DOCSLIB.ORG

Human Urinary Exosomes As Innate Immune Effectors

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Human Urinary Exosomes As Innate Immune Effectors BASIC RESEARCH www.jasn.org Human Urinary Exosomes as Innate Immune Effectors † † ‡ Thomas F. Hiemstra,* Philip D. Charles, Tannia Gracia, Svenja S. Hester,§ † ‡ | Laurent Gatto, Rafia Al-Lamki,* R. Andres Floto,* Ya Su, Jeremy N. Skepper, † ‡ Kathryn S. Lilley, and Fiona E. Karet Frankl *Department of Medicine, †Cambridge Centre for Proteome Research and Cambridge Systems Biology Centre, Department of Biochemistry, ‡Department of Medical Genetics, and |Multi-Imaging Centre, Department of Anatomy, University of Cambridge, Cambridge, United Kingdom; and §Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom ABSTRACT Exosomes are small extracellular vesicles, approximately 50 nm in diameter, derived from the endocytic pathway and released by a variety of cell types. Recent data indicate a spectrum of exosomal functions, including RNA transfer, antigen presentation, modulation of apoptosis, and shedding of obsolete protein. Exosomes derived from all nephron segments are also present in human urine, where their function is unknown. Although one report suggested in vitro uptake of exosomes by renal cortical collecting duct cells, most studies of human urinary exosomes have focused on biomarker discovery rather than exosome function. Here, we report results from in-depth proteomic analyses and EM showing that normal human urinary exosomes are significantly enriched for innate immune proteins that include antimicrobial proteins and peptides and bacterial and viral receptors. Urinary exosomes, but not the prevalent soluble urinary protein uromodulin (Tamm–Horsfall protein), potently inhibited growth of pathogenic and commensal Escherichia coli and induced bacterial lysis. Bacterial killing depended on exosome structural integrity and occurred optimally at the acidic pH typical of urine from omnivorous humans. Thus, exosomes are innate immune effectors that contribute to host defense within the urinary tract. J Am Soc Nephrol 25: 2017–2027, 2014. doi: 10.1681/ASN.2013101066 Exosomes form as intraluminal vesicles of multi- every cell type along the nephron.13,14 The array of vesicular bodies (MVBs), contain membrane and functions ascribed to exosomes in other tissues has cytoplasmic proteins, have a cytoplasmic-side in- kindled recent interest in the functional significance ward membrane orientation, and are released intact of urinary exosomes. Hogan et al.13 suggested inter- into the extracellular space (Figure 1A). First de- action of exosome-like vesicles with primary cilia of scribed in maturing ovine reticulocytes,1 exosomes renal epithelial cells, and Street and coworkers15 are released by many cell types2 and have been con- showed in vitro uptake of exosomes by a renal cortical ventionally regarded as a vehicle for shedding ob- solete protein. However, emerging evidence has revealed a variety of exosomal functions, including Received October 11, 2013. Accepted January 6, 2014. 3 the intercellular transfer of membrane receptors Published online ahead of print. Publication date available at 4–6 7 and RNA, induction of immunity, antigen pre- www.jasn.org. sentation,8 modulation of bone mineralization,9 Correspondence: Prof. Fiona E. Karet Frankl, Department of 10 and antiapoptotic responses. Medical Genetics, University of Cambridge, Cambridge Institute Nanovesicles were first shown in human urine by for Medical Research, Cambridge Biomedical Campus Box 139, Kanno and colleagues11 and subsequently, were Hills Road, Cambridge CB2 0XY, UK, or Prof. Kathryn S. Lilley, Cambridge Centre for Proteomics and Cambridge Systems Bi- 12 shown to represent exosomes. Consistent with a ology Centre, Department of Biochemistry, University of Cambridge, renal tubular epithelial origin, renal tubular epithelial Cambridge CB2 1QR, UK. Email: [email protected] or fek1000@ cells contain MVBs at the apical surface, and urine cam.ac.uk exosomes contain apical membrane proteins from Copyright © 2014 by the American Society of Nephrology J Am Soc Nephrol 25: 2017–2027, 2014 ISSN : 1046-6673/2509-2017 2017 BASIC RESEARCH www.jasn.org Published reports of the urinary exoso- mal proteome have limited value in illumi- nating the potential functions of urinary exosomes for several reasons. First, protein identification by mass spectrometry (MS) has, until recently, yielded results with unacceptably low reproducibility and high false-positive rates,22,23 and previous re- ports are not free of these limitations. Sec- ond, studies have often aimed to maximize the number of protein identifications and hence, biomarker candidates rather than applying or reporting rigorous protein identification thresholds. Third, most have relied on pooled samples from up to six donors and have not reported interin- dividual variability or reproducibility. Here, we sought, for the first time, to ascribe functionality to human urinary exosomes. We initially performed rigorous, conservative tandem MS analysis of sepa- rate human urinary exosomal samples to allow enrichment scoring24 to elucidation of urine exosomal function. RESULTS Exosomal samples were obtained from 10 healthy volunteers (five men and five women) ages 23–36 years. Nine subjects were Caucasian, and one man was Mauri- Figure 1. Vesicles isolated from human urine are consistent with exosomes. (A) tian. Samples prepared from 455628 ml sec- – Exosomes are derived from the endocytic pathway (1 4) forming through invagination ond morning void contained 0.5460.18 mg of the limiting membrane of the MVB (3). They are released into the urinary space from protein/ml urine. Exosomal integrity was renal tubular epithelial cells through fusion of the MVB with the apical plasma mem- fi fi fi con rmed by the electron microscopy brane (4). (B and C) Exosomal isolation was con rmed by the identi cation by negative 6 stain EM of nanovesicles (black arrows; characteristic mean 50-nm size distribution. (D) (EM) demonstration of 54.5 14-nm ves- fi Uromodulin (white streaks in B and dark in C; open arrows in B and C) cofractionated icles (Figure 1, B and D), the identi ca- with exosomes but was confirmed to be extraexosomal (5 nm gold-labeled; white tion of known exosomal markers TSG101, arrows in C). (E) Western blot confirmed the presence of known exosomal constituents enolase-1, CD63, podocin, and aquaporin-2 in vesicle preparations but did not confirm them in precipitated protein from exosome- by Western blot and immunogold EM depleted urine. (F) Immuno-EM with 5 (TSG101 and CD63) or 15 nm (AQP2) gold (Figure 1, E and F), and the confirmation particle-labeled antibodies showed vesicular residency of known exosomal con- of a cytoplasmic side inward membrane ori- stituents (arrows). Vesicles were nonpermeabilized; thus, positive staining with an anti- entation (Figure 1F). CD63 antibody directed against an extracellular epitope indicated the cytoplasmic We applied a number of methodological side inward membrane orientation characteristic of exosomes. EDUP, exosome-depleted approaches to overcome limitations of pre- urine protein; HKM, human kidney membrane; MW, molecular weight; TSG101, tumour susceptibility gene 101. vious studies. (1) Samples were not pooled but analyzed separately. (2)MSwasper- formed without and with a uromodulin ex- collecting duct cell line, leading to speculation that exosomes clusion list25 on a high-sensitivity instrument. (3) Data were may provide intrarenal proximal-to-distal transapical renal tu- analyzed using stringent and novel bioinformatics ap- bular epithelial signaling through RNA transfer. However, most proaches26 (Supplemental Material). (4) All ambiguous pep- studies on urine exosomes to date have focused on biomarker tides were excluded unless matched only to products of a discovery, resulting in the publication of several urine exosome single gene. From 50 mg exosomal protein per subject, we protein compendia.12,13,16–21 identified 601 unique proteins by MS, with a median 2018 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 2017–2027, 2014 www.jasn.org BASIC RESEARCH 2 2 (interquartile range [IQR]) P value of 1.17310 13 (4.08310 4) suggesting a potential role in the targeting of RNA to exo- (Supplemental Table 1). Importantly, the use of a fixed uromodulin somes,4 or involved in innate immunity and the response to exclusion list25 and a posterior error-derived protein type I infection. Uromodulin was present in all 10 samples, consis- error estimator termed espresso (Supplemental Material) un- tent with previous reports, but confirmed as extraexosomal by masked proteins that would not otherwise have been evident immunogold EM (Figure 1D). All MS data have been depos- (Figure 2A). The complete proteome included the known exo- ited with the ProteomeXchange consortium repository somal markers TSG101, CD14, and CD59. However, 307 (51%) (http://proteomecentral.proteomexchange.org; reference had not previously been identified in exosomes from any source PXD000117). compared with the EXOCARTAdatabase.27 There was only min- Using enrichment scoring (ES),24 we found, in addition to imal overlap with the soluble urinary proteome (Supplemental the expected enrichment for cytoskeletal proteins (ES=10.45) Figure 1). and proteins involved in the endocytic pathway and vesicle As previously reported for exosomes,12 the cellular origin of formation (ES=8.06), a very significant enrichment for pro- the majority of identified proteins was in vesicles or the endo- teins involved in immunity and host defense (ES=3.27, cytic vesicular pathway, cytoplasm, plasma membrane, and P,0.001). The
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Duffy, and Mnss Group Systems
    Blood Groups – Duffy, and MNSs Group Systems Qun Lu, MD Assistant Professor Division of Transfusion Medicine Department of Pathology and Laboratory Medicine UCLA, School of Medicine Los Angeles, California 2009-03-12 Duffy Blood Group System History . 1950: Mrs. Duffy, a multiply transfused hemophiliac woman, developed an antibody not reacting with the known RBC antigens. Corresponding antigen was named after Mrs. Duffy . 1951: Fyb antibody was described in a woman with 3 pregnancies. 1955: Majority of blacks tested Fy(a-b-) . 1975: Fy(a-b-) RBCs were shown to resist infection by malaria organism Plasmodium vivax. Later: more Duffy antigens (Fy3, Fy4, Fy5, Fy6) were discovered . ISBT: 008 for the Duffy Blood Group Duffy Antigens . Most common: Fya and Fyb. Present at 6 weeks of gestation, well developed at birth – anti- Fy can cause hemolytic disease of newborn . Duffy antigens can be destroyed by enzymes such as ficin, papain, bromelain, chymotrypsin, ZZAP . When compared to Rh or Kell antigens, Duffy antigens are not very immunogenic. So, anti-Fya or anti-Fyb is not common. Fy (a-b-) is not Fy null, but homozygous for Fyb gene, they express Fyb antigen in other tissues, but not on RBCs → only will produce anti-Fya, not anti-Fyb. Fy (a-b-) is negative for Fy6 antigen which is the receptor for P. vivax (Fy6 is + when Fya + or Fyb+) Duffy Antigens . Phenotype Frequencies Chinese Phenotype Whites % Blacks % % Fy (a+b-) 17 9 90.8 Fy (a+b+) 49 1 8.9 Fy (a-b+) 34 22 0.3 Fy (a-b-) rare 68 0 White donor population: Fya: 66% Caucasians, 10% Blacks, 99% Asians Fya – units: 35% Fyb: 83% Caucasians, 23% Blacks, 18.5% Asians Fyb – units: 15% Fy3: 100% Caucasians, 32% Blacks, 99.9% Asians Duffy Antigens .
    [Show full text]
  • R&D Day for Investors and Analysts
    R&D Day for Investors and Analysts November 16, 2020 Seagen 2020 R&D Day Clay Siegall, Ph.D. Roger Dansey, M.D. Nancy Whiting, Pharm.D Megan O’Meara, M.D. Shyra Gardai, Ph.D. President & Chief Chief Medical Officer EVP, Corporate Strategy VP, Early Stage Executive Director, Executive Officer Alliances and Development Immunology Communications 2 Forward-Looking Statements Certain of the statements made in this presentation are forward looking, such as those, among others, relating to the Company’s potential to achieve the noted development and regulatory milestones in 2021 and in future periods; anticipated activities related to the Company’s planned and ongoing clinical trials; the potential for the Company’s clinical trials to support further development, regulatory submissions and potential marketing approvals in the U.S. and other countries; the opportunities for, and the therapeutic and commercial potential of ADCETRIS, PADCEV, TUKYSA, tisotumab vedotin and ladiratuzumab vedotin and the Company’s other product candidates and those of its licensees and collaborators; the potential to submit a BLA for accelerated approval of tisotumab vedotin; the potential for data from the EV-301 and EV-201 cohort 2 clinical trials to support additional regulatory approvals of PADCEV; the potential for the approval of TUKYSA by the EMA; the therapeutic potential of the Company’s SEA technology and of the Company’s early stage pipeline agents including SGN-B6A, SGN-STNV, SGN-CD228A, SEA-CD40, SEA-TGT, SEA-BCMA and SEA-CD70; as well as other statements that are not historical fact. Actual results or developments may differ materially from those projected or implied in these forward-looking statements.
    [Show full text]
  • Supplemental Figure 1. Vimentin
    Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
    [Show full text]
  • Universidade Estadual De Campinas Instituto De Biologia
    UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA CAMPINAS 2016 1 VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA Dissertação apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do Título de Mestra em Biologia Funcional e Molecular na área de concentração de Bioquímica. Dissertation presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Master in Functional and Molecular Biology, in the area of Biochemistry. ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA DISSERTAÇÃO DEFENDIDA PELA ALUNA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA E ORIENTADA PELO DANIEL MARTINS-DE-SOUZA. Orientador: Daniel Martins-de-Souza CAMPINAS 2016 2 Agência(s) de fomento e nº(s) de processo(s): CNPq, 151787/2F2014-0 Ficha catalográfica Universidade Estadual de Campinas Biblioteca do Instituto de Biologia Mara Janaina de Oliveira - CRB 8/6972 Saia-Cereda, Verônica Aparecida Monteiro, 1988- Sa21p O proteoma do corpo caloso da esquizofrenia / Verônica Aparecida Monteiro Saia Cereda. – Campinas, SP : [s.n.], 2016. Orientador: Daniel Martins de Souza. Dissertação (mestrado) – Universidade Estadual de Campinas, Instituto de Biologia. 1. Esquizofrenia. 2. Espectrometria de massas. 3. Corpo caloso.
    [Show full text]
  • Oral Absorption of Peptides and Nanoparticles Across the Human Intestine: Opportunities, Limitations and Studies in Human Tissues☆
    Advanced Drug Delivery Reviews 106 (2016) 256–276 Contents lists available at ScienceDirect Advanced Drug Delivery Reviews journal homepage: www.elsevier.com/locate/addr Oral absorption of peptides and nanoparticles across the human intestine: Opportunities, limitations and studies in human tissues☆ P. Lundquist, P. Artursson ⁎ Department of Pharmacy, Uppsala University, Box 580, SE-752 37 Uppsala, Sweden article info abstract Article history: In this contribution, we review the molecular and physiological barriers to oral delivery of peptides and nanopar- Received 2 May 2016 ticles. We discuss the opportunities and predictivity of various in vitro systems with special emphasis on human Received in revised form 2 July 2016 intestine in Ussing chambers. First, the molecular constraints to peptide absorption are discussed. Then the phys- Accepted 8 July 2016 iological barriers to peptide delivery are examined. These include the gastric and intestinal environment, the Available online 3 August 2016 mucus barrier, tight junctions between epithelial cells, the enterocytes of the intestinal epithelium, and the Keywords: subepithelial tissue. Recent data from human proteome studies are used to provide information about the protein fi Oral drug delivery expression pro les of the different physiological barriers to peptide and nanoparticle absorption. Strategies that Peptide drugs have been employed to increase peptide absorption across each of the barriers are discussed. Special consider- Nanoparticles ation is given to attempts at utilizing endogenous transcytotic pathways. To reliably translate in vitro data on Ussing chamber peptide or nanoparticle permeability to the in vivo situation in a human subject, the in vitro experimental system Peptide permeability needs to realistically capture the central aspects of the mentioned barriers.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • A Cell Line P53 Mutation Type UM
    A Cell line p53 mutation Type UM-SCC 1 wt UM-SCC5 Exon 5, 157 GTC --> TTC Missense mutation by transversion (Valine --> Phenylalanine UM-SCC6 wt UM-SCC9 wt UM-SCC11A wt UM-SCC11B Exon 7, 242 TGC --> TCC Missense mutation by transversion (Cysteine --> Serine) UM-SCC22A Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC22B Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC38 Exon 5, 132 AAG --> AAT Missense mutation by transversion (Lysine --> Asparagine) UM-SCC46 Exon 8, 278 CCT --> CGT Missense mutation by transversion (Proline --> Alanine) B 1 Supplementary Methods Cell Lines and Cell Culture A panel of ten established HNSCC cell lines from the University of Michigan series (UM-SCC) was obtained from Dr. T. E. Carey at the University of Michigan, Ann Arbor, MI. The UM-SCC cell lines were derived from eight patients with SCC of the upper aerodigestive tract (supplemental Table 1). Patient age at tumor diagnosis ranged from 37 to 72 years. The cell lines selected were obtained from patients with stage I-IV tumors, distributed among oral, pharyngeal and laryngeal sites. All the patients had aggressive disease, with early recurrence and death within two years of therapy. Cell lines established from single isolates of a patient specimen are designated by a numeric designation, and where isolates from two time points or anatomical sites were obtained, the designation includes an alphabetical suffix (i.e., "A" or "B"). The cell lines were maintained in Eagle's minimal essential media supplemented with 10% fetal bovine serum and penicillin/streptomycin.
    [Show full text]
  • Dual Proteome-Scale Networks Reveal Cell-Specific Remodeling of the Human Interactome
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Dual Proteome-scale Networks Reveal Cell-specific Remodeling of the Human Interactome Edward L. Huttlin1*, Raphael J. Bruckner1,3, Jose Navarrete-Perea1, Joe R. Cannon1,4, Kurt Baltier1,5, Fana Gebreab1, Melanie P. Gygi1, Alexandra Thornock1, Gabriela Zarraga1,6, Stanley Tam1,7, John Szpyt1, Alexandra Panov1, Hannah Parzen1,8, Sipei Fu1, Arvene Golbazi1, Eila Maenpaa1, Keegan Stricker1, Sanjukta Guha Thakurta1, Ramin Rad1, Joshua Pan2, David P. Nusinow1, Joao A. Paulo1, Devin K. Schweppe1, Laura Pontano Vaites1, J. Wade Harper1*, Steven P. Gygi1*# 1Department of Cell Biology, Harvard Medical School, Boston, MA, 02115, USA. 2Broad Institute, Cambridge, MA, 02142, USA. 3Present address: ICCB-Longwood Screening Facility, Harvard Medical School, Boston, MA, 02115, USA. 4Present address: Merck, West Point, PA, 19486, USA. 5Present address: IQ Proteomics, Cambridge, MA, 02139, USA. 6Present address: Vor Biopharma, Cambridge, MA, 02142, USA. 7Present address: Rubius Therapeutics, Cambridge, MA, 02139, USA. 8Present address: RPS North America, South Kingstown, RI, 02879, USA. *Correspondence: [email protected] (E.L.H.), [email protected] (J.W.H.), [email protected] (S.P.G.) #Lead Contact: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Steroid-Dependent Regulation of the Oviduct: a Cross-Species Transcriptomal Analysis
    University of Kentucky UKnowledge Theses and Dissertations--Animal and Food Sciences Animal and Food Sciences 2015 Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis Katheryn L. Cerny University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Cerny, Katheryn L., "Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis" (2015). Theses and Dissertations--Animal and Food Sciences. 49. https://uknowledge.uky.edu/animalsci_etds/49 This Doctoral Dissertation is brought to you for free and open access by the Animal and Food Sciences at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Animal and Food Sciences by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • The Gerbich Blood Group System: a Review
    Review The Gerbich blood group system: a review P.S. Walker and M.E. Reid Antigens in the Gerbich blood group system are expressed on glycoproteins are also known as CD236R, and they attach glycophorin C (GPC) and glycophorin D (GPD), which are both to the RBC membrane through an interaction with protein encoded by a single gene, GYPC. The GYPC gene is located on 4.1R and p55. GPC and GPD contain three domains: an ex- the long arm of chromosome 2, and Gerbich antigens are in- tracellular NH2 domain, a transmembrane domain, and an herited as autosomal dominant traits. There are 11 antigens in intracellular or cytoplasmic COOH domain (Figure 1). GPC the Gerbich blood group system, six of high prevalence (Ge2, Ge3, Ge4, GEPL [Ge10*], GEAT [Ge11*], GETI [Ge12*]) and and GPD are encoded by the same gene, GYPC. When the five of low prevalence (Wb [Ge5], Lsa [Ge6], Ana [Ge7], Dha fi rst AUG initiation codon is used, GPC is encoded, whereas [Ge8], GEIS [Ge9]). GPC and GPD interact with protein 4.1R, when the second AUG is used, GPD is encoded. Thus, GPD contributing stability to the RBC membrane. Reduced lev- is a shorter version of GPC, and the amino acids in GPD els of GPC and GPD are associated with hereditary elliptocy- are identical to those found in GPC but lacking the fi rst 21 tosis, and Gerbich antigens act as receptors for the malarial amino acids at the N-terminal of GPC.9,10 parasite Plasmodium falciparum. Anti-Ge2 and anti-Ge3 have caused hemolytic transfusion reactions, and anti-Ge3 has pro- duced hemolytic disease of the fetus and newborn (HDFN).
    [Show full text]