Suppl Table 2. Gene Annotation (October 2011) for the selected genes used in the study. Locus Identifier Gene Model Description AT5G51780 basic helix-loop-helix (bHLH) DNA-binding superfamily protein; FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) D AT3G53400 BEST Arabidopsis thaliana protein match is: conserved peptide upstream open reading frame 47 (TAIR:AT5G03190.1); Has 285 Blast hits to 285 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). AT1G44760 Adenine nucleotide alpha hydrolases-like superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); BEST Arabidopsis thaliana protein match is: Adenine nucleotide alpha hydrolases-li AT4G19950 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G44860.1); Has 338 Blast hits to 330 proteins in 72 species: Archae - 2; Bacteria - 94; Metazoa - 7; Fungi - 0; Plants - 232; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). AT3G14280 unknown protein; Has 51 Blast hits to 51 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT4G14100 transferases, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G23760.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17 AT5G59960 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT1G11210 Protein of unknown function (DUF761); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF761, plant (InterPro:IPR008480); BES AT4G34950 Major facilitator superfamily protein; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: Major facilitator superfamily protein (TAIR:AT2G16660.1); Has 3379 Blast hits to 3250 proteins in 882 species: Archae - 26; Bacteria - 1593; Metazoa - 4; Fungi - 302; Plants - 604; Viruses - 0; Other Eukaryotes - AT1G18270 ketose-bisphosphate aldolase class-II family protein; FUNCTIONS IN: in 8 functions; INVOLVED IN: oxidation reduction, pentose-phosphate shunt, valine metabolic process, glycolysis, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6 AT1G54120 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14060.1); Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G34630 BEST Arabidopsis thaliana protein match is: Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT5G51150.1); Has 323 Blast hits to 315 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 95; Fungi - 110; Plants - 73; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). AT2G38590 F-box and associated interaction domains-containing protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), F-box associated domain, type 1 (InterPro:IPR006527), F-box associated interaction domain (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box and associated interaction domains-containing protein (TAIR:AT4G33290.1); Has 1 AT2G15560 Putative endonuclease or glycosyl hydrolase; BEST Arabidopsis thaliana protein match is: Putative endonuclease or glycosyl hydrolase (TAIR:AT3G62200.1); Has 355 Blast hits to 333 proteins in 56 species: Archae - 0; Bacteria - 12; Metazoa - 73; Fungi - 48; Plants - 215; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). AT2G14800 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G44713.1); Has 41 Blast hits to 38 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). AT5G03230 Protein of unknown function, DUF584; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: Protein of unknown function, DUF584 (TAIR:AT5G60680.1); Has 326 Blast hits to 326 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 324; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G12830 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 39778 Blast hits to 22088 proteins in 1060 species: Archae - 152; Bacteria - 6161; Metazoa - 14109; Fungi - 6144; Plants - 2156; Viruses - 601; Other Eukaryotes - 10455 (source: NCBI BLink). AT1G65900 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 306 Blast hits to 306 proteins in 119 species: Archae - 19; Bacteria - 238; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). AT2G40435 BEST Arabidopsis thaliana protein match is: transcription regulators (TAIR:AT3G56220.1); Has 289 Blast hits to 289 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 289; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G16230 Predicted eukaryotic LigT; FUNCTIONS IN: RNA binding, catalytic activity; INVOLVED IN: RNA metabolic process, regulation of transcription; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, type 1, subgroup (InterPro:IPR018111), K Homology (InterPro:IPR004087), K Homology, type 1 (InterPro:IPR004088), Predicted eukaryotic L AT1G47740 PPPDE putative thiol peptidase family protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: PPPDE putative thiol peptidase family protein (TAIR:AT5G25170.1); Has 836 Blast hits to 836 proteins in 174 species: Archae - 0; Bacteria - 2; Metazoa - 222; Fungi - 83; Plants - 351; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). AT5G48240 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459); Has 286 Blast hits to 283 proteins in 145 species: Archae - 0; Bacteria - 2; Metazoa - 103; Fungi - 97; Plants - 41; Viruses - 1; Other Eukaryotes - 42 (source: NCBI BLink). AT2G23100 Cysteine/Histidine-rich C1 domain family protein; FUNCTIONS IN: zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), DC1 (InterPro:IPR004146), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: Cysteine/Histidine-rich C1 domain family protein (TAIR:AT5G42280.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria AT5G63150 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1713, mitochondria (InterPro:IPR013177); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - AT4G17840 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35260.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae AT1G13640 Phosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3-/4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: p AT5G08400 Protein of unknown function (DUF3531); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF3531 (InterPro:IPR021920); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF3531) (TAIR:AT4G29400.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT5G26300 TRAF-like family protein; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: TRAF-like family protein (TAIR:AT5G26280.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT5G04320 Shugoshin C terminus; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: meiotic chromosome segregation; LOCATED IN: chromosome, centromeric region, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Shugoshin, C-terminal (InterPro:IPR011515); BEST Arabidopsis thaliana protein match is: Shugoshin C terminus (TAIR:AT3G10440.1); Has 2871 B AT4G29520 LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Saposin B (InterPro:IPR008139); Has 137 Blast hits to 137 proteins in 50 species: Archae - 2; Bacteria - 0; Metazoa - 41; Fungi - 10; Plants - 36; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). AT5G56980 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G26130.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5 AT1G17500 ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism; INVOLVED IN: metabolic process, ATP biosynthetic process, phospholipid transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOM AT5G52180 LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane protein 161AB, predicted (InterPro:IPR019395); Has 82 Blast hits to 82 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 47; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). AT3G12700 Eukaryotic aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic (InterPro:IPR021109), Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active AT4G21020 Late embryogenesis abundant protein (LEA) family protein; BEST Arabidopsis thaliana protein match is: Late embryogenesis abundant protein (LEA) family protein (TAIR:AT5G44310.2); Has 25029 Blast hits to 12516 proteins in 1815 species: Archae - 109; Bacteria - 7990; Metazoa - 4935; Fungi - 1662; Plants - 2602; Viruses - 153; Other Eukaryotes - 7578 (source: NCBI BLink). AT5G12900 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G12330.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other E AT5G15190 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; O AT1G04200 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dymeclin (InterPro:IPR019142); Has 395 Blast hits to 389 proteins in 117 species: Archae - 0; Bacteria - 0; Metazoa - 262; Fungi - 21; Plants - 68; Viruses - 0; Other Eukaryotes - 44 (sou AT1G05450 Encodes a Protease inhibitor/seed storage/LTP family protein AT1G24300 GYF domain-containing protein; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: GYF (InterPro:IPR003169); BEST Arabidopsis thaliana protein match is: GYF domain-containing protein (TAIR:AT1G27430.1); Has 5832 Blast hits to 4523 proteins in 447 species: Archae - 0; Bacteria - 473; Metazoa - 1947; Fungi - 549; Plants - 478; Viruses - 23; Other Eukaryotes - 2362 (source: NCBI BLink). AT5G02440 unknown protein; Has 71 Blast hits to 71 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 71; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT4G09640 Protein of unknown function (DUF803); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF803 (InterPro:IPR008521); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF803) (TAIR:AT1G34470.1); Has 1257 Blast hits to 1237 proteins in 219 species: Archae - 2; Bacteria - 93; Metazoa - 420; Fungi - 376; Plants - 263; Viruses - 0; Other Eukaryotes - 103 (source: NCBI BLink). AT1G73510 unknown protein; Has 7 Blast hits to 7 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G14760 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible; Has 63 Blast hits to 63 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G27480 Calcium-binding EF-hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana pro AT4G14990 Topoisomerase II-associated protein PAT1; BEST Arabidopsis thaliana protein match is: Topoisomerase II-associated protein PAT1 (TAIR:AT3G22270.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT1G80380 encodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle. AT3G13674 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55205.1); Has 76 Blast hits to 76 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 AT4G36610 alpha/beta-Hydrolases superfamily protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: alpha/beta-Hydrolases superfamily protein (TAIR:AT2G18360.1); Ha AT5G27390 Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124); Has 23 Blast hits to 23 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - AT5G46840 RNA-binding (RRM/RBD/RNP motifs) family protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 73 AT3G27930 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 35 Blast hits to 35 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G43310 Ribosomal L18p/L5e family protein; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G14280 DNA-binding storekeeper protein-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF573 (InterPro:IPR007592), TRAM/LAG1/CLN8 homology domain (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protei AT5G07330 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G63060.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT1G78250 pre-tRNA; tRNA-Met (anticodon: CAT) AT1G77610 EamA-like transporter family protein; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620), Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: golgi nucleotide AT4G24750 Rhodanese/Cell cycle control phosphatase superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: Rhodanese/Cell cycle control phosphatase superfamily prote AT1G76640 Calcium-binding EF-hand family protein; CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF-hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin-like 38 (TAIR:AT1G76650.3); Has 14790 Blast hits to 11980 proteins in 1260 species: Archae - AT1G32360 Zinc finger (CCCH-type) family protein; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); BEST Arabidopsis thaliana protein match is: Zinc finger C-x8-C-x5-C-x3-H type family protein (TAIR:AT2G35430.1); Has 13421 Blast hits to 5509 proteins in 634 species: Archae - 13; Bacteria - 2784; Metazoa - 4906; Fungi - 574; Plants - 3348; Viruses - 263; Other Eukaryotes - 1533 (source: NCBI BLink). AT1G14740 Protein of unknown function (DUF1423); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1423, plant (InterPro:IPR004082); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1423) (TAIR:AT3G63500.1); Has 415 Blast hits to 414 proteins in 82 species: Archae - 3; Bacteria - 32; Metazoa - 64; Fungi - 8; Plants - 255; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). AT1G51080 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 11 growth stages; Has 101 Blast hits to 98 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 38; Fungi - 10; Plants - 27; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). AT5G62140 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; Has 60 Blast hits to 60 proteins in 24 species: Archae - 0; Bacteria - 14; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). AT1G68585 unknown protein; Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G80130 Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: binding; INVOLVED IN: response to oxidative stress; LOCATED IN: membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT5G20190.1); AT3G10120 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03890.1); Has 57 Blast hits to 57 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G15010 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G01300.1); Has 71 Blast hits to 71 proteins in 13 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G30880 Pleckstrin homology (PH) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: plant-type cell wall; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Pleckstrin homology-type (InterPro:IPR011993), Pleckstrin homology (InterPro:IPR001849); Has 8327 Blast hits to 6951 proteins in 819 species: Archae - 67; Bacteria - 1101; Metazoa - 4180; Fungi - 797; Plants - 557; AT1G16310 Cation efflux family protein; FUNCTIONS IN: cation transmembrane transporter activity; INVOLVED IN: cation transport, transmembrane transport; LOCATED IN: membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: Cation efflux family protein (TAIR:AT1G79520.1); Has 5067 Blast AT3G62530 ARM repeat superfamily protein; FUNCTIONS IN: lyase activity, zinc ion binding, metal ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleolus, chloroplast, phycobilisome; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), PBS lyase HEAT-like repeat (InterPro:IPR004155); BEST Arabidopsis thaliana protein match is: ARM repeat AT3G53470 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 35 Blast hits to 35 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G25250 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32020.1); Has 30 Blast hits to 30 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 28; Viruses - 0; Other Eukaryotes - 0 AT3G06530 ARM repeat superfamily protein; CONTAINS InterPro DOMAIN/s: U3 small nucleolar RNA-associated protein 10 (InterPro:IPR022125), BP28, C-terminal (InterPro:IPR012954), Armadillo-type fold (InterPro:IPR016024). AT1G79090 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Topoisomerase II-associated protein PAT1 (InterPro:IPR019167); BEST Arabidopsis thaliana protein match is: Topoisomerase II-associated protein PAT1 (TAIR:AT3G22270.1); Has 30201 B AT5G08600 U3 ribonucleoprotein (Utp) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: rRNA processing; LOCATED IN: small-subunit processome; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Small-subunit processome, Utp14 (InterPro:IPR006709); BEST Arabidopsis thaliana protein match is: U3 ribonucleoprotein (Utp) family protein (TAIR:AT4G02400. AT1G18060 unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 74 Blast hits to 74 proteins in 29 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). AT1G33055 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anaerobic respiration; LOCATED IN: endomembrane system; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G61210 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: S-adenosyl-L-methionine-depe AT5G63905 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT5G40460 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G27630.1); Has 87 Blast hits to 87 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G11070 unknown protein; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT1G02710 glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 94175 Blast hits to 22560 proteins in 1554 species: Archae - 109; Bacteria - 35702; Metazoa - 26912; Fungi - 5192; Plants - 9321; Viruses - 1410; Other Eukaryotes - 15529 (source: NCBI BLink). AT2G28780 unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: inflorescence meristem, root, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF939, bacterial (InterPro:IPR010343); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09450.1); Has 671 Blast hits to 667 proteins in 30 AT5G13610 Protein of unknown function (DUF155); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF155 (InterPro:IPR003734); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF155) (TAIR:AT1G69380.1 AT3G30160 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G35320.1); Has 9 Blast hits to 9 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukar AT5G44060 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G04000.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT2G30350 Excinuclease ABC, C subunit, N-terminal; FUNCTIONS IN: nuclease activity; INVOLVED IN: DNA repair; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Excinuclease ABC, C subunit, N-terminal (InterPro:IPR000305); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; AT5G37125 transposable element gene; Mutator-like transposase family, has a 8.0e-35 P-value blast match to GB:AAA21566 mudrA of transposon="MuDR" (MuDr-element) (Zea mays) AT4G19980 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: root, pedicel; EXPRESSED DURING: 4 anthesis; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT2G38250 Homeodomain-like superfamily protein; FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleolus; EXPRESSED IN: stamen; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is AT4G27870 Vacuolar iron transporter (VIT) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF125, transmembrane (InterPro:IPR008217); BEST Arabidopsis thaliana protein match is: vacuolar iron transporter (VIT) family protein (TAIR:AT4G27860.2); Has 285 AT3G53630 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G18692.1); Has 42 Blast hits to 42 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G27080 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein, group 2 (InterPro:IPR004864); BEST Arabidopsis thaliana protein match is: Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (TAIR:AT5G21130.1); Has 1062 Blast hits to 1061 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1062; Vir AT5G17190 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: endomembrane system, integral to membrane, endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: B-cell receptor-associated 31-like (InterPro:IPR008417); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03160.1); Has 18 AT5G60760 P-loop containing nucleoside triphosphate hydrolases superfamily protein; BEST Arabidopsis thaliana protein match is: P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT3G45090.1); Has 1216 Blast hits to 969 proteins in 195 species: Archae - 93; Bacteria - 85; Metazoa - 220; Fungi - 67; Plants - 127; Viruses - 43; Other Eukaryotes - 581 (source: NCBI BLink). AT1G53450 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14830.2); Has 71 Blast hits to 71 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 71; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G15470 Transducin/WD40 repeat-like superfamily protein; CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat, conserved site (InterPro:IPR019775), WD40 repeat (InterPro:IPR001680), G-protein beta WD-40 repeat, region (InterPro:IPR020472), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:I AT2G25640 SPOC domain / Transcription elongation factor S-II protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: transcription; LOCATED IN: nucleus; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue SPOC, C-terminal (InterPro:IPR012921), Transcription elongation factor S-IIM (InterPro:IPR017890), Transcription elongation factor S-II, central dom AT1G55040 zinc finger (Ran-binding) family protein; FUNCTIONS IN: binding, zinc ion binding; LOCATED IN: nucleus; EXPRESSED IN: cultured cell, seed; EXPRESSED DURING: E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: Ran BP2/NZF zinc finger-like superfamily protein (TAIR:AT1G70650.1); Has 22562 Blast hits to 12307 proteins in 10 AT4G27310 B-box type zinc finger family protein; FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: B-box type zinc finger family protein (TAIR:AT5G54470.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0 AT1G05340 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32210.1); Has 189 Blast hits to 189 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 21; Plants - 168; Viruses - 0; Other Eukaryote AT1G53645 hydroxyproline-rich glycoprotein family protein; Has 15375 Blast hits to 12179 proteins in 920 species: Archae - 8; Bacteria - 1425; Metazoa - 5915; Fungi - 2848; Plants - 1527; Viruses - 230; Other Eukaryotes - 3422 (source: NCBI BLink). AT4G16670 CONTAINS InterPro DOMAIN/s: Pleckstrin-like, plant (InterPro:IPR013666), Protein of unknown function DUF828 (InterPro:IPR008546), Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: Plant protein of unknown function (DUF828) with plant pleckstrin homology-like region (TAIR:AT4G17350.1); Has 215 Blast hits to 188 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 20 AT4G34600 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: pollen tube growth; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage, LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16385.1); Has 17 Blast hits to 17 proteins in 4 species: A AT5G46170 F-box family protein; CONTAINS InterPro DOMAIN/s: F-box domain, Skp2-like (InterPro:IPR022364); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G18380.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT1G50280 Phototropic-responsive NPH3 family protein; FUNCTIONS IN: signal transducer activity; INVOLVED IN: response to light stimulus; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot, leaf lamina base, leaf whorl, leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible, 4 leaf senescence stage; CONTAINS InterPro DOMAIN/s: NPH3 (InterPro:IPR004249), BTB/POZ fold (InterPro:IPR011333); BEST AT1G28760 Uncharacterized conserved protein (DUF2215); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2215 (InterPro:IPR019358); BEST Arabidopsis thaliana protein match is: Uncharacterized conserved protein (DUF2215) (TAIR:AT3G49840.1); Has 153 Blast hits to 153 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 67; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). AT3G56230 BTB/POZ domain-containing protein; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: BTB/POZ domain-containing protein (TAIR:AT1G01640.2); Has 5225 Blast hits to 5141 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 3910; Fungi - 3; Plants - 1048; Vir AT2G46910 Plastid-lipid associated protein PAP / fibrillin family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Plastid lipid-associated protein/fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: Plastid-lipid associated protein AT2G16660 Major facilitator superfamily protein; INVOLVED IN: response to karrikin; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: Major facilitator superfamily protein (TAIR:AT4G3495 AT5G36920 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G36925.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT5G12010 unknown protein; INVOLVED IN: response to salt stress; LOCATED IN: chloroplast, plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G29780.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (sou AT5G61450 P-loop containing nucleoside triphosphate hydrolases superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NC AT1G71850 Ubiquitin carboxyl-terminal hydrolase family protein; CONTAINS InterPro DOMAIN/s: RNA recognition domain, plant (InterPro:IPR021099); BEST Arabidopsis thaliana protein match is: Ubiquitin carboxyl-terminal hydrolase family protein (TAIR:AT4G24320.1); Has 758 Blast hits to 736 proteins in 101 species: Archae - 0; Bacteria - 6; Metazoa - 59; Fungi - 84; Plants - 429; Viruses - 8; Other Eukaryotes - 172 (source: NCBI BLink). AT1G02660 alpha/beta-Hydrolases superfamily protein; FUNCTIONS IN: triglyceride lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: alpha/beta-Hydrolases superfamily protein (TAIR:AT3G62590.1); Has 7 AT3G59630 diphthamide synthesis DPH2 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peptidyl-diphthamide biosynthetic process from peptidyl-histidine; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Diphthamide synthesis, DPH1/DHP2 (InterPro:IPR002728), Diphthamide synthesis, DHP2 (InterPro:IPR01001 AT1G59910 Actin-binding FH2 (formin homology 2) family protein; FUNCTIONS IN: actin binding; INVOLVED IN: cellular component organization, actin cytoskeleton organization; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Actin-binding FH2/DRF autoregulatory (InterPro:IPR003104), Actin-binding FH2 (InterPro:IPR015425); BEST Arabidopsis thal AT1G80690 PPPDE putative thiol peptidase family protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: PPPDE putative thiol peptidase family protein (TAIR:AT5G25170.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source AT5G01990 Auxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport, transmembrane transport; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: Auxin efflux carrier family protein (TAIR:AT1G71090 AT3G27220 Galactose oxidase/kelch repeat superfamily protein; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: Galactose oxidase/kelch repeat superfamily protein (TAIR:AT1G51540.1); Has 1505 Blast hits to 1317 proteins in 198 species: Archae - 25; Bacteria - 276; Metazo AT5G08220 unknown protein; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G55400 Actin binding Calponin homology (CH) domain-containing protein; FUNCTIONS IN: actin binding; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Actinin-type, actin-binding, conserved site (InterPro:IPR001589), Calponin-homology (InterPro:IPR016146), Calponin-like actin-binding (InterPro:IPR001715); BEST Arabidopsis thaliana protein match is: fim AT5G13770 Pentatricopeptide repeat (PPR-like) superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR-like) superfamily protein (TA AT1G06420 unknown protein; Has 1017 Blast hits to 654 proteins in 124 species: Archae - 0; Bacteria - 39; Metazoa - 232; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 637 (source: NCBI BLink). AT4G17670 Protein of unknown function (DUF581); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF581) (TAIR:AT5G47060.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT4G39670 Glycolipid transfer protein (GLTP) family protein; FUNCTIONS IN: glycolipid transporter activity, glycolipid binding; INVOLVED IN: glycolipid transport; LOCATED IN: cytoplasm; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Glycolipid transfer protein, GLTP (InterPro:IPR014830); BEST Arabidopsis thaliana protein match is: Glycolipid transfer protein (GLTP) family protein (T AT5G62960 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10660.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). AT5G64450 BEST Arabidopsis thaliana protein match is: Putative endonuclease or glycosyl hydrolase (TAIR:AT3G62200.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT3G03150 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17165.1); Has 39 Blast hits to 39 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryote AT3G25640 Protein of unknown function, DUF617; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF617, plant (InterPro:IPR006460); BEST Arabidopsis thaliana protein match is: Protein of unknown function, DUF617 (TAIR:AT5G23100.1); Has 258 Blast hits to 256 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 258; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT4G12990 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G53770 late embryogenesis abundant 3 (LEA3) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; EXPRESSED IN: flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein, group 3 (InterPro:IPR004926); Has 104 Blast hits to 88 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 104; AT1G70200 RNA-binding (RRM/RBD/RNP motifs) family protein; FUNCTIONS IN: nucleic acid binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504); Has 4744 Blast hits to 3664 proteins in 382 species: Archae - 19; Bacteria - 294; Metazoa - 1723; Fungi - 497; Plants - 212; Viruses - 61; Other Eukaryotes AT4G30760 Putative endonuclease or glycosyl hydrolase; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: Putative endonuclease or glycosyl hydrolase (TAIR:AT3G62050.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - AT1G18660 zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ATP-dependent peptidase activity, binding, zinc ion binding; INVOLVED IN: proteolysis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Tetratricopeptide-like helical (InterPro:IPR011990), Zi AT1G79070 SNARE-associated protein-related; Has 39 Blast hits to 39 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). AT1G10410 Protein of unknown function (DUF1336); INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1336) (TAIR:AT1G59650.1); Has 292 Blast hits to 292 proteins in 32 s AT5G04860 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G11760.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT1G76980 BEST Arabidopsis thaliana protein match is: embryo defective 2170 (TAIR:AT1G21390.1); Has 65 Blast hits to 65 proteins in 23 species: Archae - 0; Bacteria - 8; Metazoa - 1; Fungi - 8; Plants - 40; Viruses - 3; Other Eukaryotes - 5 (source: NCBI BLink). AT1G70770 Protein of unknown function DUF2359, transmembrane; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endoplasmic reticulum, nucleus, plasma membrane, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2359, transmembrane (InterPro:IPR019308); BEST Arabidopsis thaliana protein match is: Protein of unknown AT3G21530 DNAse I-like superfamily protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); BEST Arabidopsis thaliana protein match is: DNAse I-like superfamily protein (TAIR:AT2G48030.1); Has 250 Blast hits to 250 proteins in 102 species: Archae - 0; Bacteria - 169; Metazoa - 0; Fungi - AT3G59680 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; Has 34 Blast hits to 34 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G50350 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT3G10020 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress, anaerobic respiration; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 47 Blast hits to 47 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G02750 Drought-responsive family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to water deprivation; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Drought induced 19/ RING finger protein 114 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: Drought-responsive family AT2G36950 Heavy metal transport/detoxification superfamily protein ; FUNCTIONS IN: copper ion binding, metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabido AT5G37070 Protein of unknown function, DUF538; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: Protein of unknown function, DUF538 (TAIR:AT3G08890.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT5G55100 SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Splicing factor, suppressor of white apricot (InterPro:IPR019147), SWAP/Surp (InterPro:IPR000061); Has 30201 Blast hits to 17322 proteins in 780 AT4G13615 Uncharacterised protein family SERF; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family SERF (InterPro:IPR007513); BEST Arabidopsis thaliana protein match is: Uncharacterised protein family SERF (TAIR:AT3G24100.1); Has 151 Blast hits to 151 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 66; Fungi - 10; Plants - 70; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). AT5G13780 Acyl-CoA N-acyltransferases (NAT) superfamily protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase, C-terminal (InterPro:IPR022610), GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransfe AT3G44330 INVOLVED IN: protein processing; LOCATED IN: mitochondrion, endoplasmic reticulum, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nicalin (InterPro:IPR016574), EF-Hand 1, calcium-binding site (InterPro:IPR018247), Nicastrin (InterPro:IPR008710); Has 245 Blast hits to 243 proteins in 99 species: Archae - 6; Bacteria - 10; Metazoa - 139; F AT2G29670 Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026), Tetratricopeptide repeat (InterPro:IPR019734); BEST Arabidopsis thaliana protein match is: Tetratricopeptide AT3G07210 unknown protein; Has 97 Blast hits to 85 proteins in 31 species: Archae - 0; Bacteria - 14; Metazoa - 7; Fungi - 19; Plants - 37; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). AT4G35930 F-box family protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G61340.1); Has 94 Blast hits to 94 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 94; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G62080 SNF7 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); Has 1192 Blast hits to 1169 proteins in 233 species: Archae - 26; Bacteria - 65; Metazoa - 638; Fungi - 121; Plants - 165; Viruses - 1; Other Eukaryotes - AT1G67920 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24600.1); Has 22 Blast hits to 22 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G16270 ENTH/VHS family protein; INVOLVED IN: intracellular protein transport; LOCATED IN: membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), Epsin, N-terminal (InterPro:IPR001026), ENTH/VHS (InterPro:IPR008942); Has 168 Blast hits to 159 proteins in 72 species: Archae - 0; Bacteria - 9; Metazoa - 51; Fungi - 0; Plants - 44; Viruses - 0; Ot AT3G04160 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage. AT2G24650 DNA binding;DNA binding;sequence-specific DNA binding transcription factors; FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: transcriptional factor B3 family protein (TAIR:AT2G24680.1); Has 1264 Blast hits to 28 AT5G16110 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G02555.1); Has 133 Blast hits to 133 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 133; Viruses - 0; Other Eukaryote AT5G53800 unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT2G27090 Protein of unknown function (DUF630 and DUF632); INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF630 (InterPro:IPR006868), Protein of unknown function DUF632 (InterPro:IPR006867); BEST Arabidopsis thaliana protein match is: Protein of unknown func AT1G54840 HSP20-like chaperones superfamily protein; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: HSP20-like chaperones superfamily protein (TAIR:AT1G54850.1); Has 96 Blast hits to 86 proteins in 17 species: Archae - 0; Bacteria - 13; Metazoa - 0; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 0 (source: NCBI B AT2G48030 DNAse I-like superfamily protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); BEST Arabidopsis thaliana protein match is: DNAse I-like superfamily protein (TAIR:AT3G21530.1); Has 404 Blast hits to 404 proteins in 167 species: Archae - 0; B AT2G46600 Calcium-binding EF-hand family protein; FUNCTIONS IN: calcium ion binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992); BEST Arabidopsis thaliana protein match is: pinoid-binding protein 1 AT3G17680 Kinase interacting (KIP1-like) family protein; CONTAINS InterPro DOMAIN/s: KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: Kinase interacting (KIP1-like) family protein (TAIR:AT1G48405.1). AT3G10300 Calcium-binding EF-hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-ha AT4G18630 Protein of unknown function (DUF688); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF688 (InterPro:IPR007789); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF688) (TAIR:AT5G45850.1); Has 118 Blast hits to 95 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 3; Plants - 90; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). AT5G66815 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: root; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT3G07150 unknown protein; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G66650 Protein of unknown function (DUF607); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF607 (InterPro:IPR006769); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF607) (TAIR:AT2G23790.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT3G15530 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: S-adenosyl-L-methionine-depe AT3G23260 F-box and associated interaction domains-containing protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), F-box associated domain, type 1 (InterPro:IPR006527), F-box associated interaction domain (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box and associated interaction domains-containing protein (TAIR:AT3G21120.1); Has 1 AT3G44820 Phototropic-responsive NPH3 family protein; FUNCTIONS IN: signal transducer activity; INVOLVED IN: response to light stimulus; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, 4 anthesis, 4 leaf senescence stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: NPH3 (InterPro:IPR004249), BTB/POZ (I AT3G26730 RING/U-box superfamily protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841); Has 5292 Blast hits to 2238 proteins in 281 species: Archae - 3; Bacteria - 121; AT2G38820 Protein of unknown function (DUF506) ; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF506) (TAIR:AT3G22970.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). AT3G19630 Radical SAM superfamily protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity, RNA methyltransferase activity; INVOLVED IN: rRNA processing; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal RNA large subunit methyltransferase RlmN; (InterPro:IPR004383), Radical SAM (InterPro:IPR007197); BEST Arabidopsis thalian AT5G17640 Protein of unknown function (DUF1005); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1005 (InterPro:IPR010410); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1005) (TAIR:AT1G10020.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT5G11090 serine-rich protein-related; BEST Arabidopsis thaliana protein match is: serine-rich protein-related (TAIR:AT5G25280.2); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT5G05220 unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT5G06130 chaperone protein dnaJ-related; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61670.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT5G19540 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT3G61100 Putative endonuclease or glycosyl hydrolase; BEST Arabidopsis thaliana protein match is: Putative endonuclease or glycosyl hydrolase (TAIR:AT3G61090.1); Has 98 Blast hits to 98 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 98; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT4G36090 oxidoreductase, 2OG-Fe(II) oxygenase family protein; BEST Arabidopsis thaliana protein match is: 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein (TAIR:AT2G17970.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). AT3G27210 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40860.1); Has 133 Blast hits to 98 proteins in 25 species: Archae - 0; Bacteria - 6; Metazoa - 32; Fungi - 7; Plants - 70; Viruses - 0; Other AT5G03880 Thioredoxin family protein; FUNCTIONS IN: electron carrier activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin active site (InterPro:IPR011767), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin AT2G25270 unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G12400.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). AT4G00440 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF3741 (InterPro:IPR022212); BEST Arabidopsis thaliana protein match is: Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-related (TAIR:AT2G45900.1); Has AT4G22560 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12450.1); Has 380 Blast hits to 380 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 374; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G56270 unknown protein; Has 38 Blast hits to 38 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G27300 unknown protein; Has 54 Blast hits to 54 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 6; Plants - 34; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). AT5G53710 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryot AT2G45920 U-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: U box domain (InterPro:IPR003613); BEST Arabidopsis thaliana protein match is: RING/U-box superfamily protein (TAIR:AT3G61390.2); Has 35333 Blast hits to 34131 AT1G16170 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G79660.1); Has 55 Blast hits to 55 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 55; Viruses - 0; O AT4G21310 Protein of unknown function (DUF1218); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1218) (TAIR:A AT5G65880 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT2G32210 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32190.1); Has 214 Blast hits to 214 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 10; Plants - 203; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G19660 Wound-responsive family protein; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: response to wounding, nucleotide-excision repair; EXPRESSED IN: ovule; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF151 (InterPro:IPR003729), UvrB/UvrC protein (InterPro:IPR001943); BEST Arabidopsis thaliana protein match is: bifunctional nuclease in basal defense response 1 (TAIR:AT1G75380.3); Has 886 Blast AT3G45840 Cysteine/Histidine-rich C1 domain family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type, conserved site (InterPro:IPR019786), DC1 (InterPro:IPR004146), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: Cysteine/Histidine-rich C AT2G38465 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; Has 16 Blast hits to 16 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G54970 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G26960.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT3G26510 Octicosapeptide/Phox/Bem1p family protein; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); BEST Arabidopsis thaliana protein match is: octicosapeptide/Phox/Bem1p (PB1) domain-containing protein (TAIR:AT1G70640.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NC AT5G05190 Protein of unknown function (DUF3133); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF3133 (InterPro:IPR021480); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF3133) (TAIR:AT3G56410.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT1G21670 LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40-like Beta Propeller (InterPro:IPR011659), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: DPP6 N-terminal domain-like protein (TAIR:AT1G21680.1); Has 8461 Blast hits to 5060 proteins in 1257 species: Archae - 79; Bact AT1G24575 unknown protein; Has 7 Blast hits to 7 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G24620 Encodes a EF-hand calcium-binding protein family member. Mutants exhibit longer root hairs under phosphate-deficient conditions. AT2G21180 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19875.1); Has 124 Blast hits to 124 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 124; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G61260 Plant calmodulin-binding protein-related; CONTAINS InterPro DOMAIN/s: Calmodulin-binding protein, plant (InterPro:IPR012417); BEST Arabidopsis thaliana protein match is: Plant calmodulin-binding protein-related (TAIR:AT5G07820.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT4G08050 transposable element gene; gypsy-like retrotransposon family (Athila), has a 0. P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana) AT2G33570 Domain of unknown function (DUF23); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF23 (InterPro:IPR008166); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF23) (TAIR:AT5G44670.1); Has 195 Blast hits to 195 proteins in 24 species: Archae - 2; Bacteria - 7; Metazoa - 43; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). AT5G01380 Homeodomain-like superfamily protein; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is: Homeodomain-like superfamily protein (TAIR:AT2G38250.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT1G76970 Target of Myb protein 1; FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), Target of Myb protein 1 (InterPro:IPR014645), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR01 AT3G56880 VQ motif-containing protein; CONTAINS InterPro DOMAIN/s: VQ (InterPro:IPR008889); BEST Arabidopsis thaliana protein match is: calmodulin (CAM)-binding protein of 25 kDa (TAIR:AT2G41010.1); Has 109 Blast hits to 109 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 106; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G05410 Photosystem II reaction center PsbP family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: oxygen evolving complex, extrinsic to membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR AT3G26950 unknown protein; Has 27 Blast hits to 27 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G55690 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G39870.1); Has 76 Blast hits to 69 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 3; Plants - 69; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT4G24590 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49710.3); Has 105 Blast hits to 105 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 3; Plants - 85; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). AT1G10140 Uncharacterised conserved protein UCP031279; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP031279 (InterPro:IPR016972); BEST Arabidopsis thaliana protein match is: Uncharacterised conserved protein AT3G60520 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02070.1); Has 107 Blast hits to 107 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 107; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G70985 hydroxyproline-rich glycoprotein family protein; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT1G23050.1); Has 1488 Blast hits to 893 proteins in 162 species: Archae - 2; Bacteria - 187; Metazoa - 240; Fungi - 90; Plants - 878; Viruses - 17; Other Eukaryotes - 74 (source: NCBI BLink). AT3G47080 Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G07280.3); Has 387 Blas AT5G03210 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages; Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G21550 Calcium-binding EF-hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-han AT5G44570 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, hypocotyl, sepal, flower, leaf; EXPRESSED DURING: petal differentiation and expansion stage, LP.08 eight leaves visible; Has 7 Blast hits to 7 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (sou AT2G13550 unknown protein; Has 23 Blast hits to 20 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). AT1G69360 Plant protein of unknown function (DUF863); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF863, plant (InterPro:IPR008581); BEST Arabidopsis thaliana protein match is: Plant protein of unknown function (DUF863) (TAIR:AT1G26620.1); Has 257 Blast hits to 226 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 2; Plants - 245; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). AT4G27652 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27657.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT4G22320 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55210.1); Has 8953 Blast hits to 5363 proteins in 542 species: Archae - 33; Bacteria - 806; Metazoa - 2454; Fungi - 831; Plants - 279; Viruses - 151; Other Eukaryotes - 4399 (source: NCBI BLink). AT2G47710 Adenine nucleotide alpha hydrolases-like superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arab AT5G55150 Protein of unknown function (DUF295); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein with a domain of unknown function (DUF295) (TAIR:AT2G26160.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (sour AT1G65500 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G65486.1); Has 23 Blast hits to 23 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Euk AT3G57070 Glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: N-terminal protein myristoylation, cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336 AT1G61660 basic helix-loop-helix (bHLH) DNA-binding superfamily protein; FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011 AT1G53460 BEST Arabidopsis thaliana protein match is: Ran BP2/NZF zinc finger-like superfamily protein (TAIR:AT1G70650.2); Has 485 Blast hits to 413 proteins in 88 species: Archae - 11; Bacteria - 27; Metazoa - 119; Fungi - 17; Plants - 101; Viruses - 2; Other Eukaryotes - 208 (source: NCBI BLink). AT1G55930 CBS domain-containing protein / transporter associated domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Transporter-associated domain (InterPro:IPR005170), Cystathion AT4G14740 FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Pleckstrin-like, plant (InterPro:IPR013666), Protein of unknown function DUF828 (InterPro:IPR008546); BEST Arabidopsis thaliana protein match is: Plant protein of unknown function (DUF828) with plant pleckstrin homology-like region (TAIR:AT3G22810.1); Has 30201 Blast hits to 17322 proteins i AT2G13270 transposable element gene; similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42120.1) AT3G60420 Phosphoglycerate mutase family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Histidine phosphatase superfamily, clade-1 (InterPro:IPR013078); BEST Arabidopsis thaliana protein match is: Phosphoglycerate mutase family protein (TAIR:AT3G60450.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 1 AT3G02700 NC domain-containing protein-related; CONTAINS InterPro DOMAIN/s: NC (InterPro:IPR007053); BEST Arabidopsis thaliana protein match is: NC domain-containing protein-related (TAIR:AT5G16360.1); Has 186 Blast hits to 185 proteins in 40 species: Archae - 0; Bacteria - 31; Metazoa - 10; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). AT1G35820 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G30520.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT2G23440 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: root; Has 25 Blast hits to 25 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G56410 Protein of unknown function (DUF3133); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF3133 (InterPro:IPR021480); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF3133) (TAIR:AT5G05190.1) AT2G35260 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17840.1); Has 42 Blast hits to 42 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 0 AT5G57340 unknown protein; Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). AT4G29440 Regulator of Vps4 activity in the MVB pathway protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: Regulator of Vps4 AT1G70470 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23530.1); Has 64 Blast hits to 64 proteins in 22 species: Archae - 0; Bacteria - 2; Metazoa - 7; Fungi - 10; Plants - 43; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). AT2G20515 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; Has 71 Blast hits to 71 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 71; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G23240 Caleosin-related family protein; CONTAINS InterPro DOMAIN/s: Caleosin related (InterPro:IPR007736); BEST Arabidopsis thaliana protein match is: Caleosin-related family protein (TAIR:AT1G70670.1); Has 342 Blast hits to 337 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 60; Plants - 279; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). AT3G10250 Plant protein 1589 of unknown function; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: Plant protein 1589 of unknown function (TAIR:AT5G04090.2); Has 239 Blast hits to 239 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 215; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). AT5G41640 Protein of unknown function (DUF626); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24388.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT3G19200 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G34419.1); Has 51 Blast hits to 51 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G25730 unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages. AT3G12910 NAC (No Apical Meristem) domain transcriptional regulator superfamily protein; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC domain containing protein 42 (TAIR:AT2G43000.1); Has 2920 Blast hits to 2915 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2920; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink) AT4G30410 sequence-specific DNA binding transcription factors; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57780.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). AT4G22740 glycine-rich protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Myelodysplasia-myeloid leukemia factor 1-interacting protein (InterPro:IPR019376); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45380.1); Has 30201 Blast hits to 17322 proteins in 780 species: A AT1G74450 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein BYPASS related (InterPro:IPR008511); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF793) (TAIR:AT1G18740.1); Has 215 Blast hits to 212 proteins in 19 species: Archae - 0; Bacteria - 0; Metazo AT1G74940 Protein of unknown function (DUF581); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF581) (TAIR:AT1G19200.1); Has 483 Blast hits to 483 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 483; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G33700 Beta-glucosidase, GBA2 type family protein; FUNCTIONS IN: catalytic activity, glucosylceramidase activity; INVOLVED IN: glucosylceramide catabolic process, sphingolipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Glucosylceramidase (InterPro:IPR006775), Six-hairpin glycosidase-like (Inter AT4G36790 Major facilitator superfamily protein; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transmembrane transport; LOCATED IN: membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily (InterPro:IPR020846), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major faci AT1G78070 Transducin/WD40 repeat-like superfamily protein; CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat, conserved site (InterPro:IPR019775), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD40 repeat, subgroup (InterPro:IPR019781); AT3G52480 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage; Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NC AT4G36600 Late embryogenesis abundant (LEA) protein; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein, group 4 (InterPro:IPR004238); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant domain-containing protein / LEA domain-containing protein (TAIR:AT2G18340.1); Has 1483 Blast hits to 893 proteins in 345 species: Archae - 4; Bacteria - 836; Metazoa - 93; Fungi - 47; Plants - 352; Viruses - 1; Other AT1G03250 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages. AT3G48200 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 210 Blast hits to 148 proteins in 42 species: Archae - 0; Bacteria - 118; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink). AT1G02820 Late embryogenesis abundant 3 (LEA3) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryo development, response to stress; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein, group 3 (InterPro:IPR004926); BEST Arabidopsis thaliana protein match is: senescence-associated gene 21 (TAIR:AT4G02380.1 AT1G52790 encodes a putative oxidoreductase, 2OG-Fe(II) oxygenase family protein, similar to GS-AOP loci (GI:16118889, GI:16118887, GI:16118891, GI:16118893); contains PF03171 2OG-Fe(II) oxygenase superfamily domain AT3G53540 unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF3741 (InterPro:IPR022212); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF3741) (TAIR:AT4G28760.2); Has 1710 Blast hits to 868 proteins in 206 species: Archae - 2; Bacteria - 409; Metazoa - 304; Fungi - 204 AT4G33980 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to karrikin; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: cold regulated gene 27 (TAIR:AT5G42900.3). AT4G19450 Major facilitator superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match i AT3G46960 The gene encodes a DExD⁄H box RNA helicase, involved in the regulation of K+ deprivation stress response. AT1G13340 Regulator of Vps4 activity in the MVB pathway protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: Regulator of Vps4 activity in the MVB pathway protein (TAIR:AT1G34220.2); Has 628 Blast hits to 628 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 164; Fungi - 130; Plants - 284; Viruses - 0; Other Eukaryotes - 50 (source AT1G12020 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62422.1); Has 89 Blast hits to 88 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). AT2G33690 Late embryogenesis abundant protein, group 6; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein, group 6 (InterPro:IPR018930); BEST Arabidopsis thaliana protein match is: Late embryogenesis abundant protein, group 6 (TAIR:AT2G23120.1); Has 37 Blast hits to 37 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G72800 RNA-binding (RRM/RBD/RNP motifs) family protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabido AT3G63270 CONTAINS InterPro DOMAIN/s: Putative harbinger transposase-derived nuclease (InterPro:IPR006912); BEST Arabidopsis thaliana protein match is: PIF / Ping-Pong family of plant transposases (TAIR:AT3G55350.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT1G30200 F-box family protein; CONTAINS InterPro DOMAIN/s: F-box domain, Skp2-like (InterPro:IPR022364); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G46170.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). AT3G01830 Calcium-binding EF-hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-han AT1G14780 MAC/Perforin domain-containing protein; CONTAINS InterPro DOMAIN/s: Membrane attack complex component/perforin (MACPF) domain (InterPro:IPR020864); BEST Arabidopsis thaliana protein match is: MAC/Perforin domain-containing protein (TAIR:AT4G24290.2); Has 221 Blast hits to 220 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 0; Plants - 202; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G46150 LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF284, transmembrane eukaryotic (InterPro:IPR005045); BEST Arabidopsis thaliana protein match is: ALA AT3G50910 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G66480.1); Has 76 Blast hits to 75 proteins in 28 species: Archae - 0; Bacteria - 10; Metazoa - 7; Fungi - 2; Plants - 49; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). AT1G70280 NHL domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL domain-containing AT1G23710 Protein of unknown function (DUF1645); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1645 (InterPro:IPR012442); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1645) (TAIR:AT1G70420.1); Has 288 Blast hits to 282 proteins in 52 species: Archae - 0; Bacteria - 6; Metazoa - 16; Fungi - 11; Plants - 191; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). AT1G21790 TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM/LAG1/CLN8 homology domain (InterPro:IPR006634); Has 174 Blast hits to 174 proteins in 42 species: Archae - 0; Bac AT1G50730 unknown protein; Has 218 Blast hits to 209 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 2; Plants - 33; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). AT3G59820 LETM1-like protein; LOCATED IN: mitochondrion; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), LETM1-like (InterPro:IPR011685); BEST Arabidopsis thaliana protein match is: LETM1-like protein (TAIR:AT1G65540.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae AT1G62420 Protein of unknown function (DUF506) ; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF506) (TAIR:AT1G12030.1); Has 389 Blast hits to 387 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 387; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). AT2G35800 mitochondrial substrate carrier family protein; FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: transport, transmembrane transport; LOCATED IN: mitochondrial inner membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HA AT1G70990 proline-rich family protein; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT1G23040.1); Has 16801 Blast hits to 6974 proteins in 537 species: Archae - 26; Bacteria - 1654; Metazoa - 5189; Fungi - 1184; Plants - 5387; Viruses - 1054; Other Eukaryotes - 2307 (source: NCBI BLink). AT5G24500 unknown protein; Has 133 Blast hits to 129 proteins in 40 species: Archae - 2; Bacteria - 0; Metazoa - 60; Fungi - 5; Plants - 29; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). AT2G26370 MD-2-related lipid recognition domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein (TAIR:AT5G23820.1); Has 39 Blast hits to 39 proteins in 2 spec AT4G08360 KOW domain-containing protein; BEST Arabidopsis thaliana protein match is: global transcription factor group A2 (TAIR:AT4G08350.1); Has 122 Blast hits to 122 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 70; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). AT3G13050 Major facilitator superfamily protein; FUNCTIONS IN: carbohydrate transmembrane transporter activity, transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS Int AT5G63130 Octicosapeptide/Phox/Bem1p family protein; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); BEST Arabidopsis thaliana protein match is: Octicosapeptide/Phox/Bem1p family protein (TAIR:AT3G48240.1); Has 353 Blast hits to 353 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 353; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT4G13030 P-loop containing nucleoside triphosphate hydrolases superfamily protein; Has 75 Blast hits to 75 proteins in 36 species: Archae - 0; Bacteria - 37; Metazoa - 10; Fungi - 2; Plants - 25; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). AT5G64230 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19920.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Met AT1G02270 Calcium-binding endonuclease/exonuclease/phosphatase family; FUNCTIONS IN: catalytic activity, calcium ion binding; INVOLVED IN: response to cold; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); BEST AT1G16500 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G79160.1); Has 136 Blast hits to 134 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 131; Viruses - 1; Other Eukaryotes - 0 (source: NCBI BLink). AT1G79520 Cation efflux family protein; FUNCTIONS IN: cation transmembrane transporter activity; INVOLVED IN: cation transport, transmembrane transport; LOCATED IN: membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: Cation efflux family protein (TAIR:AT1G16310.1). AT1G48200 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G67040 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G26910.3); Has 89 Blast hits to 84 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 2; Plants - 82; Viruses - 0; O AT3G11720 Polyketide cyclase/dehydrase and lipid transport superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06440.3); Has 1338 Blast hits to 1079 proteins in 231 species: Archae - 0; Bacteria - 187; Metazoa - 420; Fungi - 131; Plants - 130; Viruses - 9; Other Eukaryotes - 461 (source: NCBI BLink). AT2G27790 RNA-binding (RRM/RBD/RNP motifs) family protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidop AT4G32240 unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT3G29970 B12D protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: F mature embryo stage, 4 leaf senescence stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: B12D (InterPro:IPR010530); BEST Arabidopsis thaliana prote AT4G19860 alpha/beta-Hydrolases superfamily protein; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); BEST Arabidopsis thaliana protein match is: lecithin:cholesterol acylt AT3G03170 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G24890.1); Has 184 Blast hits to 184 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 184; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G13950 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02290.1). AT5G66820 unknown protein; Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). AT5G13090 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24270.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT5G23830 MD-2-related lipid recognition domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein (TAIR:AT5G23820.1); Has 18 AT5G62510 F-box family protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), F-box associated domain, type 3 (InterPro:IPR013187), F-box associated interaction domain (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box and associated interaction domains-containing protein (TAIR:AT5G62660.1); Has 2027 Blast hits to 1969 proteins in 49 spec AT2G42220 Rhodanese/Cell cycle control phosphatase superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: Rhodanese/Cell cycle cont AT3G14060 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G54120.1); Has 30 Blast hits to 30 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G39000 Acyl-CoA N-acyltransferases (NAT) superfamily protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase, C-terminal (InterPro:IPR022610), GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPr AT4G36850 PQ-loop repeat family protein / transmembrane family protein; CONTAINS InterPro DOMAIN/s: Cystinosin/ERS1p repeat (InterPro:IPR006603); BEST Arabidopsis thaliana protein match is: PQ-loop repeat family protein / transmembrane family protein (TAIR:AT2G41050.1); Has 883 Blast hits to 635 proteins in 156 species: Archae - 0; Bacteria - 0; Metazoa - 204; Fungi - 499; Plants - 92; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BL AT5G13200 GRAM domain family protein; CONTAINS InterPro DOMAIN/s: GRAM (InterPro:IPR004182); BEST Arabidopsis thaliana protein match is: GRAM domain family protein (TAIR:AT2G22475.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT5G05910 RING/U-box superfamily protein; FUNCTIONS IN: zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); BEST Arabidopsis thaliana protein match is: RING/U-box superfamily protein (TAIR:AT5G37250.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Euk AT3G16660 Pollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen/extensin (InterPro:IPR006041); BEST Arabidopsis thaliana protein match is: Pollen Ole e 1 allergen and extensin family protein (TAIR:AT3G16670.1); Has 273 Blast hits to 210 proteins in 63 species: A AT5G20700 Protein of unknown function (DUF581); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF581) (TAIR:AT1G74940.1); Has 476 Blast hits to 476 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 476; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT4G26460 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: SAM dependent carboxyl methyltransferase (InterPro:IPR005299); BEST Arabidopsis thaliana protein match is: S-adenosyl-L-methionine-dependent methyltransferase AT2G42370 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58110.2); Has 205 Blast hits to 191 proteins in 60 species: Archae - 3; Bacteria - 23; Metazoa - 73; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). AT1G73930 unknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1630 (InterPro:IPR012860); Has 290 Blast hits to 263 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 148; Fungi - 30; Plants - 49; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). AT3G50920 Phosphatidic acid phosphatase (PAP2) family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: Phosphatidic acid phosphatase AT4G30993 Calcineurin-like metallo-phosphoesterase superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 29 AT4G08310 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone chaperone domain CHZ (InterPro:IPR019098); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G44780.2); Has 53711 Blast hits to 33687 proteins in 1618 sp AT2G20250 unknown protein; Has 10 Blast hits to 10 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G18670 RING/U-box superfamily protein; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); BEST Arabidopsis thaliana protein match is: RING/U-box superfamily protein (TAIR:AT4G30370.1); Has 8378 Blast hits to 8356 proteins in 272 species: Archae AT3G30360 transposable element gene; similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G18420.1); similar to hypothetical protein 26.t00076 [Brassica oleracea] (GB:ABD65021.1) AT5G64170 dentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G54500.2); Has 181 Blast hits to 169 proteins in 40 species: Archae - 2; Bacteria - 18; Metazoa - 17; Fungi - 0; Plan AT5G25070 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT1G32920 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to wounding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G32928.1); Has 42 Blast hits to 42 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryo AT4G26130 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56980.1); Has 121 Blast hits to 116 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 113; Viruses - 0; Oth AT4G19160 unknown protein; Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). AT5G10695 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57123.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT5G52900 unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT2G31720 FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508), Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT2G18810.1); Has 146 Blast hits to 146 proteins in 5 species: Archae - AT4G05636 transposable element gene; similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32161.1) AT5G05800 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G11290.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT5G35180 FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769), Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: ENHANCED DISEASE RESISTANCE 2 (TAIR:AT4G19040.1); Has 454 Blast hits to 426 proteins AT5G05180 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G10880.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT5G19630 alpha/beta-Hydrolases superfamily protein; Has 1062 Blast hits to 1062 proteins in 417 species: Archae - 16; Bacteria - 763; Metazoa - 1; Fungi - 28; Plants - 66; Viruses - 0; Other Eukaryotes - 188 (source: NCBI BLink). AT5G26290 TRAF-like family protein; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: TRAF-like family protein (TAIR:AT5G26280.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT3G60980 Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: glutamine-rich protein 23 (TAIR:AT1G10270.1); Has 2028 Blast hits to 1422 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2019; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). AT3G59440 Calcium-binding EF-hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF-hand (InterPro:IPR018248); BEST AT5G04910 unknown protein; Has 71 Blast hits to 71 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). AT5G39570 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT3G29075.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Othe AT5G50330 Protein kinase superfamily protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, catalytic domain (InterPro:IPR000719), Protein kinase-like domain (InterPro:IPR011009); BEST AT4G10970 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.2); Has 72 Blast hits to 50 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; O AT2G21350 RNA-binding CRS1 / YhbY (CRM) domain protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA-binding CRS1 / YhbY (CRM) domain protein (TAIR:AT4G39040.2); Has 1900 Blast hits to 1900 proteins in 975 species: Archae - 2; Bacteria - 1806; Meta AT1G04000 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G44060.1); Has 62 Blast hits to 62 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G38200 Class I glutamine amidotransferase-like superfamily protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: glutamine metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidase C26 (InterPro:IPR011697), Glutamine amidotransferase type 1 (InterPro:IPR017926); BEST Arabidopsis thaliana protein match is: Class I glutamine amidotransferase-like superfamily protein (TAIR:AT1G66860. AT4G24170 ATP binding microtubule motor family protein; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: Kinesin, motor region, conserved site (InterPro:IPR019821), Protein of unknown function DUF3490 (InterPro:IPR021881), Kinesin, mo AT5G61670 Encodes a close homolog of the Cauliflower OR (Orange) protein. The function of OR is to induce the differentiation of proplastids or other noncolored plastids into chromoplasts for carotenoid accumulation. Both proteins contain a Cysteine-rich zinc finger domain that is highly specific to DnaJ-like molecular chaperons. AT5G47635 Pollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen/extensin (InterPro:IPR006041); BEST Arabidopsis thaliana protein match is: Pollen Ole AT5G52550 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25670.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT5G50335 unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT1G73750 Uncharacterised conserved protein UCP031088, alpha/beta hydrolase; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP031088, alpha/beta hydrolase, At1g15070 (InterPro:IPR016969), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: Uncharacterised conserved protein UCP031088, alpha/beta hydrolase (TAIR:AT1G15060.1); Has 187 Blast hits to 154 proteins in 46 sp AT2G19680 Mitochondrial ATP synthase subunit G protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondria AT2G46940 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62070.1); Has 143 Blast hits to 141 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G26990 Drought-responsive family protein; CONTAINS InterPro DOMAIN/s: Drought induced 19/ RING finger protein 114 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: Drought-responsive family protein (TAIR:AT3G05700.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT1G66080 unknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF775 (InterPro:IPR008493); Has 285 Blast hits to 283 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 88; Plants - 50; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). AT5G52530 dentin sialophosphoprotein-related; Has 931 Blast hits to 739 proteins in 178 species: Archae - 6; Bacteria - 85; Metazoa - 392; Fungi - 124; Plants - 76; Viruses - 5; Other Eukaryotes - 243 (source: NCBI BLink). AT5G25280 serine-rich protein-related; BEST Arabidopsis thaliana protein match is: serine-rich protein-related (TAIR:AT5G11090.1); Has 1306 Blast hits to 350 proteins in 64 species: Archae - 0; Bacteria - 8; Metazoa - 365; Fungi - 73; Plants - 167; Viruses - 0; Other Eukaryotes - 693 (source: NCBI BLink). AT4G09890 Protein of unknown function (DUF3511); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF3511 (InterPro:IPR021899); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF3511) (TAIR:AT5G11970.1); Has 187 Blast hits to 187 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 187; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G54930 AT hook motif-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AT hook, DNA-binding motif (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT4G21895.1); Has 30201 Blast hits to 17322 proteins AT3G62650 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G47485.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). AT2G18900 Transducin/WD40 repeat-like superfamily protein; CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat 2 (InterPro:IPR019782), WD40-repeat-containing domain (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); BEST Arabidopsis thaliana protein match is: Transdu AT2G15760 Protein of unknown function (DUF1645); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1645 (InterPro:IPR012442); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1645) (TAIR:AT2G26530.2); AT1G52930 Ribosomal RNA processing Brix domain protein; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: Ribosomal RNA processing Brix domain protein (TAIR:AT3G15460.1); Has 418 Blast hits to 416 proteins in 206 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 137; Plants - 66; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). AT4G23493 unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT2G47950 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: root, flower; EXPRESSED DURING: petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62990.1); Has 22 Blast hits to 22 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Virus AT3G01680 CONTAINS InterPro DOMAIN/s: Mediator complex subunit Med28 (InterPro:IPR021640); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01670.1); Has 122 Blast hits to 112 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 122; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT4G33960 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G15830.1); Has 32 Blast hits to 32 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eu AT1G80940 unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT3G04640 glycine-rich protein; Has 42937 Blast hits to 13549 proteins in 1124 species: Archae - 42; Bacteria - 16604; Metazoa - 12821; Fungi - 2296; Plants - 5249; Viruses - 609; Other Eukaryotes - 5316 (source: NCBI BLink). AT2G33250 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04310.1); Has 41 Blast hits to 41 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 AT2G37990 ribosome biogenesis regulatory protein (RRS1) family protein; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal biogenesis regulatory protein (InterPro:IPR007023); Has 425 Blast hits to 423 proteins in 207 species: Archae - 1; Bacteria - 2; Metazoa - 151; Fungi - 137; Plants - 58; Viruses - 0; Other Euka AT3G47570 Leucine-rich repeat protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterP AT2G32200 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32210.1); Has 131 Blast hits to 131 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 1; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT4G35510 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G17540.3); Has 182 Blast hits to 179 proteins in 73 species: Archae - 0; Bacteria - 87; Metazoa - 17; Fungi - 9; Plants - 50; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). AT1G10020 Protein of unknown function (DUF1005); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1005 (InterPro:IPR010410); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1005) (TAIR:AT4G29310.1); Has 158 Blast hits to 158 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 6; Plants - 144; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). AT3G44150 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G11800.1); Has 76 Blast hits to 75 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). AT4G24200 Transcription elongation factor (TFIIS) family protein; CONTAINS InterPro DOMAIN/s: Transcription factor IIS, N-terminal (InterPro:IPR017923); Has 1174 Blast hits to 562 proteins in 174 species: Archae - 0; Bacteria - 342; Metazoa - 163; Fungi - 176; Plants - 109; Viruses - 0; Other Eukaryotes - 384 (source: NCBI BLink). AT4G35850 Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT2G02150.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI B AT3G02120 hydroxyproline-rich glycoprotein family protein; Has 21 Blast hits to 21 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G41810 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64340.1); Has 876 Blast hits to 690 proteins in 132 species: Archae - 0; Bacteria - 38; Metazoa - 180; Fungi - 112; Plants - 59; Viruses - 2; Other Eukaryotes - 485 (source: NCBI BLink). AT3G03560 unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G23490.1); Has 157 Blast hits to 146 proteins in 38 species: Archae - 3; Bacteria - 14; Metazoa - 8; Fungi - 0; Plants - 120; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). AT4G26670 Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; C AT5G59360 unknown protein; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT1G72240 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22470.1); Has 65 Blast hits to 63 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G18510 unknown protein; Has 15 Blast hits to 15 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G23370 GRAM domain-containing protein / ABA-responsive protein-related; CONTAINS InterPro DOMAIN/s: GRAM (InterPro:IPR004182); BEST Arabidopsis thaliana protein match is: GRAM domain-containing protein / ABA-responsive protein-related (TAIR:AT5G23350.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink AT4G14270 Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. AT3G55390 Uncharacterised protein family (UPF0497); CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0497, trans-membrane plant (InterPro:IPR006702), Uncharacterised protein family UPF0497, trans-membrane plant subgroup (InterPro:IPR006459); BEST Arabidopsis thaliana protein match is: Uncharacterised protein family (UPF0497) (TAIR:AT2G38480.1); Has 361 Blast hits to 361 proteins in 18 species: Archae - 0; Bacteria AT1G23000 Heavy metal transport/detoxification superfamily protein ; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: Heavy metal transport/detoxification superf AT1G58150 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: in 9 processes; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G54540 Uncharacterised conserved protein (UCP012943); CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP012943 (InterPro:IPR016606); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT3G15780 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52550.1); Has 20 Blast hits to 20 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G27210 ARM repeat superfamily protein; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), HEAT, type 2 (InterPro:IPR021133), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: ARM repeat superfamily protein (TAIR:AT1G AT3G50350 Protein of unknown function (DUF1685); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, C globular stage, 4 leaf senescence stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1685 (InterPro:IPR012881); B AT1G76250 unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 74 Blast hits to 74 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). AT5G56190 Transducin/WD40 repeat-like superfamily protein; CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat 2 (InterPro:IPR019782), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD40 repeat, subgroup (InterPro:IPR019781); BEST Arabidopsis thaliana protein match is: Transdu AT5G66985 unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT5G51740 Peptidase family M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48 (InterPro:IPR001915); Has 6369 Blast hits to 6329 proteins in 1292 species: Archae - 10; Bacteria - 4324; Metazoa - 65; Fungi - 153; Plants - 45; Viruses - 0; Other Eukaryo AT1G05575 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anaerobic respiration; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31945.1); Has 63 Blast hits to 63 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryote AT3G03430 Calcium-binding EF-hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cytoplasm; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterP AT5G52660 Homeodomain-like superfamily protein; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: Homeodomain-like superfamily protein (TAIR:AT AT4G37190 LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta tubulin, autoregulation binding site (InterPro:IPR013838), Misato Segment II, myosin-like (InterPro:IPR019605), Tubulin/FtsZ, N-terminal (InterPro:IPR019746); Has 345 Blast hits to 341 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 140; Plants - 55; Viru AT3G51090 Protein of unknown function (DUF1640); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1640 (InterPro:IPR012439); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1640) (TAIR:AT2G16460.1); Has 506 Blast hits to 503 proteins in 168 species: Archae - 2; Bacteria - 7; Metazoa - 203; Fungi - 173; Plants - 82; Viruses - 2; Other Eukaryotes - 37 (source: NCBI BLink). AT2G43140 basic helix-loop-helix (bHLH) DNA-binding superfamily protein; FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic h AT2G41180 VQ motif-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: VQ (InterPro:IPR008889); BEST Arabidopsis thaliana protein match is: sigma factor binding protein 1 (TAIR:AT3G56710.1); Has 49 Blast hits to 49 proteins in 11 species: Archae - AT2G46140 Late embryogenesis abundant protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to desiccation, embryo development ending in seed dormancy; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Water stress and hypersensitive response domain (InterPro:IPR013990), Late embryogenesis abundant protein, grou AT2G28320 Pleckstrin homology (PH) and lipid-binding START domains-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769), Pleckstrin homology-type (InterPro:IPR011993), Lipid-binding START (I AT4G19880 Glutathione S-transferase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cadmium ion; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutathione S-transferase, predicted (InterPro:IPR016639), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C AT2G15340 glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: petal, leaf whorl, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: Cupredoxin superfamily protein (TAIR:AT AT3G58540 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06190.2); Has 6 Blast hits to AT2G28460 Cysteine/Histidine-rich C1 domain family protein; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: DC1 (InterPro:IPR004146), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: Cysteine/Histidine-rich C1 domain family protein (TAIR:AT5G48320.1); Has 1625 Blast hits to 65 AT5G02160 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 121 Blast hits to 121 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 121; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G23110 unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70900.1); Has 59 Blast hits to 59 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G78640 BEST Arabidopsis thaliana protein match is: AP2/B3-like transcriptional factor family protein (TAIR:AT2G33720.1); Has 92 Blast hits to 55 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G32880 TRAF-like family protein; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: TRAF-like family protein (TAIR:AT2G32870.1); Has 574 Blast hits to 518 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 2; Plants - 559; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). AT2G34030 Calcium-binding EF-hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), Calcium/calmodulin-dependent protein kinase-like (InterPro:I AT1G56500 haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, oxidoreductase activity, catalytic activity; INVOLVED IN: metabolic process, cell redox homeostasis; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehydrogenase/epoxide hydrolase (InterPro:IPR005833), Low-density lipoprotein AT2G37680 CONTAINS InterPro DOMAIN/s: Vacuolar import/degradation protein Vid24 (InterPro:IPR018618); Has 318 Blast hits to 317 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 80; Fungi - 184; Plants - 51; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). AT5G04550 Protein of unknown function (DUF668); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF668 (InterPro:IPR007700), Protein of unknown function DUF3475 (InterPro:IPR021864); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF668) (TAIR:AT3G23160.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eu AT1G56230 Protein of unknown function (DUF1399); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1399 (InterPro:IPR009836); BEST Arabidopsis thaliana protein match is: Protein of unknown function (duplicated DUF1399) (T AT5G35690 CONTAINS InterPro DOMAIN/s: WLM (InterPro:IPR013536), PUB domain (InterPro:IPR018997), PUG domain (InterPro:IPR006567); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G55915.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT5G63480 unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT4G16490 ARM repeat superfamily protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: ARM repeat superfamily protein (TAIR:AT3G01400.1); Has AT1G35340 ATP-dependent protease La (LON) domain protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 216 Blast hits to 216 proteins in 83 species: Archae - 0; Bacteria - 95; Metazoa - 1; Fungi - 14; Plants - 53; Viru AT1G10380 Putative membrane lipoprotein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17350.1); Has 280 Blast hits to 279 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 280; V AT3G49590 Autophagy-related protein 13; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Autophagy-related protein 13 (InterPro:IPR018731); BEST Arabidopsis thaliana protein match is: Autophagy-related protein 13 (TAIR:AT3G18770.1). AT5G17460 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress. AT3G08920 Rhodanese/Cell cycle control phosphatase superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: Rhodanese/Cell cycle control phosphatase superfamily prote AT1G76600 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: nucleolus, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21010.1); Has 220 Blast hits to 220 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 220; Viruses - 0; Othe AT1G35660 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 309 Blast hits to 256 proteins in 99 species: Archae - 0; Bacteria - 11; Metazoa - 192; Fungi - 12; Plants - 36; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). AT5G11630 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17310.1); Has 90 Blast hits to 90 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 90; Viruses - 0; Other Eukaryotes - 0 AT5G48205 zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type, AN1-like) family protein (TAIR:AT3G57480.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fu AT4G31510 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24550.1); Has 205 Blast hits to 205 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 3; Plants - 187; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). AT3G18960 AP2/B3-like transcriptional factor family protein; FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: AP2/B3-like transcriptional factor family protein (TAIR:AT4G01580.1); H AT1G06320 unknown protein; Has 24 Blast hits to 24 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). AT1G29760 Putative adipose-regulatory protein (Seipin); CONTAINS InterPro DOMAIN/s: Adipose-regulatory protein, Seipin (InterPro:IPR009617); BEST Arabidopsis thaliana protein match is: Putative adipose-regulatory protein (Seipin) (TAIR:AT2G34380.1); Has 493 Blast hits to 422 proteins in 86 species: Archae - 0; Bacteria - 253; Metazoa - 134; Fungi - 11; Plants - 78; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). AT4G17150 alpha/beta-Hydrolases superfamily protein; BEST Arabidopsis thaliana protein match is: alpha/beta-Hydrolases superfamily protein (TAIR:AT4G14290.1); Has 2710 Blast hits to 2708 proteins in 908 species: Archae - 16; Bacteria - 1896; Metazoa - 181; Fungi - 45; Plants - 202; Viruses - 0; Other Eukaryotes - 370 (source: NCBI BLink). AT4G40100 GRAM domain family protein; CONTAINS InterPro DOMAIN/s: GRAM (InterPro:IPR004182); BEST Arabidopsis thaliana protein match is: GRAM domain family protein (TAIR:AT2G22475.1); Has 358 Blast hits to 358 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 357; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). AT4G32020 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25250.1); Has 65 Blast hits to 65 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 54; Viruses - 0; Other Eukaryotes - 0 AT3G19680 Protein of unknown function (DUF1005); LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1005 (InterPro:IPR010410); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1005) (TAIR:AT1G50040.1); Has 782 Blast hits to 189 proteins in 38 species: Archae - 0; Bacteria - 22; Metazo AT2G32190 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32210.1); Has 218 Blast hits to 218 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 16; Plants - 202; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G15940 Tudor/PWWP/MBT superfamily protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: Tudor/PWWP/MBT superfamily protein (TAIR:AT1G80810.1); Has 113244 Blast hits to 64070 proteins in 2877 species: Archae - AT2G47720 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: Transducin/WD40 repeat-like superfamily protein (TAIR:AT3G62770.1); Has 21 Blast hits t AT5G65910 BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT3G49800.1); Has 30201 Blast hits to 17322 AT4G15540 EamA-like transporter family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 /EamA-like transporter family protein (TAIR:AT5G40230.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - AT5G43260 chaperone protein dnaJ-related; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT1G70900 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23110.4); Has 57 Blast hits to 57 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G09410 Pectinacetylesterase family protein; CONTAINS InterPro DOMAIN/s: Pectinacetylesterase (InterPro:IPR004963); BEST Arabidopsis thaliana protein match is: Pectinacetylesterase family protein (TAIR:AT3G09405.1); Has 557 Blast hits to 548 proteins in 93 species: Archae - 0; Bacteria - 46; Metazoa - 119; Fungi - 0; Plants - 303; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). AT3G48180 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19020.1); Has 84 Blast hits to 84 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G16850 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: endomembrane system; EXPRESSED IN: leaf apex, leaf whorl, male gametophyte, flower, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; BEST Arabidopsis thaliana protein match is: unknown pro AT3G19790 unknown protein; Has 32 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 14; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). AT5G01750 Protein of unknown function (DUF567); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF567 (InterPro:IPR007612); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF567) (TAIR:AT3G11740.1); H AT1G73870 B-box type zinc finger protein with CCT domain; FUNCTIONS IN: sequence-specific DNA binding transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein matc AT2G25610 ATPase, F0/V0 complex, subunit C protein; FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is AT5G08350 GRAM domain-containing protein / ABA-responsive protein-related; CONTAINS InterPro DOMAIN/s: GRAM (InterPro:IPR004182); BEST Arabidopsis thaliana protein match is: GRAM domain-containing protein / ABA-responsive protein-related (TAIR:AT5G23370.1); Has 358 Blast hits to 358 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 358; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G37400 Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026), Tetratricopeptide repeat AT4G32080 unknown protein; Has 7 Blast hits to 7 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G38500 FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF313 (InterPro:IPR005508), Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: Domain of unknown function (DUF313) (TAIR:AT5G38490.1); Has 1807 Blast hits to 180 AT1G18620 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G74160.1); Has 1906 Blast hits to 1265 proteins in 203 species: Archae - 0; Bacteria - 130; Metazoa - 671; Fungi - 139; Plants - 265 AT5G63490 CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein (TAIR:AT5G50530.1); Has 80 AT2G39870 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G55690.1); Has 73 Blast hits to 71 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 69; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G47440 Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Heat shock protein DnaJ, N-terminal (Inter AT1G75860 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20100.1); Has 258 Blast hits to 235 proteins in 58 species: Archae - 0; Bacteria - 4; Metazoa - 59; Fungi - 16; Plants - 90; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). AT4G39550 Galactose oxidase/kelch repeat superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Ke AT2G25590 Plant Tudor-like protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tudor-like, plant (InterPro:IPR014002), Agenet (InterPro:IPR008395); BEST Arabidopsis thaliana protein match is: Plant Tudor-like RNA-binding protein (TAIR:AT4G32440.3); Has 129 Blast hits to 122 proteins in 12 species: Ar AT4G27450 Aluminium induced protein with YGL and LRDR motifs; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: Aluminium induced protein with YGL and LRDR motifs (TAIR:AT3G15450.1); Has 30201 Blast hits to 17322 protein AT2G39920 HAD superfamily, subfamily IIIB acid phosphatase ; FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: response to cadmium ion; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase (Class B) (InterPro:IPR005519); BEST Arabidopsis thaliana protein match is: HAD superfamily, subfamily IIIB acid phosphata AT2G10930 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48500.1); Has 7 Blast hits to 7 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT4G36210 Protein of unknown function (DUF726); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF726 (InterPro:IPR007941); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF726) (TAIR AT4G14230 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein with a dom AT1G15270 Translation machinery associated TMA7; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: Translation machinery associated TMA7 (TAIR:AT AT4G10270 Wound-responsive family protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function wound-induced (InterPro:IPR022251); BEST Arabidopsis thaliana protein match is: Wound-responsive family protein (TAIR:AT4G10265.1); Has 183 Blast hits to 182 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 183; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G44190 FAD/NAD(P)-binding oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding; INVOLVED IN: oxidation reduction; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridine nucleotide-disulphide oxidoreductase, class-II (InterPro:IPR000103), FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR01302 AT1G62330 O-fucosyltransferase family protein; CONTAINS InterPro DOMAIN/s: GDP-fucose protein O-fucosyltransferase (InterPro:IPR019378); BEST Arabidopsis thaliana protein match is: O-fucosyltransferase family protein (TAIR:AT1G11990.1); Has 815 Blast hits to 808 proteins in 29 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 815; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G18850 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 40 Blast hits to 40 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G15450 Aluminium induced protein with YGL and LRDR motifs; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: Aluminium induced protein with YGL and LRDR motifs (TAIR:AT4G27450.1); Has 430 Blast hits to 430 proteins in 86 species: Archae - 0; Bacteria - 40; Metazoa - 2; Fungi - 2; Plants - 364; Viruses - 0; Other Euka AT1G68490 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G13390.2); Has 125 Blast hits to 125 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryote AT4G27860 vacuolar iron transporter (VIT) family protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF125, transmembrane (InterPro:IPR008217), Cytokine, IL-1-like (InterPro:IPR008996); BEST Arabidopsis thaliana protein match is: Vacuolar iron transporter (VIT) family protein (TAIR:AT4G27870.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; AT4G25780 CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, extracellular region; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Allergen V5/Tpx-1 related, conserved site (InterPro:IPR018244), Alle AT5G48480 Lactoylglutathione lyase / glyoxalase I family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 AT1G49245 Prefoldin chaperone subunit family protein; FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin beta-like (InterPro:IPR002777), Prefoldin (InterPro:IPR009053); Has 20 Blast hits to 20 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - AT5G67370 Protein of unknown function (DUF1230); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1230 (InterPro:IPR009631); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1230) (TAIR:AT5G11840.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT5G66490 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G50900.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; O AT2G01220 Nucleotidylyl transferase superfamily protein; FUNCTIONS IN: nucleotidyltransferase activity; INVOLVED IN: biosynthetic process; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Cytidylyltransferase (InterPro:IPR004820); BEST Arabidopsis thaliana protein match is: N AT2G32050 Family of unknown function (DUF572) ; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell, stamen; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: Family of unknown function (DUF572) (TAIR:AT3 AT5G55610 unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT1G15400 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80180.1); Has 84 Blast hits to 84 proteins in 17 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 75; Viruses - 0; Other Eukar AT1G22600 Late embryogenesis abundant protein (LEA) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: stem, embryo, sperm cell, hypocotyl, flower; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant domain-containing protein / AT5G08580 Calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-hand (InterPr AT2G27900 CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2451, C-terminal (InterPro:IPR019514), Vacuolar protein sorting-associated protein 54 (InterPro:IPR019515); Has 316 Blast hits to 252 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 200; Fungi - 2; Plants - 68; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink). AT4G32910 CONTAINS InterPro DOMAIN/s: Nuclear pore complex protein, Nucleoporin Nup85-like (InterPro:IPR011502); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT3G13900 ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism; INVOLVED IN: ATP biosynthetic process, phospholipid transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-typ AT3G24190 Protein kinase superfamily protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, catalytic domain (InterPro:IPR000719), Aminoglycoside phosphotransferase (InterPro:IPR002575), Protein kinase AT4G02210 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24960.2); Has 791 Blast hits to 465 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 17; Plants - 748; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). AT4G35320 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G17300.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT4G32630 ArfGap/RecO-like zinc finger domain-containing protein; FUNCTIONS IN: ARF GTPase activator activity, zinc ion binding; INVOLVED IN: regulation of ARF GTPase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Arf GTPase activating protein (InterPro:IPR001164); BEST Arabidopsis thaliana protein match is: NSP (nucle AT1G34280 unknown protein; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G64490 DEK, chromatin associated protein; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: DEK, chromatin associated protein (TAIR:AT5G42060.1); Has 63 Blast hits to 62 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). AT4G05640 transposable element gene; similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G41855.1) AT1G67870 glycine-rich protein; Has 8710 Blast hits to 3981 proteins in 499 species: Archae - 16; Bacteria - 1349; Metazoa - 4702; Fungi - 419; Plants - 500; Viruses - 11; Other Eukaryotes - 1713 (source: NCBI BLink). AT1G05210 Transmembrane protein 97, predicted; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane protein 97, predicted (InterPro:IPR016964); BEST Arabidopsis thaliana protein match is: Transmembrane protein 97, predicted (TAIR:AT2G AT3G06760 Drought-responsive family protein; INVOLVED IN: response to water deprivation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19/ RING finger protein 114 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: Drought-responsive family protein (TAIR:AT5G49230.1); Has 224 Blast hits to 224 proteins in 20 species: Archae - 0; Bacteria - 0; M AT1G35612 pseudogene of Ulp1 protease family protein AT1G79380 Ca(2)-dependent phospholipid-binding protein (Copine) family; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Copine (InterPro:IPR010734), von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: RING domain ligase2 (TAIR:AT5G14420.2); Has 30201 AT2G32280 Protein of unknown function (DUF1218); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1218) (TAIR:AT AT1G55450 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; FUNCTIONS IN: methyltransferase activity; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (TAIR:AT3G54150.1). AT1G13520 Protein of unknown function (DUF1262); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1262 (InterPro:IPR010683); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1262) (TAIR:AT1G13480.1); Has 107 Blast hits to 100 proteins in 12 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 101; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G39785 FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e (InterPro:IPR008195), Protein of unknown function DUF1666 (InterPro:IPR012870); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1666) (TAIR:AT1G696 AT2G31945 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05575.1); Has 61 Blast hits to 61 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - AT2G05510 Glycine-rich protein family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Glycine rich protein (InterPro:IPR010800); BEST Arabidopsis thaliana protein match is: GLYCINE RICH PROTEIN 9 (TAIR:AT2G05440.1); Has 96640 Blast hits to 23865 proteins in 1692 species: Archae - 84; Bacteria - 39011; Metazoa - 28988; Fun AT3G15357 unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: shoot apex, hypocotyl, root, leaf; Has 6931 Blast hits to 2036 proteins in 230 species: Archae - 7; Bacteria - 933; Metazoa - 1824; Fungi - 836; Plants - 482; Viruses - 218; Other Eukaryotes - 2631 (source: NCBI BLink). AT5G15120 Protein of unknown function (DUF1637); FUNCTIONS IN: cysteamine dioxygenase activity; INVOLVED IN: anaerobic respiration; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1637 (InterPro:IPR012864); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1637) (TAIR: AT5G51570 SPFH/Band 7/PHB domain-containing membrane-associated protein family; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: SPFH/Band 7/PHB domain-containing membrane-associated protein family AT1G01240 unknown protein; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1); Has 95 Blast hits to 78 proteins in 16 species: Archae - 0; Bacteria - 2; Metazoa - 11; Fungi - 0; Plants - 80; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). AT5G07820 Plant calmodulin-binding protein-related; CONTAINS InterPro DOMAIN/s: Calmodulin-binding protein, plant (InterPro:IPR012417); BEST Arabidopsis thaliana protein match is: Plant calmodulin-binding protein-related (TAIR:AT5G61260.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT3G23910 BEST Arabidopsis thaliana protein match is: RNA-directed DNA polymerase (reverse transcriptase)-related family protein (TAIR:AT3G24255.2); Has 562 Blast hits to 532 proteins in 147 species: Archae - 28; Bacteria - 51; Metazoa - 157; Fungi - 82; Plants - 85; Viruses - 6; Other Eukaryotes - 153 (source: NCBI BLink). AT1G73350 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 50 Blast hits to 50 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 3; Plants - 36; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). AT4G10150 RING/U-box superfamily protein; FUNCTIONS IN: zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); BEST Arabidopsis thaliana protein match is: RING/U-box superfamily protein (TAIR:AT4G10160.1); Has 9409 Blast hits to 9387 proteins in 290 species: Archae - 0; Bacteria - 6; Metazoa - 2329; Fungi - 766; Plants - 4947; Viruses - 49; Other AT5G44250 Protein of unknown function DUF829, transmembrane 53; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF829, transmembrane 53 (InterPro:IPR008547); BEST Arabidopsis thaliana protein match is: Protein of unknown function DUF829, transmembrane 53 (TAIR:AT2G15695.1); Has 221 Blast hits to 219 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 97; Fungi - 6; Plants - 101; Viruses - 0; Other Eukaryotes - 1 AT1G07500 unknown protein; Has 4 Blast hits to 4 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G04570 Major facilitator superfamily protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: chloroplast, membrane; CONTAINS InterPro DOMAIN/s: Biopterin transport-related protein BT1 (InterPro:IPR004324), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: Major facilitator superfamily protein (TAIR:AT2G33280.1); Has 816 Blast hits to 81 AT2G40400 Protein of unknown function (DUF399 and DUF3411); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF399 (InterPro:IPR007314), Protein of unknown function DUF3411 (InterPro:IPR021825); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF399 and DUF3411) (TAIR:AT3G56140.1); Has 496 Blast hits to 496 proteins in 118 species: Archae - 0; Bacteria - 198; Metazoa - 0; Fungi - 0; Plants - 27 AT4G01600 GRAM domain family protein; CONTAINS InterPro DOMAIN/s: GRAM (InterPro:IPR004182); BEST Arabidopsis thaliana protein match is: FH interacting protein 1 (TAIR:AT1G28200.1); Has 358 Blast hits to 358 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 358; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G54370 Late embryogenesis abundant (LEA) protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Root cap (InterPro:IPR009646); BEST Arabidopsis thaliana protein match is: Late embryogenesis abundant (LEA) protein-related (TAIR:AT4G27400.1); Has 1807 Blast hits to 1807 proteins in 277 spe AT3G24630 unknown protein; Has 5348 Blast hits to 3182 proteins in 353 species: Archae - 0; Bacteria - 481; Metazoa - 1959; Fungi - 405; Plants - 180; Viruses - 10; Other Eukaryotes - 2313 (source: NCBI BLink). AT1G26130 ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism; INVOLVED IN: metabolic process, phospholipid transport, ATP biosynthetic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (Inte AT3G13130 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte; Has 140 Blast hits to 132 proteins in 41 species: Archae - 2; Bacteria - 4; Metazoa - 29; Fungi - 20; Plants - 51; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). AT1G47310 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 45 Blast hits to 45 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G44090 Ankyrin repeat family protein; CONTAINS InterPro DOMAIN/s: Ankyrin repeat-containing domain (InterPro:IPR020683); BEST Arabidopsis thaliana protein match is: Ankyrin repeat family protein (TAIR:AT3G59910.1); Has 93 Blast hits to 93 proteins in 22 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 0; Plants - 66; Viruses - 3; Other Eukaryotes - 10 (source: NCBI BLink). AT2G32450 Calcium-binding tetratricopeptide family protein; FUNCTIONS IN: binding, zinc ion binding, calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), EF-HAND 2 (InterPro:IPR018249), Zinc finger, ZZ-type (InterPro:IPR000433), Tet AT1G54280 ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: zinc ion binding, ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism; INVOLVED IN: metabolic process, phospholipid transport, ATP biosynthetic process; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, M ger AT4G30390 unknown protein; Has 22 Blast hits to 22 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G16840 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G78890.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). AT2G20010 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Munc13 homology 1 (InterPro:IPR014770), Protein of unknown function DUF810 (InterPro:IPR008528), Mammalian uncoordinated homology 13, domain 2 (InterPro:IPR014772); BEST Arab AT3G10040 sequence-specific DNA binding transcription factors; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76870.1); Has 3136 Blast hits to 1955 proteins in 249 species: Archae - 4; Bacteria - 147; Metazoa - 846; Fungi - 267; Plants - 330; Viruses - 57; Other Eukaryotes - 1485 (source: NCBI BLink). AT4G30660 Low temperature and salt responsive protein family; INVOLVED IN: response to cold, hyperosmotic salinity response; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: Low temperature and salt responsive AT3G59070 Cytochrome b561/ferric reductase transmembrane with DOMON related domain; CONTAINS InterPro DOMAIN/s: Cytochrome b561, eukaryote (InterPro:IPR004877), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: Cytochrome b561/ferric reductase transm AT5G54350 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: C2H2-like zinc finger protein (TAIR:AT5G54360.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT3G20620 F-box family protein-related; CONTAINS InterPro DOMAIN/s: F-box associated interaction domain (InterPro:IPR017451); Has 261 Blast hits to 261 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 261; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT4G24700 unknown protein; Has 20 Blast hits to 20 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G05860 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31600.1); Has 101 Blast hits to 100 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 2; Plants - 66; Viruses - 0; Other Eukaryote AT5G02580 Plant protein 1589 of unknown function; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: Plant protein 1589 of unknown function (TAIR:AT3G55240.1); Has 206 Blast hits to 206 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 202; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). AT4G08110 transposable element gene; CACTA-like transposase family (Ptta/En/Spm), has a 4.2e-66 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana) AT2G26110 Protein of unknown function (DUF761); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF761, plant (InterPro:IPR008480); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56980.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT2G36220 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G52710.1); Has 74 Blast hits to 74 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G52360 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to karrikin; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35850.1); Has 34 Blast hits to 34 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryote AT4G37700 unknown protein; Has 64 Blast hits to 64 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G27290 Protein of unknown function (DUF1279); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1279 (InterPro:IPR009688); Has 214 Blast hits to 212 proteins in 70 species: Archae - 0; Bacteria - 0 AT3G24070 Zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G47920.1); Has 77 B AT2G47360 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02570.1); Has 58 Blast hits to 55 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G04770 Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026), Tetratricopeptide repeat (InterPro:IPR0197 AT4G31360 selenium binding; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Selenoprotein, Rdx type (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: selenium binding (TAIR:AT2G24440.1); Has 221 Blast hits to 197 proteins in 65 species: Archae - 0; Bacteria - 10; Metazoa - 93; Fungi - 17; P AT5G23610 INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: SWITCH1 (TAIR:AT5G51330.1); Has 173 Blast hits to 168 proteins in 34 species: Archae - 3; Bacteria - 10; Metazoa - 6; Fungi - 2; Plants - 115; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). AT5G09620 Octicosapeptide/Phox/Bem1p family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); BEST Arabidopsis thaliana protein match is: Octicosapeptide/Phox/Bem1p family protein (T AT1G69610 FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: N-terminal protein myristoylation, translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e (InterPro:IPR008195), Protein of unknown function DUF1666 (InterPro:IPR012870); BEST Arabidopsis thaliana protein match is: Protein of unknown fun AT1G72060 serine-type endopeptidase inhibitors; FUNCTIONS IN: serine-type endopeptidase inhibitor activity; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I20, Pin2 (InterPro:IPR003465); Has 28 Blast hits to 28 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0 AT5G48500 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G10930.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT1G01770 unknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1446 (InterPro:IPR010839); Has 1597 Blast hits to 1509 proteins in 306 species: Archae - 4; Bacteria - 843; Metazoa - 22; Fungi - 131; Plants - 31; Viruses - 0; Other Eukaryotes - 566 (source: NCBI BLink). AT3G08870 Concanavalin A-like lectin protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Legume lectin, beta chain (InterPro:IPR001220), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/thre AT1G24160 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70100.3); Has 5230 Blast hits to 4162 proteins in 477 species: Archae - 30; Bacteria - 540; Metazoa - 2022; Fungi - 429; Plants - 280; Viruses - 32; Other Eukaryotes - 1897 (source: NCBI BLink). AT3G03440 ARM repeat superfamily protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: ARM repeat superfamily protein AT2G19930 RNA-dependent RNA polymerase family protein; FUNCTIONS IN: RNA-directed RNA polymerase activity; INVOLVED IN: posttranscriptional gene silencing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: RNA-dependent RNA polymerase, eukaryotic-type (InterPro:IPR007855); BEST Arabidopsis thaliana protein match is: RNA-de AT1G47280 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruse AT4G28100 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G18050.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa AT1G49230 RING/U-box superfamily protein; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); BEST Arabidopsis thaliana protein match is: RING/U-box superfamily protein (TAIR:AT1G49200.1); Has 9168 Blast hits to 9144 proteins in 279 species: Archae AT1G72700 ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism; INVOLVED IN: metabolic process, ATP biosynthetic process, phospholipid transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOM AT3G51050 FG-GAP repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell-matrix adhesion; LOCATED IN: integrin complex, integral to membrane, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 99 Blast hits to 94 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). AT1G18900 Pentatricopeptide repeat (PPR) superfamily protein; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Smr protein/MutS2 C-terminal (InterPro:IPR002625); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT1G74750.1). AT1G04900 Protein of unknown function (DUF185); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF185 (InterPro:IPR003788); Has 316 Blast hits to 314 proteins in 164 species: Archae - 0; Bacteria - 117; Metazoa - 2; Fungi - 113; Plants - 44; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). AT3G42350 transposable element gene; similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G06095.1); contains domain RAS-RELATED GTPASE (PTHR11708); contains domain RAC-GTP BINDING PROTEIN (PTHR11708:SF12) AT1G14630 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G01990.1); Has 125 Blast hits to 123 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G64880 unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT5G58510 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55060.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses AT1G78020 Protein of unknown function (DUF581); EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF581) (TAIR:AT1G22160.1); Has 525 Blast hits to 525 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 525; Viruses - 0 AT5G47455 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17310.2); Has 125 Blast hits to 125 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G55620 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09950.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT2G18330 AAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960), Protein of unknown function DUF352 AT3G04860 Plant protein of unknown function (DUF868); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF868, plant (InterPro:IPR008586); BEST Arabidopsis thaliana protein match is: Plant protein of unknown function (DUF868) (TAIR:AT5G28150.1); Has 291 Blast hits to 289 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 291; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G19300 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G56260 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40475.1). AT1G30790 F-box and associated interaction domains-containing protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), F-box associated domain, type 3 (InterPro:IPR013187), F-box associated interaction domain (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box and associated interaction domains-containing protein (TAIR:AT1G32660.1); Has 2 AT5G41960 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT3G05700 Drought-responsive family protein; CONTAINS InterPro DOMAIN/s: Drought induced 19/ RING finger protein 114 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: Drought-responsive family protein (TAIR:AT5G26990.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT3G20340 Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. AT5G48590 Protein of unknown function (DUF760); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF760) (TAIR:AT3G07310.1); H AT3G59450 Calcium-binding EF-hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), EF-hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: Calcium-binding EF-hand family protein (TAIR:AT3G59440.1); Has 94 Blast hits to AT1G41650 transposable element gene; similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G05636.1) AT3G12320 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06980.4); Has 102 Blast hits to 102 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 98; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). AT4G28310 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52270.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT1G72790 hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT5G57070.1); Has 16953 Blast hits to 10626 proteins in 654 species: A AT1G10770 Encodes a putative pectin methylesterase/invertase inhibitor. Anti-sense reduction of this gene's transcript results in pollen tube growth retardation and then partial male sterility and reduced seed set. AT2G34355 Major facilitator superfamily protein; INVOLVED IN: transmembrane transport; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily (InterPro:IPR020846), Nodulin-like (InterPro:IPR010658), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: Nodulin-like / Major AT3G57990 unknown protein; Has 1497 Blast hits to 1323 proteins in 52 species: Archae - 0; Bacteria - 4; Metazoa - 23; Fungi - 34; Plants - 61; Viruses - 0; Other Eukaryotes - 1375 (source: NCBI BLink). AT1G67360 Rubber elongation factor protein (REF); INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: Rubber elongation factor protein (REF) (TAIR:AT2G47780.1); Has 125 Blast hits to 125 proteins in 21 species: Archae - 0; Ba AT1G16510 SAUR-like auxin-responsive protein family ; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: SAUR-like auxin-responsive protein family (TAIR:AT3G12830.1); Has 1122 Blast hits to 1120 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1121; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). AT5G49900 Beta-glucosidase, GBA2 type family protein; FUNCTIONS IN: catalytic activity, glucosylceramidase activity; INVOLVED IN: glucosylceramide catabolic process, sphingolipid metabolic process; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glucosylceramidase (InterPro:IPR006775), Six-hairpin glycosidase-like (InterPro:IPR0 AT5G27710 unknown protein; Has 49 Blast hits to 49 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). AT4G02550 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). AT3G04140 Ankyrin repeat family protein; CONTAINS InterPro DOMAIN/s: Ankyrin repeat-containing domain (InterPro:IPR020683), Ankyrin repeat (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: Ankyrin repeat family protein (TAIR:AT3G01750.1); Has 23671 Blast hits to 13225 proteins in 615 species: Archae - 38; Bacteria - 1852; Metazoa - 11528; Fungi - 2058; Plants - 2257; Viruses - 72; Other Eukaryotes - 5866 (source: NCBI B AT2G19200 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G11700.1); Has 17 Blast hits to 17 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fun AT4G28025 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT1G76880 Duplicated homeodomain-like superfamily protein; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is: Duplicated homeodomain-like superfamily protein (TAIR:AT1G76890.2); Has 4096 Blast hits to 3293 proteins in 319 species: Archae - 0; Bacteria - 232; Metazoa - 1014; Fungi - 378; Plants - 799; Viruses - 55; Other Eukaryotes - 1618 (so AT4G38410 Dehydrin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to water, response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, hypocotyl, root; CONTAINS InterPro DOMAIN/s: Dehydrin (InterPro:IPR000167); Has 3050 Blast hits to 2020 proteins in 252 species: Archae - 4; Bacteria - 32; Metazoa - 564; Fungi - 141; Plants - 1342; Viruses - 0; Other Eukaryotes - 967 (sourc AT1G04300 TRAF-like superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: TRAF-like superfamily protein (TAIR:AT5G43560.2); Has 16478 Blast hits to 11071 proteins in 9 AT4G35760 Encodes a bimodular enzyme comprising an integral domain homologous to the catalytic subunit of mammalian vitamin K epoxide reductase (VKORC1, EC 1.1.4.1) that is fused to a soluble thioredoxin-like moiety. Using yeast microsomes as a recombinant system, it was shown that the VKORC1 domain of At4g35760 functions as a stringent naphthoquinone reductase, and that its reduced Trx-like partner can serve as its electron donor. L AT3G42130 glycine-rich protein; Has 7285 Blast hits to 2812 proteins in 355 species: Archae - 0; Bacteria - 809; Metazoa - 3330; Fungi - 364; Plants - 2055; Viruses - 51; Other Eukaryotes - 676 (source: NCBI BLink). AT1G75810 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 13 Blast hits to 13 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G24810 ABC1 family protein; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Beta-lactamase-type transpeptidase fold (InterPro:IPR012338), Beta-lactamase-related (InterPro:IPR001466), Protein kinase-like domain (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC2 homolog 13 (TAIR:AT5G64940.2). AT3G03620 MATE efflux family protein; FUNCTIONS IN: antiporter activity, drug transmembrane transporter activity, transporter activity; INVOLVED IN: drug transmembrane transport, transmembrane transport; LOCATED IN: membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Multi antimicrob AT1G68440 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25400.2); Has 86 Blast hits to 86 proteins in 29 species: Archae - 0; Bacteria - 6; Metazoa - 27; Fungi - 11; Plants - 24; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). AT3G01670 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01680.1); Has 121 Blast hits to 111 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 121; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT4G13230 Late embryogenesis abundant protein (LEA) family protein; BEST Arabidopsis thaliana protein match is: lyases (TAIR:AT3G24640.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT2G24020 Uncharacterised BCR, YbaB family COG0718; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0133 (InterPro:IPR004401); BEST Arabidopsis thaliana protein match is: Uncharacterised BCR, Y AT5G04730 Ankyrin-repeat containing protein; BEST Arabidopsis thaliana protein match is: Ankyrin repeat family protein (TAIR:AT5G04700.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT2G29995 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G07175.1); Has 14 Blast hits to 14 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Euk AT1G19710 UDP-Glycosyltransferase superfamily protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: UDP-Glycosyltransferase superfamily protein (T AT3G26470 Powdery mildew resistance protein, RPW8 domain; CONTAINS InterPro DOMAIN/s: Powdery mildew resistance protein, RPW8 domain (InterPro:IPR008808); BEST Arabidopsis thaliana protein match is: ADR1-like 1 (TAIR:AT4G33300.2); Has 46 Blast hits to 46 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT4G40050 FUNCTIONS IN: signal transducer activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP013022 (InterPro:IPR016607), Regulator of G protein signalling (InterPro:IPR000342); BEST Arabidopsis thaliana protein match is: Protein of unknown fu AT4G12760 unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT1G66180 The gene encodes a putative aspartyl protease (ASP). Its expression is induced in response to light and ascorbate. AT5G16360 NC domain-containing protein-related; CONTAINS InterPro DOMAIN/s: NC (InterPro:IPR007053); BEST Arabidopsis thaliana protein match is: NC domain-containing protein-related (TAIR:AT3G02700.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT5G13210 Uncharacterised conserved protein UCP015417, vWA; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP015417, vWA (InterPro:IPR011205), von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: Uncharacterised conserved protein UCP015417, vWA (TAIR:AT3G24780.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi AT1G71470 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22090.1); Has 11 Blast hits to 11 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). AT3G07170 Sterile alpha motif (SAM) domain-containing protein; CONTAINS InterPro DOMAIN/s: Sterile alpha motif (InterPro:IPR001660), Sterile alpha motif homology (InterPro:IPR010993), Sterile alpha motif, type 1 (InterPro:IPR021129); BEST Arabidopsis thaliana protein match is: Sterile alpha motif (SAM) domain-containing protein (TAIR:AT5G48680.1); Has 516 Blast hits to 515 proteins in 77 species: Archae - 0; Bacteria - 10; Metazoa - 341; Fu AT5G08240 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G23160.1); Has 69 Blast hits to 69 proteins in 10 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G55790 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G45163.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT5G27830 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folate receptor, conserved region (InterPro:IPR018143). AT1G15790 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15780.1); Has 170 Blast hits to 94 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 170; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G13570 F-box/RNI-like superfamily protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), FBD (InterPro:IPR013596), F-box domain, Skp2-like (InterPro:IPR022364), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box/RNI-like/FBD-like domains-containing protein (TAIR:AT5G56370.2); Has 1866 Blast hits to 1838 proteins in 25 species: A AT3G27770 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 158 Blast hits to 157 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 141; Viruses - 0; Ot AT5G66780 unknown protein; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT5G03450 Transducin/WD40 repeat-like superfamily protein; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03750.1); H AT5G41840 F-box/RNI-like superfamily protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box/RNI-like superfamily protein (TAIR:AT4G00320.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fung AT5G64190 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40390.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT4G15040 Subtilisin-like serine endopeptidase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, N-terminal protein myristoylation, negative regulation of catalytic activity; CONTAINS InterPro DOMAIN/s: Peptidase S8/S53, subtilisin/kexin/sedolisin (InterPro:IPR000209), Peptidase S8/S53, subtilisin, active site (InterPro:IPR022398), Peptidase S8, subtilisin-related (InterPro:IPR0155 AT5G01595 Potential natural antisense gene, locus overlaps with AT5G01600 AT1G78420 RING/U-box superfamily protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: RING/U-box superfamily protein (TAIR:AT1G17145.1); Has 267 Blast hits to 267 proteins in 123 species: Archae - 0; Ba AT5G66090 unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT5G52760 Copper transport protein family; BEST Arabidopsis thaliana protein match is: Heavy metal transport/detoxification superfamily protein (TAIR:AT5G52750.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT4G14020 Rapid alkalinization factor (RALF) family protein; CONTAINS InterPro DOMAIN/s: Rapid ALkalinization Factor (InterPro:IPR008801); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT1G02960 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 100 Blast hits to 99 proteins in 48 species: Archae - 0; Bacteria - 4; Metazoa - 26; Fungi - 13; Plants - 29; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). AT5G01450 RING/U-box superfamily protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: RING/U-box superfamily protein (TAIR:AT2G38185.2); Has 1494 Blast hits to 1 AT3G62240 RING/U-box superfamily protein; FUNCTIONS IN: zinc ion binding; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc ion binding;nucleic acid binding (TAIR:AT2G4 AT5G03460 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT1G12330 unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12900.1); Has 249 Blast hits to 249 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 14; Plants - 217; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). AT2G43500 Plant regulator RWP-RK family protein; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Plant regulator RWP-RK (InterPro:IPR003035); BEST Arabidopsis thaliana protein match is: Plant regulator RWP-RK family protein (TAIR:AT3G59580.2); Has 665 Blast hits to 521 proteins in 81 species: Archae - 0; Bacteria - 147; Metazoa - 3; Fungi - 2; Plants - 476; Viruses - 0; Other Eukaryotes - 37 (source: NCB AT5G11970 Protein of unknown function (DUF3511); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF3511 (InterPro:IPR021899); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF3511) (TAIR:AT2G AT5G62400 unknown protein; Has 7 Blast hits to 7 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT4G26960 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G54970.1); Has 22 Blast hits to 22 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT4G02940 oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to karrikin; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Oxoglutarate/iron-dependent oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G48080.1); Has 217 B AT4G30650 Low temperature and salt responsive protein family; INVOLVED IN: response to salt stress, response to cold, hyperosmotic salinity response, defense response to fungus; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana pr AT1G78030 unknown protein; BEST Arabidopsis thaliana protein match is: Protein of unknown function (duplicated DUF1399) (TAIR:AT4G37900.1); Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G01350 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT3G04560 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 16 growth stages; Has 227 Blast hits to 225 proteins in 83 species: Archae - 0; Bacteria - 17; Metazoa - 98; Fungi - 29; Plants - 51; Viruses - 1; Other Eukaryotes - 31 (source: NCBI BLink). AT3G25870 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G13360.1); Has 50 Blast hits to 50 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G56520 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55365.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT1G61350 ARM repeat superfamily protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: ARM repeat s AT3G06180 Ribosomal protein L34e superfamily protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: Ribosomal protein L34e superfamily protein (TAIR:AT5G190 AT4G30750 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30730.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT1G72510 Protein of unknown function (DUF1677); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1677, plant (InterPro:IPR012876); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1677) (TAIR:AT2G09970.1); Has 246 Blast hits to 246 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 246; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G56870 unknown protein; Has 204 Blast hits to 201 proteins in 58 species: Archae - 0; Bacteria - 10; Metazoa - 72; Fungi - 8; Plants - 41; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). AT3G46620 zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to chitin; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957), Protein of unknown function DUF1117 (InterPro:IPR010543); BEST Arabidopsis thaliana protein match is: AT1G79200 unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT3G02555 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16110.1); Has 130 Blast hits to 130 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G35450 catalytics;hydrolases; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Amidohydrolase 2 (InterPro:IPR006992); Has 1373 Blast hits to 1373 proteins in 381 species: Archae - 4; Bacteria - 1000; Metazoa - 6; Fungi - 6; Plants - 45; Viruses - 0; Other Eukaryotes - 3 AT3G63380 ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: calcium-transporting ATPase activity, calmodulin binding; INVOLVED IN: calcium ion transport, cation transport, metabolic process, ATP biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, 4 anthesis, petal differentiation and e AT1G18010 Major facilitator superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transmembrane transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: Major facilitator superfamily protein (TAIR:AT1G1800 AT2G21190 ER lumen protein retaining receptor family protein; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: integral to membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana AT3G57320 unknown protein; Has 30 Blast hits to 30 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G37010 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G65710.1); Has 6746 Blast hits to 5259 proteins in 486 species: Archae - 7; Bacteria - 485; Metazoa - 3508; Fungi - 577; Plants - 378; Viruses - 50; Other Eukaryotes - 1741 AT2G47010 unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G17030.1); Has 72 Blast hits to 72 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 71; Viruses - 0; Other E AT4G17070 peptidyl-prolyl cis-trans isomerases; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: response to oxidative stress; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); Has 214 Blast hits to 208 proteins in 48 species: Archae - 0; Bacteria - 4 AT5G55570 unknown protein; LOCATED IN: chloroplast; Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). AT4G34630 unknown protein; Has 30 Blast hits to 30 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). AT5G54130 Calcium-binding endonuclease/exonuclease/phosphatase family; FUNCTIONS IN: calcium ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); BEST Arabidopsis thalia AT5G42010 Transducin/WD40 repeat-like superfamily protein; CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat, conserved site (InterPro:IPR019775), WD40 repeat (InterPro:IPR001680), G-protein beta WD-40 repeat, region (InterPro:IPR020472), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:I AT1G36310 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); Has 3470 Blast hits to 3347 proteins in 987 species: Archae - 310; Bacteria - 1939; Metazoa - 304; Fungi - 160; Plants - 7 AT1G54570 Esterase/lipase/thioesterase family protein; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, catalytic activity; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Diacylglycerol acyltransferase (InterPro:IPR007130); BEST Arabidopsis thaliana protein match is: Esterase/lipase/thioesterase family AT1G15890 Disease resistance protein (CC-NBS-LRR class) family; FUNCTIONS IN: ATP binding; INVOLVED IN: N-terminal protein myristoylation, apoptosis, defense response; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611), Disease resistance protein (InterPro:IPR00 AT4G15020 hAT transposon superfamily; FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein of unknown function DUF659 (InterPro:IPR00 AT4G21865 unknown protein; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G01070 Lung seven transmembrane receptor family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane receptor, eukaryota (InterPro:IPR009637); BEST Arabidopsis thaliana protein match is: Lung seven tra AT4G03500 Ankyrin repeat family protein; CONTAINS InterPro DOMAIN/s: Ankyrin repeat-containing domain (InterPro:IPR020683), Ankyrin repeat (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: Ankyrin repeat family protein (TAIR:AT4G03460.1); Has 38634 Blast hits to 17459 proteins in 653 species: Archae - 49; Bacteria - 2374; Metazoa - 20314; Fungi - 3164; Plants - 3215; Viruses - 213; Other Eukaryotes - 9305 (source: NCBI AT4G33985 Protein of unknown function (DUF1685); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1685 (InterPro:IPR012881); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1685) (TAIR:AT2G15590.2); Has 30201 Blast hits to 17 AT3G13980 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G54200.1); Has 1485 Blast hits to 418 proteins in 98 species: Archae - 0; Bacteria - 6; Metazoa - 246; Fungi - 61; Plants - 107; Viruses - 6; Other Eukaryotes - 1059 (source: NCBI BLink). AT5G20170 RNA polymerase II transcription mediators; FUNCTIONS IN: RNA polymerase II transcription mediator activity; INVOLVED IN: regulation of transcription from RNA polymerase II promoter; LOCATED IN: mediator complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mediator complex, subunit Med17 (InterPro:IPR019313); Has 84 Blast hits to 82 proteins in 34 species: A AT1G22250 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G78170.1); Has 64 Blast hits to 64 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G50970 Membrane trafficking VPS53 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Vps53-like, N-terminal (InterPro:IPR007234); BEST Arabidopsis thaliana protein match is: Membrane trafficking VPS53 family protein (TAIR:AT1G50500.1); Has 637 Blast hits to 44 AT3G51530 F-box/RNI-like/FBD-like domains-containing protein; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box/RNI-like/FBD-like domains-containing protein (TAIR:AT3G52680.2); Has 1900 Blast hits to 1872 protein AT3G42190 transposable element gene; similar to cysteine-type peptidase [Arabidopsis thaliana] (TAIR:AT3G42820.1); contains domain Cysteine proteinases (SSF54001) AT2G26530 unknown function AT5G37370 encodes a putative splicing factor. Over-expression in yeast and Arabidopsis result in increased tolerance to high salt. AT4G34430 Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). AT5G14170 CHC1 is predicted to encode a protein that belongs to the chromodomain remodeling complex. Two RNAi knock-down lines have a dwarf phenotype and reduced rates of Agrobacterium-mediated transformation. The low rate of root-mediated transformation rate may result from altered root morphology or reduced root growth rates. AT4G25990 chloroplast import apparatus CIA2-like. CIA2 is a transcription factor which upregulates chloroplast translocon genes AT2G47860 Phototropic-responsive NPH3 family protein; FUNCTIONS IN: signal transducer activity; INVOLVED IN: response to light stimulus; EXPRESSED IN: hypocotyl, root, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: NPH3 (InterPro:IPR004249), BTB/POZ fold (InterPro:IPR011333); BEST Arabidopsis thaliana protein match is: Phototropic-responsive NPH3 family protein (TAIR:AT1G0 AT1G07130 Encodes a protein with similarity to yeast STN1, an OB fold protein involved in protecting yeast telomeres. In Arabidopsis, loss of STN1 function mutations exhibit gross morphological abnormalities and defects in telomere architecture and maintenance. STN1 likely plays a role in telomere end capping. AT1G74950 TIFY10B; CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399), CCT domain-like (InterPro:IPR018467); BEST Arabidopsis thaliana protein match is: jasmonate-zim-domain protein 1 (TAIR:AT1G19180.1); Has 432 Blast hits to 427 proteins in 29 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 432; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT1G29970 60S ribosomal protein L18A-1 (RPL18AA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae/LX (InterPro:IPR021138), Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: Ribosomal protein L1 AT5G64940 Encodes a member of ATH subfamily of ATP-binding cassette (ABC) proteins. AT1G69260 ABI five binding protein (AFP1); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: ABI five binding protein 2 (TAIR:AT1G13740.1); Has 267 Blast hits to 267 proteins in 42 species: Archae - 0; Bacteria - 6; Metazoa - 29; Fungi - 9; Plants - 184; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). AT1G13740 Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent. AT2G39570 Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. AT3G62910 Isolated in a screen for chloroplast development mutants. Pale green, albino seedlings arrest early in seedling development. AT2G24100 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30780.1); Has 101 Blast hits to 101 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 95; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). AT5G47580 unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17250.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT5G04930 Encodes a putative aminophospholipid translocase (p-type ATPase) involved in chilling response. AT5G44240 aminophospholipid ATPase 2 (ALA2); FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism; INVOLVED IN: metabolic process, phospholipid transport, ATP biosynthetic process; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (Inter AT5G38110 This gene is predicted to encode a silencing group A protein. Plant lines expressing RNAi constructs directed against SGA1 have reduced levels of agrobacterium-mediated root transformation. AT4G18980 Encodes a nuclear-targeted protein AtS40-3 that modulates senescence associated gene expression. AT1G54210 AUTOPHAGY 12 A (ATG12A); INVOLVED IN: autophagy, protein ubiquitination involved in ubiquitin-dependent protein catabolic process; LOCATED IN: cytoplasm; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Autophagy-related protein 12 (InterPro:IPR007242); BEST Arabidopsis thaliana protein match is: Ubiquitin-like superfamily protein (TAIR:AT3G13970.1); Has 304 AT1G12820 Auxin receptor involved in primary and lateral root growth inhibition in response to nitrate. Target of miR393. Induced by nitrate in primary roots. AT1G78100 F-box family protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G22220.1); Has 149 Blast hits to 148 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 149; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G25710 Encodes a basic helix–loop–helix transcription factor that is expressed in the hypophysis-adjacent embryo cells, and is required and partially sufficient for MP-dependent root initiation. Involved in response to phosphate starvation. Negative regulator of root hair development, anthocyanin formation and Pi content. AT5G36890 beta glucosidase 42 (BGLU42); FUNCTIONS IN: cation binding, beta-glucosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: cellulose catabolic process, carbohydrate metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1, beta-glucosidase (InterPro:IPR017736), Glycoside hydro AT1G79110 Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. AT3G61190 Encodes a protein with a C2 domain that binds to BON1 in yeast two hybrid analyses. Its ability to bind to phospholipids is enhanced by calcium ions. Involved in maintaining cell homeostasis. AT5G42750 Encodes a plasma-membrane associated phosphoprotein that interacts directly with the kinase domain of BRI1. It interferes with the interaction between BRI1 with its signalling partner, the plasma membrane localised LRR-receptor kinase BAK1. AT5G49480 AtCP1 encodes a novel Ca2+-binding protein, which shares sequence similarities with calmodulins. The expression of AtCP1 is induced by NaCl. AT1G70670 The gene encodes a stress-responsive and OB-associated non-seed caleosin-like protein. It plays a negative regulator role in ABA signaling. AT2G41010 Encodes a novel calmodulin binding protein whose gene expression is induced by dehydration and ionic (salt) and non-ionic (mannitol) osmotic stress. Lines over-expressing this gene are more sensitive and anti-sense lines are more tolerant to osmotic stress, suggesting this gene may be a negative regulator of response to osmotic stress. AT5G42380 calmodulin like 37 (CML37); FUNCTIONS IN: calcium ion binding; INVOLVED IN: response to ozone; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: EF-Hand 1, calcium-binding site (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-hand-like domain (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF-hand (InterP AT4G20780 Calcium sensor involved in trichome branching. AT1G04260 Encodes protein that interacts with CaMV movement protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as the rat PRA1) which have been described as rab acceptors. AT3G07370 Encodes AtCHIP, a new class of E3 ubiquitin ligases with three tetratricopeptide repeats and a U-box domain, structurally similar to the animal CHIP proteins. Plays an important role in plant cellular metabolism under temperature stress conditions. Functions as an E3 ubiquitin ligase of protein phosphatase 2A subunits and alters plant response to abscisic acid treatment. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide rep AT4G18510 CLE2, putative ligand, member of large gene family homologous to Clavata3 AT2G20190 Encodes a microtubule-associated protein that is involved in both cell division and cell expansion. It likely promotes microtubule stability. AT1G49970 Encodes a ClpP-related sequence. Though similar to ClpP proteins, this does not contains the highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). AT2G15970 encodes an alpha form of a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. AT5G42900 cold regulated gene 27 (COR27); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G33980.1); Has 74 Blast hits to 74 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G50830 cold acclimation protein WCOR413-like protein beta form. Transcript is not detectable. AT4G36290 R-protein-interacting protein that localizes to endosomes and functions in resistance gene–mediated immunity. AT5G03190 conserved peptide upstream open reading frame 47 (CPUORF47); FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G53400.1); Has 277 Blast hits to 276 proteins in 25 specie AT4G12560 Encodes CPR1 (Constitutive Expresser of PR Genes 1, also known as CPR30), a F-Box protein that functions as a negative regulator of defense response and targets resistance proteins. AT4G00930 Encodes COP1-interacting protein CIP4.1. AT3G23070 Encodes a CRM domain protein CFM3a, involved in group IIB intron splicing in chloroplasts. AT2G21490 dehydrin LEA (LEA); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to water, response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: petal, leaf whorl, sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Dehydrin (InterPro:IPR000167); BEST Arabidopsis thaliana protein match is: Dehydrin family protein (TAIR:AT4G AT3G50980 dehydrin xero 1 (XERO1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to water, response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, inflorescence meristem, petal, leaf whorl, seed; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Dehydrin (InterPro:IPR000167); BE AT1G79760 Identified as target of the AGL15 binding motif CArG. AT4G15910 encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The transcript level is also affected by changes of endogenous or exogenous abscisic acid level. It appears to be a member of plant-specific gene family that includes late embryo-abundant and zinc- IAA-induced proteins in other plants. AT4G35560 Target promoter of the male germline-specific transcription factor DUO1. AT1G20450 Encodes a gene induced by low temperature and dehydration. Inhibits e.coli growth while overexpressed. Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. LTI29 and LTI30 double overexpressors confer cold tolerance. Localized to membranes and cytoplasm. AT3G18390 embryo defective 1865 (EMB1865); FUNCTIONS IN: RNA binding; INVOLVED IN: embryo development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: CRM family member 3B (TAIR:AT4G14510.1); Has 1281 Blast hits to 114 AT5G39680 EMBRYO DEFECTIVE 2744 (EMB2744); CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT2G27610.1); Has 37711 Blast hits to 13427 proteins in 206 species: Archae - 0; Bacteria - 0; Metazoa - 37; Fungi - 23; Plants - 37282; Viruses - 0; Other Eukaryotes - 369 (source: NCBI BLink). AT4G13235 Encodes a defensin-like (DEFL) family protein. AT2G48140 embryo sac development arrest 4 (EDA4); CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (TAIR:AT1G05450.2); Has 541 Blast hits to 526 proteins AT2G36640 Encodes putative phosphotyrosine protein belonging to late embryogenesis abundant (LEA) protein in group 3 that might be involved in maturation and desiccation tolerance of seeds. RFLP and CAPS mapping place it on chromosome 4 but the nucleotide sequence maps it to chromosome 2. AT4G02440 EID1 is an F-box protein that functions as a negative regulator in phytochrome A (phyA)-specific light signalling. Expressed at all stages of plant development independently of light conditions, localizes to the nucleus, and forms nuclear speckles under continuous far-red light. Forms stable dimeric and trimeric complexes with several ASK proteins and Cullin1 in yeast and in planta. AT4G19040 Encodes a PH and START domain-containing protein that mediates resistance to pathogenic fungi. Resistance requires salicylic acid signalling. Mutants are resistant to E. cichoracearum. Expressed throughout plant tissues and possibly localized to membranes /mitochondrion. AT5G17170 enhancer of sos3-1 (ENH1); FUNCTIONS IN: electron carrier activity, metal ion binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rubredoxin-type Fe(Cys)4 protein (InterPro:IPR004039), PDZ/DHR/GLGF (InterPro:IPR001478); BEST Arabidopsis thaliana protein match is: Rubredoxin-lik AT3G20290 Encodes AtEHD1, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD2, At4g05520). AT3G55990 Encodes ESK1 (Eskimo1). A member of a large gene family of DUF231 domain proteins whose members encode a total of 45 proteins of unknown function. ESK1 functions as a negative regulator of cold acclimation. Mutations in the ESK1 gene provides strong freezing tolerance. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene AT5G49830 Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. AT3G29030 Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) AT3G52370 FASCICLIN-like arabinogalactan protein 15 precursor (FLA15); INVOLVED IN: cell adhesion; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAS1 domain (InterPro:IPR000782); BEST Arabidopsis thaliana protein match is: FASCICLIN-like arabinogalactan protein 16 precursor (TAIR:AT2G35860.1); Has 1194 Blast hits to 1139 protein AT3G11700 FASCICLIN-like arabinogalactan protein 18 precursor (FLA18); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cyclopentenone, cell adhesion; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FAS1 domain (InterPro:IPR000782); BEST Arabidopsis thaliana protein match is: FASCICLIN-like arabinogalactan protein 17 precurs AT5G01600 Encodes a ferretin protein that is targeted to the chloroplast. Member of a Ferritin gene family. Gene expression is induced in response to iron overload and by nitric oxide. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. AT3G53800 Encodes one of the Arabidopsis orthologs of the human Hsp70-binding protein 1 (HspBP-1) and yeast Fes1p: Fes1A (AT3G09350), Fes1B (AT3G53800), Fes1C (AT5G02150). AT1G28200 VirF-interacting protein FIP1 AT4G26700 fimbrin-like protein AT3G14270 Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar AT4G17060 Encodes one of the FRI interacting proteins: FRIGIDA INTERACTING PROTEIN 1 (FIP1)/At2g06005, FIP2/ At4g17060. FRI (At4G00650) is a major determinant of natural variation in Arabidopsis flowering time. AT3G28340 Encodes a protein with putative galacturonosyltransferase activity. AT3G13222 Encodes a protein that binds to G-box binding transcription factors and enhances their binding affinities to G-box in vitro. This protein localizes to the nucleus and is expressed predominantly in the root. AT2G18440 Encodes a noncoding RNA, a member of an emerging class of transcripts that lack significant open reading frames and encode RNA as their final product. AT2G22475 Encodes GL2-expression modulator (GEM). Involved in the spatial control of cell division, patterning and differentiation of Arabidopsis root epidermal cells. GEM interacts with CDT1, a DNA replication protein and TTG1 (TRANSPARENT TESTA GLABRA1), a WD40-repeat protein involved in GL2-dependent cell fate decision. GEM seems to participate in the maintenance of a repressor histone H3 epigenetics status of the GL2 and CPC (C AT4G31730 Glutamine dumper1 is a putative transmembrane protein. It is involved in glutamine secretion AT5G24920 Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). AT1G10270 glutamine-rich protein 23 (GRP23); FUNCTIONS IN: binding; INVOLVED IN: embryo development, cell division; LOCATED IN: nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily pro AT1G03850 Encodes glutaredoxin ATGRXS13, required to facilitate Botrytis cinerea infection of Arabidopsis thaliana plants. Sylvain La Camera et al (2011, PMID:21756272) reported a third splice variant in addition to the two annotated in TAIR10. AT5G41080 PLC-like phosphodiesterases superfamily protein; FUNCTIONS IN: phosphoric diester hydrolase activity, glycerophosphodiester phosphodiesterase activity; INVOLVED IN: glycerol metabolic process, lipid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946), Glycerophosphoryl d AT2G32690 Glycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid. AT2G05520 Encodes a glycine-rich protein that is expressed mainly in stems and leaves. mRNA levels are upregulated in response to ABA, salicylic acid and ethylene but downregulated in response to dessication. AT3G61570 This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC3 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (161 aa) portion of the protein. AT2G22840 Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower AT5G13190 Encodes a plasma membrane localized LITAF domain protein that interacts with LSD1 and acts as a negative regulation of hypersensitive cell death. AT1G33240 Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome. AT5G05930 guanylyl cyclase 1 (GC1); CONTAINS InterPro DOMAIN/s: Guanylyl cyclase (InterPro:IPR018616); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT5G56010 A member of heat shock protein 90 (HSP90) gene family. Expressed in all tissues and abundant in root apical meristem, pollen and tapetum. Expression is NOT heat-induced but induced by IAA and NaCl. Overexpression reduced tolerance to heat and conferred higher tolerance to calcium. AT2G24150 heptahelical transmembrane protein HHP3 AT3G01290 SPFH/Band 7/PHB domain-containing membrane-associated protein family; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: mitochondrion, plasma membrane, vacuole, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: SPFH/Band 7/PHB domain-containing membran AT3G16730 CONTAINS InterPro DOMAIN/s: Non-SMC condensin II complex, subunit H2-like (InterPro:IPR009378); Has 249 Blast hits to 211 proteins in 82 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 8; Plants - 30; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink). AT5G42810 Encodes an inositol tetra-/pentaphosphate 2-kinase, involved in the biosynthesis of phytic acid, a regulator of intracellular signaling, a highly abundant animal antinutrient, and a phosphate and mineral storage compound in plant seeds. AT4G00820 IQ-domain 17 (iqd17); CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQ-domain 18 (TAIR:AT1G01110.2); Has 1332 Blast hits to 1131 proteins in 120 species: Archae - 0; Bacteria - 14; Metazoa - 172; Fungi - 58; Plants - 857; Viruses - 43; Other Eukaryotes - 188 (source: NCBI BLink). AT3G49260 IQ-domain 21 (iqd21); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQ-domain 2 (TAIR:AT5G03040.3). AT5G35670 IQ-domain 33 (iqd33); CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQ-domain 3 (TAIR:AT3G52290.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT5G26820 Mutations in MAR1 confer resistance, while MAR1 overexpression causes hypersensitivity to multiple aminoglycoside antibiotics. Localizes to the chloroplast envelope. MAR1 may act as a plastid transporter involved in cellular iron homeostasis. AT3G17860 JAZs are direct targets of the SCFCOI1 E3 ubiquitin-ligase and JA treatment induces their proteasome-mediated degradation. Furthermore, JAI3 negatively regulates the key transcriptional activator of JA responses, AtMYC2. The C-terminal portion of JAZ3, including the Jas domain, appears to be important for JAZ3-COI1 binding in the presence of coronatine. AT2G34600 jasmonate-zim-domain protein 7 (JAZ7); CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399); BEST Arabidopsis thaliana protein match is: jasmonate-zim-domain protein 8 (TAIR:AT1G30135.1); Has 38 Blast hits to 38 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT2G19600 member of Putative potassium proton antiporter family AT1G31350 KAR-UP F-box 1 (KUF1); CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: Galactose oxidase/kelch repeat superfamily protein (TAIR:AT1G55270.1); Has 661 Blast hits to 661 proteins in 63 species: Archae - 0; Bacteria - 29; Metazoa - 81; Fungi - 0; Plants - 548; Vi AT2G35300 Encodes LEA4-2/LEA18, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. AT1G32560 Encodes LEA4-1, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. AT2G14560 Encodes LURP1, a member of the LURP cluster (late upregulated in response to Hyaloperonospora parasitica) which exhibits a pronounced upregulation after recognition of the pathogenic oomycte H. parasitica. LURP1 is required for full basal defense to H. parasitica and resistance to this pathogen mediated by the R-proteins RPP4 and RPP5. AT3G03310 lecithin:cholesterol acyltransferase 3 (LCAT3); FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); BEST Arabidopsis thaliana protein match is: alpha/beta-Hydrolase AT5G02840 CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis. AT3G23290 LIGHT SENSITIVE HYPOCOTYLS 4 (LSH4); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF640) (TAIR:AT2G31160.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT1G72520 PLAT/LH2 domain-containing lipoxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen, lipoxygenase activity, iron ion binding, metal ion binding; INVOLVED IN: growth, jasmonic acid biosynthetic process, response to wounding, defense response; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED D AT3G02550 LOB domain-containing protein 41 (LBD41); CONTAINS InterPro DOMAIN/s: Lateral organ boundaries, LOB (InterPro:IPR004883), Asymmetric leaves, AS2/LOB (InterPro:IPR017414); BEST Arabidopsis thaliana protein match is: LOB domain-containing protein 40 (TAIR:AT1G67100.1); Has 601 Blast hits to 600 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 601; Viruses - 0; Other Eukaryotes - 0 (source: N AT2G27230 Encodes a nuclear-localized transcriptional activator with weak sequence similarity to basic helix-loop-helix(bHLH)-domain proteins. It promotes the production of stele cells in root meristems and is required to establish and maintain the normal vascular cell number and pattern in primary and lateral roots. AT3G02170 Encodes LONGIFOLIA2 (LNG2). Regulates leaf morphology by promoting cell expansion in the leaf-length direction. The LNG2 homologue LNG1 (At5g15580) has similar function. AT4G37300 maternal effect embryo arrest 59 (MEE59); Has 70 Blast hits to 70 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT3G14810 mechanosensitive channel of small conductance-like 5 (MSL5); INVOLVED IN: transmembrane transport; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Membrane protein, At2g17000, predicted (InterPro:IPR016688), Mechanosensitive ion channel MscS (InterPro:IPR006685), Like-Sm ribonucleoprotein (LSM)-related domain (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: mechanosensitive channel of sma AT3G09390 metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage AT5G08210 Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGUAGCAGUAGCGGUGGUAA AT4G38440 Encodes MINIYO (IYO), a positive regulator of transcriptional elongation that is essential for cells to initiate differentiation. AT3G63150 Encodes a calcium binding GTPases that is localized to the mitochondrion and is involved in salt stress response. AT1G53480 Encodes MRD1 (mto 1 responding down). Down-regulated in mto1-1 mutant that over-accumulates soluble methionine. AT5G63790 Encodes a member of the NAC family of transcription factors. ANAC102 appears to have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings. AT5G04410 NAC family member, functions as a transcriptional activator, regulates flavonoid biosynthesis under high light. AT4G01550 Encodes a plasma-membrane bound NAC transcription factor, whose controlled proteolytic activation allows it to enter the nucleus. AT1G32870 NAC domain protein 13 (NAC13); CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC domain containing protein 16 (TAIR:AT1G34180.1); Has 2951 Blast hits to 2946 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 2931; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). AT4G35580 NAC transcription factor-like 9 (NTL9); CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC 014 (TAIR:AT1G33060.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT5G46830 Calcium-binding transcription factor involved in salt stress signaling. AT1G74880 Encodes subunit NDH-O of NAD(P)H:plastoquinone dehydrogenase complex (Ndh complex) present in the thylakoid membrane of chloroplasts. This subunit is thought to be required for Ndh complex assembly. AT3G47450 Encodes a protein with similarity to the bacterial YqeH GTPase required for proper ribosome assembly. In Arabidopsis, mutant analyses show that this protein regulates growth and hormonal signaling in plants. It also attenuates oxidative stress and reactive oxygen species (ROS). It also seems to be involved in regulating leaf senescence and cell death. This gene product is also involved in nitric oxide biosynthesis in response to ABA but no AT1G31470 NUCLEAR FUSION DEFECTIVE 4 (NFD4); INVOLVED IN: response to salt stress; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: Major facilitator superfamily protein (TAIR:AT3G016 AT1G19520 NUCLEAR FUSION DEFECTIVE 5 (NFD5); EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G01970.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3 AT5G18860 Encodes a purine nucleoside hydrolase active in the apoplast. It might play a role in salvaging extracellular ATP. NSH3 transcript levels rise in response to jasmonic acid and wounding. AT2G15820 Encodes a protein that promotes splicing of type II introns. otp51 mutants fail to splice intron 2 of plastid ycf3 transcripts, a factor required for the assembly of Photosystem I. Therefore, homozygous otp51 mutants have profound photosynthetic defects and can only survive in sucrose-supplemented in vitro cultures under low light conditions. OTP51 may also be involved in splicing several other transcripts and precursor forms of the trnL, trnG AT2G40000 ortholog of sugar beet HS1 PRO-1 2 (HSPRO2); CONTAINS InterPro DOMAIN/s: Hs1pro-1, C-terminal (InterPro:IPR009743), Hs1pro-1, N-terminal (InterPro:IPR009869); BEST Arabidopsis thaliana protein match is: Hs1pro-1 protein (TAIR:AT3G55840.1); Has 71 Blast hits to 71 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). AT2G32100 ovate family protein 16 (OFP16); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623 (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: ovate family protein 12 (TAIR:AT1G05420.1); Has 251 Blast hits to 251 proteins in 22 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 0; Plants - 235; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G57780 Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. AT3G29370 Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. AT3G26060 encodes periredoxin Q which decomposes peroxides and plays a role in the protection of the photosynthetic apparatus AT1G65390 phloem protein 2 A5 (PP2-A5); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: signal transduction, defense response, innate immune response; LOCATED IN: intrinsic to membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: phloem protein 2-A6 (TAIR:AT5G AT3G61060 phloem protein 2-A13 (PP2-A13); CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364); BEST Arabidopsis thaliana protein match is: phloem protein 2-A12 (TAIR:AT1G12710.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink AT1G73010 Encodes PPsPase1, a pyrophosphate-specific phosphatase catalyzing the specific cleavage of pyrophosphate (Km 38.8 uM) with an alkaline catalytic pH optimum. AT4G03960 Encodes an atypical dual-specificity phosphatase. AT1G14870 PCR2 encodes a membrane protein involved in zinc transport and detoxification. AT3G22590 Encodes PLANT HOMOLOGOUS TO PARAFIBROMIN (PHP), a homolog of human Paf1 Complex (Paf1C) subunit Parafibromin. Human Parafibromin assists in mediating output from the Wnt signaling pathway, and dysfunction of the encoding gene HRPT2 conditions specific cancer-related disease phenotypes. PHP resides in a ~670-kDa protein complex in nuclear extracts, and physically interacts with other known Paf1C-related proteins AT5G58650 Encodes PSY1, an18-aa tyrosine-sulfated glycopeptide that promotes cellular proliferation and expansion. PSY1 is widely expressed in various tissues, including shoot apical meristem, and is highly up-regulated by wounding. Perception of PSY1 depends on At1g72300, a leucine-rich repeat receptor kinase (LRR-RK). AT1G60190 Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. AT2G35930 Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. AT3G46780 plastid transcriptionally active 16 (PTAC16); FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding domain (InterPro:IPR016040), NmrA-like (InterPro:IPR008030); BEST Arabidopsis thaliana protein match is: NAD(P)-binding Rossmann-fold superfamily pr AT4G20010 plastid transcriptionally active 9 (PTAC9); FUNCTIONS IN: single-stranded DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plastid chromosome, nucleoid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Primosome PriB/single-strand DNA-b AT4G27540 prenylated RAB acceptor 1.H (PRA1.H); CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT3G13330 Encodes a protein that interacts with the 26S proteasome. Mutants are phenotypically indistinguishable from wild type plants under a variety of growth conditions. Protein levels increase upon exposure of seedlings to MG132, a specific, potent, reversible, and cell-permeable proteasome inhibitor. AT5G46790 Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. AT1G79650 Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. AT1G32230 Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. AT3G16570 Encodes RALF23, a member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF23 is significantly downregulated by brassinolide treatment of seedlings. Overexpression of AtR AT3G23590 REF4-related 1 (RFR1); BEST Arabidopsis thaliana protein match is: reduced epidermal fluorescence 4 (TAIR:AT2G48110.1); Has 143 Blast hits to 139 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 143; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). AT5G62920 Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin. AT5G24660 RESPONSE TO LOW SULFUR 2 (LSU2); BEST Arabidopsis thaliana protein match is: response to low sulfur 4 (TAIR:AT5G24655.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). AT5G17300 Myb-like transcription factor that regulates hypocotyl growth by regulating free auxin levels in a time-of-day specific manner. AT5G37260 Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis. AT4G31700 Encodes a putative ribosomal protein S6 (rps6a). RPS6A and RPS6B are fully redundant and essential during gametogenesis. AT1G13620 Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), A AT5G64770 Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), A AT5G02020 Encodes a protein involved in salt tolerance, names SIS (Salt Induced Serine rich). AT4G02380 Encodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses. AT5G45610 Encodes a homologue of the ATR-interacting protein ATRIP. Mutant (named sensitive to UV2 or suv2) is UVB-hypersensitive and defective in DNA damage response. AT2G21400 A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. AT3G56710 Sig1 binding protein; interacts with Sig1R4. As well as Sig1, SibI is imported into chloroplasts and its expression is light-dependent in mature chloroplasts. AT2G35510 Encodes a WWE domain-containing protein with 76% similarity to RCD1. The protein also contains a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. AT3G47720 Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. AT5G62520 Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Up-regulated by NaCl. SRO5 and P5CDH (an overlapping gene in the antisense orientation) generate AT5G55760 Encodes SRT1, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). AT5G09230 Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). AT5G02600 Heavy metal transport/detoxification superfamily protein ; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: Chloroplast-targeted copper chaperone protein (TAIR:AT2G AT1G09070 SRC2 specifically binds the peptide PIEPPPHH, and moves from ER to a vacuole fraction where it gets internalized. Involved in Protein Storage Vacuole targeting. AT5G13960 Encodes a histone 3 lysine 9 specific methyltransferase involved in the maintenance of DNA methylation. SUVH4/KYP is a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. In kyp mutants, there is a loss of CpNpG methylatio AT1G17770 Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. A paternally expressed imprinted gene. AT3G59770 Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses. AT1G80680 Mutant has early-flowering phenotype, encodes a putative nucleoporin. Required for the activation of downstream defense pathways by the snc1 mutation. Involved in basal resistance against bacterial pathogens. AT4G37120 Encodes a zinc finger containing protein similar to step II splicing factors that is similar to SMP1. SMP2 is also reduced in SMP1 epigenetic alleles; plants make smaller organs having reduced cell numbers but increased cell size. AT2G20990 Encodes a plasma membrane localized protein with similarity to synaptotagmins, a class of membrane trafficking proteins. SYT1 is expressed in all tissues. Loss of function mutations show hypersensitivity to NaCl and electrolyte leakage from the plasma membrane. SYT1 also affects calcium dependent freezing tolerance. SYT1 probably plays a role in membrane repair such as membrane resealing after freezing induced damage. Regulate AT5G24590 Member of NAc protein family. Interacts with turnip crinkle virus (TCV) capsid protein. Transcription factor involved in regulating the defense response of Arabidopsis to TCV. AT5G59430 Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein. AT5G58070 Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. AT4G13280 Catalyzes the conversion of farnesyl diphosphate to (Z)-gamma-bisabolene and the additional minor products E-nerolidol and alpha-bisabolol. Expressed in cortex and sub-epidermal layers of roots, leaf hydathodes and flower stigmata. Induced by wounding. AT4G32570 TIFY domain protein 8 (TIFY8); CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). AT5G27030 TOPLESS-related 3 (TPR3); FUNCTIONS IN: protein binding; INVOLVED IN: primary shoot apical meristem specification; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat, conserved site (InterPro:IPR019775), WD40 repeat (InterPro:IPR001680), CTLH, C-terminal LisH motif (InterPro:IPR006595), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 AT5G23080 Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1. AT3G55380 ubiquitin-conjugating enzyme 14 (UBC14); CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: ubiquitin carrier protein 7 (TAIR:AT5G59300.1). AT5G57990 Encodes a ubiquitin-specific protease. AT4G30890 Encodes a ubiquitin-specific protease. AT3G56040 UDP-glucose pyrophosphorylase 3 (UGP3); FUNCTIONS IN: nucleotidyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UTP--glucose-1-phosphate uridylyltransferase (InterPro:IPR002618); Has 215 Blast hits to 211 proteins in 91 species: Archae - 0; Bacteria - 18; Metazoa - 12; Fungi - 60; Pla AT1G16730 unknown protein 6 (UP6); Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). AT5G43580 Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Functions in resistance to necrotrophic fungi and insect herbivory. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. AT1G29280 member of WRKY Transcription Factor; Group II-e AT3G04630 Member of a small gene family which have a KLEEK domain which may be involved in protein- protein interactions. Over expression of WDL1 results in abnormal root development. AT2G35610 Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. AT5G57360 Encodes clock-associated PAS protein ZTL; Also known as FKF1-like protein 2 or ADAGIO1(ADO1). A protein containing a PAS domain ZTL contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. ZTL is the F-box component of an SCF complex implicated in the degradation of TOC1. The query for the following terms resulted in no hits: AT4G18200 AT1G18381 AT4G39450