sign in sign up
<<
Home , FCGR3A, Glycophorin C, XK (protein)

Journal of Group Serology and Molecular Genetics

Vo l u m e 31, N u m b e r 1, 2015

Immunohematology Journal of Blood Group Serology and Molecular Genetics Volume 31, Number 1, 2015 CONTENTS

O r i g i n a l R e p o r t 1 Comparative evaluation of gel column agglutination and erythrocyte magnetized technology for alloantibody titration A. Dubey, A. Sonker, and R.K. Chaudhary

O r i g i n a l R e p o r t 7 High-resolution melting analysis as an alternative method for human neutrophil genotyping K. Yasui, M. Tanaka, T. Hayashi, N. Matsuyama, A. Kuroishi, R.A. Furuta, Y. Tani, and F. Hirayama

R e v i e w 14 Kell and Kx blood group systems G.A. Denomme

O r i g i n a l R e p o r t 20 A simple approach to screen rare donors in Brazil C.P. Arnoni, F.R.M. Latini, J.G. Muniz, R.D.M. Person, T.A.P. Vendrame, D. Gazito, and L. Castilho

O r i g i n a l R e p o r t 24 Proposed criterion for distinguishing ABO mosaics from ABO chimeras using flow cytometric analysis A. Oda, N. Matsuyama, M. Hirashima, H. Ishii, K. Kimura, H. Matsukura, F. Hirayama, K. Kawa, and Y. Fukumori

R e v i e w 29 Kidd blood group system: a review J.R. Hamilton 36 A nnouncements 40 A dv e r t i s e m e n t s 44 I n s t r u c t i o n s f o r A u t h o r s 46 S u b s c r i p t i o n I n f o r m at i o n E d i to r - i n -C h i e f E d i to r ia l B oa r d Sandra Nance, MS, MT(ASCP)SBB Philadelphia, Pennsylvania Patricia Arndt, MT(ASCP)SBB Paul M. Ness, MD Pomona, California Baltimore, Maryland M a n ag i n g E d i to r Barbara J. Bryant, MD Thierry Peyrard, PharmD, PhD Cynthia Flickinger, MT(ASCP)SBB Milwaukee, Wisconsin Paris, France Wilmington, Delaware Lilian Castilho, PhD Mark Popovsky, MD Campinas, Brazil Braintree, Massachusetts Tec h n i c a l E d i to r s Christine Lomas-Francis, MSc Martha R. Combs, MT(ASCP)SBB S. Gerald Sandler, MD New York City, New York Durham, North Carolina Washington, District of Columbia Joyce Poole, FIBMS Geoffrey Daniels, PhD Jill R. Storry, PhD Bristol, United Kingdom Bristol, United Kingdom Lund, Sweden Dawn M. Rumsey, ART(CSMLT) Anne F. Eder, MD David F. Stroncek, MD Washington, District of Columbia Bethesda, Maryland Norcross, Georgia Melissa R. George, DO, FCAP Nicole Thornton S e n i o r M e d i c a l E d i to r Hershey, Pennsylvania Bristol, United Kingdom Ralph R. Vassallo, MD Brenda J. Grossman, MD Philadelphia, Pennsylvania St. Louis, Missouri E m e r i t u s E d i to r s Christine Lomas-Francis, MSc Delores Mallory, MT(ASCP)SBB A s s o c iat e M e d i c a l E d i to r s New York City, New York Supply, North Carolina P. Dayand Borge, MD Baltimore, Maryland Geralyn M. Meny, MD Marion E. Reid, PhD, FIBMS San Antonio, Texas New York City, New York David Moolten, MD Philadelphia, Pennsylvania

M o l ec u l a r E d i to r Margaret A. Keller Philadelphia, Pennsylvania Immunohematology is published quarterly (March, June, September, and December) by the E d i to r ia l A s s i s ta n t American Red Cross, National Headquarters, Washington, DC 20006. Sheetal Patel Immunohematology is indexed and included in Index Medicus and MEDLINE on the MEDLARS system. The contents are also cited in the EBASE/Excerpta Medica and Elsevier P r o d u c t i o n A s s i s ta n t BIOBASE/Current Awareness in Biological Sciences (CABS) databases. Marge Manigly The subscription price is $50 for individual, $100 for institution (U.S.), and $60 for individual, $100 for institution (foreign), per year. C o p y E d i to r Subscriptions, Change of Address, and Extra Copies: Mary L. Tod Immunohematology, P.O. Box 40325 Philadelphia, PA 19106 P r o o f r e a d e r Wendy Martin-Shuma Or call (215) 451-4902 Web site: www.redcross.org/about-us/publications/immunohematology E l ec t r o n i c P u b l i s h e r Copyright 2015 by The American National Red Cross Paul Duquette ISSN 0894-203X

O n O u r C o v e r

Jean Metzinger painted in the Divisionist mode inaugurated by Seurat as “Chromoluminarism” in the late 19th century, with its small patches of separated color and its aims of maximal brightness. But Metzinger brought to the style a faceted geometry that anticipated cubism. In Femme au Chapeau (Woman with a Hat), which he completed in 1906, we can see in the woman’s eponymous headgear and also in her clothing, face, and features, contrapuntal to their implied curvature, small cubes that embody symmetry and mathematical order. The mosaic quality of Metzinger’s composition typified his work and ties into the Oda et al. article in this issue of Immunohematology. David Moolten, MD O r i g i n a l R e p o r t Comparative evaluation of gel column agglutination and erythrocyte magnetized technology for red blood cell alloantibody titration

A. Dubey, A. Sonker, and R.K. Chaudhary

Antibody titration is traditionally performed using a conventional In 1990, Lapierre et al.3 introduced a column agglutination test tube (CTT) method, which is subjected to interlaboratory method, which gained popularity because of its standardized variations because of a lack of standardization and reproducibility. performance, technical ease, stable end point, and the The aim of this study is to compare newer methods such as gel column technology (GCT) and erythrocyte magnetized technology versatility of the method. This method is presently used (EMT) for antibody titration in terms of accuracy and precision. worldwide and has been reported to be more sensitive for Patient serum samples that contained immunoglobulin G (IgG) red detection and identification of RBC alloantibodies.4,5 However, blood cell (RBC) alloantibodies of a single specificity for Rh or K were identified during routine transfusion service testing on performing the titration studies with gel column technology and stored. Titration and scoring were performed separately by (GCT), researchers have found no linear correlation and different laboratory personnel on CTT, GCT, and EMT. Testing several-fold higher titers in comparison with CTT.6,7 This may was performed a total of three times on each sample. Results lead to overestimation of the antibody’s strength and, hence, were analyzed for accuracy and precision. A total of 50 samples were tested. Only 20 percent of samples tested with GCT showed clinical decisions toward more invasive interventions for titers identical to CTT, whereas 48 percent of samples tested with patients who develop the antibody. EMT showed titers identical to CTT. Overall, the mean of the titer A recent introduction in the field of difference from CTT was higher using GCT (+0.31) compared with is erythrocyte magnetized technology (EMT) (Fig. 1). This that using EMT (+0.13). Precision shown by CTT was 30 percent, EMT was 76 percent, and GCT was 92 percent on repeat testing. method is based on the adsorption of paramagnetic particles GCT showed higher titer values in comparison with CTT but was in the presence of an externally applied magnetic field on the found to be the most precise. EMT titers were comparable to CTT, membrane of the RBCs. Thus, after contact with antibodies, and its precision was intermediate. Further studies to validate this method are required. Immunohematology 2015;31:1–6. reactive and nonreactive magnetized RBCs are rapidly pulled

Key Words: titration, alloantibody, conventional test tube, gel column technology, erythrocyte magnetized technology

Titration is performed to assess the concentration and strength of antibodies semiquantitatively in serum or eluate samples. This procedure is quite technique dependent1 and inherently subjected to interlaboratory variations in accuracy and precision. Conventional test tube (CTT) is the recommended method for performing red blood cell (RBC) alloantibody titrations in transfusion medicine laboratories, but the method has been criticized because of concerns about inaccuracy, relatively poor reproducibility, and the subjectivity in interpretation of the titer end point.2 In recent years, several new methods have found their place in transfusion medicine laboratories for RBC serology and are suitable because of their accuracy, reproducibility, and precision. Fig. 1. Instrumentation for erythrocyte magnetized technology.

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 1 A. Dubey et al.

operator bias. Sample identity was also blinded. Titration and scoring for each serum sample was performed a total of three times. On each test day, a new master dilution was prepared and one aliquot of serum sample was tested by all three methods. For comparison of the accuracy, CTT was considered the reference method, and results obtained on the first testing of a sample were used. Results of all three trials for a particular sample were analyzed to determine precision.

Serum Dilution Serial twofold dilutions were made in normal saline. Pipette tips were changed after the transfer of each dilution. Using the same master dilution tube for all three methods reduces the likelihood of variation in titer and score relevant to Fig. 2. Plate showing results of testing by erythrocyte magnetized technology. Negative reactions appear as a dot, and positive the preparation of serial twofold dilutions. reactions are visualized as a cellular layer. Reagent RBCs to the bottom of the well when placed on a magnetic plate. A Reagent RBCs for CTT and GCT were prepared from final phase of shaking reveals positive or negative reactions, donors who were homozygous for the encoding the with no need for centrifugation (Fig. 2). The method has been corresponding antigen for the alloantibody being titrated using found to be highly reliable for evaluating ABO grouping, Rh commercial antisera (DiaClon Bio-Rad Laboratories, DiaMed phenotyping, K typing, and antibody detection.8 To the best of GmbH). A suspension was prepared in normal saline for CTT our knowledge, no major study has been conducted so far for (2%) and GCT (0.8%) using the same reagent RBCs. For EMT, evaluating antibody titration using EMT. three vials of premagnetized group O test RBCs (HemaScreen This study was conducted to determine which method I, II, III), which were supplied by the manufacturer with the (GCT versus EMT) is a better substitute for replacing the antibody detection (ScreenLys, Diagast), were used. As per age-old, gold standard of CTT for titration studies in terms the anti-gram, the reagent RBC panel cells carrying apparently of accuracy and precision. Precision serves as a more useful double dose expression of the cognate antigen were selected for indicator of the method’s ability to reproducibly predict a the titration study. rise in titer and not simply a variation observed as a result of individual technique. Titration by CTT Titration was performed using 12 test tubes following the Materials and Methods standard procedure in the AABB Technical Manual.1 Briefly, 100 μL diluted serum was placed into each test tube, and 100 The study was conducted at a transfusion medicine μL of 2 percent cell suspension was then added. The tubes department of a tertiary care hospital and research center in were incubated at 37°C for 60 minutes. After washing four North India. Blood samples that contained immunoglobulin times with saline, two drops of anti-IgG (AHG; Eryclon Tulip G (IgG) RBC alloantibodies of a single specificity for Rh or K Diagnostics, Goa, India) were added to each tube. The tubes antigens were identified during routine transfusion service were centrifuged and read for macroscopic agglutination. In- patient testing. For this study, only samples with antibodies house prepared check cells were added to all tubes showing that had strength of at least 2+ by CTT were included. Sera negative reaction and checked for agglutination to ensure the were separated from clotted blood samples and stored at –18°C integrity of the AHG test results. in three separate aliquots. They were thawed immediately before testing. Titration by GCT Testing was performed separately by different trained Titration was performed following the procedure used laboratory personnel using CTT, GCT (LISS/Coombs ID-card for antibody detection and identification. Briefly, 50 μL of 0.8 Bio-Rad Laboratories, DiaMed GmbH, Cressier, Switzerland), percent reagent RBC suspension was added to the gel column, and EMT (QWALYS 3, Diagast, Loos, France) to remove the followed by 25 μL diluted serum sample. After a standard

2 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Methods for antibody titration

15-minute incubation at 37°C, the gel cards were centrifuged times show variation, the differences were termed Δ value titer and the reactions were immediately graded. and Δ value score, respectively.

Titration by EMT Titration using EMT was also performed following Table 1. Difference in titers by GCT and EMT in comparison with CTT the procedure used for antibody detection, in which each Difference in titers (vs. CTT) GCT [n (%)] EMT [n (%)] dilution was tested as an individual sample. The machine first Identical 10 (20%) 24 (48%) dispensed 60 μL of a high-density solution (NanoLys) that Twofold prevents contact between the patient’s serum and the anti-IgG Higher 23 (46%) 16 (32%) coated on the plates (ScreenLys). Next, 60 mL diluent, 15 mL Lower 3 (6%) 5 (10%) patient’s serum, and 15 mL test RBCs (1% suspension) were Threefold dispensed. The plate was incubated at 37°C for 20 minutes and Higher 8 (16%) 4 (8%) then placed on the magnetic shaker. Sensitized cells migrated Lower 2 (4%) 1 (2%) through the NanoLys solution and reacted with the coated Fourfold anti-IgG at the bottom of the wells. Positive reactions appear Higher 4 (8%) — as a cellular layer, and negative reactions appear as a dot at Lower — — the bottom of the well (Fig. 2). The results reported by the GCT = gel column technology; EMT = erythrocyte magnetized technology; instrument were graded from negative to 4+ depending on the CTT = conventional test tube. intensity of the reaction as per the literature provided by the manufacturer. Results

Scoring and Titration End Points In the present study, 50 samples containing antibodies of For all the methods, the titer was reported as the reciprocal six different specificities were subjected to titration with CTT, of the highest dilution of serum at which 1+ agglutination GCT, and EMT. Considering CTT as the reference method, was observed, and the strength of reactions was scored as difference in titers obtained by GCT and EMT are shown described in the AABB Technical Manual.1 in Table 1. Only 20 percent of the samples tested with GCT showed titers identical with CTT, whereas 48 percent of the Statistics samples tested with EMT showed identical titers with CTT. Results are presented as numbers and percentages. For In four samples, the titers with GCT were fourfold higher than calculating the mean differences in titer by two methods, all those with CTT. In no sample were the titers by EMT that titer values were converted to a log value (the logarithm of much higher than those with CTT (i.e., fourfold). the titer value to the base 2). The arithmetic mean of these The mean difference in titers, calculated by converting the differences was then calculated. titer values to log (base 2) values for each antibody, is shown For determining the precision, the differences were in Table 2. Overall, the mean difference of titer and score from calculated between the lowest and highest values of the three CTT was higher with GCT (+0.31, 10.62) compared with that test values of titers and scores. If the results of testing three using EMT (+0.13, 4.88). The mean difference of titer between

Table 2. Comparison of the mean difference in titer and score

Mean difference in titer Mean difference in score Antibody specificity Number GCT–CTT EMT–CTT GCT–CTT EMT–CTT Anti-D 32 +0.38 +0.12 12.19 7.06 Anti-E 2 +0.30 +0.15 9.50 7.0 Anti-e 6 –0.10 –0.05 2.17 3.50 Anti-C 7 +0.26 +0.17 11.58 4.72 Anti-c 1 +0.30 0 10.0 2.0 Anti-K 2 +0.45 +0.15 7.0 5.0 Total 50 +0.31 +0.13 10.62 4.88 GCT = gel column technology; CTT = conventional test tube method; EMT = erythrocyte magnetized technology.

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 3 A. Dubey et al.

Table 3. Precision of various methods in terms of titer comparison with GCT demonstrated similar performance Difference in titer* CTT GCT EMT in detecting clinically relevant antibodies together with a Δ0 15 (30%) 46 (92%) 38 (76%) noteworthy reduction in the number of antibodies without Δ1 28 (56%) 4 (8%) 11 (22%) clinical importance.8 This previous information led us to Δ2 5 (10%) — 1 (2%) evaluate the EMT against GCT as a suitable method for Δ3 2 (4%) — — antibody titration. *Δ represents the highest difference in titer. The titration of antibodies by the three methods in the CTT = conventional test tube; GCT = gel column technology; present study showed variable results. On comparison of the EMT = erythrocyte magnetized technology. titers, it was observed that titers obtained by EMT correlate Table 4. Precision of various methods in terms of score better with CTT than GCT. In nearly half of the samples (48%), Difference in score* CTT GCT EMT the titers obtained by CTT and EMT were identical. However, Δ0–2 12 (24%) 39 (78%) 32 (64%) with GCT, 46 percent of the samples were found to have twofold Δ3–4 20 (40%) 9 (18%) 12 (24%) higher titers than CTT, and 8 percent had titers as much as Δ5–6 9 (18%) 2 (4%) 4 (8%) fourfold higher in comparison with CTT. Many studies have Δ6–7 5 (10%) — 2 (4%) been conducted in the past for comparing the titrations by Δ8–9 2 (4%) — — CTT and GCT and have reported variable findings. Novaretti Δ>10 2 (4%) — — et al.6 found a strong variability in anti-D titration by GCT in *Δ represents the highest difference in score. all 79 samples tested. The observed differences were as high CTT = conventional test tube; GCT = gel column technology; as threefold in 5 sera, fourfold in 21, fivefold in 30, sixfold in EMT = erythrocyte magnetized technology. 20, sevenfold in 2, and eightfold in 1. Thus, these authors have GCT and CTT was highest for anti-K (+0.45), followed by concluded that GCT should not be used for anti-D to monitor anti-D. The mean difference of score between EMT and CTT fetuses at risk for hemolytic disease of the fetus and newborn was highest for anti-C (+0.17). The mean difference of score (HTFN). from CTT was highest for anti-D for both GCT (12.19) and Bromilow et al.11 found that 31 of 34 samples with Rh, E M T (7.06). K, Duffy, and Kidd alloantibodies had a higher titer score by Reproducibility of the methods was compared in terms GCT than CTT. Of 82 samples with Rh alloantibodies, Steiner of precision. Comparing the differences when repeating both et al.12 reported that only 20 (24%) had significantly higher the titration and scoring values (Tables 3 and 4), the highest titers by GCT compared with CTT. In their evaluation of 27 precision was observed with GCT, followed by EMT, and was samples with non-Rh antibodies, the two methods performed lowest with CTT. In terms of titer, absolute precision was seen equivalently, generating titers within two serial dilutions for all with GCT in 92 percent of cases, EMT in 76 percent of cases, samples. A previous study from India reported that GCT is more and CTT in 30 percent of cases. Highest precision in terms of sensitive than CTT for antibody detection, but significantly score (Δ0–2) was seen with GCT in 78 percent of cases, EMT higher titers were found in 22 (26.5%) of 83 samples tested. in 64 percent of cases, and CTT in 24 percent of cases. The authors thus concluded that titers obtained by GCT should not be relied on for clinical management of HDFN. Discussion GCT has also been evaluated for monitoring titers of anti-A and anti-B in patients undergoing ABO-incompatible CTT is recommended for performing antibody titration, transplantation performed by Shirey et al.13 They but this method is subject to technical variables that can affect have found identical titer values by GCT and CTT in 26 of 50 the results substantially. This study was conducted to establish samples, and no sample’s titer values varied more than one whether titrations with newer methods such as GCT and EMT dilution between the two methods. Other researchers have correlate with CTT and to compare the precision of various reported that anti-A and anti-B titers obtained by GCT were methods. less variable between institutions and demonstrated better There are no previous studies on antibody titration by clinical correlation compared with titers by CTT in similar EMT; however, a few studies have been conducted to evaluate transplant programs.14,15 antibody titration by EMT for ABO-Rh testing, antibody In the present study, the titer values for most of the Rh detection, and phenotyping, in which it demonstrated a reliable antibodies (D, E, C, c) were approximately one tube higher by performance with a high sensitivity and specificity.9,10 EMT’s GCT compared with CTT. For anti-e, the average titer values

4 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Methods for antibody titration

by both GCT and EMT were lower than those by CTT. The of more than 10. EMT had intermediate precision, with largest difference between the methods was observed with identical titers in 76 percent and identical scores in 64 percent samples for anti-K, in which the titer values by GCT were 1.5 of the cases. Judd et al.18 suggested that reproducible grading dilutions higher compared with CTT. Both CTT and EMT is well known to be problematic, even among technical staff had equal sensitivity in cases containing anti-c. Overall, the in a single laboratory, and this apparently is a major source of mean titers by GCT were 1.1 dilutions higher and those by discrepancy when reading titers. An international study was EMT were 0.35 dilutions higher than CTT. A recent study was conducted by AuBuchon et al.19 in which they reported that conducted by Finck et al.16 to determine whether GCT yields the gel card method at the AHG phase (1+ end point) showed comparable results with the CTT method in titrating Rh and K reduced variance compared with tube-based methods. This alloantibodies. For most alloantibodies titrated (anti-E, anti-e, high precision of GCT may be attributed to the clear-cut and anti-c), the GCT generated titer values were less than one grading of the results. dilution higher than the value by CTT. The GCT system was There were several limitations in this study. First, we found to be slightly less sensitive than CTT for anti-D, giving could not perform a clinical correlation of the titer values. titer results that were on average 0.09 dilutions lower. Samples Second, the reagent RBCs for antibody titration by EMT were with anti-K tended to generate higher titer values in CTT. procured commercially from the manufacturer, although Titer values alone are said to be misleading without their was identical to the in-house RBCs used evaluating the strength of agglutination as well. The observed for CTT and GCT. Third, testing by EMT was performed strength of agglutination is assigned a number, and the sum on an automated platform, whereas the other methods were of these numbers for all tubes in a titration study represents performed manually. Finally, the manufacturers of GCT and the score, which is another semiquantitative measurement EMT do not include their application for antibody titration in of antibody reactivity.1 The arbitrarily assigned threshold for the product literature, which thereby constitutes off-label use significance in comparing scores is a difference of 10 or more. of these methods. In the present study, the mean difference in scores of GCT and In conclusion, the titers obtained by GCT were very high CTT was more than 10 and, hence, significant. On the other and not dependable for clinical monitoring of patients. Titers hand, the mean difference in scores of EMT and CTT was obtained by EMT were somewhat similar to CTT, yet their 4.88, thus indicating that the strength of reaction with these reliability for clinical application remains to be determined. two methods does not differ significantly. Precision is another mandate for determining the suitability Antibody titration has long been found difficult to of a method for antibody titration. GCT has been proven best standardize and to reproduce precisely. This finding is in this regard owing to clear-cut interpretation of the results. exemplified by the AABB recommendation that antenatal The reproducibility by EMT was comparable with that of GCT evaluations of maternal antibodies should be performed on in most cases. Given its intermediate accuracy and precision, previously frozen serum samples in parallel with a current EMT may be adopted for performing antibody titration in specimen to minimize the possibility that changes in the titer settings where it is currently in use after further validation of result from differences in method and in the skill of the testing its performance in studies with larger sample numbers. technologist.1 Such duplicate testing mitigates the problem of imprecision within a laboratory. The disparity in titration Acknowledgments results is also reported in proficiency testing samples provided in the antibody titration survey of the College of American This study was conducted at the Department of Pathologists.17 Results from different laboratories were Transfusion Medicine, Sanjay Gandhi Post Graduate Institute grouped according to the method used, and the variations of Medical Sciences, Lucknow, India. extended over five or more dilutions (i.e., a 32-fold difference, for both anti-D and anti-A). References On comparing the precision of various methods in terms 1. Brecher ME, Ed. Technical manual. 15th ed. Bethesda, MD: of both titer and score in the present study, GCT was found to AABB, 2005. have the best reproducibility. This method reported identical 2. Engelfriet CP, Reesink HW, Bowman JM, et al. Laboratory titers in 92 percent of cases and identical scores in 78 percent procedures for the prediction of the severity of haemolytic disease of the newborn. Vox Sang 1995;69:61–9. of cases. CTT was found to be the least precise, with few cases having titer difference of three dilutions and a score difference

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 5 A. Dubey et al.

3. Lapierre Y, Rigal D, Adam J, et al. The gel test: a new way 14. Kumlien G, Wilpert J, Säfwenberg J, Tydén G. Comparing to detect red cell antigen–antibody reactions. Transfusion the tube and gel techniques for ABO antibody titration, 1990;30:109–13. as performed in three European centers. Transplantation 4. Judd WJ, Steiner EA, Knafl PC. The gel test: sensitivity and 2007;84(12 Suppl):S17–19. specificity for unexpected antibodies to blood group antigens. 15. Cohney SJ, Hogan C, Haeusler M, et al. Variability of anti-blood Immunohematology 1997;13:132–5. group titers according to methodology and clinical relevance 5. Delaflor-Weiss E, Chizhevsky V. Implementation of gel testing in ABO incompatible renal transplantation. Am J Transplant for antibody screening and identification in a community 2007;7:157. hospital, 3-year experience. Lab Med 2005;36:489–90. 16. Finck R, Lui-Deguzman C, Teng SM, Davis R, Yuan S. 6. Novaretti MC, Jens E, Pagliarini T, Bonifácio SL, Dorlhiac- Comparison of a gel microcolumn assay with the conventional Llacer PE, Chamone DA. Comparison of conventional tube test tube test for red blood cell alloantibody titration. Transfusion with DiaMed gel microcolumn assay for anti-D titration. Clin 2013;53:811–15. Lab Haematol 2003;25:311–15. 17. College of American Pathologists. ABT proficiency testing 7. Thakur MK, Marwaha N, Kumar P, et al. Comparison of gel test survey A. Northfield, IL: College of American Pathologists, and conventional tube test for antibody detection and titration 2006. in D-negative pregnant women: study from a tertiary-care 18. Judd WJ, Luban NLC, Ness PM, Silberstein LE, Stroup M, hospital in North India. Immunohematology 2010;26:174–7. Widmann FK. Prenatal and perinatal immunohematology: 8. Bouix O, Ferrera V, Delamaire M, Redersdorff JC, Roubinet recommendations for serologic management of the F. Erythrocyte-magnetized technology: an original and fetus, newborn infant, and obstetric patient. Transfusion innovative method for blood group serology. Transfusion 1990;30:175–83. 2008;48:1878–85. 19. AuBuchon JP, de Wildt-Eggen J, Dumont LJ; Biomedical 9. Schoenfeld H, Bulling K, von Heymann C, et al. Evaluation Excellence for Safer Transfusion Collaborative; Transfusion of immunohematologic routine methods using the new Medicine Resource Committee of the College of American erythrocyte-magnetized technology on the QWALYS 2 system. Pathologists. Reducing the variation in performance of Transfusion 2009;49:1347–52. antibody titrations. Vox Sang 2008;95:57–65. 10. Schoenfeld H, Pretzel KJ, von Heymann C, et al. Validation of a hospital-laboratory workstation for immunohematologic Anju Dubey, MD (corresponding author), Assistant Professor, methods. Transfusion 2010;50:26–31. Department of Transfusion Medicine, All India Institute of Medical 11. Bromilow IM, Adams KE, Hope J, Eggington JA, Duguid Sciences, Rishikesh, India, 249201; Atul Sonker, MD, Associate JK. Evaluation of the ID-gel test for antibody screening and Professor, and Rajendra K. Chaudhary, MD, Head of the Department, identification. Transfus Med 1991;1:159–61. Department of Transfusion Medicine, Sanjay Gandhi Post Graduate 12. Steiner E, Judd WJ, Combs M, et al. Prenatal antibody titers by Institute of Medical Sciences, Lucknow, India, 226014. the gel test. Transfusion 2001;41(3S):31. 13. Shirey RS, Cai W, Montgomery RA, Chhibber V, Ness PM, King KE. Streamlining ABO antibody titrations for monitoring ABO- incompatible kidney transplants. Transfusion 2010;50:631–4.

Attention: SBB and BB Students

You are eligible for a free 1-year subscription to Immunohematology.

Ask your education supervisor to submit the name and Important Notice About Manuscripts for Immunohematology complete address for each student and the inclusive dates Please e-mail all manuscripts to [email protected] of the training period to [email protected]

For information concerning Immunohematology or the Notice to Readers Immunohematology Methods and Procedures manual, Immunohematology is printed on acid-free paper. contact us by e-mail at [email protected]

6 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 O r i g i n a l R e p o r t High-resolution melting analysis as an alternative method for human neutrophil antigen genotyping

K. Yasui, M. Tanaka, T. Hayashi, N. Matsuyama, A. Kuroishi, R.A. Furuta, Y. Tani, and F. Hirayama

Human neutrophil antigen (HNA)-typed granulocyte panels are and Japanese (88%) populations.19,20 Polymorphism of this widely used to screen for the presence of HNA antibodies and to antigen has not been reported. Antibodies against this antigen determine antibody specificity. Many laboratories screen donors are associated with ANN, autoimmune neutropenia, febrile for HNA using low-throughput methods such as 12,21–23 allele-specific polymerase chain reaction (PCR), PCR–restriction transfusion reactions, and TRALI. HNA-3, comprising fragment–length polymorphism, and multiplex PCR. In the HNA-3a and HNA-3b, is expressed on granulocytes, present study, we used a high-resolution melting (HRM) analysis lymphocytes, , endothelial cells, kidney, spleen, and to determine HNA genotypes. For the HRM analysis, purified 24 genomic DNA samples were amplified via PCR with HNA-specific placental cells. Alloantibodies to HNA-3a are associated with primers. substitutions in encoding HNAs were occasional cases of febrile transfusion reactions,25 ANN,26 and differentiated on the basis of the HRM curves, and the results of HRM serious cases of TRALI.14,27,28 The HNA-4 and HNA-5 antigens and DNA sequencing analyses were determined to be in complete reside on the subunits of the β-2 integrin family (CD11a and agreement. The frequency of HNA-1a, -1b, -1c, -3a, -3b, -4a, -4b, -5a, and -5b in the Japanese population was consistent CD11b, respectively). HNA-4 is expressed on granulocytes, with the previous reports. Our results suggest that HRM analysis monocytes, and NK cells, whereas HNA-5 is expressed on can be used for genotyping HNA antigens determined by single all leukocytes.17 Moreover, alloantibodies against HNA-4a nucleotide substitutions. Immunohematology 2015;31:7–13. can cause ANN, but those specific for HNA-5a have not been clinically associated with neutropenia.29 Key Words: neutrophil, HNA, antibody, genotyping, high- The detection of antibodies against HNAs primarily relies resolution melting analysis on cell-based assays, the granulocyte immunofluorescence test (GIFT), and granulocyte agglutination test (GAT). The Evidence indicates that leukocyte antibodies are one of the International Society of Working Party on primary causes of nonhemolytic transfusion reactions, par- Granulocyte Immunobiology recommends GIFT and GAT as ticularly in transfusion-related acute lung injury (TRALI).1–4 reference methods for detecting HNA antibodies.30 Although Human leukocyte antigen (HLA) class I,1,2,5 HLA class II,6–9 cells could be stored for a week following fixation for use and human neutrophil antigen (HNA)10–15 antibodies have with GIFT, they were difficult to use in high-sensitivity flow been associated with nonhemolytic transfusion reactions. cytometry analysis because normal human sera revealed high Therefore, it is important to detect such antibodies in blood background reactivity to neutrophils. components used for transfusion. Genotyping via high-resolution melting (HRM) analysis HNAs have been classified into five systems (HNA-1, can be used to rapidly predict the HNA antigen status of cells HNA-2, HNA-3, HNA-4, and HNA-5), and differences that could be used as panel cells in GIFT and GAT. In the between these HNA polymorphisms can result in several field of genotyping, HRM analysis sensitively and specifically alloimmunization responses. HNA-1 comprises the following detects a single nucleotide change in a gene.31 Further, HRM antigens: HNA-1a, HNA-1b, HNA-1c, and HNA-1d; these analysis is a simpler and more rapid genotyping method are specifically expressed on neutrophils. Antibodies against compared with allele-specific polymerase chain reaction HNA-1 are frequently thought to be the cause of alloimmune (PCR), PCR–restriction fragment–length polymorphism, and neutropenia (ANN), autoimmune neutropenia, and TRALI.16–18 multiplex PCR.32 In the present study, we used HRM analysis HNA-2 is represented by a single antigen and is expressed on to for HNAs. neutrophils in Caucasian (97%), African American (95%),

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 7 K. Yasui et al.

Materials and Methods et al. performed epitope mapping experiments using human embryonic kidney cells that express different recombinant Blood Samples and DNA Preparation variants of FcγRIIIb. We designed several primer sets to anticoagulated with ethylenediamine- amplify the polymorphic sites of HNA-1, HNA-3, HNA-4, and tetraacetic acid was collected from healthy blood donors HNA-5. The primer sequences are shown in Table 2. These and used as leukocyte samples for genotyping HNAs. DNA primers were synthesized using standard phosphoramidite was prepared using the QIAsymphony instrument and chemistry (Life Technologies, Carlsbad, CA). QIAsymphony DNA Mini kit (Qiagen, Hilden, Germany). This research project was approved by the ethics committee of the PCR Amplification ofFCGR3B Fragment Prior to Japanese Red Cross Society Blood Service Headquarters. HNA-1 Genotyping Because nucleotide sequences of FCGR3A and FCGR3B Primer Selection are very similar, we developed a PCR pre-amplification system We performed HNA-1, HNA-3, HNA-4, and HNA-5 for HNA-1 to avoid the amplification of the FCGR3A fragment genotyping using a PCR-HRM method.31 HNA-1a, HNA-1b, prior to HNA-1 genotyping. Each PCR contained 1 µL and HNA-1c were encoded by FCGR3B*1, FCGR3B*2, and genomic DNA, 1 µL forward primer (5 µmol/L), 1 µL reverse FCGR3B*3 (GenBank accession number: NC_000001.10), primer (5 µmol/L), 8.5 µL RNase-free water (Qiagen), and respectively. Because FCGR3B highly resembles FCGR3A,18 12.5 µL PrimeSTAR Max DNA polymerase premix (Takara, which encodes FcγR3a, we first amplifiedFCGR3B -specific Seta, Japan) in a final volume of 25 µL. PCR amplification was DNA to avoid the contamination of FCGR3A DNA before performed with initial denaturation at 95°C for 5 minutes, performing PCR-HRM analysis for HNA-1 genotyping; we followed by 35 cycles of 10 seconds at 95°C, at 55°C for 5 developed a pair of primers [5-GGCACATATGGGGACAAT-3, seconds, and at 72°C for 10 seconds. Amplicons were purified called “FCGR3B forward” (nucleotide position in FCGR3B, using Diffinity RapidTip2 (Sigma, Deisenhofen, Germany). 6616–6633), and 3-GAGCTCACTGCAACTTCTG-5, called “FCGR3B reverse” (nucleotide position in FCGR3B, 7604– PCR Amplification for Genotyping of HNA-1 to -5 7622)] that were designed to amplify the FCGR3B fragment, This assay used the Type-it HRM Kit (Qiagen). Each PCR including the five polymorphic sites described subsequently contained 1 µL DNA, 1 µL forward primer (5 µmol/L), 1 µL but not the FCGR3A fragment. FCGR3B*1 differs from reverse primer (5 µmol/L), 8.5 µL RNase-free water (Qiagen), FCGR3B*2 at five nucleotide positions, and a single and 12.5 μL of a 2× HRM PCR master mix (Qiagen). The nucleotide polymorphism (SNP) differentiates FCGR3B*2 purified amplicons described earlier were used as templates from FCGR3B*3 (Table 1). HNA-1a differs from HNA-1b for the genotyping of HNA-1, and genomic DNA was used for at five nucleotide positions (141, 147, 227, 277, and 349), the genotyping of the other HNAs. The final reaction volume which results in four residue changes at positions was 25 µL. A Roter-Gene Q (Qiagen) instrument was used. 36, 65, 82, and 106 in the membrane-distal domain of the PCR amplification was performed with initial denaturation . Furthermore, HNA-1b differs from HNA-1c at at 95°C for 5 minutes, followed by 40 cycles at 95°C for 10 nucleotide position 266 alone, resulting in the substitution seconds, at 52°C for 30 seconds, and at 72°C for 10 seconds, of Ala to Asp at position 78 (Table 1). Recently, HNA-1d was with data acquisition during the 72°C step. proposed as an additional allele of the HNA-1 system.18 Reil

Table 1. of FcγIIIb with location of single nucleotide polymorphisms and resulting amino acid changes Nucleotide position Antigen Allele 141* 147* 227* 266* 277* 349* HNA-1a FCRG3B*01 AGG (p.Arg36) CTC (p.Leu38) AAC (p.Asn65) GCT (p.Ala78) GAC (p.Asp82) GTC (p.Val106) HNA-1b FCRG3B*02 AGC (p.Ser36) CTT (p.Leu38) AGC (p.Ser65) GCT (p.Ala78) AAC (p.Asn82) ATC (p.Ile106) HNA-1c FCRG3B*03 AGC (p.Ser36) CTT (p.Leu38) AGC (p.Ser65) GAT (p.Asp78) AAC (p.Asn82) ATC (p.Ile106) HNA-1d FCRG3B*02 AGC(p.Ser36) CTC (p.Leu38) AGC (p.Ser65) GCT (p.Ala78) AAC (p.Asn82) ATC (p.Ile106) *The underlined letters correspond to the position of the single nucleotide polymorphisms. Note that for HNA-1d, amino acid positions and nucleotide positions were estimated according to the reactivity of the antisera against HNA-1d as reported by Reil et al.18

8 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 HNA genotyping using real-time PCR and HRM

Table 2. DNA sequences of primers used in polymerase chain Creation of Positive Control Plasmid for Genotyping reaction and high-resolution melting analyses Synthetic DNA fragments (Fig. 1A–D) were cloned into Gene name Primer name Primer sequence (5´ to 3´) the pCR2.1 TOPO plasmid (Life Technologies, Carlsbad, CA) FCGR3B forward GGCACATATGGGGACAAT and served as positive controls. FCGR3B reverse GAGCTCACTGCAACTTCTG FCGR3B HNA-1 forward1 CTCATCTCAAGCCAGG (NC_000001.10)* HNA-1 reverse1 ATGGACTTCTAGCTGCACC HRM Analysis For HRM analysis, amplified samples bound to the fluo- SLC44A2 HNA-3 forward1 GGGCAGTGGCAGTGTACTAG (NC_000019)* HNA-3 reverse1 CTGAGCCTCTGCAGAGCCT rescent dye were heated from 65°C to 95°C. The temperature ITGAM HNA-4 forward1 GAGATAGTGGCTGCCAACC was increased by 0.1°C/second at each step using the Roter- (NG _011719.1)* HNA-4 reverse1 GATCCCCAGGACACAGGAGTG Gene Q and covered the full range of expected melting points. ITGAL HNA-5 forward1 GGCCCACCAGATCCCTCAG HRM data were analyzed using the Roter-Gene Q software. (NC_000016.9)* HNA-5 reverse1 AAGTGCAGGTCCAGCTGGA Fluorescence intensity values were normalized between 0 *GenBank accession numbers. percent and 100 percent by defining linear baselines before and after the melting transition of each sample. The fluorescence of each acquisition was obtained from HRM curves and was

A B

C D

Fig. 1. Outlines of high-resolution melting analysis for HNA-1 to HNA-5 genotyping. The structures of responsible of each human neutrophil antigen (HNA), the sequences of synthetic DNA fragments used in high-resolution melting (HRM) analysis as positive controls, and the location of each single nucleotide polymorphism (SNP) of HNA alleles are presented. Arrows indicate the primers were used. The regions with the SNP are highlighted in each DNA sequence. The nucleotide position for each SNP is shown above the highlight. The regions with the SNPs in different alleles are shown below each synthetic DNA fragment. Polymerase chain reaction (PCR) amplification regions of HNA-1 (A), HNA-3 (B), HNA-4 (C), and HNA-5 (D) are shown.

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 9 K. Yasui et al.

calculated as the percentage of fluorescence between the top HNA-1 (nucleotide 266, 277) 105 and bottom baselines of each acquisition temperature, with a 100 a/a 95 a/b confidence threshold of 80 percent of the controls. a/c 90 b/b 85 b/c Statistical Analysis 80 c/c

e 75

Genotype and allele frequencies were calculated by 70 65 the counting method. The validity of the Hardy-Weinberg 60 Fluorescenc 55 equilibrium was tested by calculating the expected number 50 of subjects for each genotype. Agreement of the observed 45 Normalized 40 and expected genotypes, based on the Hardy-Weinberg 35 30 2 equilibrium, was determined using the χ test. The level of 25 statistical significance was set atp < 0.05. 20 15 10

80.5 81 81.5 82 82.5 83 83.5 84 84.5 85 85.5 86 86.5 87 87.5 Results Temperature (°C)

Fig. 2. High-resolution melting analysis for HNA-1d allele. The HRM Analysis for Genotyping of HNAs synthetic DNA samples representing each HNA-1 were amplified In the field of DNA-based genotyping, HRM analysis was using the primer set, which distinguished the changes at developed as a novel method for detecting a single nucleotide 266 and 277, and were analyzed using high-resolution melting (HRM). Six representative HRM curves (a/a, a/b, a/c, b/b, b/c, and change in a gene.31 Before performing HRM analysis, the target c/c) are shown. sequence is amplified in the presence of a double-stranded DNA-binding fluorescent dye, and the melting temperature (Tm) is increased from a lower to a higher temperature for the amplicons revealed only FCGR3B-specific bands on agarose HRM analysis. Differences in the gene sequences between the gel electrophoresis, and (2) subsequent DNA sequence analysis heterozygous and homozygous genotypes lead to differences revealed that the amplicons were derived from FCGR3B. After in Tm. Heterozygous genotypes tend to have lower Tm than excluding the possibility of contamination of FCGR3A DNA, homozygous genotypes, and, consequently, the overall HRM we genotyped these 15 genomic DNA samples using the PCR- curves will shift to the left. The differences in the HRM curves HRM method. Following analysis of all samples, samples 6, 7, were determined using the Roter-Gene Q software. and 2 were determined as HNA-1a/1a, HNA-1b/1b, and HNA- To confirm validity of HRM analysis for genotyping 1a/1b, respectively (data not shown). The results of HRM HNA‑1, we amplified the control plasmids of each HNA‑1 analysis were in complete agreement with the sequencing data. allele (a/a, b/b, c/c, a/b, a/c, and b/c) and analyzed them Using the two different sets of HRM analysis, we successfully using the Roter-Gene Q software. Because four nucleotide determined the genotypes of the three HNA-1 alleles. substitutions are involved in HNA-1 polymorphism, we set Then, we analyzed HNA-3 (a/a, b/b, and a/b), HNA-4 up a PCR system to categorize the “1a,” “1b,” and “1c” alleles (a/a, b/b, and a/b), and HNA-5 (a/a, b/b, and a/b). The HRM based on the SNPs at positions 266 and 277. Figure 2A curves of HNA-3 (Fig. 3A), HNA-4 (Fig. 3B), and HNA-5 presents the representative HRM curves of synthesized DNA (Fig. 3C) clearly identified the individual genotypes using the samples containing 1a, 1b, or 1c sequences. The melting curve synthetic DNA samples, and the results for 15 blood donors shift for each of the synthetic DNA samples was estimated completely coincided with the DNA sequence analyses (data using Roter-Gene Q software, and these curves successfully not shown). Therefore, HRM analysis successfully detected all defined each HNA-1 genotype. Subsequently, we used these the HNA polymorphisms. curves as standard allotype-specific curves. With regard to HNA-1 genotyping, we first pre-amplified HNA-1–specific Frequencies of HNA Genotypes Among Japanese PCR amplicons and used these amplicons as templates for Blood Donors HNA-1 genotyping to avoid amplification of FCGR3A, whose Having demonstrated that HRM analysis can be used DNA sequence highly resembles that of HNA-1. The absence to determine HNA genotypes, we subsequently genotyped of contamination of FCGR3A in the amplicons was confirmed 500 Japanese individuals for HNA-1, HNA-3, HNA-4, and using 15 representative genomic DNA samples derived from HNA‑5 using HRM analysis and calculated the genotype blood donors based on the following two points: (1) the frequency (Table 3) and the allele frequency (Table 4) of the

10 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 HNA genotyping using real-time PCR and HRM

A B C HNA-1d) among the Japanese population.18,33,34 The results

HNA-3 HNA-4 HNA-5 reported here, using a different method, are consistent with 100 100 100 these findings (Tables 3 and 4). The frequency of HNA-1d 95 a/a 95 a/a 95 a/a 90 90 90

e a/b a/b a/b 85 85 85 has not been reported previously. The HNA-1 system has 80 b/b 80 b/b 80 b/b 75 75 75 three FCGR3B alleles. FCGR3B*01 encodes only one antigen 70 70 70 65 65 65 60 60 60 (HNA-1a), while FCGR3B*02 and FCGR3B*03 encode two

Fluorescenc 55 55 55 50 50 50 antigens each (HNA-1b and HNA-1d, and HNA-1b and HNA- 45 45 45 40 40 40 1c, respectively). Because the occurrence of HNA-1c was not 35 35 35 30 30 30 observed in this study, the frequency of HNA-1d was similar Normalized 25 25 25 20 20 20 to that of HNA-1b. 15 15 15 10 10 10 Occasionally, the contamination of PCR products interferes 83 83.584 84.5 85 85.586 86.5 87 87.5 88 88.5 89 86.5 87 87.5 88 88.5 89 89.5 90 90.5 91 91.5 81.5 82 82.5 83 83.5 84 84.5 85 85.5 86 Temperature (°C) Temperature (°C) Temperature (°C) with genotype testing. HRM analysis determines genotypes of individual test samples using a real-time PCR instrument with Fig. 3. High-resolution melting analysis of HNA-3, HNA-4, and HNA‑5. Synthetic DNA samples were amplified and analyzed a sample cap piercing feature, which eliminates a potential using high-resolution melting (HRM). HRM curves for each human source of contamination. neutrophil antigen (HNA) and its corresponding genotypes are presented in the following panels: (A) heterozygous HNA‑3a/3b, The frequency of HNA-1 among the Japanese population homozygous HNA-3b/3b, and homozygous HNA-3a/3a; (B) hetero- considerably differs from that of Caucasians, who express zygous HNA-4a/4b, homozygous HNA-4b/4b, and homozygous HNA-1b more frequently than HNA-1a.34 Additionally, the HNA-4a/4a; and (C) heterozygous HNA-5a/5b, homozygous HNA- 5b/5b, and homozygous HNA-5a/5a. Table 3. HNA genotypes among Japanese blood donors

Observed Observed Expected HNA system in Japan. The deviation of the observed numbers Genotypes number prevalence (%) number Remarks of genotypes from the expected numbers on the basis of the HNA-1 a/a 175 35.0 194.3 χ2 = 3.89 Hardy-Weinberg equilibrium was not statistically significant a/b 256 51.2 234.8 p < 0.05 a/c 0 0 0 (Table 3). The occurrence of HNA-1 to -5 was similar to that b/b 69 13.8 71.0 reported elsewhere.33–35 b/c 0 0 0 c/c 0 0 0

2 Discussion HNA-3 a/a 210 42.0 213.8 χ = 0.591 a/b 234 46.8 226 p < 0.05 b/b 56 11.2 59.8 — HRM is a very attractive, advanced, fast, and cost-effective HNA-4 a/a 500 100.0 — — SNP genotyping technology based on the analysis of the a/b 0 0 — b/b 0 0 — melting profile of PCR products, using intercalating fluorescent HNA-5 a/a 378 75.6 384.6 χ2 = 5.52 dyes to monitor the transition from double-stranded to single- a/b 120 24.0 107.8 p < 0.05 stranded (melted) DNA. This method was used to confirm b/b 2 0.4 7.5 HLA genotypic identity between unrelated individuals HNA = human neutrophil antigen. before allogeneic hematopoietic stem-cell transplantation.32,36 Subsequently, several blood group antigens, including some Table 4. HNA alleles among Japanese blood donors in the Duffy, Kidd, and Diego blood group systems, were also HNA Number Allele prevalence (%) 37 genotyped using HRM analysis. Further, SNPs in the genes HNA-1a 500 60.6 encoding human antigens 1–6 and 15 were analyzed HNA-1b 39.4 38 using HRM analysis. Thus, HRM analysis is a useful method HNA-1c 0 for genotyping SNPs. In the present study, we applied HRM HNA-3a 500 65.4 analysis to HNA genotyping and clearly genotyped and HNA-3b 34.6 distinguished homozygous from heterozygous HNA alleles HNA-4a 500 100 (Fig. 3). HNA-4b 0 Knowledge of HNA frequency is important for predicting HNA-5a 500 87.6 the risk of alloimmunization to HNA. Previous studies HNA-5b 12.4 had reported the frequency of HNA-1 to HNA-5 (except HNA = human neutrophil antigen.

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 11 K. Yasui et al.

frequency of HNA-3b seems to be higher in the Japanese pop- 12. Bux J, Becker F, Seeger W, Kilpatrick D, Chapman J, Waters A. ulation than in Caucasians.34,39,40 This observation suggests a Transfusion-related acute lung injury due to HLA-A2-specific antibodies in recipient and NB1-specific antibodies in donor higher risk of alloimmunization for individuals homozygous blood. Br J Haematol 1996;93:707–13. for HNA-3b by exposure to the HNA-3a antigen during 13. Nordhagen R, Conradi M, Dromtrop SM. Pulmonary reaction transfusion or pregnancy. Detection of antibodies against associated with transfusion of plasma containing anti-5b. Vox HNA-3a was infrequent in Japanese patients with TRALI, Sa ng 1986;51:102–7. 14. Davoren A, Curtis BR, Shulman IA, et al. TRALI due to however. Therefore, additional factors specific for the Japanese granulocyte-agglutinating human neutrophil antigen-3a (5b) population may elicit antibodies against HNA-3a. antibodies in donor plasma: a report of 2 fatalities. Transfusion 2003;43:641–5. Acknowledgments 15. Clay ME, Schuller RM, Bachowski GJ. Granulocyte serology: current concepts and clinical significance. Immunohematology 2010;26:11–20. We thank the laboratory staff of the Japanese Red Cross 16. Bux J, Behrens G, Jaeger G, Welte K. Diagnosis and clinical Kinki Block Blood Center for preparing blood samples and course of autoimmune neutropenia in infancy: analysis of 240 cases. Blood 1998;98:181–6. extracting genomic DNA. 17. Bux J. Human neutrophil alloantigens. Vox Sang 2008;94: 277–85. References 18. Reil A, Sachs UJ, Siahanidou T, Flesch BK, Bux J. HNA- 1d: a new human neutrophil antigen located on Fc-gamma 1. Popovsky MA, Moore SB. Diagnostic and pathogenetic IIIb associated with neonatal immune neutropenia. considerations in transfusion-related acute lung injury. Transfusion 2013;53:2145–51. Transfusion 1985;25:573–7. 19. Stroncek DF, Skubitz K, McCullough JJ. Biochemical nature of 2. Popovsky MA, Haley NR. Further characterization of the neutrophil-specific antigen NB1. Blood 1990;75:744–55. transfusion-related acute lung injury: demographics, clinical and laboratory features, and morbidity. Immunohematology 20. Kissel K, Scheffler S, Kerowgan M, Bux J. Molecular basis of 2000;16:157–9. NB1 (HNA-2a, CD177) deficiency. Blood 2002;99:4231–3. 3. Kopko PM, Paglieroni TG, Popovsky MA, Muto KN, MacKenzie 21. Stroncek D. Granulocyte antigens and antibody detection. Vox MR, Holland PV. TRALI: correlation of antigen-antibody and Sang 2004;87:91–4. monocyte activation in donor-recipient pairs. Transfusion 22. Bux J, Jung KD, Kauth T, Mueller-Eckhardt C. Serological 2003;43:177–84. and clinical aspects of granulocyte antibodies leading to 4. Hirayama F. Recent advance in laboratory assays for alloimmune neonatal neutropenia. Transfus Med 1992;2: nonhemolytic transfusion reactions. Transfusion 2010;50: 143–9. 252–63. 23. Bux J. Granulocyte antibody mediated neutropenias and 5. Popovsky MA, Abel MD, Moore SB. Transfusion-related acute transfusion reactions. Infus Ther Transfus Med 1999;26: lung injury associated with passive transfer of antileukocyte 152–7. antibody. Am Rev Respir Dis 1983;128:185–9. 24. Van Leeuwen A, Eerrise JG, van Room JJ. A new leukocyte 6. Nishimura M, Mitsunaga S, Ishikawa Y, Satake M. Possible group with two alleles: leukocyte group five. Vox Sang mechanisms underlying development of transfusion-related 1964;9:431–7. acute lung injury: roles of anti-major histocompatibility 25. Lalezari P, Bernard GE. Identification of a specific leukocyte complex class II DR antibody. Transfus Med 2003;13:141–7. antigen: another presumed example of 5b. Transfusion 7. Kopko PM, Popovsky M, MacKenzie MR, Paglieroni TG, Muto 1965;5:132–42. KN, Holland PV. HLA class II antibodies in transfusion-related 26. de Haas M, Muniz-Diaz E, Alonso LG, et al. Neutrophil 5b is acute lung injury. Transfusion 2001;41:1244–8. carried by a , migrating from 70 to 95 kDa, and may 8. Win N, Brown C, Navarrete C. TRALI associated with HLA be involved in neonatal alloimmune neutropenia. Transfusion class II antibodies. Transfusion 2003;43:545–6. 2000;40:222–7. 9. Flesch BK, Neppert J. Transfusion-related acute lung-injury 27. Nordhagen R, Conradi M, Drotorp SM. Pulmonary reaction caused by human leukocyte antigen class II antibody. Br J associated with transfusion of plasma containing anti-5b. Vox Haematol 2002;116:673–7. Sa ng 1986;51:102–7. 10. Leach M, Vora AJ, Jones DA, Lucas G. Transfusion-related 28. Kopko PM, Marshall CS, MacKenzie MR, Holland PV, acute lung injury (TRALI) following autologous stem cell Popovsky MA. Transfusion-related acute lung injury: report a transplant for relapsed acute myeloid leukemia: a case report clinical look-back investigation. JAMA 2002;287:168–71. and review of the literature. Transfus Med 1998;8:333–7. 29. Fung YL, Pitcher LA, Willett JE, et al. Alloimmune 11. Yomotovian R, Kline W, Press C, et al. Severe pulmonary neonatal neutropenia linked to anti-HNA-4a. Transfus Med hypersensitivity associated with passive transfusion of 2003;13:49–52. neutrophil specific antibodies. Lancet 1984;1:244–6.

12 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 HNA genotyping using real-time PCR and HRM

30. Lucas G, Rogers S, de Haas M, Porcelijn L, Bux J. Report 37. Tanaka M, Takahashi J, Hirayama F, Tani Y. High-resolution on the Fourth International Granulocyte melting analysis for genotyping Dyffy, Kidd and Diego blood Workshop: progress toward quality assessment. Transfusion group antigens. Leg Med 2011;13:1–6. 2002;42:462–8. 38. Hayashi T, Ishii H, Tanak M, et al. High-resolution melting 31. Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, Pryor method for genotyping human platelet antigens on ITGB3 RJ. High-resolution genotyping by amplicon melting analysis 11. Transfusion 2012;52:1837–8. using LCGreen. Clin Chem 2003;49:853–60. 39. Reil A, Wesche J, Greinacher A, Bux J. Geno- and phenotyping 32. Liew M, Nelson L, Margraf R, et al. Genotyping of human and immunogenicity of HNA-3. Transfusion 2002;42:651–7. platelet antigens 1 to 6 and 15 by high-resolution amplicon 40. Bowens KL, Sullivan MJ, Curtis BR. Determination of melting and conventional hybridization probes. J Mol Diagn neutrophil antigen HNA-3a and HNA-3b genotype frequencies 2006;8:97–104. in six racial groups by high-throughput 5´ exonuclease assay. 33. Matsuhashi M, Tsuno NH, Kawabata M, et al. The population Transfusion 2012;52:2368–74. of human neutrophil alloantigens among the Japanese population. Tissue Antigens 2012;80:336–40. Kazuta Yasui, PhD (corresponding author), Deputy Director of 34. Fujiwara K, Watanabe Y, Mitsunaga S, et al. Determination of granulocyte-specific antigens on neutrophil FcA receptor Preparation Development; Mitsunobu Tanaka, PhD, Deputy IIIb by PCR-preferential homoduplex formation assay, and Director of Laboratory Development; Tomoya Hayashi, PhD; gene frequencies in the Japanese populations. Vox Sang Nobuki Matsuyama, MT, Deputy Director of 3rd Laboratory; 1999;77:218–22. Ayumu Kuroishi, PhD; Rika. A. Furuta, PhD, Director of Preparation 35. Ohto H, Matsuo Y. Neutrophil-specific antigens and gene Development; Yoshihiko Tani, MD, PhD, Deputy Director General; frequencies in Japanese. Transfusion 1989;29:654. and Fumiya Hirayama, MD, PhD, Senior Director of Quality Control, 36. Zhou L, Vandersteen J, Wang L, et al. High-resolution DNA Japanese Red Cross Kinki Block Blood Center, 7-5-17, Asagi Saito, melting curve analysis to establish HLA genotypic identity. Ibaraki, Osaka 567-0085 Japan. Tissue Antigens 2004;64:156–64.

Manuscripts The editorial staff of Immunohematology welcomes manuscripts and review articles, see Instructions for Authors in every issue of pertaining to blood group serology and education for consideration Immunohematology or e-mail a request to [email protected]. for publication. We are especially interested in case reports, papers Include fax and phone numbers and e-mail address with on platelet and white cell serology, scientific articles covering all manuscripts and correspondence. E-mail all manuscripts original investigations, and papers on new methods for use in the to [email protected] . For instructions for scientific articles, case reports,

Free Classified Ads and Announcements Immunohematology will publish classified ads and announcements (SBB schools, meetings, symposia, etc.)without charge.

E-mail information to [email protected] or fax to (215) 451-2538

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 13 R e v i e w Kell and Kx blood group systems

G.A. Denomme

The Kell and Kx blood group systems are expressed as covalently linked molecules on red blood cells (RBCs). The Kell blood group system is very polymorphic, with 35 antigens assigned to the system. The expression of Kell glycoprotein on RBCs is not critical to the erythrocyte function. However, the expression of Kx is critical to normal morphology, and null mutations are associated with the McLeod syndrome. The immunogenicity of the K antigen is second only to the D antigen, and alloantibodies to Kell antigens can cause transfusion reactions and hemolytic disease of the fetus and newborn. Kell alloantibodies in pregnancy are known to suppress erythropoiesis, which can result in serious disease despite low amniotic bilirubin levels and low antibody titers. Late-onset anemia with reticulocytopenia is thought to be attributable to the continual suppression of erythropoiesis from residual alloantibody in the infant. Alloimmunization to XK protein is rare, and expressed polymorphisms have not been reported. Together these two blood group systems share an integral relationship in transfusion medicine, neurology, and musculoskeletal biology. Immunohematology 2015;31:14–19.

Key Words: blood group systems, Kell, Kx

Kell glycoprotein is a single-pass type II transmembrane moiety expressed on red blood cells (RBCs).1 Kell is highly polymorphic, expressing 7 sets of 15 antithetical antigens (one set is triallelic), 2 low prevalent antigens, and 18 high prevalent antigens.2 The first alloantibody was discovered in 1946 as the result of hemolytic disease of the fetus and newborn (HDFN). The name of the antigen, “Kell”, was taken from the last name of the woman whose serum contained the antibody.3 The maternal antibody reacted with paternal and infant RBCs and reacted retrospectively with RBCs from their firstborn child. Fig. 1. Schematic diagram of the Kell–XK protein complex. Kell An incidence of 9 percent among random blood donors was glycoprotein is a single-pass transmembrane spanning (single cylinder) type II moiety, with its N-terminal on the cytoplasmic side indicative of a new blood group antigen. A few years later, (designated as In). XK protein is a multipass transmembrane spanning the antithetical antigen was identified.4 Together, they were (horizontal stacked cylinders) moiety. The two polypeptides are linked by a single disulfide bond (Kell amino acid 72 to XK amino acid 347). known as Kell/Cellano antigens, which are now named K/k Note the numerous cysteine residues on the Kell glycoprotein and or KEL1/KEL2. To this day, reference to the K antigen often is thus the susceptibility of antigens to 2-aminoethyl-isothiouronium confused by the inappropriate use of the term “Kell” because it bromide and dithiothreitol AET (2-aminoethylisothiouronium bromide) treatment. HELLH represents the histidine-glutamate- is also the name of the blood group system. -leucine-histidine metalloendopeptidase activity motif. The Kell and Kx blood group systems are discussed together Reprinted from Seminars in , vol. 37, p. 117, copyright 2000,5 used with permission. because their antigens are expressed on the surface of RBCs as covalent-linked moieties (Fig. 1). An eloquent historical perspective of the landmark discoveries and relationships two blood group systems relied on RBC serological, biochemical, between Kell glycoprotein and XK protein was reviewed in immunohistochemistry, and molecular observations. The fact Redman and Lee.6 Suffice it to say that the discovery of these that Kell glycoprotein is particularly immunogenic in humans

14 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Kell and Kx review

provided multiple sources of the alloantibodies and antigen- attributable to a conserved HxxLH motif (histidine-glutamate- negative RBCs. leucine-leucine-histidine in Kell glycoprotein) at amino acid It is important to note that although Kell and XK are positions 581–585. The three-dimensional structure of covalently linked molecules on RBCs, they are not necessarily Kell glycoprotein has been modeled on the crystal structure expressed together in other tissues. Kell is expressed in of neutral endopeptidase 24.11. Lee and coworkers noted testis, brain, and muscle. XK is found in muscle, heart, and that most of the Kell antigens are the result of amino acid brain. Expressed sequence tagged analyses show that KEL is changes in the non-conserved exofacial globular domain.14 expressed in cDNA libraries from bone marrow, macrophages, The expression of Kell glycoprotein is weaker than normally spleen, and brain. XK was detected in cDNA from the same observed when it contains a glutamate at position 281 (i.e., libraries and was detected in peripheral nervous tissue, and Kpa antigen). In other words, a reduced amount of K antigen eye. Interestingly, KEL, but not XK, is detected in 8- and can be shown when RBCs are Kp(a+)15,16 although K antigen 9-week-old embryo libraries.7–9 expression is unaffected. The reason for this observation is that Kell glycoprotein shares with M13 K antigen contains an arginine at position 281, i.e., Kp(b+). It family neutral zinc-dependent endopeptidases, and has was noted that K and Kpa would not be observed in cis moiety been demonstrated to have endothelin-converting enzyme-1 because both are low prevalence antigens. The probability activity. RBCs expressing Kell glycoprotein can cleave big is exceedingly rare for a non-sister chromatic exchange or endothelin 3 into its bioactive . The expression of sequential mutation at both nucleotide positions to create this Kell glycoprotein on RBCs does not appear to be critical to haplotype. But the Kpa-associated reduced expression was red cell membrane structure or function, however.10 The Kell confirmed with the characterization of aK E L*1, 3 allele.17 Kell glycoprotein forms part of a surface membrane complex with glycoprotein has been reported to be weakly expressed in the C and D because it has been demonstrated that presence of autoantibodies showing Kell specificity. However, Kell antigens are weakly expressed with the Ge:-3 phenotype it is important to evaluate the phenomenon carefully because or when /D are absent (Leach phenotype).11 of the immunoglobulin M (IgM) autoantibody masking of Kell The Kx blood group system is a multi-pass transmembrane antigens, as shown by Zimring and colleagues. Their eloquent moiety and contains one antigen, the XK protein. It is predicted study also showed that antibodies to Kpb sterically hinder the to traverse the plasma membrane 10 times and, because of binding of anti-K to its cognate epitope.18,19 this structure, is thought to be a membrane transporter.12 The XK protein comprises 444 amino acids and has no This protein is biologically important because the absence known polymorphisms leading another blood group antigen. of XK protein results in RBC morphological changes called The moiety is not glycosylated.12 RBCs are deemed to have the acanthocytosis and leads to the midlife onset of neuromuscular McLeod phenotype when they lack Kx antigens and weakly abnormalities known as the McLeod neuroacanthocytosis express Kell antigens and when mild is observed syndrome.13 in the patient with or without acanthocytosis. The McLeod phenotype may be part of the McLeod neuroacanthocytosis Kell and XK syndrome in which neurological and musculoskeletal abnormalities are also present.13,20 Kell glycoprotein has 732 amino acids and contains five N- sites, with the threonine to methionine Kell and XK Genes substitution at position 193 resulting in a loss of one N-glycosylation site. Therefore, Kell glycoprotein expressing The gene responsible for the expression of Kell a methionine at position 193 (K antigen) migrates faster in glycoprotein was cloned in 1991. Lee and coworkers used a sodium dodecyl sulfate polyacrylamide gel electrophoresis short oligonucleotide probe deduced from a tryptic peptide of than the version with threonine at that position. Kell the proposed glycoprotein to screen a λgt cDNA library. Later glycoprotein has 15 cysteine residues on the exofacial domain. in 1995, Lee reported that KEL was organized into 19 exons The Cys72 forms a disulfide bond with Cys347 of the XK and spanned approximately 21.5 kilobasepair. Genetic linkage protein. It is because of several internal cysteine–cysteine analysis with prolactin-inducible protein by Zelinski et al. bonds that Kell antigens are sensitive to disulfide bond mapped KEL to 7q32-36. Lee showed that KEL reducing agents (2-aminoethyl-isothiouronium bromide maps to 7q33.1,21,22 and dithiothreitol). The metalloendopeptidase activity is

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 15 G.A. Denomme

The distinguishing feature of KEL is that it is predicted Table 1. Molecular features, nucleotide polymorphisms, and antigens of the Kell blood group system to be a type II single transmembrane spanning protein; the N-terminal is on the cytoplasmic side of the plasma membrane. System: Kell, CD328 The metalloendopeptide studies were performed on the basis Location: 7q33 of sequence homology with neutral endopeptides and the fact Gene Name: KEL, ISBT 006 that the positions of many of the cysteines are conserved.10,23 Gene Size: 21,302 basepair mRNA Size: 2,562 basepair Lee determined the molecular basis of KEL1/KEL2 and, with Nucleotide Exon rs# Antigen(s) Amino acid that publication, the ability to predict fetal inheritance of KEL1 578C>T 6 8176058 KEL2/KEL1 (K/k) Thr193Met and hemolytic disease using amniotic fluid–derived DNA. The w+ molecular basis for Jsa/Jsb was reported in that same year. 577T>A 6 61729031 KEL1 (Kmod) Thr193Ser a b The molecular basis for Kpa, Kpb, and Kpc followed in 1996.24–26 841C>T 8 876059 KEL4/KEL3 [Kp /Kp )] Arg281Trp Table 1 summarizes the molecular features for the Kell blood 842G>A 8 — KEL21 [Kp(a-b-c+)] Arg281Gln group system antigens. 1790T>C 17 8176038 KEL7/KEL6 [Jsa/Jsb)] Leu597Pro The lack of Kell expression has lead to a number of 905T>C 8 — KEL11/KEL17 Val302Ala nucleotide changes responsible for the Kell-null phenotype. 539G>C 6 61729039 KEL14/KEL24 Arg180Pro The nucleotide changes result in alternative splice sites, 539G>A 6 — KEL14 (KEL:-14) Arg180His amino acid substitutions deleterious to expression, nucleotide 538C>T 6 — KEL14/KEL24 Arg180Cys insertions and deletions causing frameshifts, and termination (KEL:-14,-24) codons.27,28 In addition, several nucleotide changes result in 742C>T 8 61728832 KEL25/KEL28 Arg248Gln (VLAN-/VONG+) the reduced expression of Kell glycoprotein, termed Kmod 743G>A 8 61729040 KEL25/KEL28 Arg248Trp phenotype. The amino acid change for KEL13 not only causes (VLAN+/VONG-) the loss of the high prevalence antigen but also reduces the 875G>A 8 201698610 KEL31/KEL38 Arg292Gln expression of Kell glycoprotein.29 (KYOR+/KYOR-) 1481A>T 13 — KEL10 (Ul a) Glu494Val Kell and Kx Antigens 1643A>G 15 — KEL12 His548ARg 986T>C 9 — KEL13 (Kmod) Leu329Pro a b a b The principle antigens K/k, Kp /Kp , and Js /Js are 388C>T 4 184131044 KEL18 Arg130Trp invariably included in commercially available reagent RBC 389G>A 4 201110152 KEL18 Arg130Gln panels (Table 1). The K antigen is considered the most 1475G>A 13 — KEL19 Arg492Gln immunogenic among the minor blood group antigens, with 965C>T 9 — KEL22 Ala322Val the exception of the D antigen, which is nearly always matched 1145A>G 10 — KEL23 Gln382Arg in RBC transfusions. In fact, the K antigen has been given an 1217G>A 11 — KEL26 (TOU) Arg406Gln immunogenicity index of 1.0 by Tormey and Stack, and is the antigen with which all other minor blood group antigens are 745G>A 8 61729042 KEL27 (RAZ) Glu249Lys compared for the purpose of ranking immunogenicity (save for 1868G>A 17 — KEL29 (KALT) ARg623Lys the D antigen).30,31 The frequency of anti-K in pregnancy also 913G>A 8 — KEL30 (KTIM) Asp305Asn attests to its immunogenicity, although a significant proportion 1271C>T 11 — KEL32 (KUCI) Ala424Val of anti-K in pregnancy is the result of the transfusion of 1283G>T 11 — KEL33 (KANT) Arg428Leu K+ RBCs to K– women prior to pregnancy, since K antigen 758A>G 8 — KEL34 (KASH) Tyr253Cys matching is not mandatory. Approximately 15–20 percent 780G>T 8 — KEL35 (KELP) Leu260Phe of RBC alloimmunizations seen in pregnancy are caused by 18 Arg675Gln anti-K.32 The immunogenicity of K antigen may be HLA- 1391T>C 12 190890637 KEL36 (KETI) Thr464Ile related. The frequency of HLA-DRB1*11 and HLA-DRB1*13 877C>T 8 — KEL37 (KHUL) Arg293Trp are statistically higher in anti-K alloimmunized patients versus matched controls. This observation led Chiaroni et The prevalence of Jsa and Jsb antigens in people of African al. to conclude that the immune response to K is partially ancestry (20% and 80%, respectively) is unique to this racial attributable to preferred association of HLA type for antigen population. The prevalence of Js(a+b–) is approximately 1 presentation.33 percent, and therefore anti-Jsb alloimmunization is observed

16 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Kell and Kx review

occasionally in transfusion recipients, including chronically responsible for chronic granulomatous disease (CGD) make transfused patients with sickle cell disease. These patients anti-Kx+Km.34 The McLeod phenotype without CGD results pose particular challenges when requiring Js(b–) blood. in anti-Km alloimmunization. Exceptions, however, have been Transfusing institutions and blood centers must rely on reported of anti-Kx without anti-Km in XK−CGD deletions, continued surveillance of suitable donors and on the American and anti-Kx+Km in McLeod neuroacanthocytosis syndrome Rare Donor Program. On the other hand, the prevalence of K without CGD.35,36 antigen does not create challenges when providing compatible blood. Hemolytic Disease of the Fetus and Newborn Nearly all Kell blood group system antigens are caused by single nucleotide polymorphisms leading to single amino acid HDFN attributable to Kell blood group system antibodies substitutions. The K:-35 phenotype is the result of two amino has unique clinical features. The antibody titers do not acid substitutions at positions 260 and 675. correlate with disease severity nor are amniotic fluid bilirubin levels consistent with disease severity.37 The disease appears Kell and Kx Antibodies much more severe than titers indicate. A critical titer of 8 for intervention is recommended—however, middle cardiac vein Kell blood group system antibodies are usually IgG, but Doppler echocardiography has changed the management of can also be IgM. As a result, anti-K has been manufactured as HDFN.38,39 Kell glycoprotein is known to be expressed early IgM monoclonal antibodies with sufficient avidity to be used in fetal erythropoiesis.40 Therefore, it is assumed that HDFN as phenotyping reagents. The antibodies can cause acute and can occur earlier in gestation, when RBCs begin to form. For delayed hemolytic transfusion reactions, and autoantibodies example, maternal anti-K in the fetal circulation can bind to the with Kell specificities have been reported. As stated previously, fetal K antigen expressed on early erythroid progenitor cells, alloantibodies to this blood group system cause HDFN. It is which are thus removed by the fetal mononuclear phagocytic likely that all Kell blood group system antibodies suppress system. In vitro studies by Daniels and coworkers showed that erythropoiesis. Antibodies to the XK protein would react peripheral blood mononuclear cells from cord blood (a source similarly using in vitro techniques. Antibodies to the XK of CD34+ and early hematopoietic progenitor cells) grown in protein are not found naturally occurring. the presence of erythropoietin bound anti-K, but not anti-D,

Many single nucleotide polymorphisms lead to the K0 after 7 days of culture. Further, they showed that these cells (i.e., the complete absence of Kell glycoprotein) phenotype, had a high opsonization index (i.e., the antibody sensitized and with that phenotype the possibility of alloimmunization red cells are susceptible to ). The observation is high. The antibody produced by K0 transfusion recipients suggests that, in part, profound anemia may be caused by is anti-Ku (K5). The serum of alloimmunized K0 persons the early destruction of erythroid progenitor cells in the fetus represents antibodies to the Kell glycoprotein in much the before a significant amount of hemoglobin could accumulate same way as polyclonal anti-D or anti-U; it contains antibodies in the cells.41 Thus, early erythroid RBC destruction does not to multiple epitopes expressed on the Kell glycoprotein. Anti- correlate with the degree of anemia or amniotic fluid bilirubin

Ku is exceedingly rare—there are only ~100 K0 levels. described worldwide. Persons with marked reduction in the Vaughan and coworkers cultured cord blood mononuclear expression of Kell antigens, i.e., the Kmod phenotype, are cells (a source of hematopoietic progenitor cells) with at risk of forming antibodies to the epitope(s) expressed on erythropoietin in a semi-solid agar to enumerate erythroid wild-type Kell that they lack. Kmod variant is not mutually colony-forming and burst-forming units. They showed compatible, although the risk of alloimmunization of Kmod that anti-K suppressed erythropoiesis in an antibody dose- RBC transfusions to a Kmod recipient is lower because of the dependent manner. Therefore, both phagocytosis of early lower dose of antigen. Theoretically, K0 transfusion recipients erythroid progenitor cells and suppressed erythropoiesis are not tolerant of Kmod transfusions, but the immunogenicity contribute to disease severity that does not correlate with of Kmod RBCs is unknown. titers or evidence of RBC destruction.42 The suppressive When the XK protein is absent (McLeod phenotype), effect of anti-K goes beyond gestation. Residual alloantibody transfusion recipients are at risk of forming anti-Kx along in the newborn can continue to ongoing suppression of with anti-Km (K20). It is generally reported that major erythropoiesis. Suppressed erythropoiesis is supported chromosomal deletions that include XK and the gene by the lack of reticulocytosis that is normally observed in

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 17 G.A. Denomme

newborns.37,43 Infants who are supported by allogeneic top- 7. Camara-Clayette V, Rahuel C, Lopez C, et al. Transcriptional up or exchange transfusions may appear well a few days after regulation of the KEL gene and Kell protein expression in erythroid and non-erythroid cells. Biochem J 2001;356: delivery, but are at risk of late-onset anemia as the antibodies 171–80. continue to cause RBC destruction (as they would with anti-D) 8. Rojewski MT, Schrezenmeier H, Flegel WA. Tissue distribution along with suppression of erythropoiesis. The result is a risk of of blood group membrane proteins beyond red cells: evidence late-onset anemia within a couple of weeks as the transfused from cDNA libraries. Transfus Apher Sci 2006;35:71–82. 9. Russo D, Wu X, Redman CM, Lee S. Expression of Kell blood RBCs are sequestered and the infant’s marrow is unable to group protein in nonerythroid tissues. Blood 2000;96:340–6. produce sufficient RBCs. 10. Lee S, Lin M, Mele A, et al. Proteolytic processing of big endothelin-3 by the Kell blood group protein. Blood 1999; Conclusions 94:1440–50. 11. Anstee DJ, Ridgwell K, Tanner MJ, Daniels GL, Parsons SF. Individuals lacking the Gerbich blood-group antigen Antibodies to the Kell and Kx blood group systems have alterations in the human erythrocyte membrane provide serological challenges in immunohematology. The beta and gamma. Biochem J 1984;221: 97–104. K antigen is among the most immunogenic antigen, and 12. Ho M, Chelly J, Carter N, Danek A, Crocker P, Monaco AP. the expression of a covalent-linked complex with the XK Isolation of the gene for McLeod syndrome that encodes a protein and the non-covalent interactions with glycophorin novel membrane transport protein. Cell 1994;77:869–80. C underscore the importance of Kell and XK in membrane 13. De Franceschi L, Bosman GJ, Mohandas N. Abnormal red integrity and cellular function. The transfusion of K+ RBCs to cell features associated with hereditary neurodegenerative disorders: the neuroacanthocytosis syndromes. Curr Opin women of childbearing potential remains controversial given Hematol 2014;21:201–9. the significant incidence of anti-K HDFN. Kell blood group 14. Lee S. The value of DNA analysis for antigens of the Kell and antibodies do more than bind to their cognate antigen, which Kx blood group systems. Transfusion 2007;47:32S–39S. a makes the Kell-XK blood group systems clinically relevant and 15. Allen FH Jr, Lewis SJ. Kp (Penney), a new antigen in the Kell blood group system. Vox Sang 1957;2:81–7. scientifically challenging. The antibody-mediated intracellular 16. Yazdanbakhsh K, Lee S, Yu Q, Reid ME. Identification of a signaling events responsible for suppressed erythropoiesis defect in the intracellular trafficking of a Kell blood group remain to be characterized. The prevention of anti-K HDFN variant. Blood 1999;94:310–8. by passive immunization in a similar way as anti-D is unlikely 17. Kormoczi GF, Scharberg EA, Gassner C. A novel KEL*1,3 allele with weak Kell antigen expression confirming the cis-modifier practical. Identification of immunodominant epitopes and a effect of KEL3. Transfusion 2009;49:733–9. better understanding of T-cell tolerance induction may lead to 18. Bosco A, Xenocostas A, Kinney J, Cadwell CM, Zimring JC. a new era of immunotherapy for the prevention of HDFN.44 An autoanti-Kp b immunoglobulin M that simulates antigen suppression. Transfusion 2009;49:750–6. References 19. Seyfried H, Gorska B, Maj S, Sylwestrowicz T, Giles CM, Goldsmith KL. Apparent depression of antigens of the Kell 1. Lee S, Zambas ED, Marsh WL, Redman CM. Molecular blood group system associated with autoimmune acquired cloning and primary structure of Kell blood group protein. Proc haemolytic anaemia. Vox Sang 1972;23:528–36. Natl Acad Sci U S A 1991;88:6353–7. 20. Danek A, Rubio JP, Rampoldi L, et al. McLeod neuroacan- 2. Table of blood group antigens within systems. http://www. thocytosis: genotype and phenotype. Ann Neurol 2001;50: isbtweb.org/fileadmin/user_upload/files-2015/red%20cells/ 755–64. links%20tables%20in%20introduction%20text/Table%20 21. Lee S, Zambas E, Green ED, Redman C. Organization of the blood%20group%20antigens%20within%20systems%20 gene encoding the human Kell blood group protein. Blood v4.0%20141124.pdf. Accessed 25 June 2015. 1995;85:1364–70. 3. Coombs RR, Mourant AE, Race RR. In-vivo isosensitisation 22. Zelinski T, Coghlan G, Myal Y, et al. Genetic linkage between of red cells in babies with haemolytic disease. Lancet 1946;1: the Kell blood group system and prolactin-inducible protein 264–6. loci: provisional assignment of KEL to chromosome 7. Ann 4. Levine P, Backer M, Wigod M, Ponder R. A new human Hum Genet 1991;55:137–40. hereditary blood property (Cellano) present in 99.8% of all 23. Lee S, Debnath AK, Redman CM. Active amino acids of bloods. Science 1949;109:464–6. the Kell blood group protein and model of the ectodomain 5. Lee S, Russo D, Redman CM. The Kell blood group system: Kell based on the structure of neutral endopeptidase 24.11. Blood and XK membrane proteins. Semin Hematol. 2000;37:113-21. 2003;102:3028–34. 6. Redman CM, Lee S. A historical perspective on the discovery 24. Lee S, Wu X, Reid M, Redman C. Molecular basis of the of the Kell blood group carriers. Transfusion 2013;53: K:6,-7 [Js(a+b-)] phenotype in the Kell blood group system. 2831–3. Transfusion 1995;35:822–5. 25. Lee S, Wu X, Reid M, Zelinski T, Redman C. Molecular basis of the Kell (K1) phenotype. Blood 1995;85:912–6.

18 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Kell and Kx review

26. Lee S, Wu X, Son S, et al. Point mutations characterize KEL10, 37. Vaughan JI, Warwick R, Letsky E, Nicolini U, Rodeck CH, Fisk the KEL3, KEL4, and KEL21 alleles, and the KEL17 and NM. Erythropoietic suppression in fetal anemia because of Kell KEL11 alleles. Transfusion 1996;36:490–4. alloimmunization. Am J Obstet Gynecol 1994;171:247–52. 27. Yu LC, Twu YC, Chang CY, Lin M. Molecular basis of the Kell- 38. Bowman JM, Pollock JM, Manning FA, Harman CR, null phenotype: a mutation at the splice site of human KEL Menticoglou S. Maternal Kell blood group alloimmunization. gene abolishes the expression of Kell blood group antigens. J Obstet Gynecol 1992;79:239–44. Biol Chem 2001;276:10247–52. 39. Moise KJ Jr, Argoti PS. Management and prevention of red cell 28. Names for Kell (ISBT 006) Blood Group Alleles. http://www. alloimmunization in pregnancy: a systematic review. Obstet isbtweb.org/fileadmin/user_upload/files-2015/red%20 Gynecol 2012;120:1132–9. cells/blood%20group%20allele%20terminology/allele%20 40. Bony V, Gane P, Bailly P, Cartron JP. Time-course expression tables/006%20KEL%20Alleles%20v3.0%20131028.pdf. of polypeptides carrying blood group antigens during human Accessed 25 June 2015. erythroid differentiation. Br J Haematol 1999;107:263–74. 29. Lee S, Russo DC, Reid ME, Redman CM. Mutations that 41. Daniels G, Hadley A, Green CA. Causes of fetal anemia in diminish expression of Kell surface protein and lead to the hemolytic disease due to anti-K. Transfusion 2003;43:115–6. Kmod RBC phenotype. Transfusion 2003;43:1121–5. 42. Vaughan JI, Manning M, Warwick RM, Letsky EA, Murray 30. Tormey CA, Stack G. Immunogenicity of blood group antigens: NA, Roberts IA. Inhibition of erythroid progenitor cells by a mathematical model corrected for antibody evanescence anti-Kell antibodies in fetal alloimmune anemia. N Engl J Med with exclusion of naturally occurring and pregnancy-related 1998;338:798–803. antibodies. Blood 2009;114:4279–82. 43. Grant SR, Kilby MD, Meer L, Weaver JB, Gabra GS, Whittle 31. Tormey CA, Stack G. The persistence and evanescence of blood MJ. The outcome of pregnancy in Kell alloimmunisation. group alloantibodies in men. Transfusion 2009;49:505–12. BJOG 2000;107:481–5. 32. Moise KJ. Fetal anemia due to non-Rhesus-D red-cell 44. Stephen J, Cairns LS, Pickford WJ, Vickers MA, Urbaniak SJ, alloimmunization. Semin Fetal Neonatal Med 2008;13: Barker RN. Identification, immunomodulatory activity, and 207–14. immunogenicity of the major helper T-cell epitope on the K 33. Chiaroni J, Dettori I, Ferrera V, et al. HLA-DRB1 polymorphism blood group antigen. Blood 2012;119:5563–74. is associated with Kell immunisation. Br J Haematol 2006;132:374–8. Gregory A. Denomme, PhD, FCSMLS(D), Director of 34. Westhoff CM, Reid ME. Review: the Kell, Duffy, and Kidd blood group systems. Immunohematology 2004;20:37–49. Immunohematology and Transfusion Services, Diagnostic Laboratories, Blood Center of Wisconsin, 638 N. 18th Street, 35. Bansal I, Jeon HR, Hui SR, et al. Transfusion support for a patient with McLeod phenotype without chronic PO Box 2178, Milwaukee, WI 53201-2178. granulomatous disease and with antibodies to Kx and Km. Vox Sang 2008;94:216–20. 36. Russo DC, Oyen R, Powell VI, et al. First example of anti-Kx in a person with the McLeod phenotype and without chronic granulomatous disease. Transfusion 2000;40:1371–5.

Notice to Readers Attention: State Blood Bank Meeting Organizers All articles published, including communications and book reviews, reflect the opinions of the authors and do If you are planning a state meeting and would like copies not necessarily reflect the official policy of the American of Immunohematology for distribution, please send request, Red Cross. 4 months in advance, to [email protected]

For information concerning the National Reference Immunohematology is on the Web! Laboratory for Blood Group Serology, including the American www.redcross.org/about-us/publications/ Rare Donor Program, contact Sandra Nance, by phone at immunohematology (215) 451-4362, by fax at (215) 451-2538, or by e-mail at For more information, send an e-mail to [email protected] [email protected]

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 19 O r i g i n a l R e p o r t A simple approach to screen rare donors in Brazil

C.P. Arnoni, F.R.M. Latini, J.G. Muniz, R.D.M. Person, T.A.P. Vendrame, D. Gazito, and L. Castilho

Providing blood units for patients with an antibody to a high- of blood center personnel, the development of a computer prevalence antigen or with multiple common antibodies is a system, recruitment of donors, and maintenance of the rare constant challenge to the blood banks. Finding a compatible donor units.2 Since 2011, Colsan, a blood bank in São Paulo, has requires extensive screening, which incurs a large amount of investment. In this article, we share our experience of organizing implemented a process to screen for rare blood types, trying a rare donor inventory with limited resources, we include the to set a reliable, useful, and efficient strategy to find rare blood strategy used for finding rare donors, and we share the difficulties donors. Taking into account the limitations we have related found during the implementation of the approach and the results obtained. Immunohematology 2015;31:20–23. to financial support and the use of different methods, we developed an approach to converge resources and strengthen Key Words: rare donor, high prevalence antigen, the efforts that aim to find the best combination of tests to phenotyping, genotyping successfully screen large numbers of donors, reduce costs, and increase the chances of encountering rare phenotypes and Rare donor identification began to get attention in genotypes. the 1960s when the American Red Cross and American Different serology methods, as well as DNA typing, are Association of Blood Banks began compiling a rare donor being used to screen rare donors.2 As serology has some database.1 Both institutions realized that ensuring blood limitations attributable to the scarcity of commercial and supply for patients with antibodies to high prevalence antigens potent antisera to type rare antigens, molecular protocols for or with multiple common antibodies was a big challenge.1,2 large-scale genotyping have emerged as a tool to overcome Thereafter, rare donor programs were created in some these restrictions.9,10 countries and, in 1998, a national American program was Because the definition of what can be considered as rare formed (the American Rare Donor Program)1 to manage and blood differs between countries, the first step is to establish supply rare blood, which currently provides approximately which antigens should be screened. It is very difficult to obtain 1800 units per year in the United States.1,3 Concomitantly, a negative example of a high prevalence antigen when it only in 1965, the International Society of Blood Transfusion occurs in less than 1 in 1000 individuals.11 Then, finding donors (ISBT) established the International Panel of Rare Blood whose red cells are negative for multiple common antigens can Donors gathered by the International Blood Group Reference also be a challenge. Therefore, a donor whose red cells lack Laboratory in Bristol, U.K. Consequently, since 1984, when multiple common antigens is also considered a rare donor. the ISBT Working Party on Rare Donors was formed, the In a multi-ethnic population such as we find in Brazil, provision of an effective exchange program has been discussed the prevalence of the different blood group antigens varies worldwide.4,5 In 2004, the ISBT Working Party on Rare significantly, and it is necessary to have a range of rare Donors reported that the International Panel of Rare Blood blood types available. According to the prevalence of rare Donors held 4000 rare donors registered from 24 countries.5,6 blood groups in the Brazilian population, we established an

Other national rare donor programs were also established— approach to search for S–s–, k–, Rhnull, r′r′, r″r″, Di(b–), for example, the French program conducted by the French Vel–, Wr(b–), Co(a–), Yt(a–), Js(b–), Kp(b–), Jo(a–), and 7 National Reference Laboratory for Blood Groups and the Hy– donors. Additionally, we searched for R2R2 donors with Israeli program headquartered by the Magen David Adom a combination of negative clinical antigens. This approach National Blood Services.8 Unfortunately, however, there are includes serologic and molecular screening in repeated donors, still some countries without a national program.2 in D– donors, and in donors with RhCE variants. We herein Currently, we are starting discussions in Brazil to establish share our approach, the difficulties we experienced during a national panel of rare donors. Implementation steps include implementation, and the results obtained after approximately the screening of large numbers of donors, the education 3 years of the program.

20 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Screening of rare donors in Brazil

Materials and Methods KEL, Dombrock, and systems. All samples

previously typed by serology, such as Di(a+) and/or K+, R1r,

Rare Donor Screening Strategy R1R1, R2R2, or R0r are selected for this molecular analysis. Screening for Rare Phenotypes in Repeat Donors Repeat donors, including group O donors with at least two Screening of Rare Phenotypes in D-Negative Donors prior donations, are selected for screening by serology as well All D– donors are typed for C, E, and K by hemagglu- as by DNA typing. tination in microplates using an automated instrument (Neo, 1. Serologic Screening: We first perform a cross-match Immucor, Birkenfeld, Germany). This approach identifies rare

between the donor’s red blood cells (RBCs) and plasmas Rh phenotypes such as r′r′, r″r″, and Rhnull and also the k– containing antibodies, such as anti-K, anti-Dia, anti-s, and phenotype in the samples typed as K+. anti-E by gel test in an automated instrument (Wadianna, Grifols, Barcelona, Spain). To optimize the searching and Molecular Screening for RhCE Variants to reduce costs, we mix plasmas with anti-K and anti-Dia Molecular screening for RhCE variants is performed in and perform the tests on the pool. If the test is positive, K repeat donors of group O African descendants and in donors and Dia are individually typed. All the positive results are with altered expression of C, c, E, and e. We also perform confirmed with commercial sera. molecular searching for CE variants in donors with altered The aim of this serologic strategy is to find donors expression of D because RhD variants have been shown to

with k–, S–s–, and Di(b–) phenotypes and R2R2 donors be associated with RhCE variants. In these cases, we select with an interesting combination of antigen-negative samples with weak D expression for immediate spin with results. Figure 1 shows the four scenarios obtained two monoclonal anti-D reagents (IgM RUM-1 and blend with this strategy and the further steps performed with D175+D415) on an automated instrument (Neo, Immucor). serologic and molecular protocols. Because the most important RhCE variants are those 2. Molecular Screening: Taking into account the lack silencing the high prevalence antigens, hrS and hrB, our of commercial antisera to type the majority of high- strategy includes screening the following alleles: RHCE*ceAR, prevalence antigens and the limitations of conventional RHCE*ceEK, RHCE*ceAG, RHCE*ceMO, RHCE*ceBI, polymerase chain reaction (PCR), we developed a RHCE*ceSM, RHCE*ceCF, and RHCE*ceS (RHCE*ce733G) SNaPshot protocol to identify rare donors, as previously that cause the hrS– and/or hrB– phenotypes. To identify described by Latini et al.12 these variants, we first use a PCR–restriction fragment– Briefly, SNaPshot is a mini-sequencing assay that permits length polymorphism (PCR-RFLP) for detection of the SNPs analysis of several single nucleotide polymorphisms (SNPs) 712A>G, 254C>G, 667G>T and 733C>G. Depending on the from numerous donors in a short period of time. The protocol results obtained, we then use a strategy to identify the variant, we developed identifies alleles of the Diego, Colton, Cartwright, as shown in Figure 2.

A

B

C

D

Fig. 1. This figure shows the four scenarios obtained by serologic screening. (A) All K+ RBCs are typed for k to identify k– phenotypes. (B) s– and K– RBCs are typed for S and all S–s– samples are genotyped for GYPB to identify U– and U+var phenotypes. (C) All Di(a+) and K– samples are typed for RhCE. R1r, R1R1, R0r, and R2R2 RBCs are molecular typed by SNaPshot. (D) All E+ K– RBCs are typed for e, and all R2R2 samples are typed for other clinically relevant antigens.

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 21 C.P. Arnoni et al.

The inventory of donors with RhCE variants in the homozygous state or in the heterozygous state with Ce or cE haplotypes allows for RH molecular matching to patients with sickle cell disease, preventing Rh alloimmunization and delayed hemolytic transfusion reactions. Six of our 11 donors with RhCE variants were related to RhD variants; all hrS– linked to weak D type 4.2.2 and all hrB– linked to weak D type 4.0.

Discussion

The strategy presented herein has allowed us to search for rare donors and to create a rare donor inventory at our institution. After the complete implementation of the molecular laboratory, the investment is approximately $2.00 per sample for Fig. 2. Flowchart used to identify hrS– and hrB– donors. The investigation starts with the serologic screening and $13.00 per use of polymerase chain reaction–restriction fragment–length polymorphism to detect the single nucleotide polymorphisms 712A>G, 254C>G, 667G>T, and 733C>G. According to sample for SNaPshot screening for RHCE the results, we perform the analyses indicated in the flowchart to identify the RHCE variants. variants. The search for D– donors is part of our laboratory routine; the additional k typing is the equivalent of $0.70 per We also perform molecular tests to identify RhD variants sample. The development of the SNaPshot method has helped in all samples with RhCE variants, based on previously increase throughput and reduce costs. Therefore, this strategy published protocols.13 to find rare donors, based on a focused search, is cost-effective

Results Table 1. Rare donor inventory Total number of Phenotypes and predicted Identified rare donors are included in our rare donor Screening donors screened phenotypes from genotypes n registry. Table 1 presents the results obtained in our 3 years of Serologic screening 4500 U+var* 6 U–* 1 experience of building our rare donor inventory. To all donors k– 5 included in this inventory, we send a folder with a simple Molecular screening 1600 Yt(a-b+) 4 explanation of their rare and instructions regarding Js(a+b–) 1 their next donation. We also ask that they keep their contact Co(a–b+) 1 Kp(a+b–) 1 information updated. Di(a+b–) 2 Additionally, we also phenotype and genotype all the RhD negative 2000 r˝r˝ 2 clinical relevant antigens and freeze RBC aliquots in liquid r´r´ 2 nitrogen. Phenotype information on rare donors is submitted k– 2 S to the database housed in our blood center. The database RhCE variants 590 hr – 7 hrB– 3 allows the identification of the donors and facilitates searching hrS–, hrB– 1 for a requested phenotype. The steps of the process are TOTAL 38 schematically described in Figure 2. *U– and U+var were determined by polymerase chain reaction–allele specific and restriction fragment–length polymorphism.14

22 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Screening of rare donors in Brazil

as compared with other strategies using microarrays and may thank Silvia Iversson for her efforts to maintain, contact, and help other blood centers to build their rare donor inventory. recruit the rare donors and Carla Renata Messias for technical The benefit of this investment is documented when an support. alloimmunized patient with a rare phenotype requires a rare unit of blood and is successfully transfused with a compatible References unit. In a period of 3 years, we received 18 requests for rare 1. Flickinger C, Petrone T, Church A. Review: American rare units, and 8 of these were fulfilled using our rare donor donor program. Immunohematology 2004;20:239–43. inventory. Applying this approach, we intend to meet the 2. Nance ST. How to find, recruit and maintain rare blood donors. needs of the patients with a rare phenotype in our institution Curr Opin Hematol 2009;16:503–8. and help other blood centers. Nevertheless, we still have some 3. Meny GM, Flickinger C, Marcucci C. The American Rare Donor Program. J Crit Care 2013; 28:110. limitations to ensure that blood is made available to specific 4. Mourant AE. The establishment of an international panel of patients. Although we observed a great collaboration of the blood donors of rare types. Vox Sang 1965;10:129–32. donors when recruited, some of these may be unable to donate 5. Anstee D, Levene C, Mallory D, et al. Rare blood. An ISBT when required. Freezing blood would be a good option, but Working Party report on rare blood donors. International Society of Blood Transfusion. Vox Sang 1999;77:58-62. this procedure is currently a challenge in Brazil, since the 6. Woodfield G, Poole J, Nance ST, Daniels G. A review of the blood bag and the glycerol solution used for freezing are not ISBT rare blood donor program. Immunohematology 2004;20: licensed by our regulatory agency. 244–8. 7. Peyrard T, Pham BN, Le Pennec PY, Rouger P. [The rare Limitations of the Approach blood groups: a public health challenge]. Transfus Clin Biol 2008;15:109–19. Our strategy for searching for rare donors does not include 8. Levene C, Asher O, Shinar E, Yahalom V. Rare blood donors: a screening for D– –, Ge:-2, and Ko phenotypes, which have personal approach. Immunohematology 2006;22:64–8. already been found in the Brazilian population, but our future 9. Avent ND. Large-scale blood group genotyping: clinical screening activities will focus on the identification of such implications. Br J Haematol 2009;144:3–13. 10. Daniels G. The molecular genetics of blood group donors. Another unfavorable point of this strategy is the long polymorphism. Hum Genet 2009;126:729–42. duration of the whole process. In general, when we find a rare 11. Reesink HW, Engelfriet CP, Schennach H, et al. Donors with a donor, the RBC unit has already been transfused and we need rare pheno (geno) type. Vox Sang 2008;95:236–53. to wait until the next donation to freeze RBC aliquots and to 12. Latini FR, Gazito D, Arnoni CP, et al. A new strategy to identify perform complete phenotyping. rare blood donors: single polymerase chain reaction multiplex SNaPshot reaction for detection of 16 blood group alleles. Blood Transfus;12(Suppl 1):s256–63. Conclusion 13. Arnoni CP, Latini FR, Muniz JG, et al. How do we identify RHD variants using a practical molecular approach? Transfusion 2014;54:962–9. It is widely accepted that a rare donor program is 14. Storry JR, Reid ME, Fetics S, Huang CH. Mutations in important to ensure a safe transfusion. In our experience, GYPB exon 5 drive the S-s-U+(var) phenotype in persons of we realized that the implementation of a rare donor program African descent: implications for transfusion. Transfusion requires efforts from both technical and administrative areas. 20 03;43:1738 – 47. On the other hand, we show herein that a simple and focused strategy can help fulfill the requests for units of rare blood for Carine Prisco Arnoni, PhD (corresponding author), Adjunct Director; Flavia R.M. Latini, PhD, Director; Janaína Guilhem Muniz, patients with antibodies against high-prevalence antigens or Biologist; Rosangela Duarte de Medeiros Person, Biologist; Tatiane patients with multiple antibodies. Exchanges of experience Aparecida de Paula Vendrame, Biologist; Diana Gazito, Biologist, and collaboration between different centers, through a Technical and Scientific Department, Colsan-Associação Beneficente national program, will allow us to ensure that blood will be de Coleta de Sangue, Avenida Jandira 1260, Indianópolis 04080- made available to patients with rare blood phenotypes. 006, São Paulo, SP, Brazil; and Lilian Castilho, PhD, Professor and Researcher, Hemocentro-Unicamp, Rua Carlos Chagas 480, Barão Geraldo 13083-878, Campinas, SP, Brazil. Acknowledgments

We are grateful to Nichola Conran for English review and to Grifols, who sponsored part of the rare donor searching by serology and helped us to implement this protocol. We

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 23 O r i g i n a l R e p o r t Proposed criterion for distinguishing ABO mosaics from ABO chimeras using flow cytometric analysis

A. Oda, N. Matsuyama, M. Hirashima, H. Ishii, K. Kimura, H. Matsukura, F. Hirayama, K. Kawa, and Y. Fukumori

Differentiation of ABO mosaics from chimeras is performed using rejection after hematopoietic progenitor cell transplantation flow cytometry (FCM) analysis. Although mosaics and chimeras using ABO-incompatible cells.10 Therefore, in the present have been distinguished by presence or absence of clear resolution study, we developed a quantitative criterion for FCM-based using FCM analysis, the lack of quantitative metrics and definitive criteria for this differentiation has made some cases difficult to differentiation of ABO mosaics from chimeras by setting differentiate. In this study, therefore, we attempted to establish a a gate between the “A” or “B” antigen-negative and -positive definitive and quantitative criterion for this differentiation. When red blood cell (RBC) populations in the FCM histogram and FCM histogram gates for group “A” or “B” antigen-negative and -positive red blood cells (RBCs) were set such that group O RBCs then determining the proportion of cells in the middle gate. were classified as 99 percent negative and group A or B RBCs as 99 Quantitative tests such as this FCM system should be applied percent positive, the percentages of RBCs in the middle region of to other qualitative serologic tests. six chimeras and 23 mosaics (12 A mosaics and 11 B mosaics) were 0.1–0.6 percent and 7.0–19.0 percent, respectively. This result suggested that ABO mosaics and chimeras can be unambiguously Materials and Methods differentiated when the cutoff point of the intermediate region is set to 1 percent. Immunohematology 2015;31:24–28. Blood Samples Twelve A mosaic samples, 11 B mosaic samples, and 6 Key Words: ABO, mosaic, chimera, flow cytometry ABO chimera samples were obtained from volunteer blood donors in the Kinki area of Japan. These samples were The differentiation of ABO subgroups is usually previously identified as mosaics or chimeras based on the determined serologically on the basis of the following: (1) following: (1) agglutination tests with monoclonal anti-A, agglutination tests with human polyclonal anti-A, anti-B, and anti-B, anti-A1 lectin, and anti-H lectin; (2) identification of anti-A1 lectin; (2) identification of anti-A or anti-B in serum; anti-A or anti-B in serum; and (3) ABO transferase activity and (3) ABO transferase activity. ABO mosaics and chimeras in plasma. Consequently, the possibility of other subgroups 1,2 are usually differentiated from other subgroups using these including A1, A2, A3, and Ax were ruled out. Similarly, B, B3, 1–5 tests. Consequently, mosaics and chimeras are differentiated and Bx were ruled out. In addition, their phenotypes as mosaics by coil planet centrifugation (CPC)6 or flow cytometry (FCM) or chimeras were confirmed by the CPC method, which can methods.7–9 Genotyping is useful as a supplementary tool to detect ABO chimerism as low as 0.1 percent.6 A flow chart confirm the final differentiation of these ABO subgroups.1,2 outlining the classification of ABO mosaics, chimeras, and Although ABO mosaics and chimera can be easily differentiated other subgroups is presented in Figure 1. We did not perform from other subgroups, it is difficult to differentiate them from a family study to determine if any of the donors were related. each other using standard serologic methods,3,4 and only It is likely that most of the donors were unrelated, however, CPC and FCM methods are available for this purpose. The because they all had different family names and lived in widely coil planet centrifuge is no longer manufactured and is thus scattered regions. difficult to obtain. Furthermore, distinguishing ABO mosaics from chimeras using the FCM method is based simply on the ABO Genotyping presence or absence of clear resolution of positive and negative Genomic DNA was prepared from 200 μL ethylene- peaks. This lack of quantitative metrics has made some diaminetetraacetic acid (EDTA) whole blood using a collection cases difficult to differentiate because there are no definitive system (Quick whole blood kit, KURABO Industries, Osaka, criteria for this determination. In addition, a quantitative FCM Japan). The polymerase chain reaction–reverse sequence method appears promising for diagnosing early relapse or specific oligonucleotide (PCR-rSSO) method was performed

24 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Distinguishing ABO mosaics from chimeras

Fig. 1. Flow chart outlining the classification of ABO mosaics, chimeras, and other subgroups. Broken arrows and broken squares indicate supplementary tools used to confirm the final differentiation of these ABO subgroups. to detect single nucleotide polymorphisms (SNPs) on ABO a concentration of 250 U at 5 U/μL (AmpliTaq Gold, Applied alleles. Amplicons labeled with fluorescence were separately Biosystems). PCR amplification was performed with initial amplified by PCR from ABO exons 6 and 7 using an automated denaturation at 96°C for 2 minutes, followed by 35 cycles at system (GeneAmp PCR System 9700, Applied Biosystems, 96°C for 1 minute, 62°C for 1 minute, and 72°C for 4 minutes. Foster City, CA,) and the group-specific reagent (Genosearch For DNA sequencing analysis, the PCR fragments, which ABO reagent, Medical & Biological Laboratories, Nagano, were purified, (QIAquick PCR purification kit,QIAGEN, Japan). We detected SNPs on ABO alleles using a florescent Hilden, Germany), were fluorescently labeled with primer system (Luminex System 200, Hitachi Solutions, Tokyo, GA62 or GA03 (Table 1) using a cycle sequencing kit (BigDye Japan). In addition, we confirmed the DNA sequence of exon 7 Terminator v1.1, Applied Biosystems). The DNA sequences on both A and B alleles by direct PCR sequencing. We first amplified exon 7 on both alleles using the primers Table 1. Primers used for amplification and direct sequencing of ABO GA22 and GA23 (Table 1). Each PCR contained 2.5 gene fragments μL genomic DNA, 1 μL GA22, 1 μL GA23, 35.25 μL Primer Primer Amplified sterile water (distilled deionized sterile water, Nippon designation Primer sequence (5′–3′) Direction location region Gene Co. Ltd., Toyama, Japan), 5 μL of a dNTP mix at GA22 CTAAAACCAAGGGCGGGAGG reverse 3′-UTR a concentration of 2 mmol/L of each dNTP (GeneAmp GA23 GAAGGATGTCCTCGTGGTGA forward exon 6 exon 6–7 Applied Biosystems), 5 μL of a 10× buffer (PCR buffer, GA62 TCAGGACAGGGCAGGAGAACG forward 6 exon7 Applied Biosystems), and 0.25 μL of a Taq amplifier in GA03 TGCTGGAGGTGCGCGCCTAC forward exon 7 exon 7

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 25 A. Oda et al.

were measured using a genetic analyzer (ABI PRISM 3130×L, Inc., Kyoto, Japan) for 15 minutes at 5°C. The RBC suspension Applied Biosystems). The loci c.261 and c.297 in exon 6 and was subsequently washed four times using PBS containing c.467, c.526, c.547, c.646, c.657, c.681, c.703, c.771, c.771, 0.2% fetal bovine serum (FBS) (EIDIA Co. Ltd., Tokyo, Japan) c.784, c.796, c.802, c.803, c.829, c.871, c.930, c.1006, c.1054, and adjusted to a 0.25% cell suspension. Thereafter, 25 μL of and c.1060 in exon 7 were analyzed, and the results indicated this suspension was mixed with 50 μL monoclonal anti-A or that all of the samples that we could analyze were either A102 anti-B (Bioclone Anti-A and Bioclone Anti-B, Ortho-Clinical or B101 (Table 2). Diagnostics, Tokyo, Japan) for 30 minutes at 5°C.11,12 After washing twice with PBS containing 0.2% FBS (PBS/FBS), a Preparation of Cell Samples for FCM Analysis tagged antibody (goat anti-mouse IgG-FITC, BD Biosciences, A 10-µL RBC suspension (whole blood collected in San Jose, CA, USA) was added for 30 minutes at 5°C. After a

K2EDTA) was washed three times in phosphate-buffered final wash with PBS, the cells’ florescence was measured by saline (PBS) (Sigma-Aldrich, St. Louis, MO, USA) and fixed by FCM (FACSCalibur, BD Biosciences). mixing with 50 μL of 0.25% glutaraldehyde (Nacalai Tesque, Setting the Gate for FCM Table 2. Summarized results of nucleotide substitutions in ABO exons 6 and 7 Using control RBCs (O and A1 or B groups), Position the G1 gate was set so that group O RBCs were Exon 6 Exon 7 99 percent negative for A or B antigens, and the 261 297 467 526 657 703 796 803 930 Allele G3 gate was set so that group A1 or B RBCs were Sample* G A C C C G C G G A101 99 percent positive for A or B antigens. When A mosaic 1 NT these gates were applied, only 0.1–0.3 percent A mosaic 2 — — T — — — — — — A102 of group O control RBCs showed nonspecific A mosaic 3 NT binding to anti-A or anti-B and only 0.1–0.4 A mosaic 4 — — T — — — — — — A102 percent of group A1 or B RBCs were false A mosaic 5 — — T — — — — — — A102 negative. The G2 gate was set as the region A mosaic 6 NT between G1 and G3 (Fig. 2). The proportion A mosaic 7 — — T — — — — — — A102 of cell population detected in the G2 gate was A mosaic 8 — — T — — — — — — A102 calculated as follows: [G2 / (G1 + G2 + G3) × A mosaic 9 — — T — — — — — — A102 100]. A mosaic 10 NT A mosaic 11 — — T — — — — — — A102 Calculation of the Heterogeneity of A mosaic 12 — — T — — — — — — A102 Chimera Samples from a Standard B mosaic 1 — G — G T A A C A B101 Calibration Curve B mosaic 2 — G — G T A A C A B101 The following artificial mixtures of A or B B mosaic 3 — G — G T A A C A B101 1 and O RBCs were prepared [(A or B) / (A or B B mosaic 4 — G — G T A A C A B101 1 1 + O) × 100] and analyzed using FCM: 0, 10, 20, B mosaic 5 — G — G T A A C A B101 B mosaic 6 NT 30, 40, 50, 60, 70, 80, 90, and 100 percent. A B mosaic 7 NT standard calibration curve of (G2 + G3) / (G1 + B mosaic 8 — G — G T A A C A B101 G2 + G3) was generated and used to estimate the B mosaic 9 — G — G T A A C A B101 ratios of cells in the chimera samples. B mosaic 10 — G — G T A A C A B101 B mosaic 11 — G — G T A A C A B101 Results Chimera 1 ND Chimera 2 ND The percentages of 23 ABO mosaics Chimera 3 ND and 6 ABO chimeras detected in the G2 gate Chimera 4 ND are presented in Tables 3 and 4. The mean Chimera 5 ND percentages of mosaics and chimeras in the G2 Chimera 6 ND gate were 13.1 percent (range: 7.0–19.0%) and *GenBank accession no. AF134412. NT = not tested; ND = not determined. 0.2 percent (range: 0.1–0.6%), respectively.

26 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Distinguishing ABO mosaics from chimeras

Fig. 2. Determination of gate. Dot plots of negative (A) and positive (B) control samples. Gating regions were determined as 99 percent negative (G1, dotted line) and 99 percent positive (G3, dotted line). The G2 (solid line) gate was defined as the region between G1 and

G3 indicated in images C and D, which are example dot plots of an A mosaic and A1 + O chimera sample, respectively. FITC = fluorescein isothiocyanate.

Although the number of samples was small, the G2 values of Table 3. ABO mosaic samples mosaics were significantly higher than the values of chimeras % of gate (anti-A) (p < 0.001: Mann-Whitney U test). When the cutoff point Sample G1 G2 G3 was set to 1 percent to differentiate mosaics from chimeras, A mosaic 1 17.6 11.8 70.6 all analyzed cases were differentiated accurately and A mosaic 2 36.7 19 44.3 unambiguously. A mosaic 3 66.8 8.7 24.5 We then attempted to estimate the proportion of the A mosaic 4 17.6 13.7 68.7 two different types of RBCs in the chimera samples using a A mosaic 5 20.6 13.8 65.6 standard linear curve that defines the relationship between A mosaic 6 55.5 7 37.5 the mixing ratio of artificial chimera samples and their values A mosaic 7 40.4 14.4 45.2 in the G3 gate. We obtained a linear curve, with the known A mosaic 8 23.5 17.4 59.1 concentrations on the y-axis and the measured variable on A mosaic 9 32.9 12.6 54.5 the x-axis (data not shown). The estimated ratios were almost A mosaic 10 24.5 10.2 65.3 consistent with the G1 and G3 gate values (Table 4). A mosaic 11 37.1 18.8 44.1 A mosaic 12 45 10.7 44.3 Discussion Mean 34.9 13.1 52 % of gate (anti-B) In the present study, we successfully established a clear and Sample G1 G2 G3 simple criterion for FCM analysis to differentiate ABO mosaics B mosaic 1 27.7 11.3 61 from ABO chimeras by setting the FCM histogram gates (G1 B mosaic 2 19.5 10.9 69.6 and G3) for group “A” and/or “B” antigen-negative and -positive B mosaic 3 35.3 17.3 47.4 RBCs. We set these gates such that 99 percent negative RBCs B mosaic 4 28.9 13.8 57.3 and 99 percent positive RBCs were included in gates G1 and B mosaic 5 18.3 12 69.7 G3, respectively. The value of 99 percent set the cutoff point to B mosaic 6 44.9 14.8 40.3 1 percent to differentiate mosaics from chimeras. This value B mosaic 7 32.7 16.8 50.5 allowed us to unambiguously differentiate both types of RBCs. B mosaic 8 45.6 11.9 42.5 Furthermore, we attempted to determine heterogeneity based B mosaic 9 43.2 10.8 46 on data from artificial chimera samples with a known number B mosaic 10 61.1 15.3 23.6 of RBCs of each blood group. B mosaic 11 46.8 8.5 44.7 After having established the proposed criteria, we — — — — performed serologic ABO blood group testing on 777,617 Mean 36.7 13.1 50.2

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 27 A. Oda et al.

Table 4. ABO chimera samples References

Estimated chimera 1. Olsson ML, Chester MA. Polymorphisms at the ABO locus in % of gate ratio Positive subgroup A individuals. Transfusion 1996;36:309–13. Sample Constituent antigen G1 G2 G3 Negative Positive 2. Storry JR, Olsson ML. The ABO blood group system revisited: Chimera 1 B + AB A 82.9 0.1 17 76 24 a review and update. Immunohematology 2009;25:48–59. Chimera 2 O + B B 70.9 0.1 29 70 30 3. Marsh WL, Nichols ME, Oven R, Whitsett DC, Ethridge EL. Inherited mosaicism affecting the ABO blood groups. Chimera 3 A + AB B 56.1 0.6 43.3 55 45 Transfusion 1975;15:589–95. Chimera 4 A + AB B 95 0.1 4.9 95 5 4. Tippett P. Blood group chimeras; a review. Vox Sang Chimera 5 O + B B 91.7 0.1 8.2 88 12 1983;44:333–59. Chimera 6 O + A A 29.9 0.1 70 30 70 5. Chester MA, Olsson ML. The ABO blood group gene: a locus Mean — — 71.1 0.2 28.7 69 31 of considerable genetic diversity. Transfus Med Rev 2001;15: 177–200. Constituent = red blood cell ABO group. 6. Takahashi J, Seno T, Nakade T, et al. Detection and quantitation of ABO RBC chimerism by a modified coil planet centrifuge donors as a routine test from December 2013 to October method. Transfusion 2002;42:702–10. 7. Blanchard D, Bruneau V, Bernard D, et al. Flow cytometry 2014. Among the samples from all donors, nine samples were analysis of dual red blood cell populations after bone marrow suspected to be mosaic or chimera based on serologic analyses; transplantation. Br J Haematol 1995;89:741–7. subsequent CPC analyses revealed that seven of these samples 8. Nelson M. An overview of the use of flow cytometry in the were mosaics and the remaining two samples were chimeras. analysis of mixed red cell populations. Pathology 1999;31: 191–8. When a validation test was performed using these nine 9. Hult AK, Olsson ML. Many genetically defined ABO subgroups samples, our proposed FCM criterion clearly discriminated exhibit characteristic flow cytometric patterns. Transfusion between these mosaics and chimeras. 2010;50:308–23. Although FCM analysis is widely used to distinguish ABO 10. Hendriks EC, de Man AJ, van Berkel YC, Stienstra S, de Witte T. Flow cytometric method for the routine follow-up of red cell mosaics from ABO chimeras and hence our qualitative FCM populations after bone marrow transplantation. Br J Haematol system may not have a powerful impact on the differentiation 1997;97:141–5. of ABO mosaics and chimeras, we hope that it contributes 11. Sacks SH, Lennox ES. Monoclonal anti-B as a new blood- to the introduction of more quantitative tests in the field of typing reagent. Vox Sang 1981;40:99–104. serologic blood typing. 12. Lowe AD, Lennox ES, Voak D. A new monoclonal anti-A: culture supernatants with the performance of hyperimmune Our FCM system has a drawback. Because it is necessary human reagents. Vox Sang 1984;46:29–35. to set the G3 gate wide enough for a substantial number of 13. Reid ME, Lomas-Francis C, Olsson ML. The blood group mosaic RBCs to be counted in the G3 population, chimera antigen facts book. 3rd ed. London: Academic Press, 2012: 27–51. RBCs in G2 should exhibit relatively high expression of A or

B antigens. Therefore, A2 chimeras (e.g., A2 + O), the RBCs of Akira Oda, MT (corresponding author); Nobuki Matsuyama, MT, which express only a limited amount of A or B antigens, cannot subsection chief; Mizuko Hirashima, MT, subsection chief; Hiroyuki be distinguished from “A” mosaics. Although A2 is a rare blood Ishii, MT, section head; Keiko Kimura, MT, section head; Harumichi group in Asian populations and is not a major problem in Asia, Matsukura, PhD, general manager; Fumiya Hirayama, MD, PhD, the possibility of finding an A2 blood type should be carefully general manager, Research; Keisei Kawa, MD, PhD, department considered when analyzing RBCs from people of European or head; and Yasuo Fukumori, PhD, Japanese Red Cross, Kinki Block Blood Center Laboratory, 7-5-17, Saito-Asagi, Ibaraki, Osaka 567- African descent, because A2 is found in 8–10 percent of these 0085, Japan. populations.13

28 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 R e v i e w Kidd blood group system: a review

J.R. Hamilton

The Kidd blood group system has been recognized as clinically resulting phenotypes, however, exhibit varying frequencies important in red blood cell (RBC) serology since its identification among different population groups (Table 1). Jk3 has a very in 1951. Forty years later, the JK glycoprotein was determined to high prevalence and is found on all RBCs carrying either Jka be a product of SCL14A1 and was identical to the urea transport b protein UT-B produced by HUT11A. The functional role of the or Jk . The null phenotype, Jk(a–b–), identifies those RBCs protein as a urea transporter in RBCs and kidney has been well that are Jk:–3. This phenotype occurs rarely, but has a greater documented. The polymorphism responsible for the antithetical frequency in individuals of Polynesian or Finnish descent upon antigens Jka and Jkb was identified in 1994 as c.838G>A (p. Asp280Asn). Recent discoveries have expanded the system inheritance of two silent alleles. The phenotype frequency in to include 23 variant alleles recognized by the International Polynesian populations is 0.1–1.4 percent, with frequency Society of Blood Transfusion that silence the protein expression variations seen in different Polynesian tribes.6 In Finns, the and 7 variant alleles presumably producing weak or partial JK Jk(a–b–) phenotype frequency is approximately 0.03 percent.7 antigens. Null phenotypes have been identified in individuals of several populations including those of African, Indian, and A second mechanism for the Jk(a–b–) phenotype is the Chinese decent, in addition to the well-documented findings in inheritance of a dominant suppressor gene that leads to the the Polynesian and Finnish populations. This review will examine apparent lack of JK antigens on the cell surface.8 In actuality, the historical information about the antigens and antibodies of small amounts of Jka, Jkb, and Jk3 can be demonstrated when the JK system as well as catalog the variations of the JK gene. Immunohematology 2015;31:29–35. sensitive methods such as adsorption/elution are used. The suppressor null phenotype is designated In(Jk) and has been Key Words: Kidd, blood group system, JK, SLC14A1, RBC identified in two families of Japanese ancestry. antigens Table 1. Phenotypes in the Kidd blood group system

The Kidd blood group system (ISBT009) was the ninth Incidence (%) blood group system identified. It was described in 1951 when Phenotype White Black Asian an unknown antibody detected in the plasma of the propositus, Jk(a+b–), Jk:3 26 52 23 Mrs. Kidd, caused hemolytic disease of the fetus and newborn Jk(a+b+), Jk:3 50 40 50 (HDFN) in her infant son.1 His initials, JK, became the symbol Jk(a–b+), Jk:3 24 8 27 that now represents this blood group system. The antithetical Jk(a–b–), Jk:–3 Rare Rare Rare except Polynesians (0.9) antigen, Jkb, was identified in 1953 when investigation of a 5 transfusion reaction identified a new antibody.2 Discovery of Modified from Fung et al. the Jk(a–b–) phenotype followed in 1959.3 It is of interesting historical note that Dr. Mary Crawford, pediatrician and blood The JK antigens have been detected on fetal RBCs as early group serologist, discovered inheritance patterns in her family as 7–11 weeks’ gestation and are fully developed at birth.9 The that suggested a silent JK allele while investigating her own Kidd antigen density has been shown to be approximately Lu(a–b–) phenotype.4 Basic characteristics of the antigens 14,000 copies per cell as determined on Jk(a+b–) RBCs.10 and antibodies of this blood group system have been well The antigens are not destroyed by treatment with proteolytic established; however, much information has been obtained enzymes or sulfhydryl compounds. Variations in the from molecular analysis of the JK protein. expression of both Jka and Jkb have been described and will be discussed in further detail subsequently. Antigens and Inheritance Genetics and Antigen Biochemistry The JK blood group system consists of three antigens: Jka, Jkb, and Jk3. Jka and Jkb are inherited as codominant The gene encoding the JK glycoprotein, SLC14A1, is a autosomal characteristics and are commonly found on red member of the solute carrier family of genes. It is located on blood cells (RBCs) of most population groups.5 The three the long arm of chromosome 18 (18q11-q12) and is organized

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 29 J.R. Hamilton

into 11 exons. Exons 1–3 are not translated; exons 4–11 code encoding for at this position. The p.Asp280Arg for the mature JK glycoprotein.11,12 substitution is found in the fourth extracellular loop of the JK The human erythrocyte urea transport gene, HUT11, was glycoprotein. The other two SNPs, which cause no change in identified in 199413 and later was assigned to the same position the amino acid sequence, are at position 588 of exon 7 and on chromosome 18 as the JK blood group locus.14 The encoded position –46 in intron 9. The JK*01 allele is characterized protein was demonstrated on all RBCs except Jk(a–b–) cells, a by nt588a and IVS9-46a. The JK*02 allele contains nt588g, finding that linked the urea transport protein to the JK locus. IVS9-46g. These changes are summarized in Figure 2. The Subsequently, it was identified that JK renamedSLC14A1, molecular basis of In(Jk) and Jk3 remain unknown, although encoded for a related but slightly different polypeptide the In(Jk) suppressor is not linked to the JK locus.8 HUT11A.15 These discoveries resulted in an understanding of the functional aspects of the Kidd antigens. The mature glycoprotein resulting from JK contains 389 amino acids with a molecular weight of 45 kDa. Hydrophobicity studies predict that the protein is organized into five extracellular loops with 10 membrane-spanning regions13,16 (Fig. 1). The third extracellular loop is significantly larger than the other four and contains the protein’s only external glycosylation site at amino acid position 211. This N-linked sugar chain has been shown to also carry ABO antigens.16 The N-terminal and C-terminal regions of the protein are both Fig. 2. Arrangement of JK showing the JK*01/JK*02 polymorphisms. intracellular. Open rectangles are non-coding exons. Shaded rectangles are coding exons. Arrowhead indicates the missense substitution in The Jka/Jkb polymorphism is defined by three single exon 9 defining the JK polymorphism. The two remaining changes nucleotide polymorphisms (SNPs). An SNP is a variation at are silent. a single nucleotide position in the DNA. The antigen-defining SNP occurs in exon 9 at nucleotide position 838.17 At this Sequencing studies have identified a number of molecular position, the JK*01(JK*A) allele contains nt838G and encodes variations that result in the Jk(a–b–) phenotype. These for aspartic acid at position 280; JK*02 (JK*B) contains nt838A, changes occur on both the JK*01 and JK*02 alleles and affect the normal expression through exon deletions, intron changes that cause splice site mutations, and nucleotide substitutions. Most variants are, in fact, SNPs in the gene’s coding region that lead to missense mutations or premature stop codons. Two genetic variants are responsible for the majority of Jk(a–b–) phenotypes. The more frequent variant is found in the Polynesian population and has been assigned the allele designation JK*02N.01. At position –1 of intron 5 of the JK*02 allele, a G>A nucleotide substitution (c.342-1G>A) causes a splice site mutation that leads to the skipping of exon 6.11 The resulting truncated protein is not transported to the RBC membrane. In addition to Polynesians, this genetic variant has been reported in Vietnamese,18 Chinese,19,20 Thai, Filipino, and Indonesian21 individuals—suggesting a historical relationship between these groups. One Jk(a–b–) Asian Indian individual possesses the same 342-1G>A SNP, although it was found on the background of a JK*01 allele (nt838G).22 Fig. 1. Depiction of JK glycoprotein in RBC membrane. Features The second most frequent Jk(a–b–) genetic variant occurs include ten membrane spanning regions, five extracellular loops, glycosylation site on third extracellular loop, epitopes of Jka and in the Finnish population. A nucleotide substitution c.871T>C Jkb in the fourth extracellular loop, and intracellular N-terminus and on a JK*02 background results in a to proline change C-terminus. at amino acid position 21.7 Other null variants have been

30 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Kidd blood group system

identified in single probands or in a small number of families. was described by Horn et al. that illustrates the variation in The Jk(a–b–) genetic variants are summarized in Table 2 frequency in different population groups of African descent.25 based on the International Society of Blood Transfusion The original propositus was an African American individual, (ISBT)-assigned allele name. Of interest are the variants but no additional examples of this variant were identified identified in African American and Asian Indian individuals, in testing of an additional 1000 African American blood since these groups have not historically been associated with donors. In contrast, the c.561C>A SNP was identified in 7 6 the JKnull phenotype. A JK*01 allele with c.561C>A change of 1174 Brazilian blacks (1:164) who were heterozygous for

Table 2. JKnull alleles Exon (intron) JK antibody Allele name† location Nucleotide change Amino acid change Ethnic group produced‡ Reference(s) JK*01N.01 Del 4 & 5 c.1-?_341+ ?del Initiation Met absent, English, Tunisian, Bosnian -Jk3 Irshaid et al.,23 Lucien exons 4–5 skipped et al.,24 Wester et al.18 JK*01N.02 5 c.202C>T p.Gln68Ter Caucasian -Jk3 Wester et al.18 JK*01N.03 7 c.582C>G p.Try194Ter Swiss -Jk3 Irshaid et al.23 JK*01N.04 10 c.956C>T p.Thr319Met African American None Wester et al.18 JK*01N.05 7 c.561C>A p.Tyr187Ter African American, Brazilian -Jk3 Horn et al.25 black JK*01N.06 Intron 5 c.342-1G>A p.(Arg114_Thr156del), Asian Indian -Jk3 Ekman et al.22 exon 6 skipped JK*01N.07 8 c.723delA Ile262Ter Not reported -Jka Crews et al.26 JK*01N.08 9 c.866A>G Asn269Ser Not reported Not reported Moulds et al.27 JK*01N.09 4 c.27_50del Val10-Arg17del African American -Jka Burgos et al.28 JK*01N.10 Intron 8 c.811+5G>A p.Ala270fs, exon 8 Chinese None Guo et al.29 skipped JK*02N.01 Intron 5 c.342-1G>A p.(Arg114_Thr156del), Polynesian, Vietnamese, -Jk3 Lucien et al.,11 Irshaid exon 6 skipped Chinese, Thai, Filipino, et al.,12 Lui et al.,19 Yan Indonesian et al.,20 Lin and Lung- Chih21 JK*02N.02 Intron 5 c.342-1G>C p.(Arg114_Thr156del), Chinese none Meng et al.30 exon 6 skipped JK*02N.03 5 c.222C>A p.Asn74Lys Chinese, Taiwanese not reported Lui et al.,19 Guo et al.29 JK*02N.04 Intron 7 c.663+1G>T Leu223fs, exon 7 French not reported Lucien et al.11 skipped JK*02N.05 8 c.723delA Ile262fs Hispanic none Wester et al.18 JK*02N.06 9 c.871T>C p.Ser291Pro Finnish -Jk3 Sidoux-Walter et al.,7 Irshaid et al.12 JK*02N.07 9 c.896G>A p.Gly299Glu Chinese not reported Lui et al.,19 Guo et al.29 JK*02N.08 10 c.956C>T p.Thr319Met Asian Indian, Pakistani -Jk3 Wester et al.18 JK*02N.09 4 c.191G>T p.Arg64Gln African American -Jkb Billingsley et al.,31 Gaur et al.32 JK*02N.10 4 c.194G>A p.Gly65Asp Not reported Not reported St-Louis et al.33 JK*02N.11 7 c.499A>G, p.Met167Val, Chinese None Guo et al.29 c.512G>A p.Trp171Ter JK*02N.12 6,7 c.437T>C, p.Leu146Pro, Chinese None Guo et al.29 c.499A>G p.Met167Val JK*02N13 7 c.499A>G, p.Met167Val, Chinese None Guo et al.29 c.536C>G p.Pro179Arg JK*01 or JK*02 designates the source allele. †Allele name is assigned by International Society of Blood Transfusion (ISBT) Working Party on Blood Group Antigens. ‡JK antibodies identified in original or subsequent propositi as listed in one or more cited references. Consult the ISBT Web site (www.isbtweb.org) or recent publications for newly described alleles.

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 31 J.R. Hamilton

561C/A and 1 individual who was homozygous for 561A/A screening test does not identify variant alleles, sequencing of and typed Jk(a–b–). Another variant, c.191G>T in JK*02, has exons 4–11 is required to avoid false results. recently been reported in an African American population at a frequency of approximately 1:400.31 Function Genetic variations predicted to encode weak or partial antigen expression have also been identified. Investigations The JK protein is expressed on RBCs and in the of the propositi were generally initiated when antigen-typing endothelium of the descending vasa recta and epithelial discrepancies were seen with various sources of antisera or the surfaces of the kidney inner medulla.39 In renal function, propositus had produced an apparent alloantibody to the JK this transporter protein is important in regulating urea as antigen detected either by a serological typing or predicted by part of the mechanism for urine concentration and water the genotype at nt838 (Jka or Jkb). The first allele reported was conservation.40 The erythrocyte JK glycoprotein serves to a c.130G>A substitution described by Wester et al. that led to facilitate rapid urea transport across the RBC membrane.41 a weakened expression of Jka.34 Variant alleles are listed in This mechanism is thought to ensure red cell structural Table 3. The antigens produced by these variant alleles would stability as the cells pass through the renal medulla via the be termed partial following the convention of the D weak versus vasa recta. Individuals of the Jk(a–b–) phenotype have been partial alleles. Until alloantibody production demonstrates shown to have suboptimal urine concentrating ability.42 that a glycoprotein produced is structurally different from the Other than this deficit, no other clinical sequelae have been commonly found form, identified variants are considered to associated with the Jknull phenotype, suggesting the presence code for weaker than normal antigen expression. of compensatory mechanisms. The lack of urea transport in Recognition of the relative likelihood of certain alternative the RBCs is illustrated by the resistance of Jk(a–b–) RBCs to alleles is important in designing JK genotyping assays. In lysis in 2M urea.43 RBCs having normal JK phenotypes will addition to the c.838G>A polymorphism, assays should be lyse within 30 seconds as the urea is transported into the cells, designed to interrogate other regions of the JK gene where followed by a rapid osmotic influx of water. Because of the lack variations affecting antigen expression have been identified. of urea transport and therefore no water uptake, Jk(a–b–) cells This approach was used by Wester et al. to design a polymerase remain intact after 2 minutes. This characteristic has been chain reaction multiplex screening assay to more effectively used to perform mass screening for Jk(a–b–) individuals. identify the genetic variants most commonly encountered The JK protein has also been isolated from human colon,44 in their investigations.38 For example, consideration of the as well as brain, , heart, lung, , small intestine, bone c.561C>A variant or the c.191G>T variant would be important marrow, urinary tract, bladder, prostate, pancreas, skeletal in screening assays for Brazilian or American blacks, muscle and spleen, and testes.45 The exact purpose of the urea respectively. Assays based on known SNPs, however, will transporters in non-erythroid, non-renal tissues remains not detect previously unknown genetic variations. When a speculative. No JK antigens have been found on lymphocytes, monocytes, granulocytes, or platelets.9

Table 3. JK partial or weak alleles

Exon (intron) JK antibody Allele name† location Nucleotide change Amino acid change Ethnic group produced‡ Reference(s) JK*01W.01 4 c.130G>A p.Glu44Lys Caucasian, Asian, Chinese -Jkb; -Jk3 Wester et al.,34 Whorley et al.35 JK*01W.02 7 c.551T>C p.Trp171Arg African American None Whorley et al.35 JK*01W.03 4 c.28G>A p.Val10Met African American -Jka Deal et al.36 JK*01W.04 5 c.226G>A p.Val76Ile African American -Jka Deal et al.36 JK*01W.05 8 c.742G>A p.Ala248Thr American Indian Not reported Gaur et al.32 JK*02W.01 7 c.548C>T p.Ala183Val African American None Whorley et al.35 JK*02W.02 8 c.718T>A p.Trp240Arg African American Not reported St-Louis et al.37 JK*01 or JK*02 designates the source allele. †Allele name is assigned by International Society of Blood Transfusion (ISBT) Working Party on Blood Group Antigens. ‡JK antibodies identified in original or subsequent propositi as listed in one or more cited references. Consult the ISBT Web site (www.isbtweb.org) or recent publications for newly described alleles.

32 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Kidd blood group system

Antibodies and were transient antibodies produced during JK antigen suppression.61 It is interesting to postulate that some previously The antibodies to the three antigens of the JK system have reported immune autoantibodies may have been caused by been well documented in multiple studies and case reports as unrecognized variant Jka or Jkb on the RBCs of individuals responsible for immediate and delayed transfusion reactions whose RBCs type as antigen-positive. Reactivity with as well as HDFN.9 In contrast to the frequent severity of autologous cells in these cases might have been a temporary reactions to incompatible transfusion, cases of HDFN caused finding as the immune system refined the specificity of the by Kidd antibodies are relatively mild.9 The antibodies are alloantibody. predominately caused by RBC stimulation, although the In a study examining genetic factors influencing JK literature contains two examples of apparently naturally immunization, Reviron et al. demonstrated that HLA- occurring anti-Jka.46,47 Most examples are IgG1 and IgG3, DRB1*0101, -DRB1*0102, and -DRB1*1001 alleles were more although some antibody examples can contain IgG2, IgG4, or frequently found in individuals immunized to Jka than in the IgM fractions.9 non-immunized southern European population studied (65% Anti-Jka and -Jkb are well known for their rapid and versus 19.5%).62 significant drop in titer to levels that are difficult to detect by routine serological methods. Double-dose Jk(a+) or Jk(b+) Role in Renal Transplantation test cells or enzyme-treated cells may be necessary to detect weak antibody reactivity. Some Kidd antibodies can only be Location of the JK antigens on renal cells raises intriguing detected in antiglobulin tests in which serum and polyspecific questions about the impact of Kidd system antibodies on renal antihuman globulin are used to detect complement binding.9 graft survival in kidney transplants. Several case reports In other reported examples, manual hexadimethrine bromide suggest a role for this. Hamilton et al., Holt et al., and Rourk (polybrene) or solid-phase tests were required to detect et al. report cases of cadaveric transplants to patients with reactivity of anti-Jka.9,26 If Kidd antibodies are not detected, negative antibody screens. Two to ten years after transplant the subsequent transfusion of antigen-positive RBCs results in and during a period where each patient was noncompliant a rapid anamnestic response, with the rising titer frequently with immunosuppressive regimes, acute graft rejection resulting in a delayed transfusion reaction. Studies at the occurred simultaneously with the appearance of a Kidd system Mayo Clinic showed that 29 percent of the delayed hemolytic antibody.62–66 One case reported by Holt et al. described a or delayed serologic transfusion reactions between August patient who suffered a hemolytic reaction attributable to 1999 and June 2007 involved JK system antibodies. The anti-Jka following a post-transplant transfusion.66 This was overwhelming majority of these were attributable to anti‑Jka.48 then followed by hyperacute rejection of the transplanted The severe immediate or delayed hemolytic transfusion organ. In two cases where previous exposure to foreign reactions described with JK system antibodies were thought to RBCs had occurred, the appearance of the JK antibodies be caused by the complement binding of IgG class antibodies. was presumed to be an anamnestic response. In the one case This was refuted, however, in studies by Yates et al. that with no apparent RBC stimulation,64 the antigen-positive demonstrated complement binding was only present in those transplanted organ was postulated as providing the primary antibodies that had a direct agglutinating component or were immunization stimulus. Nevertheless, even with prior RBC reactive in indirect antiglobulin tests using anti-IgM.49 stimulus, primary immunization by the transplanted kidney Multiple examples of JK autoantibodies have been should not be excluded.65 Leure et al. demonstrated in 370 reported in the literature. The case reports show that the kidney transplants that mismatch of the recipient/graft at the majority have had autoanti-Jka specificity and have presented JK locus was associated with a higher frequency of interstitial with immune hemolysis.50–54 In many cases, an underlying inflammation observed on kidney biopsy when compared autoimmune disease was present. Autoanti-Jkb and autoanti- with those recipient/graft pairs that were matched at the JK Jk3 are also reported.55,56 One report described an autoanti- locus although overall graft survival was not influenced.67 Jka that appeared during a course of methyldopa therapy.57 The literature also contains descriptions of JK autoantibodies Summary whose reactivity required the presence of paraben compounds found in commercial low-ionic-strength saline reagents,58,59 Although recognized at the serological level in its most were apparent autoantibodies with mimicking specificity,60 basic form for many decades, the Kidd blood group system

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 33 J.R. Hamilton

has been shown to be increasingly complex. The knowledge 13. Olives B, Neau P, Bailly P, et al. Cloning and functional of this system has increased as the tools for investigating expression of a urea transporter from human bone marrow cells. J Biol Chem 1994;269:31649–52. both phenotypic and genotypic variation have expanded. 14. Olives B, Mattei M, Huet M, et al. Kidd blood group and urea Future studies would be expected to result in a more complete transport function of human erythrocytes are carried by the understanding of the products of the variant alleles that are same protein. J Biol Chem 1995;270:15607–10. currently known as well as provide new information on the 15. Sidoux-Walter F, Lucien N, Olives B, et al. At physiological expression levels the Kidd blood group/urea transporter basis of Jk3 and In(Jk) phenotype. What remains unchanged protein is not a water channel. J Biol Chem 1999;274: is the clinical significance of Kidd system antibodies and the 30228–35. importance of recognizing them in order to provide safe blood 16. Lucien N, Sidoux-Walter F, Roudier N, et al. Antigenic and components for transfusion. functional properties of the human red blood cell urea transporter hUT-B1. J Biol Chem 2002;37;34101–7. 17. Olives B, Merriman M, Bailly P, et al. The molecular basis of the Acknowledgments JK polymorphism and lack of association with type 1 diabetes susceptibility. Hum Mol Genet 1997;6:1017–20. The author acknowledges Robert Ratner for preparation of 18. Wester ES, Johnson ST, Copeland T, et al. Erythroid urea transporter deficiency due to novel JKnull alleles. Transfusion Figure 2 and Connie Westhoff for assistance with genotyping 2008;48:365–72. data. 19. Lui HM, Lin JS, Chen PS, et al. Two novel Jknull alleles derived from 222C>A in exon 5 and 896G>A in exon 9 of the JK gene. References Transfusion 2009;49:259–64. 20. Yan L, Zhu F, Fu Q. Jk(a-b-) and Kidd blood group genotypes 1. Allen FH, Diamond LK, Niedziela B. A new blood-group in Chinese people (letter). Transfusion 2003;43:289–90. antigen. Nature 1951;167:482. 21. Lin M, Lung-Chih Y. Frequencies of the JKnull (IVS5-1g>a) allele 2. Plaut G, Ikin EW, Mourant AE, et al. A new blood group in Taiwanese, Fujian, Filipino and Indonesian populations antibody, anti-Jkb. Nature 1953;171:431. (letter). Transfusion 2008;48:1768. 3. Pinkerton FJ, Mermod LE, Liles BA, et al. The phenotype 22. Ekman GC, Hessner MJ. Screening of six racial groups for Jk(a-b-) in the Kidd blood group system. Vox Sang 1959;4: the intron 5G>A 3´ splice acceptor mutation responsible 155–60. for the Polynesian Kidd (a-b-) phenotype: the null mutation 4. Crawford MN, Greenwalt TJ, Sasaki T, et al. The phenotype is not always associated with the JKB allele. Transfusion Lu(a-b-) along with unconventional Kidd groups in one family. 2000;40:888–9. Transfusion 1961;1 228–31. 23. Irshaid NM, Eicher NI, Hustinx H, et al. Novel alleles at the 5. Fung MK, Grossman BJ, Hillyer CD, et al. Technical manual. JK blood group locus explain the absence of the erythrocyte 18th ed. Bethesda, MD: American Association of Blood Banks, urea transporter in European families. Br J Haematol 2014. 2002;116:445–53. 6. Henry S, Woodfield G. Frequencies of the Jk(a-b-) phenotype 24. Lucien N, Chiaroni J, Cartron J, et al. Partial deletion in the JK in Polynesian ethnic groups (letter). Transfusion 1995;35:277. locus causing a Jknull phenotype. Blood 2002;99:1079–81. 7. Sidoux-Walter F, Lucien N, Nissinen R, et al. Molecular 25. Horn T, Castilho L, Moulds JM, et al. A novel JKA allele, nt561C>A, associated with silencing of Kidd expression. heterogeneity of the Jknull phenotype: expression analysis of the Jk(S291P) mutation found in Finns. Blood 2000;96:1566–73. Transfusion 2012;52:1092–6. 8. Okubo Y, Yamaguchi H, Nago N, et al. Heterogenity of 26. Crews WS, Gould JM, Keller MA, JH Herman. A novel JK*A the phenotype Jk(a-b-) found in Japanese. Transfusion variant detectable only by solid phase testing. Transfusion 1986;26:237–9. 2013;53:164A. 9. Daniels G. Human blood groups. 3rd ed. Hoboken, NJ: Wiley- 27. Moulds JM, Noumsi GT, Hendrix J, et al. Evidence that Blackwell, 2013. microarray genotyping is an accurate predictor of a blood group phenotype. Transfusion 2013:53;47A. 10. Masouredis SP, Sudora E, Mahan L, et al. Quantitative immunoferritin microscopy of Fya, Fyb, Jka, U and Dib antigen 28. Burgos A, Vege S, Velliquette RW, et al. Serologic and molecular site numbers on human red cells. Blood 1980;56:969–77. investigation of novel Kidd system alleles in African-Americans. Transfusion 2013;53:39A. 11. Lucien N, Sidoux-Walter F, Olives B, et al. Characterization of the gene encoding the human Kidd blood group/urea 29. Guo Z, Wang C, Yan K, et al. The mutation spectrum of the JKnull phenotype in the Chinese population. Transfusion 2013; transporter protein. Evidence for splice site mutations in Jknull individuals. J Biol Chem 1998;273:12973–80. 53:545–53. 12. Irshaid NM, Henry SM, Olsson ML. Genomic characterization 30. Meng Y, Zhou S, Li Y, et al. A novel mutation at the JK locus of the Kidd blood group gene: different molecular basis of the causing Jknull phenotype in a Chinese family. Sci China C Life Jk(a-b-) phenotype in Polynesians and Finns. Transfusion Sci 2005:48;636–40.

2000;40:69–74. 31. Billingsley K, Posadas JB, Moulds JM, et al. A novel JKnull allele associated with typing discrepancies amond African Americans. Immunohematology 2013;29:145–8.

34 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Kidd blood group system

32. Gaur K, Posadas J, Teramure G, et al. Molecular diversity of the 52. Ciaffoni S, Ferro I, Potenza R, et al. Evans syndrome: a case

JKnull phenotype (abstract). Vox Sang 2010;99:371. of autoimmune thrombocytopenia and autoimmune hemolytic 33. St-Louis M, Lavoie J, Caron S, et.al. Novel JK*02 allele in a anemia caused by anti-Jka. Haematologica 1987;72:245–7. French-Canadian family. Transfusion 2013:53;3024. 53. Sander RP, Hardy NM, Van Meter SA. Anti-Jka autoimmune 34. Wester E, Storry JR, Olsson ML. Characterization of a Jk(a+w): in an infant. Transfusion 1987;27:58–60. a blood group phenotype associated with an altered JK*01 54. Wondergem MJ, Overbeeke M, Som N, et al. Mixed allele. Transfusion 2011;51:380–92. autoimmune haemolysis in a SLE patient due to aspecific 35. Whorley T, Vege S, Kosanke J, et al. JK alleles associated with and anti-Jka autoantibodies: case report and review of the altered Kidd antigen expression (abstract). Transfusion 2009; literature. Haematologica 2006;91:ECR12. 49:48A–49A. 55. Grishaber JE, Cordile DG, Strauss RG. Development of 36. Deal T, Adamski J, Hue-Roye K, et al. Two novel JKA alleles in alloanti-Jka in a patient with hemolytic anemia due to autoanti- a Jk(a+b-) patient with anti-Jka (abstract). Transfusion 2011; Jkb. Am J Clin Pathol 1992;98:542–44. 51:24A. 56. O’Day T. A second example of autoanti-Jk3. Transfusion 1987; 37. St-Louis M, Lavoie J, Caron S, et al. Two new JK variants 27:442. causing null and weakened Jkb antigen. Transfusion 2012;52; 57. Patten E, Beck CE, Scholl C, et al. Autoimmune hemolytic 160A–161A. anemia with anti-Jka specificity in a patient taking aldomet. 38. Wester ES, Gustafsson B, Snell B, et al. A simple screening Transfusion 1977;17:517–20. assay for the most common JK*0 alleles revealed 58. Judd WJ, Steiner EA, Cochran RK. Paraben-associated compound heterozygosity in Jk(a-b-) probands from Guam. autoanti-Jka antibodies: three examples detected using Immunohematology 2009;25:165–9. commercially prepared low-ionic strength saline containing 39. Xu Y, Olives B, Bailly P, et al. Endothelial cells of the kidney parabens. Transfusion 1982;22:31–5. vasa recta express the urea transported HUT11. Kidney Int 59. Halima D, Garratty G, Bueno R. An apparent anti-Jka reacting 1997;51:138–46. only in the presence of methyl esters of hydroxybenzoic acid. 40. Sands JM, Timmer RT, Gunn RB. Urea transporters in the Transfusion 1982;22:521–4. kidney and erythrocytes. Am J Physiol 1997;273:F321–39. 60. Ellisor SS, Reid ME, O’Day T, et al. Autoantibodies mimicking 41. Macy RI, Yousef LW. Osmotic stability of red cells in renal anti-Jkb plus anti-Jk3 associated with autoimmune hemolytic circulation requires rapid urea transport. Am J Physiol 1988; anemia in a primipara who delivered an unaffected infant. Vox 254:C669–74. Sang 1983;45:53–9. 42. Sands JM, Gargus JJ, Frohlich O, et al. Urinary concentration 61. Issitt PD, Ovarski G, Hartnett PL, et al. Temporary suppression ability in patients with Jk(a-b-) blood type who lack carrier- of Kidd system antigen expression accompanied by transient mediated urea transport. J Am Soc Nephrol 1992;2:1689–96. production of anti-Jk3. Transfusion 1990;30:46–50. 43. Heaton DC, McLoughlin K. Jk(a-b-) red cells resist urea lysis. 62. Reviron D, Detton I, Ferrera V, et al. HLA-DRB1 alleles and Transfusion 1982;22:70–1. Jk(a) immunization. Transfusion 2005;45:956–9. 44. Inoue H, Jackson SD, Vikulina T, et al. Identification and 63. Hamilton MS, Singh V, Warady BA. Plasma cell–rich acute characterization of a Kidd antigen/UT-B urea transporter cellular rejection of a transplanted kidney associated with expressed in human colon. Am J Physiol Cell Physiol 2004; antibody to the red cell Kidd antigen. Pediatr Transplant 287:C30–5. 20 06;10:974 –7. 45. Sands JM. Molecular mechanisms of urea transport. J 64. Hamilton MS, Singh V, Warady BA. Additional case of acute Membrane Biol 2003;191:149–63. cellular kidney rejection associated with antibodies to the red 46. Rumsey D, Nance SJ, Rubino N, et al. Naturally-occurring blood cell Kidd antigen. Pediatr Transplant 2008;12:918–9. anti-Jka in infant twins. Immunohematology 1999;15:159-62. 65. Rourk A, Squires JE. Implications of Kidd blood group system 47. Kim HH, Park TS, Lee W, et al. Naturally occurring anti-Jk(a). in renal transplantation. Immunohematology 2012;3:91–4. Transfusion 2005;45:1043–4. 66. Holt S, Donaldson H, Hazlehurst G, et al. Acute transplant 48. Winters, JL, Richa EM, Bryant SC, et al. Polyethylene glycol rejection induced by blood transfusion reaction to the Kidd antiglobulin tube versus gel microcolumn: influence on the blood group system. Nephrol Dial Transplant 2004;19: incidence of delayed hemolytic transfusion reactions and 2403–6. delayed serologic transfusion reactions. Transfusion 2010; 67. Leure E, Van Damme B, Noizat-Pirenne F, et al. Duffy and 50:1444–52. Kidd blood group antigens: minor histocompatibility antigens 49. Yates J, Howell P, Overfield J, et al. IgG anti-Jka/Jkb antibodies involved in renal allograft rejection? Transfusion 2007;47: are unlikely to fix complement. Transf Med 1998;8:133–40. 28–40. 50. Garcia-Munoz R, Anton J, Rodriguez-Otero P, et al. Common variable immunodeficiency and Evans syndrome complicated Janis R. Hamilton, MS, MT(ASCP)SBB, American Red Cross– by autoimmune hemolysis due to anti-Jka auto-antibodies. Southeastern Michigan Region, Manager, Immunohematology Leuk Lymphoma 2008;49:1220–2. Reference Laboratory, PO Box 33351, 100 Mack Ave., Detroit, MI 51. Guastafierro S, Sessa F, Cuomo C, et al. Delayed hemolytic 48232-5351. transfusion reaction due to anti-S antibody in patient with anti-Jk(a) autoantibody and multiple alloantibodies. Ann Hematol 2004;83:307–8.

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 35 A n n o u n c e m e n t s

36 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Announcements, cont.

Masters (MSc) in Transfusion and Transplantation Sciences at The University of Bristol, England

Applications are invited from medical or science graduates for the Master of Science (MSc) degree in Transfusion and Transplantation Sciences at the University of Bristol. The course starts in October 2015 and will last for 1 year. A part-time option lasting 2 or 3 years is also available. There may also be opportunities to continue studies for PhD or MD following the MSc. The syllabus is organized jointly by The Bristol Institute for Transfusion Sciences and the University of Bristol, Department of Pathology and Microbiology. It includes: • Scientific principles of transfusion and transplantation • Clinical applications of these principles • Practical techniques in transfusion and transplantation • Principles of study design and biostatistics • An original research project

Application can also be made for Diploma in Transfusion and Transplantation Science or a Certificate in Transfusion and Transplantation Science.

The course is accredited by the Institute of Biomedical Sciences.

Further information can be obtained from the Web site: http://ibgrl.blood.co.uk/MSc/MscHome.htm

For further details and application forms please contact:

Dr Patricia Denning-Kendall University of Bristol Paul O’Gorman Lifeline Centre Department of Pathology and Microbiology Southmead Hospital Westbury-on-Trym, Bristol BS10 5NB, England Fax +44 1179 595 342, Telephone +44 1779 595 455, e-mail: [email protected].

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 37 Announcements, cont.

Online Specialist in Blood Bank (SBB) Certificate and Masters in Clinical Laboratory Management Program Rush University College of Health Sciences

Continue to work and earn graduate credit while the Rush University SBB/MS program prepares you fo the SBB exam and the Diplomat in Laboratory Management (DLM) exam given by ASCP Board of Certification! (Please note acceptable clinical experience is required for these exams.)

Rush University offers online graduate level courses to help you achieve your career goals. Several curricular options are available. The SBB/MS program at Rush University is currently accepting applications for Fall 2015. For additional information and requirements, please visit our website at: www.rushu.rush.edu/cls/

Rush University is fully accredited by the Higher Learning Commission (HLC) of the North Central Association of Colleges and Schools and the SBB Certificate Program is accredited by the Commission on Accreditation of Allied Health Education Programs (CAAHEP).

Applications for the SBB/MS Program can be submitted online at the folowing website: http://www.rushu.rush.edu/admiss/hlthadm.html

Contact: Yolanda Sanchez, MS, MLS(ASCP)CMSBB, Director, by email at [email protected] or by phone at 312-942-2402 or Denise Harmening, PhD, MT(ASCP), Director of Curriculum by email at [email protected]

38 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Announcements, cont.

The Johns Hopkins Hospital Specialist in Blood Bank Technology Program

The Johns Hopkins Hospital was founded in 1889. It is located in Baltimore, Maryland, on the original founding site, just 45 minutes from Washington, DC. There are approximately 1,000 inpatient beds and another 1,200 outpatient visits daily; nearly 600,000 patients are treated each year.

The Johns Hopkins Hospital Transfusion Medicine Division is one of the busiest in the country and can provide opportunities to perform tasks that represent the entire spectrum of Immunohematology and Transfusion Medicine practice. It provides comprehensive support to all routine and specialized areas of care for surgery, oncology, cardiac, obstetrics, neonatal and pediatric, solid organ and bone marrow transplant, therapeutic , and patients with hematological disorders to name a few. Our intradepartment Immunohematology Reference Laboratory provides resolution of complex serologic problems, transfusion management, platelet antibody, and molecular genotype testing.

The Johns Hopkins Hospital Specialist in Blood Bank Technology Program is an onsite work-study, graduate-level training program for certified Medical Technologists, Medical Laboratory Scientists, and Technologists in Blood Banking with at least two years of full-time Blood Bank experience.

The variety of patients, the size, and the general intellectual environment of the hospital provide excellent opportunities for training in Blood Banking. It is a challenging program that will prepare competent and knowledgeable graduates who will be able to effectively apply practical and theoretical skills in a variety of employment settings. The Johns Hopkins Hospital Specialist in Blood Bank Technology Program is accredited by the Commission on Accreditation of Allied Health Education Programs (CAAHEP). Please visit our website at http://pathology.jhu.edu/department/divisions/transfusion/ sbb.cfm for additional information.

Contact: Lorraine N. Blagg, MA, MLS(ASCP)CMSBB Program Director E-mail: [email protected] Phone: (410) 502-9584

The Johns Hopkins Hospital Department of Pathology Division of Transfusion Medicine Sheikh Zayed Tower, Room 3100 1800 Orleans Street Baltimore, Maryland 21287

Phone (410) 955-6580 Fax (410) 955-0618 Web site: http://pathology.jhu.edu/department/divisions/transfusion/index.cfm

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 39 A dvertisements

Reference and Consultation Services IgA Testing

Antibody identification and problem resolution IgA testing is available to do the following:

HLA-A, B, C, and DR typing • Identify IgA-deficient patients

HLA-disease association typing • Investigate anaphylactic reactions

Paternity testing/DNA • Confirm IgA-deficient donors Our ELISA for IgA detects protein to 0.05 mg/dL.

For information, contact: For additional information contact: Mehdizadeh Kashi Sandra Nance (215) 451-4362 at (503) 280-0210 or e-mail: or write to: [email protected]

Tissue Typing Laboratory or write to: American Red Cross Biomedical Services American Red Cross Biomedical Services Musser Blood Center Pacific Northwest Region 700 Spring Garden Street 3131 North Vancouver Philadelphia, PA 19123-3594 Portland, OR 97227 ATTN: Sandra Nance CLIA licensed, ASHI accredited CLIA licensed

National Reference Laboratory Donor IgA Screening for Blood Group Serology • Effective tool for screening large volumes of donors Immunohematology Reference Laboratory • Gel diffusion test that has a 15-year proven track record: AABB, ARC, New York State, and CLIA licensed Approximately 90 percent of all donors identified as 24-hour phone number: IgA deficient by this method are confirmed by the more (215) 451-4901 Fax: (215) 451-2538 sensitive testing methods

American Rare Donor Program For additional information: 24-hour phone number: (215) 451-4900 Kathy Kaherl Fax: (215) 451-2538 at (860) 678-2764 [email protected] e-mail: Immunohematology [email protected] Phone, business hours: (215) 451-4902 or write to: Fax: (215) 451-2538 Reference Laboratory [email protected] American Red Cross Biomedical Services Quality Control of Cryoprecipitated–AHF Connecticut Region Phone, business hours: 209 Farmington Ave. (215) 451-4903 Farmington, CT 06032 Fax: (215) 451-2538

40 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Advertisements, cont.

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 41 Advertisements, cont.

National Reference Laboratory National Neutrophil Serology Reference Laboratory for Specialized Testing Our laboratory specializes in granulocyte antibody detection Diagnostic testing for: and granulocyte antigen typing. • Neonatal alloimmune thrombocytopenia (NAIT) Indications for granulocyte serology testing • Posttransfusion purpura (PTP) include: • Refractoriness to • Alloimmune neonatal neutropenia (ANN) • Heparin-induced thrombocytopenia (HIT) • Alloimmune idiopathic thrombocytopenia purpura (AITP) • Autoimmune neutropenia (AIN) • Transfusion-related acute lung injury (TRALI) Medical consultation available Methodologies employed: Test methods: • Granulocyte agglutination (GA) • GTI systems tests • Granulocyte immunofluorescence by flow cytometry (GIF) — detection of glycoprotein-specific platelet antibodies • Monoclonal antibody immobilization of neutrophil antigens — detection of heparin-induced antibodies (PF4 ELISA) (MAINA) • Platelet suspension immunofluorescence test (PSIFT) • Solid phase red cell adherence (SPRCA) assay TRALI investigations also include: • Molecular analysis for HPA-1a/1b • HLA (PRA) Class I and Class II antibody detection

For further information, contact: For further information, contact: Platelet Serology Laboratory (215) 451-4205 Neutrophil Serology Laboratory (651) 291-6797 Sandra Nance (215) 451-4362 Randy Schuller (651) 291-6758 [email protected] [email protected]

American Red Cross Biomedical Services American Red Cross Biomedical Services Musser Blood Center Neutrophil Serology Laboratory 700 Spring Garden Street 100 South Robert Street Philadelphia, PA 19123-3594 CLIA licensed St. Paul, MN 55107 CLIA licensed

42 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Advertisements, cont.

Becoming a Specialist in Blood Banking (SBB)

What is a certified Specialist in Blood Banking (SBB)? • Someone with educational and work experience qualifications who successfully passes the American Society for Clinical Pathology (ASCP) board of registry (BOR) examination for the Specialist in Blood Banking. • This person will have advanced knowledge, skills, and abilities in the field of transfusion medicine and blood banking. Individuals who have an SBB certification serve in many areas of transfusion medicine: • Serve as regulatory, technical, procedural, and research advisors • Perform and direct administrative functions • Develop, validate, implement, and perform laboratory procedures • Analyze quality issues preparing and implementing corrective actions to prevent and document issues • Design and present educational programs • Provide technical and scientific training in transfusion medicine • Conduct research in transfusion medicine Who are SBBs? Supervisors of Transfusion Services Managers of Blood Centers LIS Coordinators Educators Supervisors of Reference Laboratories Research Scientists Consumer Safety Officers Quality Assurance Officers Technical Representatives Reference Lab Specialists Why become an SBB? Professional growth Job placement Job satisfaction Career advancement How does one become an SBB? • Attend a CAAHEP-accredited SBB Technology program OR • Sit forthe examination based on criteria established by ASCP for education and experience. However: In recent years, a greater percentage of individuals who graduate from CAAHEP-accredited programs pass the SBB exam. Conclusion: The BEST route for obtaining an SBB certification is . . . to attend a CAAHEP-accredited Specialist in Blood Bank Technology Program. Additional information can be found by visiting the following Web sites: www.ascp.org, www.caahep.org, and www.aabb.org Contact the following programs for more information:

 Onsite or : Online Program Contact Name Phone Contact E-mail Contact Web Site Program Blood Systems Laboratories Marie P. Holub 602-996-2396 [email protected] www.bloodsystemslaboratories.org : Walter Reed Army Medical Center William Turcan 301-295-8605 [email protected] www.militaryblood.dod.mil/Fellow/default.aspx  [email protected] American Red Cross, Southern California Region Catherine Hernandez 909-859-7496 [email protected] www.redcrossblood.org/socal/communityeducation  ARC-Central OH Region Joanne Kosanke 614-253-2740 ext. 2270 [email protected] none  Blood Center of Wisconsin Phyllis Kirchner 414-937-6271 [email protected] www.bcw.edu  Community Blood Center/CTS Dayton, Ohio Nancy Lang 937-461-3293 [email protected] www.cbccts.org/education/sbb.htm : Gulf Coast Regional Blood Center Clare Wong 713-791-6201 [email protected] www.giveblood.org/services/education/sbb-distance-program : Hoxworth Blood Center, University of Cincinnati Pamela Inglish 513-558-1275 [email protected] www.grad.uc.edu  Medical Center Indiana Blood Center Jayanna Slayten 317-916-5186 [email protected] www.indianablood.org : Johns Hopkins Hospital Lorraine N. Blagg 410-502-9584 [email protected] http://pathology.jhu.edu/department/divisions/transfusion/sbb.cfm  Medical Center of Louisiana Karen Kirkley 504-903-3954 [email protected] www.mclno.org/webresources/index.html  NIH Clinical Center Blood Bank Karen Byrne 301-496-8335 [email protected] www.cc.nih.gov/dtm  Rush University Yolanda Sanchez 312-942-2402 [email protected] www.rushu.rush.edu/cls : Transfusion Medicine Center at Florida Blood Services Marjorie Doty 727-568-5433 ext. 1514 [email protected] www.fbsblood.org : Univ. of Texas Health Science Center at San Antonio Linda Myers 210-731-5526 [email protected] www.sbbofsa.org  University of Texas Medical Branch at Galveston Janet Vincent 409-772-3055 [email protected] www.utmb.edu/sbb : University of Texas SW Medical Center Lesley Lee 214-648-1785 [email protected] www.utsouthwestern.edu/education/school-of-health-professions/ : programs/certificate-programs/medical-laboratory-sciences/index.html Revised February 2013

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 43 Immunohematology Instructions for Authors | New Blood Group Allele Reports

A. For describing an allele which has not been described in a peer-reviewed publication and for which an allele name or provisional allele name has been assigned by the ISBT Working Party on Blood Group Allele Terminology (http://www.isbtweb.org/working-parties/red-cell-immunogenetics-and-blood-group-terminology/blood-group- terminology/blood-group-allele-terminology/)

B. Preparation 1. Title: Allele Name (Allele Detail) ex. RHCE*01.01 (RHCE*ce48C) 2. Author Names (initials and last name of each (no degrees, ALL CAPS)

C. Text 1. Case Report i. Clinical and immunohematologic data ii. Race/ethnicity and country of origin of proband, if known 2. Materials and Methods Description of appropriate controls, procedures, methods, equipment, reagents, etc. Equipment and reagents should be identified in parentheses by model or lot and manufacturer’s name, city, and state. Do not use patient names or hospital numbers. 3. Results Complete the Table Below: Phenotype Allele Name Nucleotide(s) Exon(s) Amino Acid(s) Allele Detail References e weak RHCE*01.01 48G>C 1 Trp16Cys RHCE*ce48C 1

Column 1: Describe the immunohematologic phenotype (ex. weak or negative for an antigen). Column 2: List the allele name or provisional allele name. Column 3: List the nucleotide number and the change, using the reference sequence (see ISBT Blood Group Allele Terminology Pages for reference sequence ID). Column 4: List the exons where changes in nucleotide sequence were detected. Column 5: List the amino acids that are predicted to be changed, using the three-letter amino acid code. Column 6: List the non-consensus nucleotides after the gene name and asterisk. Column 7: If this allele was described in a meeting abstract, please assign a reference number and list in the Reference section. 4. Additional Information i. Indicate whether the variant is listed in the dbSNP database (http://www.ncbi.nlm.nih.gov/snp/); if so, provide rs number and any population frequency information, if available. ii. Indicate whether the authors performed any population screening and if so, what the allele and genotype frequencies were. iii. Indicate whether the authors developed a genotyping assay to screen for this variant and if so, describe in detail here. iv. Indicate whether this variant was found associated with other variants already reported (ex. RHCE*ce48C,1025T is often linked to RHD*DIVa-2)

D. Acknowledgments

E. References

F. Author Information List first name, middle initial, last name, highest degree, position held, institution and department, and complete address (including ZIP code) for all authors. List country when applicable.

44 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 Immunohematology Instructions for Authors

I. GENERAL INSTRUCTIONS b. Use short headings for each column needed and capitalize first letter of first Before submitting a manuscript, consult current issues of Immunohematology for style. word. Omit vertical lines. Number the pages consecutively, beginning with the title page. c. Place explanation in footnotes (sequence: *, †, ‡, §, ¶, **, ††). 8. Figures II. SCIENTIFIC ARTICLE, REVIEW, OR CASE REPORT WITH a. Figures can be submitted either by e-mail or as photographs (5 ×7″ glossy). LITERATURE REVIEW b. Place caption for a figure on a separate page (e.g. Fig. 1 Results of…), ending A. Each component of the manuscript must start on a new page in the following with a period. If figure is submitted as a glossy, place first author’s name and order: figure number on back of each glossy submitted. 1. Title page c. When plotting points on a figure, use the following symbols if possible: 2. Abstract l l s s n n. 3. Text 9. Author information 4. Acknowledgments a. List first name, middle initial, last name, highest degree, position held, 5. References institution and department, and complete address (including ZIP code) for all 6. Author information authors. List country when applicable. Provide e-mail addresses of all authors. 7. Tables 8. Figures III. EDUCATIONAL FORUM B. Preparation of manuscript A. All submitted manuscripts should be approximately 2000 to 2500 words with 1. Title page pertinent references. Submissions may include: a. Full title of manuscript with only first letter of first word capitalized (bold 1. An immunohematologic case that illustrates a sound investigative approach with title) clinical correlation, reflecting appropriate collaboration to sharpen problem solving b. Initials and last name of each author (no degrees; all CAPS), e.g., M.T. JONES, skills J.H. BROWN, AND S.R. SMITH 2. Annotated conference proceedings c. Running title of ≤40 characters, including spaces B. Preparation of manuscript d. Three to ten key words 1. Title page 2. Abstract a. Capitalize first word of title. a. One paragraph, no longer than 300 words b. Initials and last name of each author (no degrees; all CAPs) b. Purpose, methods, findings, and conclusion of study 2. Text 3. Key words a. Case should be written as progressive disclosure and may include the a. List under abstract following headings, as appropriate 4. Text (serial pages): Most manuscripts can usually, but not necessarily, be divided i. Clinical Case Presentation: Clinical information and differential diagnosis into sections (as described below). Survey results and review papers may need ii. Immunohematologic Evaluation and Results: Serology and molecular individualized sections testing a. Introduction — Purpose and rationale for study, including pertinent iii. Interpretation: Include interpretation of laboratory results, correlating background references with clinical findings b. Case Report (if indicated by study) — Clinical and/or hematologic data and iv. Recommended Therapy: Include both transfusion and nontransfusion- background serology/molecular based therapies c. Materials and Methods — Selection and number of subjects, samples, items, v. Discussion: Brief review of literature with unique features of this case etc. studied and description of appropriate controls, procedures, methods, vi. Reference: Limited to those directly pertinent equipment, reagents, etc. Equipment and reagents should be identified in vii. Author information (see II.B.9.) parentheses by model or lot and manufacturer’s name, city, and state. Do not viii. Tables (see II.B.7.) use patient’s names or hospital numbers. d. Results — Presentation of concise and sequential results, referring to IV. LETTER TO THE EDITOR pertinent tables and/or figures, if applicable A. Preparation e. Discussion — Implication and limitations of the study, links to other studies; if 1. Heading (To the Editor) appropriate, link conclusions to purpose of study as stated in introduction 2. Title (first word capitalized) 5. Acknowledgments: Acknowledge those who have made substantial contributions 3. Text (written in letter [paragraph] format) to the study, including secretarial assistance; list any grants. 4. Author(s) (type flush right; for first author: name, degree, institution, address 6. References [including city, state, Zip code and country]; for other authors: name, degree, a. In text, use superscript, Arabic numbers. institution, city and state) b. Number references consecutively in the order they occur in the text. 5. References (limited to ten) 7. Tables 6. Table or figure (limited to one) a. Head each with a brief title; capitalize the first letter of first word (e.g., Table 1. Results of…) use no punctuation at the end of the title. Send all manuscripts by e-mail to [email protected]

IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015 45 Journal of Blood Group Serology and Molecular Genetics

Published quarterly by The American National Red Cross

Subscription Application

United States: Institution . . $100 Individual . . $50 Students . . $40 (free for 1 year with letter of validation)

Outside United States: Institution . . $100 Individual . . $60 Students . . $50 (free for 1 year with letter of validation)

NAME Degree(s)

ORGANIZATION

DEPT/DIV

STREET

CITY, STATE, ZIP CODE, COUNTRY

Check if home address used Check enclosed*

Card Number: Security Code: Exp. Date: /

*Make check payable in U.S. dollars to THE AMERICAN RED CROSS. Mail this card in an envelope addressed to: Immunohematology, P.O. Box 40325, Philadelphia, PA 19106

THIS FORM MUST ACCOMPANY PAYMENT.

**Billing information may be emailed to: [email protected] or via phone to Marge Manigly at 215-451-4902

46 IMMUNOHEMATOLOGY, Volume 31, Number 1, 2015

NON PROFIT U.S. POSTAGE PAID Musser Blood Center AMERICAN 700 Spring Garden Street RED CROSS Philadelphia, PA 19123-3594

(Place Label Here)