DOCSLIB.ORG

Fish and Shellfish Immunology 91 (2019) 99–107

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Fish and Shellfish Immunology 91 (2019) 99–107 Fish and Shellfish Immunology 91 (2019) 99–107 Contents lists available at ScienceDirect Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi Full length article Identification of Hc-β-catenin in freshwater mussel Hyriopsis cumingii and its T involvement in innate immunity and sex determination ∗ Guiling Wanga,b,c, Feifei Liua,b,c, Zhicheng Xua,b,c, Jinyuan Gea,b,c, Jiale Lia,b,c, a Key Laboratory of Freshwater Aquatic Genetic Resources, Ministry of Agriculture, Shanghai Ocean University, Shanghai, 201306, China b National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, Shanghai, 201306, China c Shanghai Engineering Research Center of Aquaculture, Shanghai, 201306, China ARTICLE INFO ABSTRACT Keywords: β-catenin is a multifunctional protein that participates in a variety of physiological activities, including immune β-catenin regulation, sex determination, nervous system development and, cell differentiation. However, the function of β- Hyriopsis cumingii catenin in freshwater mussel Hyriopsis cumingii remains unclear. Herein, the gene encoding β-catenin from H. Quantitative real-time PCR cumingii (Hc-β-catenin) was cloned and characterised. The full-length 5544 bp gene includes an open reading Immune stimulation frame (ORF) of 2463 bp encoding a putative protein of 820 amino acids residues containing 12 armadillo (ARM) Innate immunity repeats. After injecting H. cumingii with Aeromonas hydrophila or lipopolysaccharides, Hc-β-catenin transcription Sex determination Armadillo repeat was induced in hemocytes and gills, and the greatest responses occurred at 24 h after bacterial challenge, Aeromonas hydrophila confirming an important role in immune responses. Quantitative real-time PCR analysis showedthat Hc-β-ca- tenin mRNA was distributed in the gill, foot, liver, kidney, mantle, adductor muscle and gonad of male and female mussels. In gonad, Hc-β-catenin expression was markedly higher in females than males. During the em- bryonic period, Hc-β-catenin expression was highest at 3 day. In 1-, 2- and 3-year-old mature mussels, Hc-β- catenin expression in female gonad tissue was notably higher than in males. In situ hybridisation revealed a significant hybridisation signal in female gonads, indicating that Hc-β-catenin is a pro-ovarian, anti-testis gene. Our findings demonstrate that Hc-β-catenin is important in immune regulation and sex determination in fresh- water mussel. 1. Introduction which relies on β-catenin to control various developmental processes such as gender fate determination, differentiation, and survival [5]. Hyriopsis cumingii is the main freshwater pearl mussel species in In addition to developmental processes, evidence suggests that the China. Pearls produced by H. cumingii are smooth, bright in colour, Wnt signalling pathway participates in immunity, particularly in den- round in shape, and have great economic value. China is the largest dritic cells (DCs). β-catenin is a key downstream mediator of canonical producer of pearls in the world, of which more than 80% of freshwater Wnt signalling in DCs. Although β-catenin is a core modulator of several pearls are produced by H. cumingii [1], making this the most important intersecting signalling pathways, many immune responses can be acti- pearl aquaculture species. vated by β-catenin independently [6]. β-catenin has been found to reg- β-catenin was discovered as an adhesion molecule in 1980, and is a ulate stem cell differentiation and proliferation [7,8], affect interferon member of the catenin family. It is also an important transcription (IFN)-β synthesis, and participate in cancer development [9,10]. factor of the classical Wnt signalling pathway that regulates various Changes in the localisation and expression levels of β-catenin often re- developmental processes such as limb regeneration [2], nervous system sult in exacerbation of diseases and disorders associated with cancer development, body axis formation [3], and adrenal cortical develop- and metastasis [11]. Whole-genome RNA interference (RNAi) screening ment [4]. Signalling pathways in Wnt cells are mainly divided into revealed a novel role for the Wnt/β-catenin signalling pathway as a three types, including the well-studied classical Wnt/β-catenin pathway, negative regulator of viral-induced innate immune responses [12]. The Abbreviations: qRT-PCR, quantitative real-time PCR; RACE, rapid amplification of cDNA ends; ISH, In situ hybridisation; ARM, Armadillo; AH, Aeromonas hydrophila; PBS, phosphate-buffered saline ∗ Corresponding author. Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources and College of Fisheries and Life Science, Shanghai Ocean University, Shanghai, 201306, China. E-mail address: [email protected] (J. Li). https://doi.org/10.1016/j.fsi.2019.05.009 Received 20 November 2018; Received in revised form 29 March 2019; Accepted 4 May 2019 Available online 07 May 2019 1050-4648/ © 2019 Elsevier Ltd. All rights reserved. G. Wang, et al. Fish and Shellfish Immunology 91 (2019) 99–107 function of β-catenin in immunity was also demonstrated in Chinese Table 1 tongue sole [13,14], and recent studies have shown that the Wnt sig- Primers used in this study. nalling pathway plays a role in immunity against white spot syndrome Primer name Primer sequence (5’−3′) Purpose virus (WSSV) in Pacific white shrimp Litopenaeus vannamei [15]. The sex mechanism of molluscs is complex and includes hermaph- β3′-1 ATGATGTTTGATGCCTGGGGTG 3′ RACE outer rodites and sexual reversal [16,17]. H. cumingii is dioecious, but there β3′-2 ACAGGCTGGAGACAGAGAGGAC 3′ RACE inner β5′-1 GATGGGCACAAAGCCAGGTTGCGGAT 5′ RACE outer are significantly differences in the breeding performance of maleand β5′-2 CGTGTGGTTTCGGCATCATTAGTATT 5′ RACE inner female mussels; adult male mussels produce better breeding pearls than HβF CCAAGGTGGAGACCTGAACT qPCR Hc-β-catenin females [18]. Various sex-related genes have been studies in mammals, HβR CCACTGGGTCATTCCCTGAT qPCR Hc-β-catenin including those encoding Wt1, Sry, Sox9 and Dmrt1 that promote tes- EFl-αF GGAACTTCCCAGGCAGACTGTGC qPCR EFl-αR TCAAAACGGGCCGCAGAGAAT qPCR ticular development [19], and Wnt4, RSpo1 and Dax1 that are con- IβF CCAAGGTGGAGACCTGAACT ISH ducive to ovarian development [20]. However, there are few reports on IβR TAATACGACTCACTATAGGGCCACT ISH gender-related genes in H. cumingii, although the fem-1c gene is known GGGTCATTCCCTGAT to be involved in female gonad differentiation [21]. Several studies have found that β-catenin plays an important role in mammalian sex determination and differentiation. The activation of β- USA) according to the manufacturer's instructions. RNA quality and catenin in otherwise normal XY mice effectively impedes testicular de- quantity were determined by agarose gel electrophoresis and a Nano- velopment, including disruption of testosterone synthesis, and down- Drop spectrophotometer (Thermo Scientific, USA). The cDNA was regulation of testicular marker genes, ultimately leading to male-to- synthesised using a PrimerScript RT reagent Kit (TaKaRa, Japan). female sexual reversal [22]. Although β-catenin is only necessary for ovarian differentiation and is dispensable for testis development, loss of 2.3. Cloning of the full-length Hc-β-catenin cDNA β-catenin in ovaries can cause molecular and morphological defects, including the formation of testis-specific coelomic vessels, the appear- Purified RNA samples were diluted to 500 ng/μl for first-strand ance of androgen-producing adrenal-like cells, and loss of female germ cDNA synthesis using a 5′/3′ SMARTer RACE cDNA Amplification kit cells [23]. R-spondin genes encode secreted proteins of the classical β- (Clontech, USA) according to the manufacturer's instructions, with catenin pathway. Sex-determining region Y (SRY) genes in human and primers listed in Table 1. Thermal cycling included an initial dena- mouse interact with β-catenin in the nucleus to inhibit the transcrip- turation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, 60 °C tional activation of the Rspo1/Wnt gene, ultimately promoting male for 30 s, 72 °C for 1 min, and a final extension at 72 °C for 10 min. PCR development [24]. This indicates that Rspo1 and Wnt4 exert important products were separated by agarose gel electrophoresis, purified using a effects on ovarian differentiation, hence β-catenin may also affect sex Gel Extraction Kit (TIANGEN), inserted into the PGEM-T vector (Pro- determination [25]. mega, Madison, USA) at 16 °C for 16 h, and the resulting constructs In order to further investigate the role of Hc-β-catenin in immune were transformed into competent Escherichia coli DH5ɑ cells. Selected responses and sex formation processes in H. cumingii, we cloned and clones were sequenced by Sangon Biotech (Shanghai, China). characterised the full-length Hc-β-catenin gene in the present work. Real-time quantitative PCR (qRT-PCR) was used to measure the relative expression levels in different tissues of male and female mussels, and 2.4. Sequence analysis and phylogenetic tree construction during gonadal development. The results also revealed the dynamic expression of Hc-β-catenin following injection with the bacterial pa- The sequence of Hc-β-catenin was confirmed using the BLAST al- thogen Aeromonas hydrophila (AH) or lipopolysaccharide (LPS). gorithm and the NCBI database (https://blast.ncbi.nlm.nih.gov/Blast. Additionally, the distribution of the Hc-β-catenin protein in male and cgi). The deduced amino acid sequence of Hc-β-catenin
Load more

Recommended publications
  • Supp. Table S2: Domains and Protein Families with a Putative Role in Host-Symbiont Interactions
    Supp. Table S2: Domains and protein families with a putative role in host-symbiont interactions. The domains and protein families listed here were included in the comparisons in Figure 5 and Supp. Figure S5, which show the percentage of the respective protein groups in the Riftia symbiont metagenome and in metagenomes of other symbiotic and free-living organisms. % bacterial, total number bacterial: Percentage and total number of bacterial species in which this domain is found in the SMART database (January 2019). Domain name Pfam/SMART % bacterial (total Literature/comment annotation number bacterial) Alpha-2- alpha-2- A2M: 42.05% (2057) A2Ms: protease inhibitors which are important for eukaryotic macroglobulin macroglobulin innate immunity, if present in prokaryotes apparently fulfill a family (A2M), similar role, e.g. protection against host proteases (1) including N- terminal MG1 domain ANAPC Anaphase- APC2: 0 Ubiquitin ligase, important for cell cycle control in eukaryotes (2) promoting complex Bacterial proteins might interact with ubiquitination pathways in subunits the host (3) Ankyrin Ankyrin repeats 10.88% (8348) Mediate protein-protein interactions without sequence specificity (4) Sponge symbiont ankyrin-repeat proteins inhibit amoebal phagocytosis (5) Present in sponge microbiome metatranscriptomes, putative role in symbiont-host interactions (6) Present in obligate intracellular amoeba symbiont Candidatus Amoebophilus asiaticus genome, probable function in interactions with the host (7) Armadillo Armadillo repeats 0.83% (67)
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Armc5 Deletion Causes Developmental Defects and Compromises T-Cell Immune Responses
    ARTICLE Received 26 Jan 2016 | Accepted 4 Nov 2016 | Published 7 Feb 2017 DOI: 10.1038/ncomms13834 OPEN Armc5 deletion causes developmental defects and compromises T-cell immune responses Yan Hu 1,*, Linjiang Lao1,*, Jianning Mao1, Wei Jin1, Hongyu Luo1, Tania Charpentier2, Shijie Qi1, Junzheng Peng1, Bing Hu3, Mieczyslaw Martin Marcinkiewicz4, Alain Lamarre2 & Jiangping Wu1,5 Armadillo repeat containing 5 (ARMC5) is a cytosolic protein with no enzymatic activities. Little is known about its function and mechanisms of action, except that gene mutations are associated with risks of primary macronodular adrenal gland hyperplasia. Here we map Armc5 expression by in situ hybridization, and generate Armc5 knockout mice, which are small in body size. Armc5 knockout mice have compromised T-cell proliferation and differentiation into Th1 and Th17 cells, increased T-cell apoptosis, reduced severity of experimental autoimmune encephalitis, and defective immune responses to lymphocytic choriomeningitis virus infection. These mice also develop adrenal gland hyperplasia in old age. Yeast 2-hybrid assays identify 16 ARMC5-binding partners. Together these data indicate that ARMC5 is crucial in fetal development, T-cell function and adrenal gland growth homeostasis, and that the functions of ARMC5 probably depend on interaction with multiple signalling pathways. 1 Centre de recherche (CR), Centre hospitalier de l’Universite´ de Montre´al (CHUM), 900 Rue Saint Denis, Montre´al, Que´bec, Canada H2X 0A9. 2 Institut national de la recherche scientifique—Institut Armand-Frappier (INRS-IAF), 531 Boul. des Prairies, Laval, Que´bec, Canada H7V 1B7. 3 Anatomic Pathology, AmeriPath Central Florida, 4225 Fowler Ave. Tampa, Orlando, Florida 33617, USA.
    [Show full text]
  • Comprehensive Computational Analysis of Leucine-Rich Repeat (LRR) Proteins Encoded in the Genome of the Diatom Phaeodactylum Tricornutum
    Erschienen in: Marine Genomics ; 21 (2015). - S. 43-51 https://dx.doi.org/10.1016/j.margen.2015.02.007 Comprehensive computational analysis of leucine-rich repeat (LRR) proteins encoded in the genome of the diatom Phaeodactylum tricornutum Birgit Schulze ⁎, Matthias T. Buhmann 1, Carolina Río Bártulos, Peter G. Kroth Department of Biological Sciences, Universität Konstanz, 78457 Konstanz, Germany abstract We have screened the genome of the marine diatom Phaeodactylum tricornutum for gene models encoding proteins exhibiting leucine rich repeat (LRR) structures. In order to reveal the functionality of these proteins, their amino acid sequences were scanned for known domains and for homologies to other proteins. Additionally, proteins were categorized into different LRR families according to the variable sequence part of their LRR. This approach enabled us to group proteins with potentially similar functionality and to classify also LRR proteins Keywords: where no characterized homologues in other organisms exist. Most interestingly, we were able to indentify LRR several transmembrane LRR proteins, which are likely to function as receptor like molecules. However, none Receptor-like protein of them carry additional domains that are typical for mammalian or plant like receptors. Thus, the respective Adhesion protein signal recognition pathways seem to be substantially different in diatoms. Moreover, P. tricornutum encodes a RanGAP family of secreted LRR proteins likely to function as adhesion or binding proteins as part of the extracellular matrix. Additionally, intracellular LRR only proteins were divided into proteins similar to RasGTPase activators, regulators of nuclear transport, and mitotic regulation. Our approach allowed us to draw a detailed picture of the conservation and diversification of LRR proteins in the marine diatom P.
    [Show full text]
  • Armadillo Repeat Proteins: Beyond the Animal Kingdom Coates, Juliet
    University of Birmingham Armadillo repeat proteins: beyond the animal kingdom Coates, Juliet DOI: 10.1016/S0962-8924(03)00167-3 Document Version Early version, also known as pre-print Citation for published version (Harvard): Coates, J 2003, 'Armadillo repeat proteins: beyond the animal kingdom', Trends in Cell Biology, vol. 13, no. 9, pp. 463-471. https://doi.org/10.1016/S0962-8924(03)00167-3 Link to publication on Research at Birmingham portal General rights Unless a licence is specified above, all rights (including copyright and moral rights) in this document are retained by the authors and/or the copyright holders. The express permission of the copyright holder must be obtained for any use of this material other than for purposes permitted by law. •Users may freely distribute the URL that is used to identify this publication. •Users may download and/or print one copy of the publication from the University of Birmingham research portal for the purpose of private study or non-commercial research. •User may use extracts from the document in line with the concept of ‘fair dealing’ under the Copyright, Designs and Patents Act 1988 (?) •Users may not further distribute the material nor use it for the purposes of commercial gain. Where a licence is displayed above, please note the terms and conditions of the licence govern your use of this document. When citing, please reference the published version. Take down policy While the University of Birmingham exercises care and attention in making items available there are rare occasions when an item has been uploaded in error or has been deemed to be commercially or otherwise sensitive.
    [Show full text]
  • Rigid Fusions of Designed Helical Repeat Binding Proteins Efficiently
    www.nature.com/scientificreports OPEN Rigid fusions of designed helical repeat binding proteins efciently protect a binding surface from crystal contacts Patrick Ernst1, Annemarie Honegger1, Floor van der Valk1, Christina Ewald1,2, Peer R. E. Mittl1 & Andreas Plückthun1* Designed armadillo repeat proteins (dArmRPs) bind extended peptides in a modular way. The consensus version recognises alternating arginines and lysines, with one dipeptide per repeat. For generating new binding specifcities, the rapid and robust analysis by crystallography is key. Yet, we have previously found that crystal contacts can strongly infuence this analysis, by displacing the peptide and potentially distorting the overall geometry of the scafold. Therefore, we now used protein design to minimise these efects and expand the previously described concept of shared helices to rigidly connect dArmRPs and designed ankyrin repeat proteins (DARPins), which serve as a crystallisation chaperone. To shield the peptide-binding surface from crystal contacts, we rigidly fused two DARPins to the N- and C-terminal repeat of the dArmRP and linked the two DARPins by a disulfde bond. In this ring-like structure, peptide binding, on the inside of the ring, is very regular and undistorted, highlighting the truly modular binding mode. Thus, protein design was utilised to construct a well crystallising scafold that prevents interference from crystal contacts with peptide binding and maintains the equilibrium structure of the dArmRP. Rigid DARPin-dArmRPs fusions will also be useful when chimeric binding proteins with predefned geometries are required. Designed Armadillo repeat proteins (dArmRPs) bind to elongated peptide sequences and may eventually com- plement classical detection antibodies (a review on alternative binding scafolds can be found in ref.1, their use in therapeutics is reviewed in ref.2).
    [Show full text]
  • 'Design of Armadillo Repeat Protein Scaffolds'
    Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2008 Design of armadillo repeat protein scaffolds Parmeggiani, F Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-4818 Dissertation Published Version Originally published at: Parmeggiani, F. Design of armadillo repeat protein scaffolds. 2008, University of Zurich, Faculty of Medicine. Design of Armadillo Repeat Protein Scaffolds Dissertation zur Erlangung der naturwissenschaftlichen Doktorwürde (Dr. sc. nat.) vorgelegt der Mathematisch-naturwissenschaftlichen Fakultät der Universität Zürich von Fabio Parmeggiani aus Italien Promotionskomitee Prof. Dr. Andreas Plückthun (Leitung der Dissertation) Prof. Dr. Markus Grütter Prof. Dr. Donald Hilvert Zürich, 2008 To my grandfather, who showed me the essence of curiosity “It is easy to add more of the same to old knowledge, but it is difficult to explain the new” Benno Müller-Hill Table of Contents 1 Table of contents Summary 3 Chapter 1: Peptide binders 7 Part I: Peptide binders 8 Modular interaction domains as natural peptide binders 9 SH2 domains 10 PTB domains 10 PDZ domains 12 14-3-3 domains 12 SH3 domains 12 WW domains 12 Peptide recognition by major histocompatibility complexes 13 Repeat proteins targeting peptides 15 Armadillo repeat proteins 16 Tetratricopeptide repeat proteins (TPR) 16 Beta propellers 16 Peptide binding by antibodies 18 Alternative scaffolds: a new approach to peptide binding 20 Part
    [Show full text]
  • Comparative Features of Multicellular Eukaryotic Genomes (2017)
    Comparative Features of Multicellular Eukaryotic Genomes (2017) (First three statistics from www.ensembl.org; other from original papers) C. elegans A. thaliana D. melanogaster M. musculus H. sapiens Species name Nematode Thale Cress Fruit Fly Mouse Human Size (Mb) 103 136 143 3,482 3,555 # Protein-coding genes 20,362 27,655 13,918 22,598 20,338 (25,498 (13,601 original (30,000 (30,000 original est.) original est.) original est.) est.) Transcripts 58,941 55,157 34,749 131,195 200,310 Gene density (#/kb) 1/5 1/4.5 1/8.8 1/83 1/97 LINE/SINE (%) 0.4 0.5 0.7 27.4 33.6 LTR (%) 0.0 4.8 1.5 9.9 8.6 DNA Elements 5.3 5.1 0.7 0.9 3.1 Total repeats 6.5 10.5 3.1 38.6 46.4 Exons % genome size 27 28.8 24.0 per gene 4.0 5.4 4.1 8.4 8.7 average size (bp) 250 506 Introns % genome size 15.6 average size (bp) 168 Arabidopsis Chromosome Structures Sorghum Whole Genome Details Characterizing the Proteome The Protein World • Sequencing has defined o Many, many proteins • How can we use this data to: o Define genes in new genomes o Look for evolutionarily related genes o Follow evolution of genes ▪ Mixing of domains to create new proteins o Uncover important subsets of genes that ▪ That deep phylogenies • Plants vs. animals • Placental vs. non-placental animals • Monocots vs. dicots plants • Common nomenclature needed o Ensure consistency of interpretations InterPro (http://www.ebi.ac.uk/interpro/) Classification of Protein Families • Intergrated documentation resource for protein super families, families, domains and functional sites o Mitchell AL, Attwood TK, Babbitt PC, et al.
    [Show full text]
  • Appub0358.Pdf
    Journal of Structural Biology 185 (2014) 147–162 Contents lists available at ScienceDirect Journal of Structural Biology journal homepage: www.elsevier.com/locate/yjsbi Designing protein function Modular peptide binding: From a comparison of natural binders to designed armadillo repeat proteins ⇑ Christian Reichen, Simon Hansen, Andreas Plückthun Department of Biochemistry, University of Zurich, 8057 Zurich, Switzerland article info abstract Article history: Several binding scaffolds that are not based on immunoglobulins have been designed as alternatives to Available online 3 August 2013 traditional monoclonal antibodies. Many of them have been developed to bind to folded proteins, yet cel- lular networks for signaling and protein trafficking often depend on binding to unfolded regions of pro- Keywords: teins. This type of binding can thus be well described as a peptide–protein interaction. In this review, we Protein engineering compare different peptide-binding scaffolds, highlighting that armadillo repeat proteins (ArmRP) offer an Libraries attractive modular system, as they bind a stretch of extended peptide in a repeat-wise manner. Instead of Proteomics generating each new binding molecule by an independent selection, preselected repeats – each comple- Protein design mentary to a piece of the target peptide – could be designed and assembled on demand into a new pro- Repeat proteins Peptide binding tein, which then binds the prescribed complete peptide. Stacked armadillo repeats (ArmR), each typically Protein–peptide interactions consisting of 42 amino acids arranged in three a-helices, build an elongated superhelical structure which enables binding of peptides in extended conformation. A consensus-based design approach, comple- mented with molecular dynamics simulations and rational engineering, resulted in well-expressed monomeric proteins with high stability.
    [Show full text]
  • Use of Protein Engineering Techniques to Elucidate Protein Folding Pathways
    Provided for non-commercial research and educational use only. Not for reproduction, distribution or commercial use. This chapter was originally published in the book Progress in Molecular Biology and Translational Science, Vol. 84, published by Elsevier, and the attached copy is provided by Elsevier for the author's benefit and for the benefit of the author's institution, for non-commercial research and educational use including without limitation use in instruction at your institution, sending it to specific colleagues who know you, and providing a copy to your institution’s administrator. All other uses, reproduction and distribution, including without limitation commercial reprints, selling or licensing copies or access, or posting on open internet sites, your personal or institution’s website or repository, are prohibited. For exceptions, permission may be sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial From: Anna L. Mallam and Sophie E. Jackson, Use of Protein Engineering Techniques to Elucidate Protein Folding Pathways. In P. Michael Conn, editor: Progress in Molecular Biology and Translational Science, Vol. 84, Burlington: Academic Press, 2008, pp. 57-113. ISBN: 978-0-12-374595-8 © Copyright 2008 Elsevier Inc. Academic Press. Author's personal copy Use of Protein Engineering Techniques to Elucidate Protein Folding Pathways Anna L. Mallam and Sophie E. Jackson Department of Chemistry, Cambridge, CB2 1EW, United Kingdom I. Introduction............................................................................... 58 II. Early Protein Engineering Studies of Folding Pathways ........................ 59 III. Single Point Mutations and F‐Value Analysis...................................... 61 A. Mixed a/b Proteins .................................................................. 65 B. All‐a‐Helical Proteins............................................................... 69 C. All‐b‐Proteins........................................................................
    [Show full text]
  • Suppl Figure 1
    Suppl Table 2. Gene Annotation (October 2011) for the selected genes used in the study. Locus Identifier Gene Model Description AT5G51780 basic helix-loop-helix (bHLH) DNA-binding superfamily protein; FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) D AT3G53400 BEST Arabidopsis thaliana protein match is: conserved peptide upstream open reading frame 47 (TAIR:AT5G03190.1); Has 285 Blast hits to 285 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). AT1G44760 Adenine nucleotide alpha hydrolases-like superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); BEST Arabidopsis thaliana protein match is: Adenine nucleotide alpha hydrolases-li AT4G19950 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G44860.1); Has 338 Blast hits to 330 proteins in 72 species: Archae - 2; Bacteria - 94; Metazoa - 7; Fungi - 0; Plants - 232; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). AT3G14280
    [Show full text]
  • Armadillo-Repeat Protein Functions: Questions for Little Creatures Tewari, R; Bailes, E; Bunting, KA; Coates, Juliet
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by University of Birmingham Research Portal University of Birmingham Armadillo-repeat protein functions: questions for little creatures Tewari, R; Bailes, E; Bunting, KA; Coates, Juliet DOI: 10.1016/j.tcb.2010.05.003 Document Version Early version, also known as pre-print Citation for published version (Harvard): Tewari, R, Bailes, E, Bunting, KA & Coates, J 2010, 'Armadillo-repeat protein functions: questions for little creatures', Trends in Cell Biology, vol. 20, no. 8, pp. 470-481. https://doi.org/10.1016/j.tcb.2010.05.003 Link to publication on Research at Birmingham portal General rights Unless a licence is specified above, all rights (including copyright and moral rights) in this document are retained by the authors and/or the copyright holders. The express permission of the copyright holder must be obtained for any use of this material other than for purposes permitted by law. •Users may freely distribute the URL that is used to identify this publication. •Users may download and/or print one copy of the publication from the University of Birmingham research portal for the purpose of private study or non-commercial research. •User may use extracts from the document in line with the concept of ‘fair dealing’ under the Copyright, Designs and Patents Act 1988 (?) •Users may not further distribute the material nor use it for the purposes of commercial gain. Where a licence is displayed above, please note the terms and conditions of the licence govern your use of this document.
    [Show full text]