Marked Intragenomic Heterogeneity and Geographical Differentiation of Nrdna ITS N Larix Potaninii (Pinaceae)
Total Page：16
File Type：pdf, Size：1020Kb
J Mol Evol (2003) 57:623–635 DOI: 10.1007/s00239-003-2512-8 Marked Intragenomic Heterogeneity and Geographical Differentiation of nrDNA ITS in Larix potaninii (Pinaceae) Xiao-Xin Wei, Xiao-Quan Wang, De-Yuan Hong Laboratory of Systematic and Evolutionary Botany, Institute of Botany, Chinese Academy of Sciences, 20 Nanxincun, Xiangshan, Beijing 100093, China Received: 9 December 2002 / Accepted: 16 June 2003 Abstract. Nuclear ribosomal DNA (nrDNA) of Key words: nrDNA ITS — Pseudogene — Re- gymnosperms, especially Pinaceae, is characterized combination — Concerted evolution — Geo- by slow concerted evolution and exhibits substantial graphical differentiation — Larix ITS-region length variation (975–3663 bp), in sharp contrast to the narrow range (565–700 bp) in angio- sperms. Here we examined intra- and intergenomic heterogeneity of the nrDNA internal transcribed Introduction spacer (ITS) region in four varieties of Larix potani- nii, a species from the mountainous areas of western Nuclear ribosomal DNA (nrDNA) occurs as tan- China. Two clones with more than a 100-bp deletion demly repeated units at one or several loci, with copy in ITS1 were detected in L. potaninii var. chinensis numbers varyingfrom several hundreds to thousands and L. potaninii var. australis, respectively. The de- per haploid genome (Long and Dawid 1980). Each letion resulted in the loss of most part, includingthe unit, separated by intergenic spacers (IGS), consists motif sequence, of subrepeat 1 (SR1). Sequence di- of the 18S, 5.8S, and 26S codingregionsand two vergence and phylogenetic analyses showed that some internal transcribed spacers (ITS1 and ITS2) in clones would be pseudogenes given their low GC plants. Repeats within one array are more closely content, high substitution rates, unique positions in related to one another than to repeats in arrays on the phylogenetic trees, or significant length variation. other chromosomes (Schlo¨ tterer and Tautz 1994; These clones might represent orphons or paralogues Copenhaver et al. 1995; Muir et al. 2001) or to re- at minor loci resulting from large-scale gene or peats in other taxa (Arnhein 1983) due to concerted chromosome reorganization. Some recombinants evolution by unequal crossing-over (Smith 1976) and characterized by chimeric structure and discordant gene conversion (Nagylaki and Petes 1982; Nagylaki phylogenetic positions in partitioned sequence anal- 1984; Hillis et al. 1991). For nrDNA of angiosperms, yses indicate that unequal crossing-over plays an intragenomic diversity is generally low and the length important role in the process of nrDNA concerted of the ITS region remains in the relatively narrow evolution. In addition, some varieties of L. potaninii range of 565 to 700 bp (Baldwin et al. 1995; Wendel might have experienced an nrDNA founder effect et al. 1995). Though some polymorphism was ob- parallel to their geographical isolation. served within or amongindividuals, species, or even genera, the ITS repeats do not differ significantly in length, but solely in nucleotide substitutions. The Correspondence to: Dr. Xiao-Quan Wang; email: xiaoq_wang@ only exception, a variant carryinga 100-bp insertion ns.ibcas.ac.cn in ITS1, was reported within and amongindividuals 624 from five populations of the Lisianthius skinneri the seed scales, and Sect. Multiserialis includes species species complex of the family Gentianaceae (Sytsma with bracts extendingfar beyond the seed scales and Schaal 1990). (Patschke 1913; Farjon 1990; LePage and Basinger The concerted evolution of nrDNA in gymno- 1991, 1995; Schorn 1994). Larix potaninii, a species of sperms, however, is much slower than that in angio- Sect. Multiserialis, is endemic to the Himalayas and sperms. Substantial length variation is commonly adjacent regions. Due to morphological radiation observed. For example, the family Pinaceae exhibits and geographical isolation, it has differentiated into the greatest variation in ITS length, ranging from four varieties, namely, var. potaninii (Pot), var. aus- 1550 bp in Pseudotsuga to between 3150 and 3660 bp tralis (Aus), var. chinensis (Chi), and var. himalaica in Picea (Liston et al. 1996; Marrocco et al. 1996; (Him) (Farjon 1990, 2001; Fu et al. 1999). The former Germano and Klein 1999; Maggini et al. 1998, 2000; two varieties are distributed mainly in the Hengduan Gernandt et al. 2001). Besides, inter- or intraspecific Mountains, the eastern Himalayan diversity ‘‘hot length difference in the ITS region as large as several spot’’ (Wilson 1992), and they are sympatric in SW hundred base pairs was reported in Abies (Xianget al. Sichuan and NW Yunnan. Var. himalaica is confined 2000), Picea (Maggini et al. 1998, 2000), and Pinus to the Himalayas (SW Tibet and Nepal), and var. (Quijada et al. 1998; Gernandt et al. 2001). Espe- chinensis has a very limited distribution in the Taibai cially, extensive intragenomic length variation (>100 Mountains, S Shaanxi. However, no clear molecular bp) has been found in Cedrus deodara (Liston et al. differentiation was found amongthe four varieties 1996) and Pinus sylvestris (Karvonen and Savolainen (Wei and Wang2003). In the present study, we 1993) through RFLP or PCR-RFLP analysis. It is cloned the nrDNA ITS region of all the varieties of L. interesting that the large and extensive length varia- potaninii to investigate its intra- and intergenomic tion always results from ITS1, while 5.8S and ITS2 heterogeneity and to explore the distribution pattern have very conserved lengths, i.e., 162 and 232–245 bp, and phylogenetic history of ITS paralogues, which respectively (Gernandt and Liston 1999; Gernandt would shed a new light on the evolutionary dynamics et al. 2001). Sequence structure analysis showed that of nrDNA family in gymnosperms. a conserved motif embedded in two to six subrepeats occurs in all Pinaceae ITS1 and is synapomorphic for the family. In particular, Pinaceae ITS1 length vari- Materials and Methods ation is highly positively correlated with subrepeat number (Vining 1999). The high heterogeneity of Plant Materials nrDNA in Pinaceae provides us with an ideal mate- rial to retrieve the evolutionary process of the The four varieties of Larix potaninii were all sampled in this study. multigene family and to explore the mechanism of L. laricina, a North American species of Sect. Larix, was also concerted evolution. However, previous studies fo- analyzed. The origins of materials are shown in Table 1. cused mainly on two old genera, i.e., Pinus and Picea, with an early Cretaceous origin (Florin 1963; Millar DNA Extraction,ITS Region Amplification, 1993; Wang et al. 2000), and no large intragenomic Cloning,and Sequencing length variation of the ITS region was found at the sequence level (Bobola et al. 1992; Karvonen and Total DNA was extracted from silica gel dried needles using the CTAB method followingthe protocol of Rogersand Bendich Savolainen 1993; Quijada et al. 1998; Gernandt et al. (1988) and used as template in the polymerase chain reaction. 2001). In addition, Pinus and Picea have multiple The ITS region was amplified with primers ITS1N (50- rDNA loci, ranging between five and eight pairs in GTCGTAACAAGGTTTCCGTAGG) located on the 18S rDNA the diploid genomes (Brown and Carlson 1997; and ITS4 of White et al. (1990). The PCR reaction was carried out Gernandt and Liston 1999). Some authors suggested in a volume of 25 ll containing5–50 ngof DNA template, 6.25 pmol of each primer, a 0.2 mM concentration of each dNTP, 2 mM that the ITS heterogeneity may be related to the high MgCl2, and 0.75 U of Taq DNA polymerase. Amplification was number of rDNA loci (Liston et al. 1996; Gernandt conducted in a Peltier Thermal Cycler (PTC-200, MJ Research). and Liston 1999; Gernandt et al. 2001). Further PCR cycles were as follows: 1 cycle of 4 min at 70°C, 4 cycles of 40 studies on the relationship between concerted evolu- sat94°C, 20 s at 52°C, and 2 min 30 s at 72°C, followed by 36 tion rate and rDNA loci number are needed. cycles of 20 s at 94°C, 20 s at 52°C, and 2 min 30 s at 72°C, with a final extension step for 10 min at 72°C. PCR products were sepa- Contrary to Pinus and Picea, Larix is a young rated by 1.5% agarose gel electrophoresis. The band with the right genus with an Eocene origin (LePage and Basinger size was cut out and purified usingthe GFX PCR DNA and Gel 1995; Wanget al. 2000) and has fewer rDNA loci Band Purification Kit (Pharmacia) and then cloned with the (three pairs) (Lubaretz et al. 1996). It consists of pGEM-T Easy Vector System II (Promega). about 10 species, which fall into two morphologically For each taxon, at least 30 clones with correct insertion (de- termined by digestion with EcoRI) were screened by comparing distinct groups based on the female cone. Sect. Larix restriction fragments of MspI or both HaeIII and HinfI. All distinct (or Pauciserialis) comprises species characterized by clones were sequenced with the two PCR primers and several in- bracts on the cone that did not extend well beyond ternal primers (Fig. 1), i.e., LITS3 (50-CTTCTTGCCTCGA- 625 Table 1. Sources of materials used in the present study Taxon Source Latitude/longitude Clone Nos. GenBank accession Nos. L. potaninii Var. australis (Aus) Lijiang, Yunnan, China 26°080/100°020 1, 2, 18, 20, 7, 17 AY188526–AY188529, AY188550–AY188551 Var. chinensis (Chi) Changan, Shaanxi, China 34°010/108°090 1, 5, 9, 12, 26, 27 AY188530–AY188534, AY188552 Var. himalaica (Him) Jilong, Xizang, China 28°090/85°020 5, 7, 9, 13, 18, 22, 14 AY188535–AY188540, AY188553 Var. potaninii (Pot) Kangding, Sichuan, China 30°000/101°090 1, 2, 3, 5, 8, 10, 16 AY188541–AY188547 L. laricina Arboretum of Shenyang, 1, 2 AY188548–AY188549 Liaoning, China/cultivated Fig. 1. Schematic representation and primer position for ITS region in Larix. Shaded boxes represent the two subre- peats.