The Complete Mitogenome of Apocheima Cinerarius (Lepidoptera: Geometridae: Ennominae) and Comparison with That of Other Lepidopteran Insects

Gene 547 (2014) 136–144

Contents lists available at ScienceDirect

Gene

journal homepage: www.elsevier.com/locate/gene

The complete mitogenome of Apocheima cinerarius (Lepidoptera: Geometridae: Ennominae) and comparison with that of other lepidopteran insects

Shuxian Liu a,b,DayongXuea, Rui Cheng a,b, Hongxiang Han a,⁎ a Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China b University of the Chinese Academy of Sciences, Beijing 100049, China article info abstract

Article history: The complete mitochondrial genome (mitogenome) of a female ﬂightless geometrid moth Apocheima cinerarius Received 19 February 2014 was found to be 15,722 bp in length, containing 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes, 2 Received in revised form 22 May 2014 ribosomal RNA (rRNA) genes, and a control region. The A + T content of the complete mitogenome is 80.83%. The Accepted 21 June 2014 AT skew value ([A − T] / [A + T]) is 0.027. The 13 PCGs of the mitogenome start with typical ATN codons, except Available online 24 June 2014 for cox1 with the start codon CGA. All the tRNA genes have typical cloverleaf secondary structures, except for

Keywords: trnSer(AGN). The secondary structures of rrnL and rrnS were predicted. Six structural domains including con- ﬁ Mitochondrial genome served regions (IV, V) and variable regions (I, II, III, VI) were identi ed in the secondary structure of rrnL. The sec- Apocheima cinerarius ondary structure of rrnS consists of 3 structural domains. The control region of A. cinerarius begins with conserved Secondary structure motifs of “ATAGA” + 19-bp poly T. It also contains a microsatellite-like (TA)26, a stem-and-loop structure, and a Phylogeny poly-A stretch. Phylogenetic analysis showed that Geometroidea is more closely related to Bombycoidea than to Noctuoidea. A. cinerarius is more closely related to Biston panterinaria than to Phthonandria atrilineata, which is in accordance with the conventional morphology-based classiﬁcation. © 2014 Elsevier B.V. All rights reserved.

1. Introduction also contains an A + T-rich region of variable length, which is the largest noncoding area, functioning in the regulation of transcription and Apocheima cinerarius (Erschoff, 1874) (Lepidoptera: Geometridae: replication (Wolstenholme, 1992). Geometridae is the third largest Ennominae) is widely distributed in northern China, southeast Russia, lepidopteran family, with more than 26,000 described species, but and Central Asia. The moth, one of the female flightless moths in only 2 Geometridae (Phthonandria atrilineata and Biston panterinaria) Geometridae, is univoltine. It overwinters by pupa and emerges from mitogenomes have been published (Yang et al., 2009, 2013). To date, early March to early May. A. cinerarius outbreaks occur frequently in there has been no report of the complete mitogenome of a female flight- northern China. The moth can defoliate deciduous trees in a few days, less moth. damaging the forest landscape and destroying the regional ecological In the present study, the complete mitogenome of A. cinerarius was balance (Chu, 1981). A. cinerarius has the most economic significance sequenced. The genomic organization, base composition, PCGs, tRNA among the described female flightless moths of Geometridae. Research genes and rRNA structures, and A + T-rich region were analyzed, with on A. cinerarius has mostly focused on its biology and control methods a focus on the A + T-rich region and the secondary structure for rrnL (Zhang et al., 2011); there have been no reports of its mitogenome. and rrnS. The phylogenetic relationships among lepidopteran super- The insect mitogenome DNA is a circular molecule 14–16 kbp in families were reconstructed using the nucleotide sequence of 13 PCGs length. It contains 13 protein-coding genes (PCGs), 2 ribosomal RNA for 52 lepidopteran species. The relationships among A. cinerarius, genes (large and small rRNAs), and 22 transfer RNA (tRNA) genes. It P. atrilineata,andB. panterinaria were comparatively analyzed.

Abbreviations: Mitogenome, mitochondrial genome; PCGs, protein coding genes; atp6 2. Material and methods and atp8, atp synthase subunit 6 and 8 genes; cox1-3, cytochrome c oxidase 1–3 genes; cytb, cytochrome b gene; nad1-6 and nad4L, NADH dehydrogenase subunit 1–6 and 4L 2.1. DNA extraction genes; rRNA, ribosomal RNA; rrnL and rrnS, large and small subunit ribosomal RNA; tRNA, transfer RNA; PCR, polymerase chain reaction; AIC, Akaike information criterion. An adult specimen of A. cinerarius was collected from Lulong, Hebei, ⁎ Corresponding author. ′ ′ E-mail addresses: [email protected] (S. Liu), [email protected] (D. Xue), China (118°52 ,39°52) in March 2007. The specimen was preserved in [email protected] (H. Han). anhydrous ethanol at −20 °C and stored in the Lepidoptera systematics

http://dx.doi.org/10.1016/j.gene.2014.06.044 0378-1119/© 2014 Elsevier B.V. All rights reserved. S. Liu et al. / Gene 547 (2014) 136–144 137 group of the Institute of Zoology, Chinese Academy of Sciences. DNA 2.4. Phylogenetic analysis was extracted using the Qiagen DNeasy Blood & Tissue Kit (Qiagen, Beijing, China). The phylogenetic relationships of Lepidoptera were reconstructed using a concatenated set of 13 PCGs of 52 complete mitogenomes 2.2. PCR amplification and sequencing (51 obtained from GenBank, A. cinerarius from the present study) (Table. 2). Thitarodes yunnanensis and Thitarodes renzhiensis (Cao Short fragments of the A. cinerarius mitogenome were PCR-amplified et al., 2012) of Hepialoidea in Exoporia were used as outgroups. The with previously published conserved primers (Clary and Wolstenholme, 13 PCG nucleotide sequences were aligned and translated into amino 1985; Hebert et al., 2004; Kim et al., 2012; Sezonlin et al., 2006; Simon acid sequences on the basis of the invertebrate mitochondrial genetic et al., 1994). Specific primers were designed from the short fragments code with deleted stop codons, using MEGA 5.0. The GTR + I + G using Primer Premier 5 (Premier Biosoft International) (Table 1). PCR model was selected from 88 models by the Akaike information criterion reactions for long fragments were performed in a 25-μl volume with (AIC) with the jModelTest 0.1 (Posada, 2008). The concatenated sets of 0.625 U of LA Taq (Takara, China), 1 μlofDNA,2.5μl10×LATaqbuffer nucleotide sequences of the 13 PCGs were used to reconstruct the (plus Mg2+), 4 μl dNTPs, and 16 pmol of each primer. PCR reactions for phylogenetic relationships by Bayesian inference and Maximum short fragments (b1 kb) were performed using the following procedure: likelihood (ML) methods. The Bayesian analysis was performed 94 °C for 2 min; 5 cycles of 40 s at 94 °C, 40 s at 45 °C, and 1.5 min at using MrBayes v3.1.2 (Ronquist and Huelsenbeck, 2003). The 72 °C; and 35 cycles of 40 s at 94 °C, 40 s at 51 °C, and 1.5 min at 72 °C, MCMC analysis was run for 10,000,000 generations, following a followed by 72 °C for 10 min (Hebert et al., 2004). The long segments burn-in series of 1000. Maximum likelihood (ML) analysis was con- (3–5 kb) were amplified with specific primers using the following ducted using the program of RAxMLv7.0.4 (Stamatakis, 2006)with procedure: 94 °C for 2 min, 35 cycles of 30 s at 94 °C, 30 s at 45–55 °C, conducting 1000 bootstraps. The GTRGAMMA model was used for and 12 min at 68 °C, followed by 68 °C for 10 min. The PCR products all 13PCGs and partitions. were detected by 1% agarose gel electrophoresis and directly sequenced with ABI PRISM 3730xl capillary sequencers. 3. Results 2.3. Sequence assembly, gene annotation, and secondary structure prediction 3.1. Genome organization and base composition The sequences were run using the NCBI BLAST program to determine sequencehomology.Thecompletemitogenomewasassembledfromthe The complete mitogenome of A. cinerarius was found to be 15,722 bp overlapping short sequences with ChromasPro (www.technelysium.com. in length, containing 13 PCGs, 22 tRNA genes, 2 rRNA genes, and 1 con- au/ChromasPro.html), and open reading frames (ORFs) were identified trol region (Fig. 1), like other lepidopteran genomes. The mitogenome using the ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi) sequence has been deposited in GenBank under accession number at NCBI. The nucleotide sequences were aligned with the known KF836545. Twenty-three genes are transcribed on the J strand and the mitogenome sequences of closely related species using ClustalX 1.83 remaining 14 are transcribed on the N strand. The nucleotide composi- (Thompson et al., 1997). The base composition was calculated using tion is (A) 41.51%, (C) 11.37%, (G) 7.8%, and (T) 39.32%. The AT nucleo- BioEdit, and codon usage was calculated using MEGA 5.0 (Tamura tide content is 80.83%. The AT skew value ([A − T] / [A + T]) (Perna and et al., 2011). The 22 tRNA cloverleaf secondary structures and anticodon Kocher, 1995b; Wei et al., 2010) is 0.027. sequences were determined with tRNAscan-SE version 1.21 (lowelab. ucsc.edu/tRNAscan-SE/)(Lowe and Eddy, 1997) and alignment with the known mitogenome sequences of closely related species. The rrnL 3.2. Protein-coding genes and rrnS secondary structures were inferred from Mfold Web Server (http://mfold.rna.albany.edu/?q=mfold) and comparison with rRNA The mitogenome of A. cinerarius contains 13 PCGs starting with the secondary structures proposed for other insects, including Grapholita typical ATN codons, except for cox1 with the CGA start codon. There molesta (Lepidoptera: Tortricidae), Manduca sexta (Lepidoptera: are 3766 codons excluding the start and termination codons. UUA Sphingidae), Phalera flavescens (Lepidoptera: Notodontidae), and (Leu), UUU (Phe), and AUU (Ile) are the most abundant amino acid co- Ochrogaster lunifer (Lepidoptera: Notodontidae) (Cameron and dons. Codon usage in PCGs is biased, using more A and T than G and C. Whiting, 2008; Gong et al., 2012; Simonato et al., 2013; Sun et al., The RSCU (relative synonymous codon usage) of the third positions 2012). Stem–loops are named according to the conventions of Gillespie has a high frequency of AU in two-and-four fold degenerate codons et al. (2006) and Niehuis et al. (2006a,b). than GC (Fig. 2).

Table 1 Primers used to amplify and sequence the complete mitochondrial genome of A. cinerarius.

Region Name Sequence (5′–3′)Source

rrnS → trnGln(Q) mtD35 AAGAGCGACGGGCGATGTGT Clary and Wolstenholme (1985) CIN-COI-R TGTGCAGTTACAATAGTGTTAT This study cox1 LepF1 ATTCAACCAATCATAAAGATATTGG Hebert et al. (2004) LepR1 TAAACTTCTGGATGTCCAAAAAATCA Hebert et al. (2004) cox2 → nad5 CIN-COI-F TTTTGGGCATCCTGAAGTAT This study CIN-ND5-R1 GTTACAGCAGGGGTTTATTT This study nad5 → cytb Lep-ND5-F2 CGAATATCTTGAATATCATTTATTA Kim et al. (2012) CIN-CYTB-R GGTTGAATATGAACAGGAGT This study cytb CP1 GATGATGAAATTTTGGATC Sezonlin et al. (2006) TRs TATTTCTTTATTATGTTTTCAAAAC Simon et al. (1994) cyb → rrnL CIN-CYTB-F2 TTGCTTATGCTATTTTACGATC This study CIN-lrRNA-R2 GTACAAAGGTAGCATAATCATTAGTC This study 138 S. Liu et al. / Gene 547 (2014) 136–144

Table 2 List of taxa in the phylogenetic analyses with their GenBank accession numbers.

Superfamily Family Species GenBank accession no. Reference

Bombycoidea Bombycidae Bombyx mandarina NC_003395 Yukuhiro et al. (2002) Bombycoidea Bombycidae Bombyx mori NC_002355 Direct submission Bombycoidea Saturniidae Actias selene NC_018133 Liu et al. (2012) Bombycoidea Saturniidae Antheraea pernyi NC_004622 Liu et al. (2008) Bombycoidea Saturniidae Antheraea yamamai NC_012739 Kim et al. (2009b) Bombycoidea Saturniidae Eriogyna pyretorum NC_012727 Jiang et al. (2009) Bombycoidea Saturniidae Samia cynthia ricini NC_017869 Kim et al. (2012) Bombycoidea Saturniidae Saturnia boisduvalii NC_010613 Hong et al. (2008) Bombycoidea Sphingidae Manduca sexta NC_010266 Cameron and Whiting (2008) Bombycoidea Sphingidae Sphinx morio NC_020780 Kim et al. (2013) Geometroidea Geometridae Apocheima cinerarius KF836545 Present study Geometroidea Geometridae Biston panterinaria NC_020004 Yang et al. (2013) Geometroidea Geometridae Phthonandria atrilineata NC_010522 Yang et al. (2009) Hepialoidea Hepialidae Thitarodes yunnanensis NC_018095 Cao et al. (2012) Hepialoidea Hepialidae Thitarodes renzhiensis NC_018094 Cao et al. (2012) Noctuoidea Arctiidae Hyphantria cunea NC_014058 Liao et al. (2010) Noctuoidea Lymantriidae Gynaephora menyuanensi NC_020342 Direct submission Noctuoidea Lymantriidae Lymantria dispar NC_012893 Unpublished Noctuoidea Noctuidae Helicoverpa armigera NC_014668 Yin et al. (2010) Noctuoidea Noctuidae Sesamia inferens NC_015835 Unpublished Noctuoidea Noctuidae Spodoptera exigua NC_019622 Wu et al. (2013) Noctuoidea Notodontidae Ochrogaster lunifer NC_011128 Salvato et al. (2008) Noctuoidea Notodontidae Phalera ﬂavescens NC_016067 Sun et al. (2012) Papilionoidea Hesperiidae Ctenoptilum vasava NC_016704 Hao et al. (2012) Papilionoidea Hesperiidae Ochlodes venata NC_018048 Unpublished Papilionoidea Lycaenidae Coreana raphaelis NC_007976 Kim et al. (2006) Papilionoidea Lycaenidae Protantigius superans NC_016016 Kim et al. (2011) Papilionoidea Lycaenidae Spindasis takanonis NC_016018 Kim et al. (2011) Papilionoidea Nymphalidae Apatura ilia NC_016062 Chen et al. (2012) Papilionoidea Nymphalidae Apatura metis NC_015537 Zhang et al. (2012) Papilionoidea Nymphalidae Argyreus hyperbius NC_015988 Wang et al. (2011) Papilionoidea Nymphalidae Calinaga davidis NC_015480 Direct submission Papilionoidea Nymphalidae Euploea mulciber NC_016720 Unpublished Papilionoidea Papilionidae Papilio maraho NC_014055 Unpublished Papilionoidea Papilionidae Parnassius bremeri NC_014053 Kim et al. (2009a) Papilionoidea Papilionidae Teinopalpus aureus NC_014398 Unpublished Papilionoidea Pieridae Artogeia melete EU597124 Hong et al. (2009) Papilionoidea Pieridae Delias hyparete NC_020428 Shi et al. (2012) Papilionoidea Pieridae Pieris melete NC_010568 Direct submission Papilionoidea Pieridae Pieris rapae NC_015895 Mao et al. (2010) Papilionoidea Nymphalidae Acraea issoria NC_013604 Hu et al. (2010) Pyraloidea Crambidae Chilo suppressalis NC_015612 Chai et al. (2012) Pyraloidea Crambidae Diatraea saccharalis NC_013274 Li et al. (2011) Pyraloidea Crambidae Ostrinia furnacalis NC_003368 Coates et al. (2005) Pyraloidea Pyralidae Cnaphalocrocis medinalis NC_015985 Chai et al. (2012) Pyraloidea Pyralidae Corcyra cephalonica NC_016866 Unpublished Totricoidea Tortricidae Acleris ﬁmbriana NC_018754 Unpublished Totricoidea Tortricidae Adoxophyes honmai NC_008141 Lee et al. (2006) Totricoidea Tortricidae Grapholita molesta NC_014806 Son and Kim (2011) Totricoidea Tortricidae Spilonota lechriaspis NC_014294 Zhao et al. (2011) Yponomeutoidea Lyonetiidae Leucoptera malifoliella NC_018547 Wu et al. (2012) Yponomeutoidea Plutellidae Plutella xylostella JF911819 Wei et al. (2013)

3.3. tRNA genes and rRNA genes rrnS secondary structure (Fig. 4) consists of 3 domains, with domain III being more conserved than domains I and II. The lengths of the 22 tRNA genes range from 64 to 70 bp. Of these, 14 are encoded on the J strand and 8 are encoded on the N strand. All the 3.4. Noncoding and A + T-rich regions tRNAs have typical cloverleaf secondary structures, except for trnSer(AGN), which lacks a dihydroxyuridine (DHU) arm (Fig. A.1). The mitogenome of A. cinerarius contains 14 short noncoding re- Nineteen tRNAs were identiﬁed by tRNAscan-SE version 1.21, and the gions of sizes ranging from 1 to 73 bp, for a total length of 218 bp. The remaining 3 were identiﬁed by comparison with closely related species. largest intergenic spacer is 73-bp long and lies between the genes of Both rrnL and rrnS are encoded on the N strand. rrnL is located between nad2 and trnGln(Q). the genes of trnLeu(CUN) and trnVal(V)l with an A + T content of The control region, located between rrnS and trnMet(M),is625bpin 84.82%. The length is 1390 bp. rrnS was assumed to be located between length and harbors the largest A + T content (95.84%) among all the trnVal(V) and the control region with an A + T content of 85.68%. The genes of the A. cinerarius mitogenome. It includes typical structures length of the rrnS gene was estimated to be 788 bp. We determined (Fig. 5): (1) a conserved On (origin of minority or light-strand replica- the complete secondary structures of the rrnL and rrnS molecules. Six tion) motif that includes ATAGA + 19-bp poly-T units located 17 and structural domains including conserved regions (IV and V) and variable 22 bp upstream from rrnS; (2) a microsatellite-like (TA)26 inserted by regions (I, II, III, VI) appear in the rrnL secondary structure (Fig. 3). The several TG beginning with ATTTA at the 3′-end of the A + T-rich region; S. Liu et al. / Gene 547 (2014) 136–144 139

Fig. 1. Circular map of the complete mitogenome of A. cinerarius. PCGs are denoted in blue, transfer RNA genes in pink, rRNA genes in green and the control region in red.

Fig. 2. Codon usage in the A. cinerarius mitogenome. (A) CDspT (codons per thousand) indicates the codons used in coding amino acids per thousand codons. The X axis shows the 13 coded amino acids. (B) Relative synonymous codon usage (RSCU). 140 S. Liu et al. / Gene 547 (2014) 136–144

Fig. 3. Secondary structure of rrnL.Watson–Crick pairs by lines, wobble GU pairs by dots, and other noncanonical pairs by circles.

(3) an A + T-rich region harboring no apparent large repeated ele- 4. Discussion ments, only several short (11–13 bp) (TA)nT(A)n repeats; (4) genes between 197 bp and 284 bp in the middle of the A + T-rich region that can 4.1. Genome organization and base composition fold into a stem-and-loop structure (ΔG −8.70 kcal/mol). The structure begins with TATAA and ends with GAAAT, similar to the published struc- The order of the tRNA genes in the A. cinerarius mitogenome is trnM– tures TTATA and G(A)nT for other insects (Clary and Wolstenholme, trnI–trnQ, which is identical with that of the Ditrysia mitogenomes and 1987; Zhang and Hewitt, 1997; Zhang et al., 1995); and (5) a poly-A different from the ancestral gene order trnI–trnQ–trnM (Boore, 1999; stretch located downstream of trnMet(M),consistingof13Anucleotides Caoetal.,2012;Flooketal.,1995). and 2 interpolated T nucleotides. The A + T content of the sequences is 80.83%, which is typical of this region for lepidopteran species (Kim et al., 2006; Salvato et al., 2008). 3.5. Phylogenetic analysis The A + T content of 13 PCGs is 78.9% on average. Among all the genes, the cox1 gene has the lowest A + T content (71.78%), whereas The 52 Neolepidoptera species used for phylogenetic analysis in- the A + T content of atp8 is 91.52%, the highest A + T content. The T cluded 8 superfamilies (Hepialoidea, Yponomeutoidea, Tortricoidea, content of the third codons of the 13 PCGs (49%) is higher than that of Papilionoidea, Pyraloidea, Noctuoidea, Bombycoidea, Geometroidea) the control region (48.64%). The results showed that the AT skew and 18 families, using the concatenated nucleotide sequences of the value ([A − T] / [A + T]) (Perna and Kocher, 1995b; Wei et al., 2010) 13 PCGs. T. yunnanensis and T. renzhiensis of Hepialoidea were used as for A. cinerarius is 0.027, which lies between −0.047 (Coreana raphaelis) outgroups. Hepialoidea belonging to Exoporia are primordial groups and 0.059 (Bombyx mori)(Lu et al., 2002). The AT skew and GC skew (van Nieukerken et al., 2011; Cao et al., 2012). The ingroup in this values of the PCGs on the J strand (AT skew −0.074, GC skew 0.162) study belongs to Ditrysia. The topologies of phylogenetic analysis in are larger than those of the PCGs on the N strand (AT skew −0.230, both BI and ML analyses were approximately the same except some GC skew −0.363). The AT skew and GC skew represent the strand slight differences. By comparing the nodal support values across the bias of the mitogenome (Lobry, 1995; Perna and Kocher, 1995a). The analyses, BI analysis was found to be superior to ML analysis. Both BI strand bias of the nucleotide composition of the mitogenome reﬂects and ML analyses showed that the superfamilies Noctuoidea, Bombycoidea unequal rates of substitution and heterogeneity in base composition and Geometroidea were clustered in one branch, of them, Bombycoidea among taxa (Hassanin et al., 2005; Perna and Kocher, 1995b). and Geometroidea were sister groups. Noctuoidea, Bombycoidea and Geometroidea were members of the Macroheterocera, Pyraloidea 4.2. Protein-coding genes and Papilionoidea together with the Macroheterocera belonged to Obtectmera, which was the sister group of Tortricoidea (Fig. 6). In A. cinerarius PCGs, the third codons of the initiation codons for A. cinerarius, B. panterinaria,andP. atrilineata were clustered into nad2, atp8, cox3, nad3, and nad6 have variations compared with those one branch in the phylogenetic tree with a 100% bootstrapping in P. atrilineata and B. panterinaria, which also belong to Geometridae. value. For example, the start codon of the atp8 gene of A. cinerarius is ATC, S. Liu et al. / Gene 547 (2014) 136–144 141

Fig. 4. Secondary structure of rrnS. Watson–Crick pairs by lines, wobble GU pairs by dots, and other noncanonical pairs by circles. that of B. panterinaria is ATT, and that of P. atrilineata is ATA. Ten of the Zygaena sarpedon lusitanica (Lepidoptera: Zygaenidae) (Cameron and 13 PCGs end with the TAA codon, whereas the other PCGs, cox1, cox2, Whiting, 2008; Chai et al., 2012; Niehuis et al., 2006b; Wu et al., 2012). and nad4, end with a single T. These incomplete termination codons The differences of the stem–loops among lepidopteran rrnL may present form the complete TAA in the assembly process of mRNA (Boore, some phylogenetic information. 1999; Gong et al., 2012). The length of the sequence between domain II and domain IV (between helix H579/D1 and H1648/E18) is variable among lepidopteran 4.3. The secondary structures of rRNA genes taxa and has different levels of base insertion in some species. The sequence close to stem H1648/E18 was assumed to have 17-bp inserts The secondary structure of rrnL of A. cinerarius largely conforms to in A. cinerarius, similar to the 19-bp insertion in M. sexta. Most of the he- the models proposed for other Lepidoptera (Cameron and Whiting, lices in domain V are conserved within lepidopteran mitogenomes, ex- 2008; Gillespie et al., 2006; Niehuis et al., 2006a,b; Wei et al., 2013), cept for helix H2077/G3. We found that the helix H2077/G3 of rrnL but there are different degrees of variations in the stem–loops (Fig. 3). consists of a stem of 20 paired bases and a 17-bp loop in A. cinerarius. We found that domain II is a highly variable structure among the lepi- The sequence and secondary structure of domain III are more con- dopteran mtDNA with respect to nucleotide sequence and secondary served than that of domain I and domain II in lepidopteran rrnS (Fig. 4). structure, with the main differences being in the stem length, inner In domain I, H47 (H5 + H7 + H8) is one of the variable stems and terminal loops, and base substitutions. For example, there is only (Gillespie et al., 2006; Gong et al., 2012; Niehuis et al., 2006a; 1 unpaired base on the stem H837/D13, D14 for A. cinerarius,withthe Simonato et al., 2013). There are variations in base substitution and terminal loop consisting of only 4 bases, similar to M. sexta (Lepidoptera: loop size for stem H47 among lepidopteran mitogenomes. Helix H47 Sphingidae) and different from Leucoptera malifoliella Costa (Lepidoptera: in A. cinerarius has 3 stems with 2 internal loops and 1 terminal loop. Lyonetiidae), Cnaphalocrocis medinalis (Lepidoptera: Pyralidae), and The loop size of helix H47 for A. cinerarius is similar to that of M. sexta 142 S. Liu et al. / Gene 547 (2014) 136–144

Fig. 5. Control region of the A. cinerarius mitochondrial genome. (A) Predicted structural elements of the A. cinerarius A + T-rich region; (B) A proposed stem-and-loop structure found in the A. cinerarius A + T-rich region.

Fig. 6. Phylogenetic tree for 52 lepidopteran species. Phylogenetic analysis inferred from the nucleotide sequences of 13 PCGs by the Bayesian method. Bayesian posterior probabilities are indicated at each node. S. Liu et al. / Gene 547 (2014) 136–144 143 and P. flavescens (Cameron and Whiting, 2008; Sun et al., 2012), smaller moth showed that the variations mainly locate in stem length, inner than that of Z. sarpedon lusitanica, and larger than that of G. molesta and and terminal loops, and base substitutions. The secondary structures O. lunifer. In domain II, it is more variable on the base substitution and of rrnL and rrnS contain important phylogenetic information and need the component base number of the loop between H577/23 and H673/ more attentions. The complete mitogenome of A. cinerarius supplied 25. In Lepidoptera, domain III is more conserved, except for the sequence more molecular information for lepidopteran phylogeny. Phylogenetic length and structure variations of H1068/39, H1074/40, and H1113/42 reconstructions based on the concatenated nucleotide sequences of (Page, 2000). There is little evidence for the existence of H1113/42, and the 13 PCGs showed that Geometroidea has a closer relationship helix H1113/42 only has 1 base pair confined by CCS. We propose that with Bombycoidea than with Noctuoidea. A. cinerarius is closer with A. cinerarius has 4 paired bases. B. panterinaria than with P. atrilineata. The secondary structure of rRNA had been successfully used to re- Supplementary data to this article can be found online at http://dx. construct phylogenetic relationships (Billoud et al., 2000; Lydeard doi.org/10.1016/j.gene.2014.06.044. et al., 2000; Misof and Fleck, 2003), and the method is increasing in im- portance. rRNA secondary structural information can be used for guid- ing nucleotide sequence alignment (Wuyts et al., 2004). Studies of the Acknowledgment rRNA secondary structure in Lepidoptera are few, and the field awaits more attention. The authors sincerely thank Xuejian Wang for collecting the speci- mens and also thank the reviewers for providing the useful comments 4.4. The control region and suggestions. This work was supported by the National Science Foundation of China (No. 31272288), the National Science Fund for Fos- The length of the control region is highly variable among animal taxa tering Talents in Basic Research (No. NSFCJ 1210002) and a grant from (Rand, 1993). Differences in mitogenome length occur mostly in the the Key Laboratory of the Zoological Systematics and Evolution of the intergenic region, including noncoding genes and repeated sequences, Chinese Academy of Sciences (No. O529YX5105). because the PCGs and RNA genes are conserved. The control region is the largest noncoding gene in the complete mitogenome (Boyce et al., 1989; Galtier et al., 2009; Lagisz et al., 2013; Wang et al., 2013). Similar References to vertebrates, including mammals (Anderson et al., 1982), and other Anderson, S., de Bruijn, M.H., Coulson, A.R., Eperon, I.C., Sanger, F., Young, I.G. (1982). invertebrates such as Diptera and Orthoptera (Cha et al., 2007; da Complete sequence of bovine mitochondrial DNA: conserved features of the mito- Silva et al., 2009), A. cinerarius has a similar stem-and-loop structure chondrial genome. J. Mol. Biol. 156, 683–717. in its control region (Fig. 5). This structure is highly conserved in inver- Billoud, B., Guerrucci, M.A., Masselot, M., Deutsch, J.S. (2000). Cirripede phylogeny using a novel approach: molecular morphometrics. Mol. Biol. Evol. 17 (10), 1435–1445. tebrates, but its location in the control region is variable (Zhang et al., Boore, J.L. (1999). Animal mitochondrial genomes. Nucleic Acids Res. 27, 1767–1780. 1995). It may represent the initiation of secondary structure folding in Boyce, T.M., Zwick, M.E., Aquadro, C.F. (1989). Mitochondrial DNA in the bark weevils: invertebrates (Clary and Wolstenholme, 1987). size, structure and heteroplasmy. Genetics 123, 825–836. Cameron, S.L., Whiting, M.F. (2008). The complete mitochondrial genome of the tobacco hornworm, Manduca sexta, (Insecta: Lepidoptera: Sphingidae), and an examination 4.5. Phylogenetic analysis of mitochondrial gene variability within butterflies and moths. Gene 408, 112–123. Cao, Y.Q., Ma, C., Chen, J.Y., Yang, D.R. (2012). The complete mitochondrial genomes of fl two ghost moths, Thitarodes renzhiensis and Thitarodes yunnanensis: the ancestral A. cinerarius is one of the female ightless moths in Geometridae. gene arrangement in Lepidoptera. BMC Genomics 13, 276. But, there is no obvious change on mitogenome between flightless Cha, S.Y., Yoon, H.J., Lee, E.M., Yoon, M.H., Hwang, J.S., Jin, B.R., Han, Y.S., Kim, I. (2007). The and female fully winged moths. The ecological habit of the flightless fe- complete nucleotide sequence and gene organization of the mitochondrial genome of fl the bumblebee, Bombus ignitus (Hymenoptera: Apidae). Gene 392, 206–220. male moths may have not re ected the sequence and structures of their Chai, H.N., Du, Y.Z., Zhai, B.P. (2012). Characterization of the complete mitochondrial ge- mitogenome. In the present study, the result of phylogenetic analysis nomes of Cnaphalocrocis medinalis and Chilo suppressalis (Lepidoptera: Pyralidae). Int. was in agreement with the proposed conventional morphology-based J. Biol. Sci. 8 (4), 561. classification of van Nieukerken et al. (2011) but not with the earlier Chen, M., Tian, L.L., Shi, Q.H., Cao, T.W., Hao, J.S. (2012). Complete mitogenome of the Lesser Purple Emperor Apatura ilia (Lepidoptera: Nymphalidae: Apaturinae) and classification by Kristensen and Skalski (1999). The phylogenetic rela- comparison with other nymphalid butterflies. Zool. Res. 33 (2), 191–201. tionships identified Yponomeutoide and Apoditrysia as sister taxa, Chu, H.F. (1981). Geometridae. Iconographia heterocerorum Sinicorum, 1, pp. 112–131 – Tortricoidea and Obtectmera both belong to Apoditrysia with high (pls 29 37). Clary, D.O., Wolstenholme, D.R. (1985). The mitochondrial DNA molecule of Drosophila nodal support by Bayesian analysis. Pyraloidea and Macroheterocera yakuba: nucleotide sequence, gene organization, and genetic code. J. Mol. Evol. 22 were identified as sisters, both clustering in a branch with Papilionoidea (3), 252–271. in both BI and ML analyses. Phylogenetic analysis revealed that Clary, D.O., Wolstenholme, D.R. (1987). Drosophila mitochondrial DNA: conserved sequences in the A + T-rich region and supporting evidence for a secondary structure Geometroidea is more closely related to Bombycoidea than to Noctuoidea model of the small ribosomal RNA. J. Mol. Evol. 25 (2), 116–125. which is in accordance with the phylogenetic results of Wu et al. (2012), Coates, B.S., Sumerford, D.V., Hellmich, R.L., Lewis, L.C. (2005). Partial mitochondrial ge- Yang et al. (2009),andYang et al. (2013), but not with those of Chai et al. nome sequences of Ostrinia nubilalis and Ostrinia furnicalis. Int. J. Biol. Sci. 1 (1), 13. da Silva, N.M., de Souza Dias, A., da Silva Valente, V.L., Valiati, V.H. (2009). Characteriza- (2012) and Liu et al. (2013). The latter phylogenetic trees revealed tion of mitochondrial control region, two intergenic spacers and tRNAs of Zaprionus Geometroidea to be more closely related to Noctuoidea, possibly owing indianus (Diptera: Drosophilidae). Genetica 137 (3), 325–332. to the use of only 1 Geometroidea species and several Bombycoidea spe- Flook, P.K., Rowell, C.H.F., Gellissen, G. (1995). The sequence, organization, and evolution of the Locusta migratoria mitochondrial genome. J. Mol. Evol. 41, 928–941. cies in the phylogenetic analysis. More Geometroidea mitogenomes Galtier, N., Jobson, R.W., Nabholz, B., Glemin, S., Blier, P.U. (2009). Mitochondrial whims: should be sequenced and analyzed. The phylogenetic relationship of metabolic rate, longevity and the rate of molecular evolution. Biol. Lett. 5, 413–416. Geometroidea supported a closer relationship of A. cinerarius with Gillespie, J.J., Johnston, J.S., Cannone, J.J., Gutell, R.R. (2006). Characteristics of the nuclear B. panterinaria than with P. atrilineata. This is in accordance with (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements. In- the conventional morphology-based classification. sect Mol. Biol. 15, 657–686. Gong, Y.J., Shi, B.C., Kang, Z.J., Zhang, F., Wei, S.J. (2012). The complete mitochondrial ge- 5. Conclusion nome of the oriental fruit moth Grapholita molesta (Busck) (Lepidoptera: Tortricidae). Mol. Biol. Rep. 39, 2893–2900. Hao, J., Sun, Q., Zhao, H., Sun, X., Gai, Y., Yang, Q. (2012). The complete mitochondrial ge- The complete mitogenome of A. cinerarius,afemaleflightless moth nome of Ctenoptilum vasava (Lepidoptera: Hesperiidae: Pyrginae) and its phyloge- in Geometridae, has the typical gene organization of mitogenome as in netic implication. Comp. Funct. Genom. 2012. Hassanin, A., Leger, N., Deutsch, J. (2005). Evidence for multiple reversals of asymmetric other ditrysian Lepidoptera. Comparison on the secondary structures mutational constraints during the evolution of the mitochondrial genome of of rrnL and rrnS between A. cinerarius and the other lepidopteran Metazoa, and consequences for phylogenetic inferences. Syst. Biol. 54, 277–298. 144 S. Liu et al. / Gene 547 (2014) 136–144

Hebert, P.D.N., Penton, E.H., Burns, J.M. (2004). Ten species in one: DNA barcoding reveals Perna, N.T., Kocher, T.D. (1995a). Unequal base frequencies and the estimation of substi- cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proc. Natl. tutional rates. Mol. Biol. Evol. 12, 359–361. Acad. Sci. U. S. A. 101, 14812–14817. Perna, N.T., Kocher, T.D. (1995b). Patterns of nucleotide composition at fourfold degener- Hong, M.Y., Lee, E.M., Jo, Y.H., Park, H.C., Kim, S.R., Hwang, J.S., Jin, B.R., Kang, P.D., Kim, K., ate sites of animal mitochondrial genomes. J. Mol. Evol. 41, 353–358. Han, Y.S., Kim, I. (2008). Complete nucleotide sequence and organization of the Posada, D. (2008). jModelTest: phylogenetic model averaging. Mol. Biol. Evol. 25, mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and 1253–1256. comparison with other lepidopteran insects. Gene 413 (1), 49–57. Rand, D.M. (1993). Endotherms, ectotherms, and mitochondrial genome-size variation. J. Hong, G., Jiang, S., Yu, M., Yang, Y., Li, F., Xue, F., Wei, Z. (2009). The complete nucleotide Mol. Evol. 37, 281–295. sequence of the mitochondrial genome of the cabbage butterfly, Artogeia melete Ronquist, F., Huelsenbeck, J.P. (2003). MRBAYES 3: Bayesian phylogenetic inference under (Lepidoptera: Pieridae). Acta Biochim. Biophys. Sin. 41 (6), 446–455. mixed models. Bioinformatics 19 (12), 1572–1574. Hu, J., Zhang, D., Hao, J., Huang, D., Cameron, S., Zhu, C. (2010). Thecompletemitochondrial Salvato, P., Simonato, M., Battisti, A., Negrisolo, E. (2008). The complete mitochondrial ge- genome of the yellow coaster, Acraea issoria (Lepidoptera: Nymphalidae: Heliconiinae: nome of the bag-shelter moth Ochrogaster lunifer (Lepidoptera, Notodontidae). BMC Acraeini): sequence, gene organization and a unique tRNA translocation event. Mol. Genomics 9, 331. Biol. Rep. 37 (7), 3431–3438. Sezonlin, M., Dupas, S., Le RÜ, B., Le Gall, P., Moyal, P., Calatayud, P.A., Giffard, I., Faure, N., Jiang, S.T., Hong, G.Y., Yu, M., Li, N., Yang, Y., Liu, Y.Q., Wei, Z.J. (2009). Characterization of Silvain, J.F. (2006). Phylogeography and population genetics of the maize stalk borer the complete mitochondrial genome of the giant silkworm moth, Eriogyna pyretorum Busseola fusca (Lepidoptera, Noctuidae) in sub-Saharan Africa. Mol. Ecol. 15, 407–420. (Lepidoptera: Saturniidae). Int. J. Biol. Sci. 5 (4), 351–365. Shi, Q., Xia, J., Sun, X., Hao, J., Yang, Q. (2012). Complete mitogenome of the Painted Jez- Kim, I., Lee, E.M., Seol, K.Y., Yun, E.Y., Lee, Y.B., Hwang, J.S., Jin, B.R. (2006). The mitochon- ebel, Delias hyparete Linnaeus (Lepidoptera: Pieridae) and its comparison with drial genome of the Korean hairstreak, Coreana raphaelis (Lepidoptera: Lycaenidae). other butterfly species. Zool. Res. 33 (6), 111–120. Insect Mol. Biol. 15 (2), 217–225. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P. (1994). Evolution, weighting, Kim, M.I., Baek, J.Y., Kim, M.J., Jeong, H.C., Kim, K.G., Bae, C.H., Han, Y.S., Jin, B.R., Kim, I. and phylogenetic utility of mitochondrial gene sequences and a compilation of con- (2009a). Complete nucleotide sequence and organization of the mitogenome of the served polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87, 651–701. red-spotted apollo butterfly, Parnassius bremeri (Lepidoptera: Papilionidae) and com- Simonato, M., Battisti, A., Kerdelhué, C., Burban, C., Lopez-Vaamonde, C., Pivotto, I., parison with other lepidopteran insects. Mol. Cells 28 (4), 347–363. Salvato, P., Negrisolo, E. (2013). Host and phenology shifts in the evolution of the so- Kim, S.R., Kim, M.I., Hong, M.Y., Kim, K.Y., Kang, P.D., Hwang, J.S., Han, Y.S., Jin, B.R., Kim, I. cial moth genus Thaumetopoea. PLoS One 8 (2), e57192. (2009b). The complete mitogenome sequence of the Japanese oak silkmoth, Son, Y., Kim, Y. (2011). ThecompletemitochondrialgenomeofGrapholita molesta Antheraea yamamai (Lepidoptera: Saturniidae). Mol. Biol. Rep. 36 (7), 1871–1880. (Lepidoptera: Tortricidae). Ann. Entomol. Soc. Am. 104 (4), 788–799. Kim, M.J., Kang, A.R., Jeong, H.C., Kim, K.G., Kim, I. (2011). Reconstructing intraordinal re- Stamatakis, A. (2006). RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses lationships in Lepidoptera using mitochondrial genome data with the description of with thousands of taxa and mixed models. Bioinformatics 22, 2688–2690. two newly sequenced lycaenids, Spindasis takanonis and Protantigius superans Sun, Q.Q., Sun, X.Y., Wang, X.C., Gai, Y.H., Hu, J., Zhu, C.D., Hao, J.S. (2012). Complete se- (Lepidoptera: Lycaenidae). Mol. Phylogenet. Evol. 61 (2), 436–445. quence of the mitochondrial genome of the Japanese buff-tip moth, Phalera flavescens Kim, J.S., Park, J.S., Kim, M.J., Kang, P.D., Kim, S.G., Jin, B.R., Kim, I. (2012). Complete nucle- (Lepidoptera: Notodontidae). Genet. Mol. Res. 11 (4), 4213–4225. otide sequence and organization of the mitochondrial genome of eri-silkworm, Samia Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S. (2011). MEGA5: mo- cynthia ricini (Lepidoptera: Saturniidae). J. Asia Pac. Entomol. 15 (1), 162–173. lecular evolutionary genetics analysis using likelihood, distance, and parsimony Kim, M.J., Choi, S.W., Kim, I. (2013). Complete mitochondrial genome of the larch hawk methods. Mol. Biol. Evol. 28 (10), 2731–2739. moth, Sphinx morio (Lepidoptera: Sphingidae). Mitochondrial DNA 24 (6), 622–624. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G. (1997). The Kristensen, N.P., Skalski, A.W. (1999). Phylogeny and palaeontology. In: Kristensen, N.P. CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment (Ed.), Handbuch der Zoologie Band IV Arthropoda: Insecta Part 35 Lepidoptera, aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Moths and Butterflies. Vol. 1: Evolution, Systematics and Biogeography. Walter de van Nieukerken, E.J., et al.(2011). Order Lepidoptera Linnaeus, 1758. Zootaxa 3148, 212–221. Gruyter Publishing, Berlin, New York, pp. 7–25. Wang, X.C., Sun, X.Y., Sun, Q.Q., Zhang, D.X., Hu, J., Yang, Q., Hao, J.S. (2011). Complete mito- Lagisz, M., Poulin, R., Nakagawa, S. (2013). You are where you live: parasitic nematode chondrial genome of the laced fritillary Argyreus hyperbius (Lepidoptera: Nymphalidae). mitochondrial genome size is associated with the thermal environment generated Zool.Res.32(5),465–475. by hosts. J. Evol. Biol. 26 (3), 683–690. Wang, Y., Huang, X.L., Qiao, G.X. (2013). Comparative analysis of mitochondrial genomes Lee, E.S., Shin, K.S., Kim, M.S., Park, H., Cho, S., Kim, C.B. (2006). The mitochondrial genome of five aphid species (Hemiptera: Aphididae) and phylogenetic implications. PLoS of the smaller tea tortrix Adoxophyes honmai (Lepidoptera: Tortricidae). Gene 373, One 8 (10), e77511. 52–57. Wei, S.J., Shi, M., Chen, X.X., Sharkey, M.J., Achterberg, C., Ye, G.Y., He, J.H. (2010). New views Li, W., Zhang, X., Fan, Z., Yue, B., Huang, F., King, E., Ran, J. (2011). Structural characteristics on strand asymmetry in insect mitochondrial genomes. PLoS One 5 (9), e12708. and phylogenetic analysis of the mitochondrial genome of the sugarcane borer, Wei, S.J., Shi, B.C., Gong, Y.J., Li, Q., Chen, X.X. (2013). Characterization of the mitochondrial Diatraea saccharalis (Lepidoptera: Crambidae). DNA Cell Biol. 30 (1), 3–8. genome of the diamondback moth Plutella xylostella (Lepidoptera: Plutellidae) and phy- Liao, F., Wang, L., Wu, S., Li, Y.P., Zhao, L., Huang, G.M., Niu, C.J., Liu, Y.Q., Li, M.G. (2010). logenetic analysis of advanced moths and butterflies. DNA Cell Biol. 32 (4), 173–187. The complete mitochondrial genome of the fall webworm, Hyphantria cunea (Lepidop- Wolstenholme, D.R. (1992). Animal mitochondrial DNA: structure and evolution. Int. Rev. tera: Arctiidae). Int. J. Biol. Sci. 6 (2), 172–186. Cytol. 141, 173–216. Liu, Y., Li, Y., Pan, M., Dai, F., Zhu, X., Lu, C., Xiang, Z. (2008). The complete mitochondrial Wu, Y.P., Zhao, J.L., Su, T.J., Li, J., Yu, F., Chesters, D., Zhu, C.D. (2012). The complete mitogenome of the Chinese oak silkmoth, Antheraea pernyi (Lepidoptera: Saturniidae). chondrial genome of Leucoptera malifoliella Costa (Lepidoptera: Lyonetiidae). DNA Acta Biochim. Biophys. Sin. 40 (8), 693–703. Cell Biol. 31 (10), 1508–1522. Liu, Q.N., Zhu, B.J., Dai, L.S., Wei, G.Q., Liu, C.L. (2012). The complete mitochondrial genome Wu, Q.L., Gong, Y.J., Gu, Y., Wei, S.J. (2013). The complete mitochondrial genome of the of the wild silkworm moth, Actias selene. Gene 505 (2), 291–299. beet armyworm Spodoptera exigua (Hübner) (Lepodiptera: Noctuidae). Mitochondri- Liu, Q.N., Zhu, B.J., Dai, L.S., Liu, C.L. (2013). The complete mitogenome of Bombyx mori al DNA 24 (1), 31–33. strain Dazao (Lepidoptera: Bombycidae) and comparison with other lepidopteran in- Wuyts, J., Perrière, G., Van de Peer, Y. (2004). The European ribosomal RNA database. sects. Genomics 101 (1), 64–73. Nucleic Acids Res. 32 (Suppl. 1), D101–D103. Lobry, J.R. (1995). Properties of a general model of DNA evolution under no-strand-bias Yang, L., Wei, Z.J., Hong, G.Y., Jiang, S.T., Wen, L.P. (2009). The complete nucleotide se- conditions. J. Mol. Evol. 40, 326–330. quence of the mitochondrial genome of Phthonandria atrilineata (Lepidoptera: Lowe, T.M., Eddy, S.R. (1997). tRNAscan-SE: a program for improved detection of transfer Geometridae). Mol. Biol. Rep. 36, 1441–1449. RNA genes in genomic sequence. Nucleic Acids Res. 25, 955–964. Yang, X.S., Xue, D.Y., Han, H.X. (2013). The complete mitochondrial genome of Biston Lu, C., Liu, Y.Q., Liao, S.Y., Li, B., Xiang, Z.H., Han, H., Wang, X.G. (2002). Complete sequence panterinaria (Lepidoptera: Geometridae), with phylogenetic utility of mitochondrial determination and analysis of Bombyx mori mitochondrial genome. J. Agric. Biotechnol. genome in the Lepidoptera. Gene 515, 349–358. 10, 163–170. Yin, J., Hong, G.Y., Wang, A.M., Cao, Y.Z., Wei, Z.J. (2010). Mitochondrial genome of the cot- Lydeard, C., Holznagel, W.E., Schnare, M.N., Gutell, R.R. (2000). Phylogenetic analysis of ton bollworm Helicoverpa armigera (Lepidoptera: Noctuidae) and comparison with molluscan mitochondrial LSU rDNA sequences and secondary structures. Mol. other Lepidopterans. Mitochondrial DNA 21 (5), 160–169. Phylogenet. Evol. 15 (1), 83–102. Yukuhiro, K., Sezutsu, H., Itoh, M., Shimizu, K., Banno, Y. (2002). Significant levels of se- Mao, Z.H., Hao, J.S., Zhu, G.P., Hu, J., Si, M.M., Zhu, C.D. (2010). Sequencing and analysis of quence divergence and gene rearrangements have occurred between the mitochon- the complete mitochondrial genome of Pieris rapae Linnaeus (Lepidoptera: Pieridae). drial genomes of the wild mulberry silkmoth, Bombyx mandarina, and its close Acta Entomol. Sin. 53 (11), 1295–1304. relative, the domesticated silkmoth, Bombyx mori. Mol. Biol. Evol. 19, 1385–1389. Misof, B., Fleck, G. (2003). Comparative analysis of mt LSU rRNA secondary structures of Zhang, D.X., Hewitt, F.M. (1997). Insect mitochondrial control region: a review of its struc- Odonates: structural variability and phylogenetic signal. Insect Mol. Biol. 12, 535–547. ture, evolution and usefulness in evolutionary studies. Biochem. Syst. Ecol. 25, 99120. Niehuis, O., Naumann, C.M., Misof, B. (2006a). Identification of evolutionary conserved Zhang, D.X., Szymura, J.M., Hewitt, G.M. (1995). Evolution and structural conservation of structural elements in the mt SSU rRNA of Zygaenoidea (Lepidoptera): a comparative the control region of insect mitochondrial DNA. J. Mol. Evol. 40, 382–391. sequence analysis. Org. Divers. Evol. 6, 17–32. Zhang, Z.L., Li, S.J., Li, S., Wang, S.L. (2011). Artificial mass propagation techniques of Niehuis, O., Yen, S.H., Naumann, C.M., Misof, B. (2006b). Higher phylogeny of zygaenid Apocheima cinerarius nuclear polyhedrosis virus. Forest Pest Dis. 30 (4), 26–28. moths (Insecta: Lepidoptera) inferred from nuclear and mitochondrial sequence Zhang, M., Nie, X., Cao, T., Wang, J., Li, T., Zhang, X., Guo, Y., Ma, E., Zhong, Y. (2012). The data and the evolution of larval cuticular cavities for chemical defence. Mol. complete mitochondrial genome of the butterfly Apatura metis (Lepidoptera: Phylogenet. Evol. 39, 812–829. Nymphalidae). Mol. Biol. Rep. 39 (6), 6529–6536. Page, R.D.M. (2000). Comparative analysis of secondary structure of insect mitochondrial Zhao, J.L., Zhang, Y.Y., Luo, A.R., Jiang, G.F., Cameron, S.L., Zhu, C.D. (2011). The complete small subunit ribosomal RNA using maximum weighted matching. Nucleic Acids Res. mitochondrial genome of Spilonota lechriaspis Meyrick (Lepidoptera: Tortricidae). 28, 3839–3845. Mol. Biol. Rep. 38 (6), 3757–3764.