DOCSLIB.ORG

Protein 4.1R-Dependent Multiprotein Complex: New Insights Into the Structural Organization of the Red Blood Cell Membrane

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Protein 4.1R-Dependent Multiprotein Complex: New Insights Into the Structural Organization of the Red Blood Cell Membrane Protein 4.1R-dependent multiprotein complex: New insights into the structural organization of the red blood cell membrane Marcela Salomao*, Xihui Zhang*, Yang Yang*, Soohee Lee†, John H. Hartwig‡, Joel Anne Chasis§, Narla Mohandas*, and Xiuli An*¶ *Red Cell Physiology Laboratory and †Membrane Biochemistry Laboratory, New York Blood Center, New York, NY 10065; ‡Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; and §Life Sciences Division, Lawrence Berkeley National Laboratory, University of California, Berkeley, CA 94720 Communicated by Joseph F. Hoffman, Yale University School of Medicine, New Haven, CT, April 3, 2008 (received for review January 4, 2008) Protein 4.1R (4.1R) is a multifunctional component of the red cell The membrane-skeletal network is coupled to the lipid bilayer membrane. It forms a ternary complex with actin and spectrin, which through transmembrane proteins. One such linkage is generated by defines the nodal junctions of the membrane-skeletal network, and ankyrin, which forms a bridge between spectrin and band 3 tet- its attachment to the transmembrane protein glycophorin C creates a ramers (14–17). Band 3 also contains a binding site for carbonic bridge between the protein network and the membrane bilayer. We anhydrase II at its C-terminal cytoplasmic domain (18) and binding now show that deletion of 4.1R in mouse red cells leads to a large sites for glycolytic enzymes, hemoglobin, and protein 4.2 at its diminution of actin accompanied by extensive loss of cytoskeletal N-terminal cytoplasmic domain (19). In addition, there is a clear lattice structure, with formation of bare areas of membrane. Whereas interaction between glycophorin A (GPA) and band 3 (20–23). The band 3, the preponderant transmembrane constituent, and proteins association of these proteins with band 3 forms the band-3-based known to be associated with it are present in normal or increased complex. In addition to the band 3 complex, studies using human amounts, glycophorin C is missing and XK, Duffy, and Rh are much Rh-null erythrocytes suggested the existence of the Rh protein reduced in the 4.1R-deficient cells. The inference that these are complex comprising RhAG, Rh, CD47, LW, and GPB (24, 25). associated with 4.1R was borne out by the results of in vitro pull- More recently, the finding that components of both the band 3 down assays. Furthermore, whereas Western blot analysis showed complex and the Rh complex are absent or reduced in band-3- normal levels of band 3 and Kell, flow cytometric analysis using an deficient erythrocytes led to the concept of a band-3-based mac- antibody against the extracellular region of band 3 or Kell revealed romolecular complex (26). reduction of these two proteins, suggesting a conformational change A second membrane skeleton–bilayer link, consisting of a nexus of band 3 and Kell epitopes. Taken together, we suggest that 4.1R among 4.1R, p55, and the transmembrane glycophorin C (GPC), is organizes a macromolecular complex of skeletal and transmembrane located at the network junctions (27–29). GPC and p55 are missing proteins at the junctional node and that perturbation of this macro- from 4.1RϪ/Ϫ mouse red cells (30) and are much reduced in human molecular complex not only is responsible for the well characterized 4.1R-deficient red cells (31, 32). These proteins, as well as some membrane instability but may also remodel the red cell surface. transmembrane blood group proteins, Duffy, Lu, and CD44, and the glucose transporter GLUT1 are found in normal or elevated macromolecular complex ͉ cytoskeleton amounts in band-3-deficient red cells (26). The work described here was undertaken to examine whether and to what extent 4.1R plays n essential attribute of the red cell is its ability to undergo a part in the formation of membrane structures other than the Ϫ/Ϫ Aextensive and repeated deformations while maintaining struc- network junctions. The results, based on the study of 4.1R mouse tural integrity. The cell owes this mechanical resilience to the red cells, have allowed us to identify a 4.1R-based macromolecular membrane-associated protein skeleton (1, 2). This has the form of complex and to develop a more refined model of red cell membrane a lattice, made up of spectrin tetramers, formed by self-association organization. ␣␤ of spectrin heterodimers (3). The tetramers are attached at their Results ends to predominantly sixfold junctions consisting of short F-actin filaments (protofilaments) and several actin-binding proteins, in- Specificity of Various Anti-Mouse Antibodies. To compare the ex- pression of red cell membrane proteins between wild-type and cluding 4.1R, protein 4.9 (dematin), adducin, tropomyosin, and Ϫ/Ϫ tropomodulin (4). Defects or deficiency of components of the 4.1R cells, we first needed to generate a panel of various junctional complexes, and especially of 4.1R, lead to instability of antibodies against mouse transmembrane and cytoskeletal pro- the network and consequently of the cell. This reveals itself in teins. For transmembrane proteins we usually generate two anti- progressive fragmentation in vivo (5). bodies, one against the extracellular region and one against the In addition to the above-mentioned cytoskeletal proteins, a cytoplasmic part. The antigens used for antibody production are number of transmembrane proteins that specify blood group anti- listed in supporting information (SI) Table S1. All of the antibodies gens have also been purified and characterized biochemically. are raised in rabbit with the exception of monoclonal anti-Kell These include band 3, glycophorin A, glycophorin B, glycophorin C, antibody, which was generated in mice using red cell as antigen. The RhAG, Rh, Duffy, Lu, LW, CD44, CD47, Kell, and XK (6). These specificity of our antibodies was confirmed by Western blot analysis transmembrane proteins exhibit diverse functions. For example, band 3 functions as an anion exchanger. Rh/RhAG are probably gas Author contributions: S.L., J.A.C., N.M., and X.A. designed research; M.S., X.Z., Y.Y., S.L., and transporters although there is some controversy regarding whether J.H.H. performed research; M.S., S.L., J.H.H., J.A.C., N.M., and X.A. analyzed data; and M.S., they transport ammonia or carbon dioxide (7, 8). Duffy serves as a N.M., and X.A. wrote the paper. chemokine receptor and is also a receptor for the malarial parasite The authors declare no conflict of interest. Plasmodium vivax (9, 10). Lu, LW, and CD44 are proteins that are ¶To whom correspondence should be addressed at: Red Cell Physiology Laboratory, 310 involved in adhesive interactions (11). CD47 can function as a East 67th Street, New York, NY 10065. E-mail: [email protected]. marker of self on erythrocytes by binding to the inhibitory receptor This article contains supporting information online at www.pnas.org/cgi/content/full/ SIRP␣ (12). Kell possess endothin-3-converting enzyme activity 0803225105/DCSupplemental. (13), but the function of XK remains to be defined. © 2008 by The National Academy of Sciences of the USA 8026–8031 ͉ PNAS ͉ June 10, 2008 ͉ vol. 105 ͉ no. 23 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0803225105 Downloaded by guest on September 26, 2021 and thalassemia (data not shown). Another major skeleton protein, ankyrin, was unchanged. Structural Consequences of 4.1R Deletion. Having discovered the significant reduction of actin in 4.1R-deficient red cells, we then examined the structural consequences of 4.1R deletion. Staining of fixed red cells with fluorescent phalloidin demonstrates that F-actin is indeed much sparser on the 4.1RϪ/Ϫ cell membranes (Fig. S2). To determine whether F-actin is reduced or redistributed, we quanti- tated the fluorescence levels (pixel intensity/unit area) and found an Ϸ30% reduction in phalloidin levels in 4.1R-null red cells when compared with wild-type erythrocytes [knockout, 17,958 Ϯ 1,783; wild type, 25,479 Ϯ 1,858 (n ϭ 8, P ϭ 0.0000004)]. To establish how Fig. 1. Immunoblots of membrane skeletal proteins in red cells of 4.1Rϩ/ϩ Ϫ/Ϫ the actin deficiency affects the structure of the network, we and 4.1R mice. Blots of SDS/PAGE of total membrane protein were probed examined the membranes by electron microscopy under negative with antibodies against the indicated proteins. Note the absence of 4.1R, as well as p55 in the 4.1R-deficient cells, the reduced actin concentration, and the stain. Fig. 2 demonstrates that the regularity of the lattice is grossly elevated tropomyosin and adducin. disrupted, with large bare regions. It thus appears that many of the junctions that are normally present are missing in the mutant membranes. using corresponding knockout mice as negative controls. All anti- bodies generated recognize the corresponding mouse proteins, and Integral Membrane Proteins in 4.1R؊/؊ Cells. It has been shown that some also recognize the cognate human proteins. Fig. S1 demon- in both mouse and human band-3-deficient red cells the known or strates the specificity of a representative set of antibodies against surmised band-3-associated proteins, namely GPA, GPB, RhAG, mouse red cell proteins. Rh, CD47, and LW, are missing or greatly reduced. GPC, 4.1R, and p55, which are confined to the network junctions, are present in Analysis of Cytoskeletal Protein Components of 4.1R؊/؊ Red Cells by normal amounts, and so also are other transmembrane proteins Western Blot. We have previously shown that the membranes of (Duffy, Lu, GLUT1, LFA-3, and CD44) with no known cytoskel- mouse red cells lacking 4.1R have greatly impaired shear resistance eton interactions (26). We have used Western blots to compare the (30). The same is true of human 4.1R-deficient cells (5).
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Duffy, and Mnss Group Systems
    Blood Groups – Duffy, and MNSs Group Systems Qun Lu, MD Assistant Professor Division of Transfusion Medicine Department of Pathology and Laboratory Medicine UCLA, School of Medicine Los Angeles, California 2009-03-12 Duffy Blood Group System History . 1950: Mrs. Duffy, a multiply transfused hemophiliac woman, developed an antibody not reacting with the known RBC antigens. Corresponding antigen was named after Mrs. Duffy . 1951: Fyb antibody was described in a woman with 3 pregnancies. 1955: Majority of blacks tested Fy(a-b-) . 1975: Fy(a-b-) RBCs were shown to resist infection by malaria organism Plasmodium vivax. Later: more Duffy antigens (Fy3, Fy4, Fy5, Fy6) were discovered . ISBT: 008 for the Duffy Blood Group Duffy Antigens . Most common: Fya and Fyb. Present at 6 weeks of gestation, well developed at birth – anti- Fy can cause hemolytic disease of newborn . Duffy antigens can be destroyed by enzymes such as ficin, papain, bromelain, chymotrypsin, ZZAP . When compared to Rh or Kell antigens, Duffy antigens are not very immunogenic. So, anti-Fya or anti-Fyb is not common. Fy (a-b-) is not Fy null, but homozygous for Fyb gene, they express Fyb antigen in other tissues, but not on RBCs → only will produce anti-Fya, not anti-Fyb. Fy (a-b-) is negative for Fy6 antigen which is the receptor for P. vivax (Fy6 is + when Fya + or Fyb+) Duffy Antigens . Phenotype Frequencies Chinese Phenotype Whites % Blacks % % Fy (a+b-) 17 9 90.8 Fy (a+b+) 49 1 8.9 Fy (a-b+) 34 22 0.3 Fy (a-b-) rare 68 0 White donor population: Fya: 66% Caucasians, 10% Blacks, 99% Asians Fya – units: 35% Fyb: 83% Caucasians, 23% Blacks, 18.5% Asians Fyb – units: 15% Fy3: 100% Caucasians, 32% Blacks, 99.9% Asians Duffy Antigens .
    [Show full text]
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • The Gerbich Blood Group System: a Review
    Review The Gerbich blood group system: a review P.S. Walker and M.E. Reid Antigens in the Gerbich blood group system are expressed on glycoproteins are also known as CD236R, and they attach glycophorin C (GPC) and glycophorin D (GPD), which are both to the RBC membrane through an interaction with protein encoded by a single gene, GYPC. The GYPC gene is located on 4.1R and p55. GPC and GPD contain three domains: an ex- the long arm of chromosome 2, and Gerbich antigens are in- tracellular NH2 domain, a transmembrane domain, and an herited as autosomal dominant traits. There are 11 antigens in intracellular or cytoplasmic COOH domain (Figure 1). GPC the Gerbich blood group system, six of high prevalence (Ge2, Ge3, Ge4, GEPL [Ge10*], GEAT [Ge11*], GETI [Ge12*]) and and GPD are encoded by the same gene, GYPC. When the five of low prevalence (Wb [Ge5], Lsa [Ge6], Ana [Ge7], Dha fi rst AUG initiation codon is used, GPC is encoded, whereas [Ge8], GEIS [Ge9]). GPC and GPD interact with protein 4.1R, when the second AUG is used, GPD is encoded. Thus, GPD contributing stability to the RBC membrane. Reduced lev- is a shorter version of GPC, and the amino acids in GPD els of GPC and GPD are associated with hereditary elliptocy- are identical to those found in GPC but lacking the fi rst 21 tosis, and Gerbich antigens act as receptors for the malarial amino acids at the N-terminal of GPC.9,10 parasite Plasmodium falciparum. Anti-Ge2 and anti-Ge3 have caused hemolytic transfusion reactions, and anti-Ge3 has pro- duced hemolytic disease of the fetus and newborn (HDFN).
    [Show full text]
  • Flow Reagents Single Color Antibodies CD Chart
    CD CHART CD N° Alternative Name CD N° Alternative Name CD N° Alternative Name Beckman Coulter Clone Beckman Coulter Clone Beckman Coulter Clone T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells CD1a T6, R4, HTA1 Act p n n p n n S l CD99 MIC2 gene product, E2 p p p CD223 LAG-3 (Lymphocyte activation gene 3) Act n Act p n CD1b R1 Act p n n p n n S CD99R restricted CD99 p p CD224 GGT (γ-glutamyl transferase) p p p p p p CD1c R7, M241 Act S n n p n n S l CD100 SEMA4D (semaphorin 4D) p Low p p p n n CD225 Leu13, interferon induced transmembrane protein 1 (IFITM1). p p p p p CD1d R3 Act S n n Low n n S Intest CD101 V7, P126 Act n p n p n n p CD226 DNAM-1, PTA-1 Act n Act Act Act n p n CD1e R2 n n n n S CD102 ICAM-2 (intercellular adhesion molecule-2) p p n p Folli p CD227 MUC1, mucin 1, episialin, PUM, PEM, EMA, DF3, H23 Act p CD2 T11; Tp50; sheep red blood cell (SRBC) receptor; LFA-2 p S n p n n l CD103 HML-1 (human mucosal lymphocytes antigen 1), integrin aE chain S n n n n n n n l CD228 Melanotransferrin (MT), p97 p p CD3 T3, CD3 complex p n n n n n n n n n l CD104 integrin b4 chain; TSP-1180 n n n n n n n p p CD229 Ly9, T-lymphocyte surface antigen p p n p n
    [Show full text]
  • Quantitation of the Number of Molecules of Glycophorins C and D on Normal Red Blood Cells Using Radioiodinatedfab Fragments of Monoclonal Antibodies
    Quantitation of the Number of Molecules of Glycophorins C and D on Normal Red Blood Cells Using RadioiodinatedFab Fragments of Monoclonal Antibodies By Jon Smythe, Brigitte Gardner, andDavid J. Anstee Two rat monoclonal antibodies (BRAC 1 and BRAC 1 1 ) cytes. Fabfragments of BRAC 1 1 and ERIC 10 gave values have been produced. BRAC 1 recognizes an epitope com- of 143,000 molecules GPC per red blood cell (RBC). Fab mon to the human erythrocyte membrane glycoproteins fragments of BRAC1 gave 225,000 molecules of GPC and glycophorin C (GPC) and glycophorin D (GPD). BRAC 11 GPD per RBC. These results indicate that GPC and GPD is specific for GPC. Fabfragments of these antibodies and together are sufficiently abundantto provide membrane at- BRlC 10, a murine monoclonal anti-GPC,were radioiodin- tachment sites for all ofthe protein 4.1 in normal RBCs. ated and used in quantitative binding assays to measure 0 1994 by The American Societyof Hematology. the number of GPC and GPD molecules on normal erythro- HE SHAPE AND deformability of the mature human (200,000)" and those reported for GPC (50,000).7 This nu- Downloaded from http://ashpublications.org/blood/article-pdf/83/6/1668/612763/1668.pdf by guest on 24 September 2021 T erythrocyte is controlled by a flexible two-dimensional merical differencehas led to the suggestion that a significant lattice of proteins, which together comprise the membrane proportion of protein 4.1 in normal erythrocyte membranes skeleton.' The major components of the skeleton are spec- must be bound to sites other than GPC and GPD.3 The trin, actin, ankyrin, and protein 4.1.
    [Show full text]
  • Role of Active Contraction and Tropomodulins in Regulating Actin Filament Length and Sarcomere Structure in Developing Zebrafish Skeletal Muscle
    ORIGINAL RESEARCH published: 31 March 2016 doi: 10.3389/fphys.2016.00091 Role of Active Contraction and Tropomodulins in Regulating Actin Filament Length and Sarcomere Structure in Developing Zebrafish Skeletal Muscle Lise Mazelet 1, Matthew O. Parker 2, Mei Li 3, Anders Arner 3 and Rachel Ashworth 4* 1 School of Biological and Chemical Sciences, Queen Mary, University of London, London, UK, 2 School of Health Sciences and Social Work, University of Portsmouth, Portsmouth, UK, 3 Department of Physiology and Pharmacology, Karolinska Institutet, Stockholm, Sweden, 4 The Blizard Institute/Institute of Health Sciences Education, Barts and The London School of Medicine and Dentistry, London, UK Whilst it is recognized that contraction plays an important part in maintaining the structure and function of mature skeletal muscle, its role during development remains undefined. In this study the role of movement in skeletal muscle maturation was investigated in intact zebrafish embryos using a combination of genetic and pharmacological approaches. An immotile mutant line (cacnb1ts25) which lacks functional voltage-gated calcium channels (dihydropyridine receptors) in the muscle and pharmacological immobilization of embryos Edited by: with a reversible anesthetic (Tricaine), allowed the study of paralysis (in mutants and Catherine Coirault, anesthetized fish) and recovery of movement (reversal of anesthetic treatment). The Institut National de la Santé et de la Recherche Médicale, France effect of paralysis in early embryos (aged between 17 and 24 hours post-fertilization, hpf) Reviewed by: on skeletal muscle structure at both myofibrillar and myofilament level was determined Corrado Poggesi, using both immunostaining with confocal microscopy and small angle X-ray diffraction.
    [Show full text]
  • Introduction to the Rh Blood Group.Pdf
    Introduction to the Rhesus Blood Group Justin R. Rhees, M.S., MLS(ASCP)CM, SBBCM University of Utah Department of Pathology Medical Laboratory Science Program Objectives 1. Describe the major Rhesus (Rh) blood group antigens in terms of biochemical structure and inheritance. 2. Describe the characteristics of Rh antibodies. 3. Translate the five major Rh antigens, genotypes, and haplotypes from Fisher-Race to Wiener nomenclature. 4. State the purpose of Fisher-Race, Wiener, Rosenfield, and ISBT nomenclatures. Background . How did this blood group get its name? . 1937 Mrs. Seno; Bellevue hospital . Unknown antibody, unrelated to ABO . Philip Levine tested her serum against 54 ABO-compatible blood samples: only 13 were compatible. Rhesus (Rh) blood group 1930s several cases of Hemolytic of the Fetus and Newborn (HDFN) published. Hemolytic transfusion reactions (HTR) were observed in ABO- compatible transfusions. In search of more blood groups, Landsteiner and Wiener immunized rabbits with the Rhesus macaque blood of the Rhesus monkeys. Rhesus (Rh) blood group 1940 Landsteiner and Wiener reported an antibody that reacted with about 85% of human red cell samples. It was supposed that anti-Rh was the specificity causing the “intragroup” incompatibilities observed. 1941 Levine found in over 90% of erythroblastosis fetalis cases, the mother was Rh-negative and the father was Rh-positive. Rhesus macaque Rhesus (Rh) blood group Human anti-Rh and animal anti- Rh are not the same. However, “Rh” was embedded into blood group antigen terminology. The
    [Show full text]
  • Lineage-Specific Programming Target Genes Defines Potential for Th1 Temporal Induction Pattern of STAT4
    Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021 is online at: average * The Journal of Immunology published online 26 August 2009 from submission to initial decision 4 weeks from acceptance to publication J Immunol http://www.jimmunol.org/content/early/2009/08/26/jimmuno l.0901411 Temporal Induction Pattern of STAT4 Target Genes Defines Potential for Th1 Lineage-Specific Programming Seth R. Good, Vivian T. Thieu, Anubhav N. Mathur, Qing Yu, Gretta L. Stritesky, Norman Yeh, John T. O'Malley, Narayanan B. Perumal and Mark H. Kaplan Submit online. Every submission reviewed by practicing scientists ? is published twice each month by http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://www.jimmunol.org/content/suppl/2009/08/26/jimmunol.090141 1.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* • Why • • Material Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of October 1, 2021. Published August 26, 2009, doi:10.4049/jimmunol.0901411 The Journal of Immunology Temporal Induction Pattern of STAT4 Target Genes Defines Potential for Th1 Lineage-Specific Programming1 Seth R. Good,2* Vivian T. Thieu,2† Anubhav N. Mathur,† Qing Yu,† Gretta L.
    [Show full text]
  • Anti-Glycophorin C Antibody (ARG41471)
    Product datasheet [email protected] ARG41471 Package: 100 μl anti-Glycophorin C antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes Glycophorin C Tested Reactivity Hu Tested Application FACS, ICC/IF, IHC-P, IP, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name Glycophorin C Antigen Species Human Immunogen Synthetic peptide of Human Glycophorin C. Conjugation Un-conjugated Alternate Names Glycophorin-D; CD236R; GPD; Glycophorin-C; Glycoprotein beta; Glycoconnectin; GPC; PAS-2; CD antigen CD236; GE; CD236; Sialoglycoprotein D; GYPD; PAS-2' Application Instructions Application table Application Dilution FACS 1:50 ICC/IF 1:50 - 1:200 IHC-P 1:50 - 1:200 IP 1:50 WB 1:500 - 1:2000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control K562 Calculated Mw 14 kDa Observed Size ~ 39 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.4), 150 mM NaCl, 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide www.arigobio.com 1/2 Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol GYPC Gene Full Name glycophorin C (Gerbich blood group) Background Glycophorin C (GYPC) is an integral membrane glycoprotein.
    [Show full text]
  • View Table of Contents
    Table of Contents Preface. xv About the Authors . xvii Section 1: ABO: The Birth of Blood Groups 1. Blood Groups—From Then ’Til Now . .1 Discovery . .1 Response and Reconsideration . .2 Beyond ABO . .4 M, N, and P . .5 Rh . .6 The Antiglobulin Test . .7 The Plot Thickens . .7 References . .8 2. Karl Landsteiner, Father of Blood Groups . .9 Beginnings . .9 Medical School . .11 The Young Researcher . .13 Priority Issues . .16 Decastello and Sturli: Another Blood Group . .18 Other Directions . .19 Life in Vienna . .21 References . .23 3. ABO Grows Up . .27 Transfusion History, 1600 to 1920 . .27 The Blood Groups Gain Attention . .29 Transfusion in World War I . .37 Advances in ABO Blood Group Serology . .39 References . .47 4. Genetics, Eugenics, and Blood Groups . .51 Heredity, 1900 . .52 The Rise of Genetics . .52 Genes and Blood Groups . .53 viii BLOODY BRILLIANT! Genes and Populations . 59 References . 62 5. Karl Landsteiner in New York . 65 At “The Rockefeller” . 65 Landsteiner Returns to the Blood Groups . 68 The Nobel Prize . 71 The Laureate at Work . 73 References . 74 6. Out, Damned Spot! Early Forensic Applications of ABO . 77 What Blood Can Tell . 78 Is It Blood? . 78 Is It Human Blood? . 79 Whose Blood Is It? . 81 References . 85 7. Who’s Your Daddy? ABO and Paternity Testing . 87 Establishing Paternity . 87 Paternity Testing and the Courts: Europe . 89 Paternity Testing and the Courts: Britain . 91 Paternity Testing and the Courts: United States . 92 Lights! Camera! Action! . ..
    [Show full text]
  • Jka, Jkb, Jk – Co-Dominant Inheritance – Jk Is a Silent Allele
    Kidd Blood Group System Qun Lu, MD Assistant Professor Division of Transfusion Medicine Department of Pathology and Laboratory Medicine UCLA, School of Medicine Los Angeles, California 02-05-2009 History of Kidd Blood Group System . Jka was discovered in 1951 by Allen: Mrs. Kidd had hemolytic disease of newborn (HDN) in her son. A new RBC alloantibody was detected in her serum, reacted with her husband’s RBCs. Jkb was found in 1953 by Plaut . The antigens were independent of other known blood groups. They named after Mrs. Kidd. Jk null phenotyp was found in 1959 by Pinkerton. Since the specificities were inseparable, the antibody was renamed anti-Jk3 which recognizes an antigen found whenever Jka or Jkb is present. ISBT Human Blood Group Systems ISBT Number Name Abbreviation 001 ABO ABO 002 MNS MNS 003 P P 004 Rh RH 005 Lutheran LU 006 Kell KEL 007 Lewis LE 008 Duffy FY 009 Kidd JK 010 Diego DI 011 Cartwright YT 012 XG XG 013 Scianna SC 014 Dombrock DO 015 Colton CO 016 Landsteiner-Wiener LW 017 Chido/Rodgers CH/RG 018 Hh H 019 Kx XK 020 Gerbich GE 021 Cromer CROM 022 Knops KN 023 Indian IN 024 Ok OK 025 Raph RAPH Kidd Antigens . Genotype: – Genes located on chromosome 18 – Three alleles Jka, Jkb, Jk – Co-dominant Inheritance – Jk is a silent allele . Common antigen ---- JK3 Ag: – Present with Jka and/or Jkb antigens – Whenever you have Jka or Jkb antigens on the RBC you also have Jk3 antigen. – Anti- Jk3 is against Jka,Jkb, Jk3 antigens, transfuse with Jk(a-b-) blood, very difficult to find Homozygous Heterozygous for Jka or Jkb for JKa and Jkb.
    [Show full text]