The Influence of Geological Movements on the Population

Journal of Biogeography (J. Biogeogr.) (2016) 43, 691–702

ORIGINAL The inﬂuence of geological movements ARTICLE on the population differentiation of Biston panterinaria (Lepidoptera: Geometridae) Rui Cheng1,2, Nan Jiang1, Xiushuai Yang1, Dayong Xue1, Shuxian Liu1,2 and Hongxiang Han1*

1Key Laboratory of Zoological Systematics and ABSTRACT Evolution, Institute of Zoology, Chinese Aim East Asia is known for its exceptionally high levels of biodiversity, which Academy of Sciences, Beijing 100101, China, 2 is connected to its high level of species differentiation. Geological movements University of Chinese Academy of Sciences, Shijingshan District, Beijing 100049, China are the most important factor promoting the species differentiation in East Asia. In this paper, we choose Biston panterinaria, a moth species widely distributed in East Asia, to study the relative contributions of geographical isolation and glaciation cycles to its current genetic constitution.

Location East Asia. Methods Phylogenetic analyses were based on three data sets. beast was used to estimate the divergence time and reconstruct the maximum clade credibility tree. Mismatch distribution and Bayesian skyline plots (BSP) were used to infer historical population ﬂuctuations. maxent was used to predict the potential species distributions during two periods: the present day and the Last Glacial Maximum (LGM).

Results The phylogenetic tree and the median joining network strongly supported four reciprocally monophyletic lineages: northern, Yunnan-Tibet, southern and Yunnan-SE. The estimates of divergence time suggested that three differentiation processes occurred at approximately 1.17, 0.76 and 0.67 Ma. Within the northern and southern lineages, lineage divergence occurred at approximately 0.17 and 0.16 Ma. Mismatch distribution and BSP suggested that the northern and southern lineages experienced one expansion after the LGM, and this result was consistent with the result of the ecological niche model.

Main conclusions Our results suggested that B. panterinaria experienced three fragmentations of wide-ranging ancestral populations, and that mountain barrier isolation induced by geological movements is the main driver of lineage differentiation. Climatic oscillations during the Pleistocene affected the population differentiation within both the northern and southern lineages. The distribution of the four lineages of B. panterinaria is generally consistent with the zoogeographical regionalization of China. This study provides direct evidence for the importance of mountain barriers in promoting population differentiation.

*Correspondence: Hongxiang Han, Institute of Keywords Zoology, Chinese Academy of Sciences, No. 1 East Asia, ecological stability, Gaoligong Mountains, Himalaya-Hengduan Beichen West Road, Chaoyang District, Beijing Mountains, Kunlun-Yellow River Movement, mountain barrier, penultimate 100101, China. E-mail: [email protected] glaciation

and simplest types of speciation in animals (Mayr, 1942, INTRODUCTION 1970; Futuyma & Mayer, 1980). Geographical isolation sepa- It has been widely accepted that allopatric speciation (specia- rates populations, prevents gene ﬂow, and produces genetic tion by geographical isolation) is one of the most important differentiation, which results in the evolution of new species.

ª 2015 John Wiley & Sons Ltd http://wileyonlinelibrary.com/journal/jbi 691 doi:10.1111/jbi.12676 R. Cheng et al.

Examples of allopatric speciation can be found in almost all glaciations in East Asia (Shi et al., 2006; Zhou et al., 2006). animal groups, such as mammals (Ci et al., 2009), birds (Qu The development of both modern and Quaternary glacia- et al., 2014), frogs (Che et al., 2010) and butterflies (Habel tions was reliant on mountains, and the coupling of the et al., 2008). Geographical barriers may comprise many types mountain uplift and a global cooling was the ultimate cause of geological features, including mountains, rivers, straits and of glacier development around the QTP and its surrounding deserts. Mountain barriers may play a particularly important mountains (Shi et al., 2006; Zhou et al., 2006). Glacial role in shaping animal communities in East Asia by promot- oscillations are also an important factor affecting species ing speciation and maintaining high levels of endemism differentiation and the present distribution of several plants (Zhao et al., 2007; Ci et al., 2009; Huang et al., 2010; Lei and animals (Hewitt, 1996, 2004), particularly in central et al., 2015). and eastern China, where isolation due to geographical bar- The Himalaya-Hengduan Mountains (HHM) are the riers is not a factor. most important mountain system in China and are consid- The drivers of diversification for species living at different ered the ‘evolutionary powerhouse’ of Chinese avifauna (Li, altitudes are often different. Species living at high altitudes 1988; Zhao et al., 2007; Lei et al., 2015). Several previous appear to have experienced colonization via dispersal fol- studies have confirmed that geographical isolation with lowed by isolation and divergence. In contrast, species living mountain barriers was responsible for the lineage diversifi- at low altitudes appear to have experienced fragmentation of cation of multiple intra-specific genetic lineages of several wide-ranging ancestral populations (Lu et al., 2012). There bird species in the Hengduan Mountains (Lei et al., 2007; are many studies examining how species living at different Song et al., 2009; Qu et al., 2014). The complex topogra- altitudes cope with geological movements and climatic fluc- phy and glacial oscillations may have contributed to shap- tuations (Kullman, 1987; Lu et al., 2012; Qu et al., 2014). ing the high genetic diversity and endemism of the HHM The primary aim of this study is to explore how geographical (Rahbek & Graves, 2000; Fjeldsa et al., 2012). Previous events are responsible for population differentiation of spe- studies have shown that Pleistocene glaciations were cies living at low altitudes. For this study, we selected Biston restricted to high altitudes (> 2000 m) around the HHM, panterinaria (Bremer & Grey, 1853), a moth species with a unlike the situation in nearby central China, which was wide distribution at low altitudes, typically below 1500 m, extensively covered in ice (Li et al., 1991; Liu et al., 2002). through East and South Asia (including the HHM, central Apart from glaciation factors, the HHM constitute an ideal and eastern China), similar to the distribution of its host natural area for studying speciation and population differ- broad leaved trees (Liu, 1981; Li et al., 2008a). Biston pan- entiation by geographical isolation, particularly for species terinaria has many intraspecific morphological variations, living at low altitudes (Craw et al., 2008). Among the vari- involving for instance wing markings and male genitalia ous constituents of the HHM, the Gaoligong Mountains (Sato, 1996; Jiang et al., 2011). (GLGM), which constitute the extreme western section of the Hengduan Mountains, may play a particularly impor- MATERIALS AND METHODS tant role in driving species differentiation in the HHM. However, research testing this hypothesis is lacking, with Sampling and sequence data the exception of some studies on the species richness of different altitudes and slopes of the GLGM (Xu et al., A total of 271 specimens of B. panterinaria were collected 2001a,b; Li et al., 2008b). from 56 sampling sites throughout much of the distribution The HHM, an important part of the Qinghai-Tibet Pla- range of this species. We pooled the 56 sampling sites into teau (QTP), were formed by a series of geological move- 28 geographical locations (the abbreviations of sampling ments, which resulted in the strong uplift of the whole sites, see Appendix S1 in Supporting Information and QTP over the past 3.6 Myr (Li & Fang, 1998; Li, 1999). Fig. 1). Samples for DNA extraction were preserved in 100% The QTP region had an altitude of approximately 1000 m ethanol and stored at 20 °C. DNA was extracted using the before the Pliocene (Li et al., 1979) and experienced a DNeasy Tissue kit (Qiagen, Beijing, China) and vouchers strong uplift caused by the Himalayan Orogeny during the were deposited at the Museum of IZCAS (the Institute of Pliocene. During the strong uplift of the QTP, three main Zoology, Chinese Academy of Sciences, Beijing, China). geological movements took place: the Qinghai-Tibet Move- Three mitochondrial and three nuclear genes were obtained, ment (3.6–1.4 Ma), the Kunlun-Yellow River Movement including COI, CYTB, 16S, EF-1a, wg and ITS2 genes, (1.2–0.6 Ma) and the Gonghe Movement (0.15–0 Ma) (Li, through Polymerase Chain Reaction (PCR) amplification. 1999; Zhao et al., 2011). Each movement played an impor- The three mtDNA loci were amplified as described in Yang tant role in shaping the terrain of the plateau and promot- et al. (2013). The three nuDNA loci, were amplified as ing species differentiation, for instance, the Qinghai-Tibet described in Yamamoto & Sota (2007), Brower & DeSalle Movement, is thought to have led to the emergence of (1998) and Ji et al. (2003). Sequences of all primers used in Homo habilis and the speciation of three ancient elephants this study are listed in Table 1. Sequences were deposited in (Vrba, 1985; Wang et al., 2013). Geological movements in GenBank; the accession numbers are provided in the QTP were also essential for shaping the Quaternary Appendix S1.

692 Journal of Biogeography 43, 691–702 ª 2015 John Wiley & Sons Ltd The population differentiation of Biston panterinaria

Figure 1 Sampling sites of B. panterinaria. Colours represent different lineages and shape sizes represent different sample sizes. GLGM, Gaoligong Mountains; QLM, Qinling Mountains; DBM, Dabie Mountain.

Table 1 Sequences of PCR primers.

Region Primer pairs Sequence (forward and reverse) 50 ? 30 Source

COI LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) COII-R ATAAAAGCATGAGCTGTTACAATGG This study CYTB CP1 GATGATGAAATTTTGGATC Sezonlin et al. (2006) TRS TATTTCTTTATTATGTTTTCAAAAC Simon et al. (1994) 16S 16S-F AACCAACCTGGCTTACACCGG This study MT36-R GATCAAATTAGAGCTTGTTGGAAAGT This study EF-1a EF1alepF2 ACAAATGCGGTGGTATCGACAA Yamamoto & Sota (2007) EF1aR GATTTACCRGWACGACGRTC Kawakita et al. (2004) wg Wg-a CGGTGAGGCACAGGGTCGTT This study Wg-b GCAACAGGCACCCATTCG This study ITS2 NG02955 ATGAACATCGACATTTCGAACGCACAT Ji et al. (2003) AB052895 TTCTTTTCCTCCGCTTAGTAATATGCTTAA

replications of random sequence addition, tree bisection- Phylogenetic analyses reconnection (TBR) branch swapping, multrees option in Phylogenetic relationships were reconstructed based on three effect, steepest descent option not in effect. Relative node data sets (mtDNA genes, nuDNA genes and genes combined) support was estimated by a ML bootstrap analysis of 100 and inferred with Bayesian inference (BI) using mrbayes replicates of heuristic searches with settings as above, except 3.1.2 (Huelsenbeck & Ronquist, 2001) and maximum likeli- for 10 sequence addition replicates. hood (ML) analyses using paup* 4.0b10 (Swofford, 1993). We constructed haplotype networks for combined mtDNA For BI analysis, the best-fit model of nucleotide substitution sequence and each nuDNA sequence to better visualize the was selected for each gene using jModeltest 0.1.1 (Posada, nonbifurcating (multifurcations and reticulations) relation- 2008). Two independent parallel runs of four incrementally ships (Posada & Crandall, 2001). A maximum parsimony heated Metropolis-coupled Monte Carlo Markov Chains method implemented in tcs 1.23 (Clement et al., 2000), was (MCMCs) were run for 5 million or more generations, with used to draw an unrooted network to evaluate the haplotype trees sampled every 1000 generations, until the average stan- relationships for the mtDNA and the nuDNA sequences with dard deviation of the split frequencies was below 0.01. The 95% parsimoniously plausible branch connections. first 10% of generations was discarded as burn-in when sum- The maximum clade credibility tree from divergence-time- marizing tree results. Convergence of the MCMC results was rooted phylogenetic analyses of B. panterinaria was estimated verified in Tracer 1.5 (Rambaut & Drummond, 2009). For using beast 1.8.0 (Drummond & Rambaut, 2007) based on ML analyses, the model of nucleotide substitution was con- mtDNA and two nuDNA genes. Major clades were each consistent with the BI analyses. Optimal ML trees were obtained strained to be monophyletic. Because no fossil or geological by means of heuristic tree searches with parameter estimates evidence was available for calibration, we used the widely derived from Modeltest and the following settings: 100 accepted lepidopteran molecular clock of the COI gene

Journal of Biogeography 43, 691–702 693 ª 2015 John Wiley & Sons Ltd R. Cheng et al.

(0.0115 per site per million years, Brower, 1994); other genes the goal of modelling the impacts of Pleistocene climatic were scaled to the COI rate in beast. Each gene was assigned oscillations on species distributions. Because we could not a separate unlinked relaxed clock model in the analysis. obtain climatic data from the penultimate glaciation, we Default priors were used. Chains were analysed for 200 mil- used climatic data from the LGM. If changes in distribu- lion generations, with sampling every 2000 generations. tion are correlated with climatic changes, the distribution Tracer 1.5 was used to verify the posterior distribution and of B. panterinaria would be expected to have changed to a the effective sample sizes (ESSs) from the MCMC output. similar degree during the LGM as it did during the past We used Treeannotator 1.8.0 in the BEAST package to glacial periods (Carstens & Richards, 2007; Qu et al., summarize tree data with ‘mean height’ and discarded the 2012). ﬁrst 25% of trees as the ‘burn-in’ period, which ended well The ecological niche model was constructed using the after the stationarity of the chain likelihood values were maximum entropy machine learning algorithm in maxent established. The tree and divergence time are displayed in (Phillips et al., 2006), which has been shown to perform well FigTree 1.3.1. compared with alternative modelling methods and is robust for low sample sizes. A distribution was generated using 19 climatic variables from the WorldClim database at 2.5-min Population genetic analyses resolution for the current climate (Hijmans et al., 2005), To assess how genetic diversity varied across geographical with an estimate based on 80 collecting localities from populations, we calculated the following summary statistics museum records. LGM climate data were simulated from based on combined mtDNA sequence data sets. Haplotype two models: the Community Climate System Model (CCSM) diversity (h), nucleotide diversity (p) and the mean number and the Model for Interdisciplinary Research on Climate of pairwise differences were calculated to estimate DNA poly- (MIROC). The models were each run in ten replicates with morphism using Dnasp 5.10.01 (Librado & Rozas, 2009). default settings. Binomial tests of omission were conducted

Analysis of molecular variance (AMOVA) and FST calcula- by randomly selecting 30% of localities as test data. The out- tions were performed using Arlequin 3.5 (Excofﬁer & put of maxent consists of grid maps with each cell having Lischer, 2010) with 10,000 permutations, based only on pop- an index of suitability between 0 and 1. Model performance ulations that contained more than three individuals. was evaluated by averaging the area under the curve (AUC) values for the receiver operating characteristic (ROC) curves over ten replicate runs. Demographic history

Signatures of population demographic changes were tested RESULTS for four lineages based on combined mtDNA genes respectively. Tajima’s D (Tajima, 1989) and Fu’s F (Fu, 1997) S Phylogenetic relationships and estimation of statistics were used to assess whether nucleotide polymor- divergence time phisms deviated from expectations under neutral theory in arlequin. Mismatch distributions of pairwise sequences The phylogenetic analyses of mtDNA genes and combined were calculated using arlequin with 1000 bootstrap repli- genes (three mtDNA and two nuDNA genes; Fig. 2 and cates. The unimodal mismatch distributions with small Appendix S2a) revealed distinct geographical structure in Harpending’s raggedness (Hr) index would indicate recent B. panterinaria, and grouped the samples into four recipro- demographic expansion or a range expansion with high levels cally monophyletic lineages (northern, southern, Yunnan- of migration between neighbouring demes. If the data do Tibet and Yunnan-SE lineages) that corresponded roughly to not ﬁt this pattern, the population may be considered to be the different geographical regions. The northern lineage stable. Bayesian skyline plots (BSP) implemented in beast included individuals from parts of northern China to the were used to estimate population size changes through time. south Qinling-Dabie Mountains (including sampling sites of For each BSP, the substitution model was selected using LN, BJ, SD, SX, QL, HeN, DB and HB) and several southern jModeltest. Samples were drawn every 1000 steps for 50 regions (including WX, ZJ, JX, WY, GD, SC and ME). The million steps under an uncorrelated lognormal relaxed clock Yunnan-Tibet lineage included individuals from the eastern model. The mutation rate was set to 0.0115 per site per mil- slope of the GLGM, Zayu€ and M^edog County of Tibet. The lion years (Brower, 1994). Demographic plots were visualized southern lineage included individuals from the entire south in Tracer 1.5, with a burn-in of 20%. of China (including WX, ZJ, SN, CQ, SC, GZ, HN, ME, NG, JX, WY, MH, GD and HI). The Yunnan-SE lineage included individuals from the western slope of the GLGM and South Historical biogeography and ecological niche Asia (Nepal). The northern and southern lineages have over- modelling lapping ranges in southern China (including ZJ, WX, WY, An ecological niche model was constructed to estimate the ME, GD and SC). The phylogenetic analyses based on potential distributions of B. panterinaria in the present and nuDNA genes (see Appendix S2b,c) also supported the inde- during the Last Glacial Maximum (LGM, 0.021 Ma), with pendence of four lineages in general. However, the topology

694 Journal of Biogeography 43, 691–702 ª 2015 John Wiley & Sons Ltd The population differentiation of Biston panterinaria

haplotypes, which included 109, 21 and 11 individuals respectively. In the wg haplotype network, the northern lineage and Yunnan-Tibet lineage shared one haplotype, which included 4 individuals. For the three nuDNA haplotype networks, no single haplotype was found in all four lineages and each lineage has its own unique haplotypes. This result suggested that the four lineages are also divergent to some extent in nuDNA gene, although less than in mtDNA gene. The maximum clade credibility tree of B. panterinaria in BEAST based on all mtDNA and two nuDNA loci showed similar results to the BI and ML trees except as regards the relationship within the northern and southern lineages. The maximum clade credibility tree showed subpopulation differentiation within the northern and southern lineages at almost the same time respectively. Divergence time dating (Fig. 4) indicated that divergence within B. panterinaria happened several times. The first divergence occurred between Lineage I and Lineage II at approximately 1.17 Ma [0.97–1.35 Ma, 95% highest posterior density (HPD)]. The second divergence was between the southern lineage and the Yunnan-SE lineage at approxi- Figure 2 (a) Median joining network based on mitochondrial mately 0.76 Ma (0.60–0.91 Ma, 95% HPD). The third diver- DNA (mtDNA) for B. panterinaria. Each circle represents a gence occurred between the northern lineage and the haplotype, and the size of the circle is proportional to that Yunnan-Tibet lineage approximately at 0.67 Ma (0.52– haplotype’s frequency. Dots represent unsampled haplotypes and dashes represent the corresponding mutational steps. Colours 0.81 Ma, 95% HPD). All three dates fell within the time denote lineage membership and are the same as in Fig. 1. (b) frame for the Kunlun-Yellow River Movement. The last Bayesian tree based on combined mtDNA genes for divergences within the northern and southern lineages were B. panterinaria. Values on the left of nodes indicate posterior shown to have occurred relatively briefly at 0.16 Ma (0.10– probabilities and bootstrap supports of BI/ML for major clades. 0.18 Ma, 95% HPD) and 0.17 Ma (0.11–0.20 Ma, 95% HPD), respectively, which were roughly congruent with the of three nuDNA genes has some differences with that of two penultimate glaciation (0.14–0.33 Ma). nuDNA genes (ITS2 excluded). Polymorphic sites of mtDNA data sets defined 54 haplo- Genetic diversity types, 27 of which were each found in a single individual. The most abundant haplotype was shared by 45 individuals We obtained 3675 bp mitochondrial genes and 2142 bp distributed in the south of China. The median-joining net- nuclear genes for B. panterinaria, including COI (1464 bp), work analysis corroborated the split of four lineages in phy- CYTB (1001 bp),16S(1210 bp), EF-1a (939 bp), wg logenetic trees (Fig. 2). No haplotype was found to be shared (739 bp) and ITS2 (464 bp) genes. In the entire mtDNA by all four lineages. In the northern and southern lineages, alignment, 410 sites were variable, and 197 were parsimony several of the most abundant haplotypes were present in informative. Values for haplotype (h) and nucleotide most samples with loop connections between them, indicat- diversity (p) of the Yunnan-SE lineage were highest (h, 1; p, ing frequent gene flow within lineages. 0.00287), followed in turn by the northern, southern and In the EF-1a and ITS2 haplotype networks (Fig. 3), the Yunnan-Tibet lineages (Table 2). The AMOVA analyses southern lineage and Yunnan-SE lineage shared one and two based on the combined mtDNA alignment revealed

Figure 3 Networks of three nuclear sequence loci. Each circle represents a haplotype, and the size of the circle is proportional to that haplotype’s frequency. Dots represent unsampled haplotypes and dashes represent the corresponding mutational steps. Colours are coded as in Fig. 1.

Journal of Biogeography 43, 691–702 695 ª 2015 John Wiley & Sons Ltd R. Cheng et al.

Figure 4 The maximum clade credibility tree from divergence-time-rooted phylogenetic analysis of B. panterinaria based on three mtDNA and two nuDNA loci (EF-1a and wg). Posterior probabilities of clade support are shown at nodes above branches. Estimates of divergence time with 95% conﬁdence intervals are shown at nodes as purple bars and numbers below branches.

Table 2 Summary of genetic diversity includes sample size (N), the number of haplotypes (nh), nucleotide diversity (p), haplotype diversity (h), average number of nucleotide differences (k), Fu’s FS and Tajima’s D. **P < 0.01.

Group N nh p h K Fu’s FS Tajima’s D

Northern 114 28 0.00146 0.534 2.643 16.724 1.13241 Southern 118 21 0.00079 0.799 1.467 14.974** 1.49127 Yunnan-Tibet 15 6 0.00067 0.762 7.667 0.274 0.42099 Yunnan-SE 4 4 0.00287 1 2.457 0.017 0.64018

signiﬁcant genetic differentiation among all populations of B. 0.967. The binomial probabilities (P 0.0001) for the ele- panterinaria (FST = 0.82). The average FST values for north- ven common thresholds also showed that the predictions ern, southern, Yunnan-Tibet and Yunnan-SE lineages were were substantially better than those obtained using a ran- 0.41, 0.28, 0.89 and 0.93 respectively. Most variation was dom model. Because the distribution of Yunnan-SE and accounted for by variation among all four lineages (76.76%), Yunnan-Tibet lineages (around the HHM) showed few followed by variation between different populations (17.07%) changes during the present day and LGM, we primarily dis- and variation within lineage (6.17%). cuss the distributions of northern and southern lineages (central and eastern China). The respective present-day distributions of the northern and southern lineages were larger Demographic history than potential distributions during the LGM, which mean The four lineages, mostly had negative but not signiﬁcant that these two lineages underwent one expansion after the

Tajima’s D and Fu’s FS values, the only exceptions were the glaciers. Compared with the present day, the potential distri- southern (Fu’s FS: signiﬁcantly negative) and Yunnan-SE bution during the LGM showed obvious fragmentation: the

(Fu’s FS: positive) lineages (Table 2). Mismatch distributions southern distribution was generally divided into eastern and for northern and southern lineages were unimodal, and those western parts; some areas, such as Shanxi, Beijing, Shandong for the Yunnan-SE and Yunnan-Tibet lineages were multi- and Liaoning, were separated from the rest of the northern modal (Fig. 5). The BSP analyses rejected population stability distribution. in the northern and southern lineages, but could not reject population stability in the Yunnan-SE and Yunnan-Tibet lin- DISCUSSION eages (Fig. 5). Respective expansion within the northern and southern lineages occurred after the LGM. Population differentiation history

For B. panterinaria, the phylogenetic analyses supported Historical distribution change reciprocal monophyly for four major lineages: the northern, The ecological niche model for B. panterinaria (Fig. 6) had southern, Yunnan-Tibet and Yunnan-SE lineages. Although high predictive power with an average training AUC of the nuDNA genes had fewer variable sites and a slower

696 Journal of Biogeography 43, 691–702 ª 2015 John Wiley & Sons Ltd The population differentiation of Biston panterinaria

Figure 5 Mismatch distributions (left) and Bayesian skyline plots (right). (a) The northern lineage, (b) the southern lineage, (c) Yunnan-Tibet and (d) Yunnan-SE lineage were each calculated based on the concatenated mtDNA sequences. The observed mismatch distribution is denoted by vertical bars, and the expected distribution under the population expansion model is represented by red lines. Harpending’s raggedness (HR) indices are shown. For Bayesian skyline plots, the mean estimate is enclosed within the 95% highest posterior densities. LGM, the Last Glacial Maximum. evolutionary rate than mtDNA genes, phylogenetic analyses barriers in lineage diversification of multiple intra-specific based on these genes were consistent with the results on genetic lineages in the HHM (Lei et al., 2015). Our study mtDNA genes and supported independence for four lineages tested this hypothesis from the perspective of lepidopteran in general (Fig. 3 and Appendix S2b,c). The topology of the insects. three nuDNA genes shows some differences from that of the In this study, three gradual population differentiation two nuDNA genes (ITS2 excluded), and this maybe because events are demonstrated in the evolution of B. panterinaria, the large variation in the noncoding gene (ITS2) resulted in these are consistent with the interpretation of geographical the unbalance of the combined nuDNA genes. Except for the isolation by the formation of mountains. This species maybe northern and southern lineages, which partially overlap in once widespread in East and South Asia, but its distribution southern China, the four lineages are allopatric (Fig. 1). The became fragmented following geological changes in this evolutionary history of B. panterinaria is best explained by region during the Pliocene and Pleistocene. The three differ- gradual allopatric differentiation induced by isolation as a entiation events in the evolutionary history of B. panterinaria result of mountain formation. This interpretation is consis- occurred at approximately 1.17, 0.76 and 0.67 Ma respec- tent with the finding that species at low altitudes appear to tively. All three population differentiation events occurred have experienced fragmentation of wide-ranging ancestral around the Himalaya-Hengduan region. Considering the dis- populations (Lu et al., 2012). Mountain barriers may play a tribution range of the four lineages, the three geographical key role in speciation and diversification, because their topo- barriers may be the GLGM, the Yunnan Plateau and the graphic complexity can lead to ecological stratification and Hengduan Mountains (near Sichuan and Gansu) respectively. environmental heterogeneity (Fjeldsa et al., 2012). Based on This study suggests a model of QTP affecting population dif- previous studies of birds, the ‘mountain barrier hypothesis’ ferentiation through geographical isolation and is consistent was proposed to explain the importance of mountain with for the ‘mountain barrier hypothesis’ (Lei et al., 2015).

Journal of Biogeography 43, 691–702 697 ª 2015 John Wiley & Sons Ltd R. Cheng et al.

were important factors in promoting population subdivision within the northern and southern lineages of B. panterinaria. This result is consistent with previous studies (Rahbek & Graves, 2000; Fjeldsa et al., 2012). After the glaciers, all of the subpopulations of the northern and southern lineages spread widely, which resulted in frequent gene flow among different subpopulations. By virtue of the influence of several glaciation cycles, the level of differentiation is low, and the gene tree could not reveal any geographical structure within the northern and southern lineages. In the face of Quaternary climatic oscillations, the Yun- nan-SE and Yunnan-Tibet lineages were more stable when compared with northern and southern lineages (the result of demographic history and ecological niche model, Figs 5 & 6). Similar results were also found in other organisms, such as birds (Lei et al., 2007), mammals (Wu et al., 2005), spiders (Meng et al., 2008) and aphids (Huang et al., 2010). The most plausible reason is that mountain areas at such low latitudes can provide relatively stable environmental con- ditions, which is the ‘ecological stability hypothesis’ (Qu Figure 6 Ecological niche modelling for B. panterinaria during et al., 2014; Lei et al., 2015). Another important factor was the present-day and the LGM. Circles represent the localities the above-mentioned ‘mountain barrier hypothesis’. Moun- used to build the ecological niche model. Different colours tain systems in the HHM confined species to pockets of correspond to different fitting indices with low in blue and high in red. stable habitats and restricted dispersal between them, which, in turn, contributed to high genetic diversity in this region (Lei et al., 2015). Altogether, a complex combination of The uplift of the QTP resulted in the evolution of many new mountain systems (mountain barrier hypothesis) and ecolog- species and subspecies by geographical isolation and gave this ical stability (ecological stability hypothesis) contributes to region very high level of biodiversity (Huang, 1981; Zhang, the high diversity of the HHM. 1999; Lei et al., 2007, 2015). For species such as B. panterinaria, adapted to low altitudes, the uplift promoted popula- Related geological movements tion division in two ways: a decrease of suitable habitat resulted in reduced and fragmented distribution, and limita- The divergence time estimation (Fig. 4) shows that the diver- tions in available routes for dispersal resulted in a sharp gence times of lineage differentiation in B. panterinaria are reduction in gene flow (Gilpin & Soule, 1986; Reed, 2004). approximately 1.17, 0.76 and 0.67 Ma respectively. These Lacking suitable habitat at high altitudes in the HHM, three differentiation events occurred during the Kunlun-Yel- B. panterinaria cannot survive in this region, resulting in a low River Movement (Cui et al., 1997). After this movement, disjunct distribution. After being separated, the four lineages the QTP entered the cryosphere and the maximum glaciation evolved independently, which appears to be the fundamental arose. The Kunlun-Yellow River Movement resulted in mul- cause of the genetic variation between the northern and tiple differentiation events of endemic species in the HHM, southern lineages. such as Niviventer and Apodemus draco (Jing et al., 2007; Although the BI and ML trees did not reveal phylogenetic Fan et al., 2012). In our study, the Kunlun-Yellow River relationships, the maximum clade credibility tree from the Movement is also a key event in shaping the population dif- divergence-time-rooted phylogenetic analysis of B. panteri- ferentiation of B. panterinaria by the formation of three naria supports the subpopulation differentiations recovered mountain barriers. within the northern and southern lineages (Figs 2 & 4). In The divergence times within the northern and southern the absence of continuous geographical barriers both in cen- lineages of B. panterinaria are estimated to be approximately tral and eastern China, the most plausible reason for the dif- 0.17 and 0.16 Ma respectively (Fig. 4). These two dates cor- ferentiation is glaciation. During the glaciation at respond to the penultimate glaciation, which is equivalent to approximately 0.17 Ma, the northern and southern lineages MIS (Marine Oxygen Isotope Stage) 6–10 (Yi et al., 2005). went through one similar population differentiation event The glaciation divided each of the northern and southern and were divided into two subpopulations. The results of lineages into two subpopulations. In previous studies, this ecological niche model and demographic history analyses glaciation has been considered to be an important event in revealed that the northern and southern lineages went the evolutionary history of many birds (Song et al., 2009; Qu through rapid expansion after the LGM. It is reasonable to et al., 2012) and plants (Qiu et al., 2009). In contrast to the think that climatic fluctuations, especially glaciation cycles, situation in Europe and North America (Hewitt, 1996,

698 Journal of Biogeography 43, 691–702 ª 2015 John Wiley & Sons Ltd The population differentiation of Biston panterinaria

2004), the development of glaciers in East Asia is the result with this ﬁnding. In addition, some local researches based on of the combination of the uplift of the QTP and the global terrestrial vertebrates and amphibians also agree treating the glacial climate (Shi et al., 2006). The geological movements ‘Dulongjiang region of the GLGM’ as a part of the Himalaya most closely related to the penultimate glaciation are the Subregion (Yang et al., 1992; Kuang et al., 2007). Therefore, Kunlun-Yellow River Movement and the Gonghe Movement we suggest treating the GLGM with the Bomi-Zayu€ region as (Cui et al., 1997, 1998; Li, 1999; Yi et al., 2005). Therefore, the boundary of the Himalaya and Southwest Subregion (see subpopulation differentiation within the northern and south- Appendix S3). On the other hand, the western areas of the ern lineages is also the indirect result of geological move- GLGM, south-eastern Tibet and the southern ﬂank of the ments. East Himalayas make up the Himalaya Subregion (a part of the eastern Himalaya region). Distribution patterns in response to biogeographical regionalization ACKNOWLEDGEMENTS

The China zoogeographical regionalization hypothesis was We gratefully thank all collectors for their assistance in Lepi- first proposed by Cheng & Zhang (1956) based on the distri- doptera collection. We thank Sir Anthony Galsworthy, The bution of terrestrial vertebrates, and it was widely accepted Natural History Museum, London, UK for giving valuable by most zoologists. The fauna based regionalization hypothe- comments on the research and correcting the English. This sis also had consequences for the interpretation of genetic work was supported by the National Science Foundation of structure at the population level, as occurred for Alcippe China (No. 31272288, 31372176, 31572301), the National morrisonia (Song et al., 2009). Because of the different bio- Science Fund for Fostering Talents in Basic Research (No. logical characteristics of vertebrates and invertebrates, includ- NSFC-J1210002) and a grant from the Key Laboratory of the ing dependence on host and dispersal ability, the distribution Zoological Systematics and Evolution of the Chinese Acad- patterns of insects are not strictly consistent with the China emy of Sciences (No. O529YX5105). zoogeographical regionalization hypothesis (Huang, 1981; Zhang, 1986; Chu, 1987). This study provides one example REFERENCES derived from insects that allows the consistency of the zoogeographical regionalization to be assessed. The southern lin- Brower, A.V.Z. (1994) Rapid morphological radiation and eage is located in the Central and South Region, and the convergence among races of the butterfly Heliconius erato northern lineage is located in the Northern Region and part inferred from patterns of mitochondrial DNA evolution. of the Central and South Region. The boundary between the Proceedings of the National Academy of Sciences USA, 91, southern and northern lineages, the Qinling-Dabie Moun- 6491–5495. tains, is the boundary between the Northern and Central Brower, A.V.Z. & DeSalle, R. (1998) Patterns of mitochon- Region (Zhang, 1999). The Yunnan-SE and Yunnan-Tibet drial versus nuclear DNA sequence divergence among lineages of B. panterinaria are located in the Southwest nymphalid butterflies: the utility of wingless as a source of Region (including the Himalaya Subregion and the South- characters for phylogenetic inference. Insect Molecular Biol- west Subregion). The Yunnan-Tibet lineage occupies the ogy, 7,73–82. Southwest Subregion and south-eastern Tibet of the Hima- Carstens, B. & Richards, C.L. (2007) Integrating coalescent laya Subregion. A similar distribution occurs in one bird spe- and ecological niche modelling in comparative phylogeog- cies, Parus monticolus (Qu et al., 2014). This common raphy. Evolution, 61, 1439–1454. species reveals the close relationship that existed between the Che, J., Zhou, W.W., Hu, J.S., Yan, F., Papenfuss, T.J., Wake, Himalaya Subregion and the Southwest Subregion (Zhang, D.B. & Zhang, Y.P. (2010) Spiny frogs (Paini) illuminate 1999). The widely accepted boundary between these two sub- the history of the Himalayan region and Southeast Asia. regions is the Bomi-Zayu€ region. Obviously, the GLGM, the Proceedings of the National Academy of Sciences USA, 107, junction of Hengduan Mountains and the eastern Himalaya 13765–13770. region and the south extension of the Bomi-Zayu€ region, are Cheng, Z.X. & Zhang, R.Z. (1956) On tentative scheme for very important geographical units in these two subregions. dividing zoogeographical regions of China. Acta Geograph- Generally, the entire GLGM is considered to belong to the ica Sinica, 22,93–109. Southwest Subregion. However, our study confirmed that the Chu, H.F. (1987) The theoretical basis of zoological taxonomy. population of the west slope of the GLGM is closer to the Shanghai Scientific and Technical Publishers, Shanghai. population of the East Himalaya region (represented in Ci, H.X., Lin, G.H., Cai, Z.Y., Tang, L.Z., Su, J.P. & Liu, J.Q. Nepal) than to that of the Southwest Subregion. By compar- (2009) Population history of the plateau pika endemic to ing seed plants between east and west slopes of the northern the Qinghai-Tibetan Plateau based on mtDNA sequence GLGM, Li et al. (2008b) concluded that the flora of the west data. Journal of Zoology, 279, 396–403. slope is more closely linked with that of the eastern Hima- Clement, M., Posada, D. & Crandall, K.A. (2000) TCS: a layas, and the flora of the east slope is more closely linked computer program to estimate gene genealogies. Molecular with that of the Yungui Plateau. Our study is concordant Ecology, 9, 1657–1659.

Journal of Biogeography 43, 691–702 699 ª 2015 John Wiley & Sons Ltd R. Cheng et al.

Craw, D., Burridge, C.P., Upton, P., Rowe, D.L. & Waters, Huang, X.L., Qiao, G.X. & Lei, F.M. (2010) Use of parsi- J.M. (2008) Evolution of biological dispersal corridors mony analysis to identify areas of endemism of Chinese through a tectonically active mountain range in New Zeal- birds: implications for conservation and biogeography. and. Journal of Biogeography, 35, 1790–1802. International Journal of Molecular Sciences, 11, 2097–2108. Cui, Z.J., Wu, Y.Q. & Liu, G.S. (1997) Findings and charac- Huelsenbeck, J.P. & Ronquist, F. (2001) Mrbayes, Bayesian teristics of Kun-Huang Movement. Chinese Science Bul- inference of phylogenetic trees. Bioinformatics, 17, 754– letin, 42, 1986–1989. 755. Cui, Z.J., Wu, Y.Q., Liu, G.N., Ge, D.K., Pang, Q.Q. & Xu, Ji, Y.J., Zhang, D.X. & He, L.J. (2003) Evolutionary conserva- Q.H. (1998) On Kunlun-Yellow River tectonic movement. tion and versatility of a new set of primers for amplifying Science in China: Series D, 28,53–59. the ribosomal internal transcribed spacer regions in insects Drummond, A.J. & Rambaut, A. (2007) BEAST: Bayesian and other invertebrates. Molecular Ecology Notes, 3, 581– evolutionary analysis by sampling trees. BMC Evolutionary 585. Biology, 7, 214. Jiang, N., Xue, D.Y. & Han, H.X. (2011) A review of Biston Excoffier, L. & Lischer, H.E.L. (2010) Arlequin suite ver 3.5: Leach, 1815 (Lepidoptera, Geometridae, Ennominae) from a new series of programs to perform population genetics China, with description of one new species. ZooKeys, 139, analyses under Linux and Windows. Molecular Ecology 45–96. Resources, 10, 564–567. Jing, M.D., Yu, H.T., Wu, S.H., Wang, W. & Zheng, X.G. Fan, Z.X., Liu, S.Y., Liu, Y., Liao, L.H., Zhang, X.Y. & Yue, (2007) Phylogenetic relationships in genus Niviventer B.S. (2012) Phylogeography of the South China field (Rodentia: Muridae) in China inferred from complete mouse (Apodemus draco) on the southeastern Tibetan Pla- mitochondrial cytochrome b gene. Molecular Phylogenetics teau reveals high genetic diversity and glacial refugia. PLoS and Evolution, 44, 521–529. ONE, 7, e38184. Kawakita, A., Takimura, A., Terachi, T., Sota, T. & Kato, M. Fjeldsa, J., Bowie, R.C.K. & Rahbek, C. (2012) The role of (2004) Cospeciation analysis of an obligate pollination mountain ranges in the diversification of birds. Annual mutualism: have Glochidion trees (Euphorbiaceae) and Review of Ecology, Evolution and Systematics, 43, 249–256. pollinating Epicephala moths (Gracillariidae) diversified in Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. parallel? Evolution, 58, 2201–2214. (1994) DNA primers for amplification of mitochondrial Kuang, F.L., Liu, N. & Feng, Z.S. (2007) Cluster analysis on cytochrome c oxidase subunit I from diverse metazoan geographical distribution of amphibians in Yunnan Pro- invertebrates. Molecular Marine Biology and Biotechnology, vince. Sichuan Journal of Zoology, 26, 445–447. 3, 294–299. Kullman, L. (1987) Long-term dynamics of high-altitude Fu, Y. (1997) Statistical tests of neutrality of mutations populations of Pinus sylvestris in the Swedish Scandes. against population growth, hitchhiking and background Journal of Biogeography, 14,1–8. selection. Genetics, 147, 915. Lei, F.M., Wei, G.A., Zhao, H.F., Yin, Z.H. & Lu, J.L. (2007) Futuyma, D.J. & Mayer, G.C. (1980) Non-allopatric specia- China subregional avian endemism and biodiversity con- tion in animals. Systematic Biology, 29, 254. servation. Biodiversity and Conservation, 16, 1119–1130. Gilpin, M.E. & Soule, M.E. (1986) Minimum viable popula- Lei, F.M., Qu, Y.H., Song, G., Alstrom, P. & Fjeldsa, J. tions: processes of species extinction. Conservation biology: (2015) The potential drivers in forming avian biodiversity the science of scarcity and diversity (ed. by M.E. Soule), pp. hotpots in the east Himalaya-Mountains of southwest 13–34. Sinauer Associates, Sunderland, MA. China. Integrative Zoology, 10, 171–181. Habel, J.C., Meyer, M., Mousadik, A.E. & Schmitt, T. Li, D.J. (1988) The primary characteristics of flora in the (2008) Africa goes Europe: the complete phylogeography Hengduan Mountainous regions. Mountain Research, 6, of the marbled white butterfly species complex Melanargia 147–152. galathea/M. lachesis (Lepidoptera: Satyridae). Organisms Li, J.J. (1999) Studies on the geomorphological evolution of Diversity & Evolution, 8, 121–129. the Qinghai-Xizang (Tibetan) Plateau and Asian monsoon. Hewitt, G. (1996) Some genetic consequences of ice ages, Marine Geology & Quaternary Geology, 19,1–11. and their role in divergence and speciation. Biological Jour- Li, J.J. & Fang, X.M. (1998) The uplift of Qinghai-Xizang nal of the Linnean Society, 58, 247–276. (Tibetan) Plateau and the studies of environmental Hewitt, G. (2004) Genetic consequences of climatic oscilla- changes. Chinese Science Bulletin, 43, 1569–1574. tions in the Quaternary. Philosophical Transactions of the Li, J.J., Wen, S.X., Zhang, Q.S., Wang, F.B., Zheng, B.X. & Royal Society B: Biological Sciences, 359, 183–195. Li, B.Y. (1979) The discussion about age, amplitude and Hijmans, R.J., Cameron, S.E., Parra, J.L., Jones, P.G. & Jarvis, form of the uplift of Qinghai-Tibet Plateau. Science in A. (2005) Very high resolution interpolated climate sur- China, 6, 608–616. faces for global land areas. International Journal of Clima- Li, Z.W., Chen, Z.R. & Wang, M.L. (1991) Classification and tology, 25, 1965–1978. correlation of the Quaternary glacial epoch in the Heng- Huang, F.S. (1981) Promontory of Tibet Plateau and insect duan (Transverse) Mountains. Geological Reviews, 37, 125– fauna. I. Science Press, Beijing, Insects of Xizang, Vol. 132.

700 Journal of Biogeography 43, 691–702 ª 2015 John Wiley & Sons Ltd The population differentiation of Biston panterinaria

Li, Q.S., Wang, X.H. & Wang, Q.L. (2008a) Biological char- Reed, D.H. (2004) Extinction risk in fragmented habitats. acteristics and controlling experiment of Biston panterinar- Animal Conservation, 7, 181–191. ia. Practical Forestry Technology, 8, 2829. Sato, R. (1996) Records of the Boarmiini (Geometridae; Li, R., Ji, Y.H., Dao, Z.L. & Li, H. (2008b) Comparative Ennominae) from Thailand 3. Transactions of the Lepi- study of seed flora between eastern and western slope of dopterological Society of Japan, 47, 223–236. northern Gaoligong Mountains. Acta Botanica Yunnanica, Sezonlin, M., Dupas, S., LeRu,€ B., LeGall, P., Moyal, P., Cala- 30, 129–138. tayud, P.A., Giffard, I. & Silvain, J.F. (2006) Phylogeogra- Librado, P. & Rozas, J. (2009) Dnasp v5: a software for phy and population genetics of the maize stalk borer comprehensive analysis of DNA polymorphism data. Busseola fusca (Lepidoptera, Noctuidae) in sub-Saharan Bioinformatics, 25, 1451. Africa. Molecular Ecology, 15, 407–420. Liu, H.X. (1981) The vertical zonation of mountain vegeta- Shi, Y.F., Cui, Z.J. & Su, Z. (2006) The quaternary glaciations tion in China. Acta Geographica Sinica, 36, 267–279. and environmental variations in China. Hebei Science and Liu, J., Yu, G. & Chen, X. (2002) Paleoclimatic simulation of Technology Publishing House, Shijiazhuang. 21 ka for the Qinghai-Tibetan Plateau and eastern Asia. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. & Climate Dynamics, 19, 575–583. Flook, P. (1994) Evolution, weighting and phylogenetic Lu, B., Zheng, Y., Murphy, R.W. & Zeng, X. (2012) Coales- utility of mitochondrial gene sequences and a cence patterns of endemic Tibetan species of stream sala- compilation of conserved polymerase chain reaction pri- manders (Hynobiidae: Batrachuperus). Molecular Ecology, mers. Annals of the Entomological Society of America, 87, 21, 3308–3324. 651–701. Mayr, E. (1942) Systematics and the origin of species. Colum- Song, G., Qu, Y.H., Yin, Z.H., Li, S.H., Liu, N.F. & Lei, F.M. bia University Press, New York. (2009) Phylogeography of the Alcippe morrisonia (Aves: Mayr, E. (1970) Population, species, and evolution. Harvard Timaliidae): long population history beyond late Pleis- University Press, Cambridge. tocene glaciations. BMC Evolutionary Biology, 9, 143. Meng, K., Li, S.Q. & Murphy, R.W. (2008) Biogeographical Swofford, D. L. (1993) paup: phylogenetic analysis using parsi- patterns of Chinese spiders (Arachnida: Araneae) based on mony. Version 3.1.1. Illinois Natural History Survey, a parsimony analysis of endemicity. Journal of Biogeogra- Champaign, IL. phy, 35, 1241–1249. Tajima, F. (1989) Statistical method for testing the neutral Phillips, S.J., Anderson, R.P. & Schapire, R.E. (2006) Maxi- mutation hypothesis by DNA polymorphism. Genetics, mum entropy modeling of species geographical distribu- 123, 585. tions. Ecological Modelling, 190, 231–259. Vrba, E.S. (1985) Ecological and adaptive changes associated Posada, D. (2008) jModelTest, phylogenetic model averaging. with early hominid evolution. Ancestors: the hard evidence Molecular Biology and Evolution, 25, 1253–1256. (ed. by E. Delson), pp. 63–71. Alan R. Liss. Inc., New York. Posada, D. & Crandall, K.A. (2001) Intraspecific gene Wang, Y., Jin, C.Z., Deng, C.L., Wei, G.B. & Yan, Z.L. genealogies: trees grafting into networks. Trends in Ecology (2013) The first Sinomastodon (Gomphotheriidae, Pro- and Evolution, 16,37–45. boscidea) skull from the Quaternary in China. Chinese Qiu, Y.X., Guan, B.C., Fu, C.X. & Comes, H.P. (2009) Did Science Bulletin, 57, 4726–4734. glacials and/or interglacials promote allopatric incipient Wu, Z., Sun, H., Zhou, Z., Peng, H. & Li, D.Z. (2005) Ori- speciation in East Asian temperate plants? Phylogeographic gin and differentiation of endemism in the flora of China. and coalescent analyses on refugial isolation and diver- Acta Botanica Yunnanica, 27, 577. gence in Dysosma versipellis. Molecular Phylogenetics and Xu, Z.H., Jiang, X.C., Chen, Z.Q. & Wu, D.M. (2001a) Study Evolution, 51, 281–293. on the ant communities of the vertical band on east slope Qu, Y.H., Zhang, R.Y., Quan, Q., Song, G., Li, S.H. & Lei, of the Gaoligongshan Mountains nature reserve. Forest F.M. (2012) Incomplete lineage sorting or secondary Research, 14, 115–124. admixture: disentangling historical divergence from recent Xu, Z.H., Li, J.G., Fu, L. & Long, Q.Z. (2001b) A study on gene flow in the Vinous-throated parrotbill (Paradoxornis the ant communities on west slope at different elevation webbianus). Molecular Ecology, 21, 6117–6133. of the Gaoligongshan Mountain nature reserve in Yunnan, Qu, Y.H., Ericson, P.G., Quan, Q., Song, G., Zhang, R.Y., China. Zoological Research, 22,58–63. Gao, B. & Lei, F.M. (2014) Long-term isolation and stabil- Yamamoto, S. & Sota, T. (2007) Phylogeny of the Geometri- ity explain high genetic diversity in the Eastern Himalaya. dae and the evolution of winter moths inferred Molecular Ecology, 23, 705–720. from a simultaneous analysis of mitochondrial and Rahbek, C. & Graves, G.R. (2000) Detection of macro-ecolo- nuclear genes. Molecular Phylogenetics and Evolution, 44, gical patterns in South American hummingbirds is affected 711–723. by spatial scale. Proceedings of the Royal Society B: Biologi- Yang, Y.M., Liu, N. & Wang, J.H. (1992) A preliminary cal Sciences, 267, 2259–2265. study on terrestrial vertebrate divisions of zoogeographical Rambaut, A. & Drummond, A.J. (2009) Tracer V1.5. Avail- areas in Yunnan. Journal of Southwest Forestry College, 12, able at: http://tree.bio.ed.ac.uk/software/tracer/. 88–95; 207–220.

Journal of Biogeography 43, 691–702 701 ª 2015 John Wiley & Sons Ltd R. Cheng et al.

Yang, X.S., Xue, D.Y. & Han, H.X. (2013) The complete SUPPORTING INFORMATION mitochondrial genome of Biston panterinaria (Lepidoptera: Geometridae), with phylogenetic utility of mitochondrial Additional Supporting Information may be found in the genome in the Lepidoptera. Gene, 515, 349–358. online version of this article: Yi, Z.L., Cui, J.Z. & Xiong, H.G. (2005) Numerical periods Appendix S1 GenBank accession numbers. of Quaternary glaciations in China. Quaternary Sciences, Appendix S2 Phylogenetic trees. 25, 609–619. Appendix S3 Maps. Zhang, S.M. (1986) Faunal analysis of pentatomid bugs in Xizang autonomus region. Acta Entomoologica Ainca, 29, BIOSKETCH 426–431. Zhang, R.Z. (1999) Zoogeography of China. Science Press, Rui Cheng is a PHD candidate in the Key Laboratory of Beijing. Zoological Systematics and Evolution at the Institute of Zhao, H.F., Lei, F.M., Qu, Y.H. & Lu, J.L. (2007) Conserva- Zoology, Chinese Academy of Sciences. Her research interests tion priority based on avian subspeciﬁc differentiation of focus on molecular evolution and speciation in moths. endemic species. Acta Zoologica Sinica, 53, 378–382. Zhao, J.D., Shi, Y.F. & Wang, J. (2011) Comparison between Author contributions: H.H., D.X. and R.C. conceived and Quaternary glaciations in China and the marine oxygen designed the experiments; N.J. identiﬁed all samples; R.C., isotope stage (MIS):an improved schema. Acta Geographica X.Y. and S.L. performed the experiments and analysed the Sinica, 66, 867–884. data; H.H., D.X. and R.C. wrote the paper. Zhou, S.Z., Wang, X.L., Wang, J. & Xu, L.B. (2006) A preliminary study on timing of the oldest Pleistocene glacia- Editor: Fumin Lei tion in Qinghai-Tibetan Plateau. Quaternary International, 154,44–51.

702 Journal of Biogeography 43, 691–702 ª 2015 John Wiley & Sons Ltd