Immunohematology JOURNAL of BLOOD GROUP SEROLOGY and EDUCATION

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Immunohematology JOURNAL OF BLOOD GROUP SEROLOGY AND EDUCATION V OLUME 20, NUMBER 1, 2004 Immunohematology JOURNAL OF BLOOD GROUP SEROLOGY AND EDUCATION V OLUME 20, NUMBER 1, 2004 CONTENTS 1 Letter to the Readers Introduction to the review articles CHRISTINE LOMAS-FRANCIS 3 Review:ABO blood group system—ABH oligosaccharide antigens, anti-A and anti-B,A and B glycosyltransferases, and ABO genes F. Y AMAMOTO 23 Review: the molecular basis of the Rh blood group phenotypes F. F. W AGNER AND W.A. FLEGEL 37 Review: the Kell, Duffy, and Kidd blood group systems C.M.WESTHOFF AND M.E. REID 50 Review: other blood group systems—Diego,Yt, Xg, Scianna, Dombrock, Colton, Landsteiner-Wiener, and Indian K.M. BYRNE AND P.C. BYRNE 59 A bicarbonate anion-dependent anti-‘N’ MoAb Y.S. IYER,K.VASANTHA, S.R. JOSHI,M.PATWARDHAN,V.PUJARI,S.JADHAV, AND D. MOHANTY 63 Cefotetan-induced immune hemolytic anemia following prophylaxis for cesarean delivery S. SHARIATMADAR,J.R. STORRY,L.SAUSAIS, AND M.E. REID 67 69 COMMUNICATIONS Letters to the Editor Letters From the Editor-in-Chief Looking back at the history of the journal Welcome to our 20th anniversary year! MARION E. REID,PHD HELEN GLIDDEN, MT(ASCP)SBB 71 Book Review Pediatric Transfusion Therapy CORINA E. GONZALEZ,MD 72 74 ANNOUNCEMENTS ADVERTISEMENTS 77 INSTRUCTIONS FOR AUTHORS EDITOR-IN-CHIEF MANAGING EDITOR Delores Mallory, MT(ASCP)SBB Mary H. McGinniss,AB, (ASCP)SBB Rockville, Maryland Bethesda, Maryland MEDICAL EDITOR SENIOR MEDICAL EDITOR S. Gerald Sandler, MD Scott Murphy, MD Washington, District of Columbia Philadelphia, Pennsylvania TECHNICAL EDITOR GUEST EDITOR Christine Lomas-Francis, MSc Christine Lomas-Francis, MSc New York, New York New York, New York ASSOCIATE MEDICAL EDITORS David Moolton, MD Geralyn Meny, MD Ralph Vassallo, MD Philadelphia, Pennsylvania Philadelphia, Pennsylvania Philadelphia, Pennsylvania EDITORIAL BOARD Patricia Arndt, MT(ASCP)SBB W. J ohn Judd, FIBMS, MIBiol Paul M. Ness, MD Los Angeles, California Ann Arbor, Michigan Baltimore, Maryland James P.AuBuchon, MD Christine Lomas-Francis, MSc Mark Popovsky, MD Lebanon, New Hampshire New York, New York Braintree, Massachusetts Geoffrey Daniels, PhD Gary Moroff, PhD Marion E. Reid, PhD, FIBMS Bristol, United Kingdom Rockville, Maryland New York, New York Richard Davey, MD Ruth Mougey, MT(ASCP)SBB Susan Rolih, MS, MT(ASCP)SBB New York, New York Carrollton, Kentucky Cincinnati, Ohio Sandra Ellisor, MS, MT(ASCP)SBB John J. Moulds, MT(ASCP)SBB David F.Stroncek, MD Anaheim, California Raritan, New Jersey Bethesda, Maryland George Garratty, PhD, FRCPath Marilyn K. Moulds, MT(ASCP)SBB Marilyn J.Telen, MD Los Angeles, California Houston, Texas Durham, North Carolina Brenda J. Grossman, MD Sandra Nance, MS, MT(ASCP)SBB St. Louis, Missouri Philadelphia, Pennsylvania EDITORIAL ASSISTANT PRODUCTION ASSISTANT Linda Berenato Marge Manigly COPY EDITOR ELECTRONIC PUBLISHER PROOFREADER Lucy Oppenheim Paul Duquette George Aydinian Immunohematology is published quarterly (March, June, September, and December) by the American Red Cross, National Headquarters,Washington, DC 20006. The contents are cited in the EBASE/Excerpta Medica and Elsevier BIOBASE/ Current Awareness in Biological Sciences (CABS) databases. The subscription price is $30.00 (U.S.) and $35.00 (foreign) per year. Subscriptions, Change of Address, and Extra Copies: Immunohematology, P.O. Box 40325 Philadelphia, PA 19106 Or call (215) 451-4902 Web site: www.redcross.org/pubs/immuno Copyright 2004 by The American National Red Cross ISSN 0894-203X LETTER TO THE READERS Introduction to the review articles biochemical nature of the ABO antigens, the isolation of the transferases involved in the syntheses of A and B We celebrate the 20th anniversary of antigens, the cloning of the ABO genes, and the Immunohematology this year by publishing four molecular basis of the serologically defined special issues that are primarily devoted to review phenotypes. The ABO genes in other species; the articles. The reviews in this,the first,issue focus on the evolution of the ABO genes; and changes in antigen major RBC blood group systems. Each blood group expression during development, differentiation, and system is genetically discrete and consists of one or carcinogenesis are also discussed. He concludes the more antigens. The antigens are surface markers on the review by leaving us to muse over the question of “Why outside of the RBC membrane and are proteins and does the ABO polymorphism exist?” carbohydrates attached to lipid or protein. Exposure to The Rh system, after ABO, is the most clinically RBCs carrying an antigen lacking on the RBCs of the significant in transfusion medicine. The identification recipient can elicit an immune response in some of the Rh antigens led to the understanding and people. The ability to detect and identify blood group prevention of HDN. Dr. Franz Wagner and Dr. Willy antigens and antibodies by simple hemagglutination Flegel review the Rh system in this issue of techniques is the foundation of safe, supportive blood Immunohematology. The authors, through their work transfusion practice and the appropriate management in recent years, have contributed to our understanding of pregnancies at risk for HDN. of this, the most polymorphic and complex of the Currently there are 29 blood group systems, blood group systems. The Rh antigens are considered containing 229 antigens, recognized by the at the level of the gene, the protein, and the antigen. International Society of Blood Transfusion (ISBT). Current knowledge of the molecular bases of Rh Twenty years ago, at the launch of antigen expression is used to shed light on the Immunohematology, there were 16 systems with 144 serologic complexity of the Rh blood group system. In antigens and quite a collection of antigens waiting to particular,the molecular bases of D antigen expression, be assigned to systems, pending the discovery of new of the partial D, weak D, Del, and D-negative information about their relationship to the established phenotypes, is extensively reviewed, as is the systems. During the last 10 to 15 years, major phylogeny of RHD alleles. The available molecular advances, particularly at the molecular level, have information for each of the 48 Rh antigens is also occurred in our understanding of blood group presented in a tabulated format for easy reference. The antigens, the structures that carry them, and the red authors conclude their review by drawing our cell membrane that houses them. The study of people attention to the many unresolved questions about the who have a null phenotype for a certain blood group Rh system and in particular the “astounding Rh system and thus have RBCs that lack or have altered antigenic variability.” membrane protein(s) has provided a key to the Dr. Connie Westhoff and Dr. Marion Reid focus on function of that protein. The reviews in this issue,each the Kell, Duffy, and Kidd blood group systems. The in a unique way,address the exciting findings of recent antibodies to antigens in these three systems are the years and consider the molecular events that generate most clinically significant, after those of ABO and Rh. diversity in blood group antigens and phenotypes and Because of the association between Kx and Kell,the Kx relate them back to possible applications at the clinical system is included. The authors have distilled the level. wealth of information about these systems into a few The discovery of the ABO groups at the beginning pages of text and several informative tables and figures. of the 20th century made blood transfusion possible. The history of each system is addressed (e.g., Kell was Therefore, it is fitting that ABO is the first system to be the first system to be identified after the introduction reviewed and that Dr. Fumiichiro Yamamoto, who was of the antiglobulin test), then the antigens, the a member of the team that cloned the ABO genes, does antibodies, and their involvement in HDN. The recent so. Dr. Yamamoto’s article begins with Landsteiner’s advances at the gene and protein levels and the work, then guides us through the elucidation of the molecular bases of the antigens and phenotypes are IMMUNOHEMATOLOGY, VOLUME 20, NUMBER 1, 2004 1 LETTER TO THE READERS CONT’D summarized. The biological role of the Kell, Kidd, and information presented by the authors should prove Duffy proteins and their significance in health and valuable to those immunohematologists studying for disease are also discussed. the SBB exam The authors of the fourth review, Karen and Peter Finally,in addition to the four reviews, two original Byrne, faced a daunting challenge, that of describing articles are published in this information-rich “Other Blood Group Systems.” They selected those anniversary issue of Immunohematology. systems considered to be of clinical importance or to have interesting features and made the scope of the Christine Lomas-Francis, MSc presented information “What you need to know for the Technical Editor and Guest Editor of this issue SBB exam.” The eight blood group systems featured in this review are Diego, Yt, Xg, Scianna, Dombrock, Colton, Landsteiner-Wiener, and Indian. The Manuscripts: The editorial staff of Immunohematology welcomes manuscripts pertaining to blood group serology and education for consideration for publication.We are especially interested in case reports, papers on platelet and white cell serology,scientific articles covering original investigations, and papers on the use of computers in the blood bank. Deadlines for receipt of manuscripts for consideration for the March, June, September, and December issues are the first weeks in November, February, May, and August, respectively. Instructions for scientific articles and case reports can be obtained by phoning or faxing a request to Mary H. McGinnniss, Managing Editor, Immunohematology, at (301) 299-7443, or see “Instructions for Authors” in every issue of Immunohematology or on the Web. Include fax and phone numbers and e-mail address with your manuscript.
Recommended publications
  • Other Blood Group Systems—Diego,Yt, Xg, Scianna, Dombrock

    Other Blood Group Systems—Diego,Yt, Xg, Scianna, Dombrock

    Review: other blood group systems—Diego, Yt, Xg, Scianna, Dombrock, Colton, Landsteiner- Wiener, and Indian K.M. B YRNE AND P.C. B YRNE Introduction Diego Blood Group System This review was prepared to provide a basic The Diego blood group system (ISBT: DI/010) has overview of “Other Blood Groups.” Some of the more expanded from its humble beginnings to now include major blood group systems, i.e., ABO, Rh, Kell, Duffy, up to 21 discrete antigens (Table 1). 3 Band 3, an anion and Kidd, are also reviewed in this issue and are not exchange, multi-pass membrane glycoprotein, is the covered here. The sheer mass of data on the MNS basic structure that carries the Diego system antigenic blood group system is so extensive and complicated determinants. 4 The gene that encodes the Band 3 that it justifies a review all of its own, and it is therefore protein is named SLC4A1 and its chromosomal location not discussed in this article. However, various aspects is 17q12–q21. 4 of MNS were described in recent papers in Di a and Di b are antithetical, resulting from a single Immunohematology. 1,2 nucleotide substitution (2561T>C) that gives rise to The blood group systems that are covered are those amino acid changes in the Band 3 protein (Leu854Pro). that most workers believe to have some degree of To date, the Di(a–b–) phenotype has not been clinical importance or interesting features: Diego (DI), described. The Di a and Di b antigens are resistant to Yt (YT), Xg (XG), Scianna (SC), Dombrock (DO), Colton treatment with the following enzymes/chemicals: (CO), Landsteiner-Wiener (LW), and Indian (IN).
  • Requirements for Blood and Blood Components Intended for Transfusion Or for Further Manufacturing Use

    Requirements for Blood and Blood Components Intended for Transfusion Or for Further Manufacturing Use

    Requirements for Blood and Blood Components Intended for Transfusion or for Further Manufacturing Use Office of Blood Research and Review CBER, FDA Ask the FDA Session – AABB Annual Meeting October 26, 2015 1 Outline • Overview – Historical Background – Intent of the Rule – Organization of the Rule • Selected Provisions – Relevant Transfusion-Transmitted Infection – Control of Bacterial Contamination of Platelets – Medical Supervision – Donor Acknowledgement – Alternative Procedures – Donor Eligibility • Implementation 2 GAO Oversight and FDA Concerns • Publish in the form of regulations the guidelines that FDA deems essential to ensure the safety of the blood supply • Concern about the delay in requiring testing for emerging infectious agents, e.g. HTLV • Concern about blood safety and the regulations being out-of-date • Concerns about donor safety 3 Intent of the Final Rule • To better assure the safety of the blood supply and to help protect donor health • To make donor eligibility and testing requirements more consistent with current practices and to provide flexibility with regard to emerging infectious diseases • To accommodate technological advances • To establish requirements for donor education, donor history, and donor testing 4 Organization of the Final Rule - 1 • A. General • B. Definitions (§§ 606.3, 610.39, 630.3, 640.125) • C. Standard Operating Procedures (§ 606.100) • D. Control of Bacterial Contamination of Platelets (§ 606.145) • E. Records (§ 606.160) • F. Test Requirements (§§ 610.40, 640.5, 640.71(a)) • G. Donor Deferral (§ 610.41) 5 Organization of the Final Rule - 2 • H. Purpose and Scope (§ 630.1) • I. Medical Supervision (§ 630.5) • J. General Donor Eligibility Requirements(§ 630.10) • K. Donor Eligibility Requirements Specific to Whole Blood, Red Blood Cells and Plasma Collected by Apheresis (§ 630.15) • L.
  • 27. Clinical Indications for Cryoprecipitate And

    27. Clinical Indications for Cryoprecipitate And

    27. CLINICAL INDICATIONS FOR CRYOPRECIPITATE AND FIBRINOGEN CONCENTRATE Cryoprecipitate is indicated in the treatment of fibrinogen deficiency or dysfibrinogenaemia.1 Fibrinogen concentrate is licenced for the treatment of acute bleeding episodes in patients with congenital fibrinogen deficiency, including afibrinogenaemia and hypofibrinogenaemia,2 and is currently funded under the National Blood Agreement. Key messages y Fibrinogen is an essential component of the coagulation system, due to its role in initial platelet aggregation and formation of a stable fibrin clot.3 y The decision to transfuse cryoprecipitate or fibrinogen concentrate to an individual patient should take into account the relative risks and benefits.3 y The routine use of cryoprecipitate or fibrinogen concentrate is not advised in medical or critically ill patients.2,4 y Cryoprecipitate or fibrinogen concentrate may be indicated in critical bleeding if fibrinogen levels are not maintained using FFP. In the setting of major obstetric haemorrhage, early administration of cryoprecipitate or fibrinogen concentrate may be necessary.3 Clinical implications y The routine use of cryoprecipitate or fibrinogen concentrate in medical or critically ill patients with coagulopathy is not advised. The underlying causes of coagulopathy should be identified; where transfusion is considered necessary, the risks and benefits should be considered for each patient. Specialist opinion is advised for the management of disseminated intravascular coagulopathy (MED-PP18, CC-PP7).2,4 y Cryoprecipitate or fibrinogen concentrate may be indicated in critical bleeding if fibrinogen levels are not maintained using FFP. In patients with critical bleeding requiring massive transfusion, suggested doses of blood components is 3-4g (CBMT-PP10)3 in adults or as per the local Massive Transfusion Protocol.
  • ABO (ISBT 001) Blood Group Alleles V1.1 171023

    ABO (ISBT 001) Blood Group Alleles V1.1 171023

    Names for ABO (ISBT 001) blood group alleles v1.1 171023 Names for ABO (ISBT 001) Blood Group Alleles General description: The ABO system was discovered as in 1900 and is considered the first and clinically most important system. The ABO gene and its 7 coding exons give rise to one of two principally different glycosyltransferases. The A glycosyltransferase (GTA) catalyzes the addition of a donor substrate, UDP-N-acetylgalactosamine, to an acceptor substrate known as the H antigen. The B glycosyltransferase (GTB) differs by only four amino-acid substitutions from GTA and performs the same enzymatic reaction but uses UDP-galactose as donor substrate. In this way, genetic polymorphism gives rise to two related antigens in this system. Any polymorphism or mutation that changes the activity or specificity of the encoded enzyme may therefore alter the ABO phenotype. Alterations that completely abolish enzymic activity give rise to the blood group O phenotype, in which the H antigen remains unconverted and no A or B antigen can be detected. If the genetic alteration decreases the activity of the enzyme, or alters its subcellular location and thereby decreases conversion of H to A or B, a weak A or B subgroup phenotype can result. Furthermore, certain polymorphisms result in promiscuous enzymes that can synthesize both A and B antigen, thereby resulting in the so-called cisAB or B(A) phenotypes. The A phenotype is divided into A1 and A2. The former is more prevalent in all populations and has approximately 5 times more A epitopes per red cell. The GTA1 is also better than GTA2 at synthesizing certain forms of A, .e.g.
  • Hemolytic Disease of the Newborn

    Hemolytic Disease of the Newborn

    Intensive Care Nursery House Staff Manual Hemolytic Disease of the Newborn INTRODUCTION and DEFINITION: Hemolytic Disease of the Newborn (HDN), also known as erythroblastosis fetalis, isoimmunization, or blood group incompatibility, occurs when fetal red blood cells (RBCs), which possess an antigen that the mother lacks, cross the placenta into the maternal circulation, where they stimulate antibody production. The antibodies return to the fetal circulation and result in RBC destruction. DIFFERENTIAL DIAGNOSIS of hemolytic anemia in a newborn infant: -Isoimmunization -RBC enzyme disorders (e.g., G6PD, pyruvate kinase deficiency) -Hemoglobin synthesis disorders (e.g., alpha-thalassemias) -RBC membrane abnormalities (e.g., hereditary spherocytosis, elliptocytosis) -Hemangiomas (Kasabach Merritt syndrome) -Acquired conditions, such as sepsis, infections with TORCH or Parvovirus B19 (anemia due to RBC aplasia) and hemolysis secondary to drugs. ISOIMMUNIZATION A. Rh disease (Rh = Rhesus factor) (1) Genetics: Rh positive (+) denotes presence of D antigen. The number of antigenic sites on RBCs varies with genotype. Prevalence of genotype varies with the population. Rh negative (d/d) individuals comprise 15% of Caucasians, 5.5% of African Americans, and <1% of Asians. A sensitized Rh negative mother produces anti-Rh IgG antibodies that cross the placenta. Risk factors for antibody production include 2nd (or later) pregnancies*, maternal toxemia, paternal zygosity (D/D rather than D/d), feto-maternal compatibility in ABO system and antigen load. (2) Clinical presentation of HDN varies from mild jaundice and anemia to hydrops fetalis (with ascites, pleural and pericardial effusions). Because the placenta clears bilirubin, the chief risk to the fetus is anemia. Extramedullary hematopoiesis (due to anemia) results in hepatosplenomegaly.
  • Association Between ABO and Duffy Blood Types and Circulating Chemokines and Cytokines

    Association Between ABO and Duffy Blood Types and Circulating Chemokines and Cytokines

    Genes & Immunity (2021) 22:161–171 https://doi.org/10.1038/s41435-021-00137-5 ARTICLE Association between ABO and Duffy blood types and circulating chemokines and cytokines 1 2 3 4 5 6 Sarah C. Van Alsten ● John G. Aversa ● Loredana Santo ● M. Constanza Camargo ● Troy Kemp ● Jia Liu ● 4 7 8 Wen-Yi Huang ● Joshua Sampson ● Charles S. Rabkin Received: 11 February 2021 / Revised: 30 April 2021 / Accepted: 17 May 2021 / Published online: 8 June 2021 This is a U.S. government work and not under copyright protection in the U.S.; foreign copyright protection may apply 2021, corrected publication 2021 Abstract Blood group antigens are inherited traits that may play a role in immune and inflammatory processes. We investigated associations between blood groups and circulating inflammation-related molecules in 3537 non-Hispanic white participants selected from the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial. Whole-genome scans were used to infer blood types for 12 common antigen systems based on well-characterized single-nucleotide polymorphisms. Serum levels of 96 biomarkers were measured on multiplex fluorescent bead-based panels. We estimated marker associations with blood type using weighted linear or logistic regression models adjusted for age, sex, smoking status, and principal components of p 1234567890();,: 1234567890();,: population substructure. Bonferroni correction was used to control for multiple comparisons, with two-sided values < 0.05 considered statistically significant. Among the 1152 associations tested, 10 were statistically significant. Duffy blood type was associated with levels of CXCL6/GCP2, CXCL5/ENA78, CCL11/EOTAXIN, CXCL1/GRO, CCL2/MCP1, CCL13/ MCP4, and CCL17/TARC, whereas ABO blood type was associated with levels of sVEGFR2, sVEGFR3, and sGP130.
  • Biological and Clinical Aspects of ABO Blood Group System

    Biological and Clinical Aspects of ABO Blood Group System

    174 REVIEW Biological and clinical aspects of ABO blood group system Eiji Hosoi Department of Cells and Immunity Analytics, Institute of Health Biosciences, the University of Tokushima Graduate School, Tokushima, Japan Abstract : The ABO blood group was discovered in 1900 by Austrian scientist, Karl Land- steiner. At present, the International Society of Blood Transfusion (ISBT) approves as 29 human blood group systems. The ABO blood group system consists of four antigens (A, B, O and AB). These antigens are known as oligosaccharide antigens, and widely ex- pressed on the membranes of red cell and tissue cells as well as, in the saliva and body fluid. The ABO blood group antigens are one of the most important issues in transfusion medicine to evaluate the adaptability of donor blood cells with bone marrow transplan- tations, and lifespan of the hemocytes. This article reviews the serology, biochemistry and genetic characteristics, and clini- cal application of ABO antigens. J. Med. Invest. 55 : 174-182, August, 2008 Keywords : ABO blood group, glycosyltransferase, ABO allele, cisAB allele, PASA : PCR amplification of spe- cific alleles INTRODUCTION The genes of ABO blood group has been deter- mined at chromosome locus 9 (6-9), and Yamamoto, The ABO blood group system was discovered by et al. cloned and determined the structures. It has Austrian scientist, Karl Landsteiner, who found made it possible to analyze genetically ABO blood three different blood types (A, B and O) in 1900 group antigens using molecular biology techniques from serological differences in blood called the Land- (7, 10 - 18). steiner Law (1). In 1902, DesCasterllo and Sturli dis- covered the fourth type, AB (2).
  • Journal of Blood Group Serology and Molecular Genetics Volume 34, Number 1, 2018 CONTENTS

    Journal of Blood Group Serology and Molecular Genetics Volume 34, Number 1, 2018 CONTENTS

    Journal of Blood Group Serology and Molecular Genetics VOLUME 34, N UMBER 1, 2018 This issue of Immunohematology is supported by a contribution from Grifols Diagnostics Solutions, Inc. Dedicated to advancement and education in molecular and serologic immunohematology Immunohematology Journal of Blood Group Serology and Molecular Genetics Volume 34, Number 1, 2018 CONTENTS S EROLOGIC M ETHOD R EVIEW 1 Warm autoadsorption using ZZAP F.M. Tsimba-Chitsva, A. Caballero, and B. Svatora R EVIEW 4 Proceedings from the International Society of Blood Transfusion Working Party on Immunohaematology Workshop on the Clinical Significance of Red Blood Cell Alloantibodies, Friday, September 2, 2016, Dubai A brief overview of clinical significance of blood group antibodies M.J. Gandhi, D.M. Strong, B.I. Whitaker, and E. Petrisli C A S E R EPORT 7 Management of pregnancy sensitized with anti-Inb with monocyte monolayer assay and maternal blood donation R. Shree, K.K. Ma, L.S. Er and M. Delaney R EVIEW 11 Proceedings from the International Society of Blood Transfusion Working Party on Immunohaematology Workshop on the Clinical Significance of Red Blood Cell Alloantibodies, Friday, September 2, 2016, Dubai A review of in vitro methods to predict the clinical significance of red blood cell alloantibodies S.J. Nance S EROLOGIC M ETHOD R EVIEW 16 Recovery of autologous sickle cells by hypotonic wash E. Wilson, K. Kezeor, and M. Crosby TO THE E DITOR 19 The devil is in the details: retention of recipient group A type 5 years after a successful allogeneic bone marrow transplant from a group O donor L.L.W.
  • Genes and Human History

    Genes and Human History

    Genes and human history Gil McVean, Department of Statistics, Oxford Contact: [email protected] 2 3 • Where does the variation come from? • How old are the genetic differences between us? • Are these differences important? How different are our genomes? 5 Serological techniques for detecting variation Rabbit Anti-A antibodies Human A A B AB O 6 Blood group systems in humans • 28 known systems – 39 genes, 643 alleles System Genes Alleles Knops CR1 24+ ABO ABO 102 Landsteiner- ICAM4 3 Wiener Colton C4A, C4B 7+ Lewis FUT3, FUT6 14/20 Chido-rodgers AQP1 7 Lutheran LU 16 Colton DAF 10 MNS GYPA,GYPB,G 43 Diego SLC4A1 78 YPE Dombrock DO 9 OK BSG 2 Duffy FY 9 P-related A4GALT, 14/5 Gerbich GYPC 9 B3GALT3 GIL AQP3 2 RAPH-MER2 CD151 3 H/h FUT1, FUT2 27/22 Rh RHCE, RHD, 129 I GCNT2 7 RHAG Indian CD44 2 Scianna ERMAP 4 Kell KEL, XK 33/30 Xg XG, CD99 - Kidd SLC14A1 8 YT ACHE 4 http://www.bioc.aecom.yu.edu/bgmut/summary.htm 7 Protein electroporesis • Changes in mass/charge ratio resulting from amino acid substitutions in proteins can be detected Starch or agar gel -- +- + +- - - - -- - + - + +- -- Direction of travel • In humans, about 30% of all loci show polymorphism with a 6% chance of a pair of randomly drawn alleles at a locus being different Lewontin and Hubby (1966) Harris(1966) 8 The rise of DNA sequencing GATAAGACGGTGATACTCACGCGACGGGCTTGGGCGCCGACTCGTTCAGACGGTGACCCAACTTATCCGATCGACCC CGGGTCCCGATTTAGACTCGGTATCATTTCTGGTGATTATCGCCTGCAGGTTCAAGAACACGTTTGCAGCAAGAAGT GAGGGATTTTGTCAGTGATCCCAGTCTACGGAGCCAGTCACCTCTGGTAGTGAAATTTTATTCGTTCATCTTCATAT AAGTCGCAGACCGCACGATGGGGGACAGAATACTCGCACAGGAAGAACCGCGATGAACCGAGGTAACCTAACATCCT
  • Changes to the Technical Manual, 18Th Edition Monday, November 17, 2014 12:00 P.M

    Changes to the Technical Manual, 18Th Edition Monday, November 17, 2014 12:00 P.M

    Changes to the Technical Manual, 18th Edition Monday, November 17, 2014 12:00 p.m. – 1:30 p.m. (ET) / 5:00p.m. – 6:30 p.m. (GMT) When this file is opened, Acrobat Reader will, by default, display the slides including the Acrobat reader controls. To return to full screen mode, hit Ctrl-L on your computer keyboard or use your mouse to click View>Full Screen on the menu bar of the Acrobat Reader program. To take the slides out of full screen mode and display the Acrobat Reader controls, simply hit the Esc key on your computer keyboard. To advance slides during the program, use the Enter, Page Down, down arrow or right arrow on your computer keyboard. To back up slides during the program, use the Page Up, up arrow of left arrow on your computer keyboard. Please remember to logon to the Live Learning Center using your email address and password to complete an evaluation of the program and speakers. At this time, advance to the next slide and wait for the audioconference to begin. A 2014 Audioconference presented to you by AABB The AABB Technical Manual 18th Edition What’s new? www.aabb.org Technical Manual by the Numbers • 1953 =year of first edition • 69 = number of authors/editors this edition • 370,378 = word count • 96 = number of methods • 60 = number of countries where TM is used www.aabb.org It’s a Process www.aabb.org Overview of Changes Major • Molecular testing • Patient blood management • Cellular therapy • Methods Minor • Throughout www.aabb.org 1: Quality Systems 2: Facilities and Safety • These 2 chapters are comprehensive discussions
  • Blood Bank I D

    Blood Bank I D

    The Osler Institute Blood Bank I D. Joe Chaffin, MD Bonfils Blood Center, Denver, CO The Fun Just Never Ends… A. Blood Bank I • Blood Groups B. Blood Bank II • Blood Donation and Autologous Blood • Pretransfusion Testing C. Blood Bank III • Component Therapy D. Blood Bank IV • Transfusion Complications * Noninfectious (Transfusion Reactions) * Infectious (Transfusion-transmitted Diseases) E. Blood Bank V (not discussed today but available at www.bbguy.org) • Hematopoietic Progenitor Cell Transplantation F. Blood Bank Practical • Management of specific clinical situations • Calculations, Antibody ID and no-pressure sample questions Blood Bank I Blood Groups I. Basic Antigen-Antibody Testing A. Basic Red Cell-Antibody Interactions 1. Agglutination a. Clumping of red cells due to antibody coating b. Main reaction we look for in Blood Banking c. Two stages: 1) Coating of cells (“sensitization”) a) Affected by antibody specificity, electrostatic RBC charge, temperature, amounts of antigen and antibody b) Low Ionic Strength Saline (LISS) decreases repulsive charges between RBCs; tends to enhance cold antibodies and autoantibodies c) Polyethylene glycol (PEG) excludes H2O, tends to enhance warm antibodies and autoantibodies. 2) Formation of bridges a) Lattice structure formed by antibodies and RBCs b) IgG isn’t good at this; one antibody arm must attach to one cell and other arm to the other cell. c) IgM is better because of its pentameric structure. P}Chaffin (12/28/11) Blood Bank I page 1 Pathology Review Course 2. Hemolysis a. Direct lysis of a red cell due to antibody coating b. Uncommon, but equal to agglutination. 1) Requires complement fixation 2) IgM antibodies do this better than IgG.
  • Demonstration of SNP Genotyping Using a Single Nucleotide Extension Method and the 3500 Series Genetic Analyzer

    Demonstration of SNP Genotyping Using a Single Nucleotide Extension Method and the 3500 Series Genetic Analyzer

    YOUR INNOVATIVE RESEARCH ABO BLOOD GROUP DETERMINATION Demonstration of SNP Genotyping Using a Single Nucleotide Extension Method and the 3500 Series Genetic Analyzer Introduction This publication describes the collaboration The Department of Legal between researchers at the Okayama Medicine, Okayama University Graduate School of Medicine, University Graduate School and at Applied Dentistry and Pharmaceutical Sciences develops research Biosystems (Foster City, CA, USA), aimed methodologies for crime detec- tion techniques that utilize DNA ® at demonstrating a SNaPshot Multiplex analyses, including the discov- System genotyping protocol on the Applied ery of new polymorphic DNA loci and tools to identify gender Biosystems® 3500xL Genetic Analyzer from sample material. Visiting fellow Dr. Doi is involved in an capillary electrophoresis (CE) instrument. ongoing effort to refine DNA- based blood typing techniques and is also developing a DNA Genotyping to determine ABO blood type identification method that is useful on composite samples. group status is a valuable tool in forensic Pictured are Dr. Yusuke Doi (top applications where routine serological right); Dr. Yuji Yamamoto (top left); Mayumi Okashita (bottom typing is not feasible. Therefore, right); and Hiroko Ide (bottom left). laboratories that are developing ABO blood group typing applications appreciate workflows that provide fast, accurate, and reliable results, particularly if the assay delivers data for samples that contain very ABO Genotyping of six SNP sites within the ABO gene (cor- low concentrations of gDNA or degraded Identification of specific combinations of responding to nucleotides 261, 297, 681, 703, gDNA. In this publication, we present a single nucleotide polymorphisms (SNPs) 802, and 803). These six sites are sufficient in the ABO locus on chromosome 9 can for accurate determination of ten common simple, rapid, and robust workflow for be used to determine ABO blood type.