder: combined selection of partitioning schemes and based on current -group names. Personal communication, published substitution models for phylogenetic analyses. Molecular Biology and in Forum Herbulot www pages without peer review. Available at http:// Evolution 29, 1695–1701. doi:10.1093/molbev/mss020 www.herbulot.de/famgroup2.htm [Verified 2 March 2017]. McGuffin, W. C. (1977). Guide to the Geometridae of Canada (Lepidoptera). Beljaev, E. A. (2016). Sem. Geometridae – Pyadenitzi [Fam. Geometridae – II. Subfamily Ennominae 2. Memoirs of the Entomological Society of Geometer ]. In ‘Annotated Catalogue of the of Russian Far Canada 109,1–191. doi:10.4039/entm109101fv East. Volume II. Lepidoptera’. (Ed. A. S. Lelei.) pp. 518–666. (Dalnauka: Miller, M. A., Pfeiffer, W., and Schwartz, T. (2010). Creating the CIPRES Vladivostok, Russia.) Science Gateway for inference of large phylogenetic trees. In Choi, S. W., Kim, S. S., and Shin, Y. H. (1998). Systematics of the tribe ‘Proceedings of the Gateway Computing Environments Workshop Abraxini (Lepidoptera, Geometridae, Ennominae) in South Korea. (GCE), 14 November 2010, New Orleans, LA’. pp. 1–8. Insecta Koreana 15,41–76. Õunap, E., Javois, J., Viidalepp, J., and Tammaru, T. (2011). Phylogenetic Cummins, C. A., and McInerney, J. O. (2011). A method for inferring the rate relationships of selected European Ennominae (Lepidoptera: of evolution of homologous characters that can potentially improve Geometridae). European Journal of Entomology 108, 267–273. doi:10.14 phylogenetic inference, resolve deep divergence and correct systematic 411/eje.2011.036 biases. Systematic Biology 60, 833–844. doi:10.1093/sysbio/syr064 Õunap, E., Viidalepp, J., and Truuverk, A. (2016). Phylogeny of the Duponchel, P. A. J. (1829). ‘Histoire Naturelle des Lépidoptères ou subfamily (Lepidoptera: Geometridae): integrating Papillons de France. Vol. 7.’ (Crevot: Paris.) molecular data and traditional classifications. Systematic Entomology Fletcher, D. S. (1967). A revision of the Ethiopian species and a check list of 41, 824–843. doi:10.1111/syen.12195 the world species of Cleora (Lepidotpera: Geometridae). Bulletin of the Pierce, F. N. (1914). ‘The Genitalia of the Group Geometridae of the British Museum (Natural History) 8,1–119. Lepidoptera of the British Islands.’ (Northern Publishing Company: Fletcher, D. S. (1974). A revision of the old world genus Zamarada Liverpool, UK.) (Lepidoptera: Geometridae). Bulletin of the British Museum (Natural Pitkin, L. M. (2002). Neotropical ennomine moths: a review of the genera History), Entomology 22,1–498. (Lepidoptera: Geometridae). Zoological Journal of the Linnean Society Forbes, W. T. M. (1948). ‘Lepidoptera of New York and Neighboring 135, 121–401. doi:10.1046/j.1096-3642.2002.01200.x States. 2.’ (Memoirs of Cornwell University Agriculture Experimental Prout, L. B. (1912–1916). The Palaearctic Geometrae. In ‘The Station: New York.) Macrolepidoptera of the World. Vol. 4’. (Ed. A. Seitz.) pp. 1–479. Forum Herbulot (2003). The Forum Herbulot world list of family group (Verlag A Kernen: Stuttgart, Germany.) names in Geometridae. Available at http://www.herbulot.de [Verified 2 Rambaut, A., and Drummond, A. J. (2010). Tracer v1.5. Available at http:// March 2017]. beast.bio.ed.ac.uk/Tracer. Hampson, G. F. (1895). ‘The Fauna of British India Including Ceylon and Regier, J. C., Mitter, C., Kristensen, N. P., Davis, D. R., Van Nieukerken, E. J., Burma (Moths). Vol. 3.’ (Taylor and Francis.) Rota, J., Simonsen, T. J., Mitter, K. T., Kawahara, A. Y., Yen, S.-H., Hebert, P. D. N., Penton, E. H., Burns, J. M., Janzen, D. H., and Hallwachs, W. Cummings, M. P., and Zwick, A. (2015). A molecular phylogeny for the (2004). Ten species in one: DNA barcoding reveals cryptic species in oldest (nonditrysian) lineages of extant Lepidoptera, with implications the neotropical skipper butterfly Astraptes fulgerator. Proceedings of the for classification, comparative morphology and life-history evolution. National Academy of Sciences of the United States of America 101, Systematic Entomology 40, 671–704. doi:10.1111/syen.12129 14812–14817. doi:10.1073/pnas.0406166101 Rindge, F. H. (1973). A revision of the North American species of the genus Herbulot, C. (1963). Mise à jour de la liste des Geometridae de France. Pseudoboarmia (Lepidoptera, Geometridae). American Museum Alexanor 3,17–24, 85–93. Novitates 2514,1–27. Holloway, J. D. (1994). The Moths of Borneo. Part 11. Family Geometridae, Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D. L., Darling, A., Subfamily Ennominae. Malayan Nature Journal 47,1–309. Hohna, S., Larget, B., Liu, L., Suchard, M. A., and Huelsenbeck, J. P. Holloway, J. D. (1997). The Moths of Borneo. Part 10. Family Geometridae, (2012). MrBayes 3.2: efficient Bayesian phylogenetic inference and Subfamily , Larentiinae. Malayan Nature Journal 51, model choice across a large model space. Systematic Biology 61, 1–242. 539–542. doi:10.1093/sysbio/sys029 Inoue, H. (1956). Check List of the Lepidoptera of Japan. Part 3. (Rikusuisha: Rota, J., and Wahlberg, N. (2012). Exploration of data partitioning in an Tokyo.) eight-gene data set: phylogeny of metalmark moths (Lepidoptera, Inoue, H. (1982a). . In ‘Moths of Japan. Vol. 1’. (Eds H. Inoue, ). Zoologica Scripta 41, 536–546. doi:10.1111/j.1463-6409. S. Sugi, H. Kuroko, S. Mroiuti and A. Kawabe.) pp. 412–579. (Kodansha: 2012.00551.x Tokyo.) Rota, J., Zacharczenko, B. V., Wahlberg, N., Zahiri, R., Schmidt, B. C., and Inoue, H. (1982b). Geometroidea. In ‘Moths of Japan. Vol. 2’. (Ed. H. Inoue, Wagner, D. L. (2016). Phylogenetic relationships of Acronictinae with S. Sugi, H. Kuroko, S. Mroiuti and A. Kawabe.) pp. 257–312. (Kodansha: discussion of the abdominal courtship brush in Noctuidae (Lepidoptera). Tokyo.) Systematic Entomology 41, 416–429. doi:10.1111/syen.12162 Inoue, H. (1992). Twenty-four new species, one new subspecies and two new Sato, R. (1981). Taxonomic notes on the genus Calicha Moore and its genera of the Geometridae (Lepidoptera) from East Asia. Bulletin of allied new genus from Japan and adjacent countries (Lepidoptera: Otsuma Women’s University, Home Economics 28, 149–188. Geometridae). Tyô to Ga 31, 103–120. Phylogeny of Boarmiini Invertebrate Systematics 441

Sato, R. (1984). Taxonomic study of the genus Hypomecis Hübner and its Sihvonen, P., Staude, H. S., and Mutanen, M. (2015). Systematic position of allied genera from Japan (Lepidoptera: Geometridae: Ennominae). the enigmatic African cycad moths: an integrative approach to a nearly Special Bulletin of Essa Entomological Society 1,1–213. century old problem (Lepidoptera: Geometridae, Diptychini). Systematic Sato, R. (1995a). Descriptions of two new genera and eight new species of Entomology 40, 606–627. doi:10.1111/syen.12125 the Boarmiini (Geometridae, Ennominae) from Sulawesi. Transactions Skou, P., and Sihvonen, P. (2015). Ennominae I. In ‘The Geometrid Moths of of the Lepidopterological Society of Japan 46,33–43. Europe. Vol. 5’. (Ed. A. Hausmann.) pp. 1–657. (Brill: Leiden, Holland.) Sato, R. (1995b). Records of the Boarmiini (Geometridae: Ennominae) Stamatakis, A., Hoover, P., and Rougemont, J. (2008). A rapid bootstrap from Thailand. II. Transactions of the Lepidopterological Society of algorithm for the RAxML web-servers. Systematic Biology 57, 758–771. Japan 46, 209–227. doi:10.1080/10635150802429642 Sato, R. (1996). Records of the Boarmiini (Geometridae; Ennominae) Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. from Thailand. III. Transactions of the Lepidopterological Society of (2011). MEGA5: molecular evolutionary genetics analysis using Japan 47, 223–236. maximum likelihood, evolutionary distance, and maximum parsimony Sato, R. (1999). Yazakia, a new genus of the Boarmiini (Ennominae, methods. Molecular Biology and Evolution 28, 2731–2739. doi:10.1093/ Geometridae), with descriptions of four new species from Sulawesi. molbev/msr121 Transactions of the Lepidopterological Society of Japan 50,41–47. Velyaev, O. A., and Beljaev, E. A. (2016). Description of skeleton-muscular Sato, R. (2002). Two new species and two new subspecies of the Boarmiini apparatus of the male genitalia of Ematurga atomaria (Linnaeus, 1758) from Taiwan, with notes on Alcis anmashanensis Sato (Geometridae, (Lepidoptera: Geometridae: Ennominae). A. I. Kurentsov’s Annual Ennominae). Transactions of the Lepidopterological Society of Japan Memorial Meetings 27, 182–188. 53, 141–149. Viidalepp, J., Tammaru, T., Snäll, N., and Wahlberg, N. (2007). Sato, R. (2005). Records of the Boarmiini (Geometridae, Ennominae) Warren, 1894 does not belong in the tribe Boarmiini (Lepidoptera: from Thailand. IV. Transactions of the Lepidopterological Society of Geometridae). European Journal of Entomology 104, 303–309. Japan 56,63–72. doi:10.14411/eje.2007.046 Sato, R. (2007). The genus Monocerotesa Wehrli (Geometridae, Ennominae) Wahlberg, N., Snäll, N., Viidalepp, J., Ruohomäki, K., and Tammaru, T. in Sumatra, with description of one new species. Transactions of the (2010). The evolution of female flightlessness among Ennominae of the Lepidopterological Society of Japan 58, 371–378. Holarctic forest zone (Lepidoptera, Geometridae). Molecular Sato, R. (2008). Two new genera and three new species of the Boarmiini and Evolution 55, 929–938. doi:10.1016/j.ympev.2010. (Geometridae, Ennominae) from Sumatra. Tinea 20, 163–169. 01.025 Sato, R. (2013). New and unrecorded species of the Boarmiini (Geometridae, Wang, H., Wahlberg, N., Holloway, J. D., Bergsten, J., Fan, X., Janzen, D. H., Ennominae) from Sumatra, with some taxonomic notes. Tinea 22, Hallwachs, W., Wen, L., Wang, M., and Nylin, S. (2015). Molecular 242–252. phylogeny of Lymantriinae (Lepidoptera, , Erebidae) Sato, R. (2014). Micromedasina, a new genus of the Boarmiini (Ennominae, inferred from eight gene regions. 31, 579–592. doi:10.1111/ Geometridae), with descriptions of two new species from south east Asia. cla.12108 Tinea 23,78–83. Wehrli, E. (1938–1954). Subfamilie: Geometrinae. In ‘Die Sato, R. (2016). Five new species of the genera Hypomecis Hübner, Grossschmetterlinge der Erde. Vol. 4’. (Ed. A. Seitz.) pp. 254–766. Ophthalmitis Fletcher and Phthonosema Warren (Geometridae; (Verlag A Kernen: Stuttgart.) Ennominae) from the Indo-Malayan region. Tinea 23, 241–248. Yamamoto, M., Nakatomi, K., Sato, R., Nakajima, H., and Owada, M. (1987). Sato, R., and Fu, C-M. (2010). Two new species of the Boarmiini ‘Larvae of Larger Moths in Japan.’ (Ed. S. Sugi.) (Kodansha: Tokyo.) (Geometridae, Ennominae) from Taiwan. Tinea 21, 122–128. Yamamoto, S., and Sota, T. (2007). Phylogeny of the Geometridae and the Sato, R., and Wang, M. (2004). Records and descriptions of the Boarmiini evolution of winter moths inferred from a simultaneous analysis of (Geometridae, Ennominae) from Nanling Mts, S. China. Part 1. Tinea 18, mitochondrial and nuclear genes. Molecular Phylogenetics and 43–55. Evolution 44, 711–723. doi:10.1016/j.ympev.2006.12.027 Sato, R., and Wang, M. (2005). Records and descriptions of the Boarmiini Young, C. J. (2006). Molecular relationships of the Australian Ennominae (Geometridae, Ennominae) from Nanling Mts, S. China. Part 2. Tinea 19, (Lepidoptera: Geometridae) and implications for the phylogeny of the 36–47. Geometridae from molecular and morphological data. Zootaxa 1264, Sato, R., and Wang, M. (2006). Records and descriptions of the Boarmiini 1–147. (Geometridae, Ennominae) from Nanling Mts, S. China. Part 3. Tinea 19, Young, C. J. (2008). Characterisation of the Australian using 69–79. adult morphology, and phylogeny of the Geometridae based on Sato, R., and Wang, M. (2007). Records and descriptions of the Boarmiini morphological characters. Zootaxa 1736,1–141. (Geometridae, Ennominae) from Nanling Mts, S. China. Part 4. Tinea 20, Zahiri, R., Kitching, I. J., Lafontaine, J. D., Mutanen, M., Kaila, L., Holloway, 33–44. J. D., and Wahlberg, N. (2011). A new molecular phylogeny offers hope Sato, R., and Wang, M. (2016). Records and descriptions of the Boarmiini for a stable family level classification of the Noctuoidea (Lepidoptera). (Geometridae, Ennominae) from Nanling Mts, S. China. Part 5. Tinea 23, Zoologica Scripta 40, 158–173. 257–269. Zahiri, R., Holloway, J. D., Kitching, I. J., Lafontaine, J. D., Mutanen, M., and Scoble, M. J. (1999). ‘Geometrid Moths of the World: A Catalogue Wahlberg, N. (2012). Molecular phylogenetics of Erebidae (Lepidoptera, (Lepidoptera, Geometridae). Vols 1 and 2’. (CSIRO Publishing & Noctuoidea). Systematic Entomology 37, 102–124. doi:10.1111/j.1365- Apollo Books: Stenstrup, Denmark.) 3113.2011.00607.x Scoble, M. J., and Hausmann, A. (2007). Online list of valid and available Zahiri, R., Lafontaine, D., Schmidt, C., Holloway, J. D., Kitching, I. J., names of the Geometridae of the World. Available at http://www.herbulot. Mutanen, M., and Wahlberg, N. (2013). Relationships among the basal de/globalspecieslist.htm [Verified 2 March 2017]. lineages of Noctuidae (Lepidoptera, Noctuoidea) based on eight gene Sihvonen, P., Mutanen, M., Kaila, L., Brehm, G., Hausmann, A., and Staude, regions. Zoologica Scripta 42, 488–507. doi:10.1111/zsc.12022 H. S. (2011). Comprehensive molecular sampling yields a robust phylogeny for geometrid moths (Lepidoptera: Geometridae). PLoS One 6, e20356. doi:10.1371/journal.pone.0020356 Handling editor: Rudolf Meier

www.publish.csiro.au/journals/is