Other Blood Group Systems—Diego,Yt, Xg, Scianna, Dombrock

Total Page:16

File Type:pdf, Size:1020Kb

Other Blood Group Systems—Diego,Yt, Xg, Scianna, Dombrock Review: other blood group systems—Diego, Yt, Xg, Scianna, Dombrock, Colton, Landsteiner- Wiener, and Indian K.M. B YRNE AND P.C. B YRNE Introduction Diego Blood Group System This review was prepared to provide a basic The Diego blood group system (ISBT: DI/010) has overview of “Other Blood Groups.” Some of the more expanded from its humble beginnings to now include major blood group systems, i.e., ABO, Rh, Kell, Duffy, up to 21 discrete antigens (Table 1). 3 Band 3, an anion and Kidd, are also reviewed in this issue and are not exchange, multi-pass membrane glycoprotein, is the covered here. The sheer mass of data on the MNS basic structure that carries the Diego system antigenic blood group system is so extensive and complicated determinants. 4 The gene that encodes the Band 3 that it justifies a review all of its own, and it is therefore protein is named SLC4A1 and its chromosomal location not discussed in this article. However, various aspects is 17q12–q21. 4 of MNS were described in recent papers in Di a and Di b are antithetical, resulting from a single Immunohematology. 1,2 nucleotide substitution (2561T>C) that gives rise to The blood group systems that are covered are those amino acid changes in the Band 3 protein (Leu854Pro). that most workers believe to have some degree of To date, the Di(a–b–) phenotype has not been clinical importance or interesting features: Diego (DI), described. The Di a and Di b antigens are resistant to Yt (YT), Xg (XG), Scianna (SC), Dombrock (DO), Colton treatment with the following enzymes/chemicals: (CO), Landsteiner-Wiener (LW), and Indian (IN). ficin/papain, trypsin, α-chymotrypsin, DTT (0.2 M), and Readers will find a brief digest of each blood group chloroquine. 4 The only other pair of antithetical system, which includes some historical, statistical, antigens in the system are Wr a and Wr b, the result of genetic, biochemical, and serologic data. It was the another nucleotide substitution (1972A>G) that authors’ intention to compile data that could be produces another change in Band 3 (Lys658Glu). 4 The entitled: “Other Blood Groups: What you need to know extremely rare Wr(a–b–) phenotype has been found in for the SBB exam.” 1 persons with rare glycophorin variants, where Readers will note that there are only a few expression of the Wr b antigen is dependent upon the references used in this review. Most of the information presence of functional glycophorin A. 5 The Wr a and given here has been dissected from the books listed in Wr b antigens are resistant to treatment with the the fourth and fifth references. Between them, they following enzymes/chemicals: ficin/papain, trypsin, α- contain a much more detailed, extensive, and chymotrypsin, DTT (0.2 M), and chloroquine. 4 comprehensive review of the vast volume of material The other antigens in this system are of extremely available on these blood group systems. For additional low frequency and are usually the result of single information or clarification, readers are strongly nucleotide substitutions. Interestingly, many of the encouraged to consult the aforementioned antibodies directed against these low-frequency publications. The additional references contain antigens show some degree of crossreactivity or other pertinent newer information that has been reported serologic associations with each other, and this is often since the publication of the main sources of data. the reason why their inclusion in this blood group 50 IMMUNOHEMATOLOGY, VOLUME 20, NUMBER 1, 2004 Review: less well-known blood group systems Table 1. Diego blood group antigens and/or cause in vitro hemolysis. a First Incidence (%) 5 Anti-Di has often been implicated in ISBT Conventional Historical reported 5 (Caucasians) Notes 4,5 HDN, but reports of immediate DI1 Di a Diego 1955 <0.1 S. Amer. Ind.: 36% Chinese: 5% hemolytic transfusion reactions are Japanese: 12% confused by other issues. 5 Anti-Di b Chippewa: 11% usually only cause mild HDN but DI2 Di b Luebano 1967 >99.9 there have been a few reports of DI3 Wr a Wright 1953 <0.1 delayed transfusion reactions. 4,5 DI4 Wr b Fritz 1971 >99.9 Anti-Wr a is probably one of the DI5 Wd a Waldner 1981 <0.1 Found in two most commonly seen antibodies to a Hutterite families low-frequency antigen (and is a a DI6 Rb Redelberger 1978 <0.1 particular bane to one of the authors DI7 WARR Warrior 1991 <0.1 May be unique to Native Americans during the manufacture of blood grouping reagents). It is often found DI8 ELO 1993 <0.1 in the sera of individuals who have DI9 Wu Wulfsberg 1976 <0.1 produced antibodies to other RBC DI10 Bp a Bishop 1966 <0.1 antigens. Given the extremely low DI11 Mo a Moen 1972 <0.1 frequency of the Wr a antigen it seems a DI12 Hg Hughes 1983 <0.1 unlikely that those individuals have a DI13 Vg Van Vugt 1981 <0.1 been actually exposed to Wr(a+) a DI14 Sw Swann 1959 <0.1 RBCs. DI15 BOW 1988 <0.1 Thus, many examples of anti-Wr a DI16 NFLD Newfoundland 1984 <0.1 appear to be “naturally occurring” or DI17 Jn a 1967 <0.1 stimulated by some-thing other than DI18 KREP 1997 <0.1 RBCs and, in particular, in sera from DI19 Tr a Traversu 1975 <0.1 (Provisional)* individuals who have made multiple DI20 Fr a Froese 1978 <0.1 antibodies to low-frequency DI21 SW1 1987 <0.1 antigens. Behavior of the antibodies * ISBT assignment to DI varies greatly, perhaps dependent upon the method of immunization. system was initially postulated. Most of these low- Many examples of anti-Wr a are IgM, saline-reactive; frequency Diego system antigens have only been found others are IgG, reactive by antiglobulin techniques. Still in small kindreds or isolated ethnic groups. While other examples contain both IgG and IgM these antigens and their corresponding antibodies may components. Most do not bind complement or cause have clinical significance, they have little or no impact in vitro hemolysis. Anti-Wr a has often been implicated upon everyday transfusion medicine. 4 in HDN and transfusion reactions. 5 An altered form of Band 3 protein has been associated with a hereditary form of red cell ovalocytosis known as South East Asian ovalocytosis, Yt Blood Group System and may confer a degree of resistance to invasion by The Yt blood group system (ISBT: YT/011), often the malarial parasite Plasmodium falciparum. A incorrectly referred to as the Cartwright system, complete absence of Band 3, and, therefore, the consists of two antigens: Yt a and Yt b.6 The antigens are Di(a–b–) phenotype, was thought to be incompatible carried by a GPI-linked glycoprotein named acetyl- with life. However, a severely hydropic, anemic baby cholinesterase (AChE), which is the product of the who lacked Band 3 and protein 4.2 was resuscitated ACHE gene located on chromosome 7 at position q22. after birth and kept alive by blood transfusions. 4 The function of this enzyme in RBCs is not known, Antibodies to Di a and Di b are generally IgG1 and however AChE is a major component of nerve impulse IgG3, although some IgM examples have been transmission. 4 reported. 5 They are usually produced in response to The genetic polymorphisms that give rise to the RBC exposure and are reactive by antiglobulin antithetical Yt a and Yt b antigens are the result of a techniques. Rare examples may bind complement nucleotide substitution in ACHE (1057C>A), which IMMUNOHEMATOLOGY, VOLUME 20, NUMBER 1, 2004 51 K.M. B YRNE AND P.C. B YRNE produces an amino acid change in the AChE example of anti-Yt a was reported to bind complement, glycoprotein (His353Asn). 4 As seen in Table 2, Yt a is of but neither in vitro hemolysis nor HDN has been high frequency in Caucasians and Yt b is of moderately attributed to Yt antibodies. 4,5 low frequency. This pattern has been seen in most The clinical significance of Yt antibodies in the populations studied, although the rarity of anti-Yt b has transfusion arena has attracted a great deal of attention limited the volume of screening possible. 4,5 Studies in and has caused an even greater amount of conster- Japan indicate thatYt a may be of higher frequency, since nation. Most work has been done on examples of no Yt(a–) individuals were detected in tests on 5000 anti-Yt a, since examples of anti-Yt b are so rare. Over a donors, and no Yt(b+) samples were found among the dozen studies have been performed on a varying 70 tested with anti-Yt b.5 On the other hand, Yt b appears number of examples of antibody, using a variety of to be more prevalent in Israel, where it was found in 24 clinical significance indicators: 51 Cr survival studies, to 26 percent of individuals tested. This finding was monocyte-monolayer assay (MMA), transfusion of accompanied by a relative lowering of the incidence of antigen-positive cells, and/or combinations of the Yt a. The incidence of the rare Yt(a–b+) phenotype in above. The conclusion: Many examples are benign, i.e., Israel was estimated to be 1 in 65, compared to an not clinically significant. However, other examples estimated 1 in 500 in the United States. 5 have caused shortened RBC survival of transfused antigen-positive cells and Table 2. Yt blood group antigens at least one has caused a delayed 5 First Incidence (%) hemolytic transfusion reaction.
Recommended publications
  • Genes and Human History
    Genes and human history Gil McVean, Department of Statistics, Oxford Contact: [email protected] 2 3 • Where does the variation come from? • How old are the genetic differences between us? • Are these differences important? How different are our genomes? 5 Serological techniques for detecting variation Rabbit Anti-A antibodies Human A A B AB O 6 Blood group systems in humans • 28 known systems – 39 genes, 643 alleles System Genes Alleles Knops CR1 24+ ABO ABO 102 Landsteiner- ICAM4 3 Wiener Colton C4A, C4B 7+ Lewis FUT3, FUT6 14/20 Chido-rodgers AQP1 7 Lutheran LU 16 Colton DAF 10 MNS GYPA,GYPB,G 43 Diego SLC4A1 78 YPE Dombrock DO 9 OK BSG 2 Duffy FY 9 P-related A4GALT, 14/5 Gerbich GYPC 9 B3GALT3 GIL AQP3 2 RAPH-MER2 CD151 3 H/h FUT1, FUT2 27/22 Rh RHCE, RHD, 129 I GCNT2 7 RHAG Indian CD44 2 Scianna ERMAP 4 Kell KEL, XK 33/30 Xg XG, CD99 - Kidd SLC14A1 8 YT ACHE 4 http://www.bioc.aecom.yu.edu/bgmut/summary.htm 7 Protein electroporesis • Changes in mass/charge ratio resulting from amino acid substitutions in proteins can be detected Starch or agar gel -- +- + +- - - - -- - + - + +- -- Direction of travel • In humans, about 30% of all loci show polymorphism with a 6% chance of a pair of randomly drawn alleles at a locus being different Lewontin and Hubby (1966) Harris(1966) 8 The rise of DNA sequencing GATAAGACGGTGATACTCACGCGACGGGCTTGGGCGCCGACTCGTTCAGACGGTGACCCAACTTATCCGATCGACCC CGGGTCCCGATTTAGACTCGGTATCATTTCTGGTGATTATCGCCTGCAGGTTCAAGAACACGTTTGCAGCAAGAAGT GAGGGATTTTGTCAGTGATCCCAGTCTACGGAGCCAGTCACCTCTGGTAGTGAAATTTTATTCGTTCATCTTCATAT AAGTCGCAGACCGCACGATGGGGGACAGAATACTCGCACAGGAAGAACCGCGATGAACCGAGGTAACCTAACATCCT
    [Show full text]
  • Blood Bank I D
    The Osler Institute Blood Bank I D. Joe Chaffin, MD Bonfils Blood Center, Denver, CO The Fun Just Never Ends… A. Blood Bank I • Blood Groups B. Blood Bank II • Blood Donation and Autologous Blood • Pretransfusion Testing C. Blood Bank III • Component Therapy D. Blood Bank IV • Transfusion Complications * Noninfectious (Transfusion Reactions) * Infectious (Transfusion-transmitted Diseases) E. Blood Bank V (not discussed today but available at www.bbguy.org) • Hematopoietic Progenitor Cell Transplantation F. Blood Bank Practical • Management of specific clinical situations • Calculations, Antibody ID and no-pressure sample questions Blood Bank I Blood Groups I. Basic Antigen-Antibody Testing A. Basic Red Cell-Antibody Interactions 1. Agglutination a. Clumping of red cells due to antibody coating b. Main reaction we look for in Blood Banking c. Two stages: 1) Coating of cells (“sensitization”) a) Affected by antibody specificity, electrostatic RBC charge, temperature, amounts of antigen and antibody b) Low Ionic Strength Saline (LISS) decreases repulsive charges between RBCs; tends to enhance cold antibodies and autoantibodies c) Polyethylene glycol (PEG) excludes H2O, tends to enhance warm antibodies and autoantibodies. 2) Formation of bridges a) Lattice structure formed by antibodies and RBCs b) IgG isn’t good at this; one antibody arm must attach to one cell and other arm to the other cell. c) IgM is better because of its pentameric structure. P}Chaffin (12/28/11) Blood Bank I page 1 Pathology Review Course 2. Hemolysis a. Direct lysis of a red cell due to antibody coating b. Uncommon, but equal to agglutination. 1) Requires complement fixation 2) IgM antibodies do this better than IgG.
    [Show full text]
  • ISBT Working Party on Terminology for Red Cell Surface Antigens J
    International Society of Blood Transfusion Societe lnternationale de Transfusion Sanguine Section Editor: H. Gunson, Manchester Vox Sang 1995;69:265-279 G. L. Daniels (Chair) D. J. Anstee, J. I? Cartron Blood Group Terminology 1995 ctl Dahr; I?D. Issitt ISBT Working Party on Terminology for Red Cell Surface Antigens J. J~irgensen,L. Kornstad C. Levene, C. Lomas-Francis A. Lubenko, D. Mallory J.J. Moulds, t: Okubo M. Overbreke, M. E. Reid I? Rouger, S. Seidl I? Sistonen, S. Wendel G. Woodfield, i? Zelinski Since the first human blood groups were discovered al- tions on red cell antigens. Much of the information provided most a century ago, many hundreds of new red cell antigens in the 1990 monograph [l] is reiterated here so that referral have been identified. Because of the extended time period back will not generally be required, but only references after over which these antigens were discovered, a variety of dif- 1990 are provided. ferent terminologies has been introduced. In some cases single capital letters were used (A, B, M, K), in some super- scripts distinguished allelic products (Fy’, Fyh),and in some ISBT Numerical Terminology a numerical notation was introduced (Fy3). Some antigens were given different names in different laboratories, based The mandate of the Working Party is to provide a termi- on alternative genetic theories (D and Rho). nology for red cell surface antigens. By definition, these an- In 1980 the International Society of Blood Transfusion tigens must be defined serologically by the use of a specific (ISBT) established a Working Party to devise a genetically antibody.
    [Show full text]
  • Genetic Variants Within the Erythroid Transcription Factor, KLF1, And
    Accepted Manuscript Genetic Variants within the Erythroid Transcription Factor, KLF1, and Reduction of the Expression of Lutheran and Other Blood Group Antigens: Review of the in(Lu) Phenotype Nicole S. Fraser, Christine M. Knauth, Assia Moussa, Melinda M. Dean, Catherine A. Hyland, Andrew C. Perkins, Robert L. Flower, Elizna M. Schoeman PII: S0887-7963(18)30146-9 DOI: https://doi.org/10.1016/j.tmrv.2019.01.004 Reference: YTMRV 50565 To appear in: Transfusion Medicine Reviews Please cite this article as: N.S. Fraser, C.M. Knauth, A. Moussa, et al., Genetic Variants within the Erythroid Transcription Factor, KLF1, and Reduction of the Expression of Lutheran and Other Blood Group Antigens: Review of the in(Lu) Phenotype, Transfusion Medicine Reviews, https://doi.org/10.1016/j.tmrv.2019.01.004 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. ACCEPTED MANUSCRIPT Genetic variants within the erythroid transcription factor, KLF1, and reduction of the expression of Lutheran and other blood group antigens: review of the In(Lu) phenotype Nicole S. Fraser* a,b, Christine M. Knauth* a,b , Assia Moussa a,b, Melinda M. Dean a, Catherine A. Hyland a,b, Andrew C.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name erythroblast membrane-associated protein (Scianna blood group) Gene Symbol ERMAP Organism Human Gene Summary The protein encoded by this gene is a cell surface transmembrane protein that may act as an erythroid cell receptor possibly as a mediator of cell adhesion. Polymorphisms in this gene are responsible for the Scianna/Radin blood group system. Two transcript variants encoding the same protein have been found for this gene. Gene Aliases MGC118810, MGC118811, MGC118812, MGC118813, PRO2801, RD, SC RefSeq Accession No. NC_000001.10, NG_008749.1, NT_032977.9 UniGene ID Hs.439437 Ensembl Gene ID ENSG00000164010 Entrez Gene ID 114625 Assay Information Unique Assay ID qHsaCID0021524 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000372517, ENST00000372514, ENST00000328249 Amplicon Context Sequence GACCAAGGGTCTTACCGATGTCTGATCCAAGTTGGAAATCTGAGTAAAGAGGAC ACCGTGATCCTGCAGGTTGCAGCCCCATCTGTGGGGAGTCTCTCCCCCTCAGCA GTGGCTCTGGCTGTGATCCTGCCTGTCCTGGTACTTCTCATCATGGTGTGCCTTT GCCTTATCTGGAAGCA Amplicon Length (bp) 149 Chromosome Location 1:43296711-43300811 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 102 R2 0.9968 cDNA Cq 22.45 cDNA Tm (Celsius) 86 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 40.23 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report ERMAP, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference
    [Show full text]
  • ERMAP Antibody (Monoclonal) (M01) Mouse Monoclonal Antibody Raised Against a Partial Recombinant ERMAP
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 ERMAP Antibody (monoclonal) (M01) Mouse monoclonal antibody raised against a partial recombinant ERMAP. Catalog # AT1943a Specification ERMAP Antibody (monoclonal) (M01) - Product Information Application WB, E Primary Accession Q96PL5 Other Accession NM_001017922 Reactivity Human Host mouse Clonality Monoclonal Isotype IgG2a Kappa Calculated MW 52605 ERMAP Antibody (monoclonal) (M01) - Additional Information Antibody Reactive Against Recombinant Protein.Western Blot detection against Gene ID 114625 Immunogen (36.74 KDa) . Other Names Erythroid membrane-associated protein, hERMAP, Radin blood group antigen, Scianna blood group antigen, ERMAP, RD, SC Target/Specificity ERMAP (NP_001017922, 376 a.a. ~ 475 a.a) partial recombinant protein with GST tag. MW of the GST tag alone is 26 KDa. Dilution WB~~1:500~1000 Format ERMAP monoclonal antibody (M01), clone Clear, colorless solution in phosphate 6F8 Western Blot analysis of ERMAP buffered saline, pH 7.2 . expression in HeLa ( (Cat # AT1943a ) Storage Store at -20°C or lower. Aliquot to avoid repeated freezing and thawing. Precautions ERMAP Antibody (monoclonal) (M01) is for research use only and not for use in diagnostic or therapeutic procedures. ERMAP Antibody (monoclonal) (M01) - Detection limit for recombinant GST tagged Page 1/2 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Protocols ERMAP is approximately 0.1ng/ml as a capture antibody. Provided below are standard protocols that you may find useful for product applications. ERMAP Antibody (monoclonal) (M01) - • Western Blot Background • Blocking Peptides • Dot Blot The protein encoded by this gene is a cell • Immunohistochemistry surface transmembrane protein that may act • Immunofluorescence as an erythroid cell receptor, possibly as a • Immunoprecipitation mediator of cell adhesion.
    [Show full text]
  • Jka, Jkb, Jk – Co-Dominant Inheritance – Jk Is a Silent Allele
    Kidd Blood Group System Qun Lu, MD Assistant Professor Division of Transfusion Medicine Department of Pathology and Laboratory Medicine UCLA, School of Medicine Los Angeles, California 02-05-2009 History of Kidd Blood Group System . Jka was discovered in 1951 by Allen: Mrs. Kidd had hemolytic disease of newborn (HDN) in her son. A new RBC alloantibody was detected in her serum, reacted with her husband’s RBCs. Jkb was found in 1953 by Plaut . The antigens were independent of other known blood groups. They named after Mrs. Kidd. Jk null phenotyp was found in 1959 by Pinkerton. Since the specificities were inseparable, the antibody was renamed anti-Jk3 which recognizes an antigen found whenever Jka or Jkb is present. ISBT Human Blood Group Systems ISBT Number Name Abbreviation 001 ABO ABO 002 MNS MNS 003 P P 004 Rh RH 005 Lutheran LU 006 Kell KEL 007 Lewis LE 008 Duffy FY 009 Kidd JK 010 Diego DI 011 Cartwright YT 012 XG XG 013 Scianna SC 014 Dombrock DO 015 Colton CO 016 Landsteiner-Wiener LW 017 Chido/Rodgers CH/RG 018 Hh H 019 Kx XK 020 Gerbich GE 021 Cromer CROM 022 Knops KN 023 Indian IN 024 Ok OK 025 Raph RAPH Kidd Antigens . Genotype: – Genes located on chromosome 18 – Three alleles Jka, Jkb, Jk – Co-dominant Inheritance – Jk is a silent allele . Common antigen ---- JK3 Ag: – Present with Jka and/or Jkb antigens – Whenever you have Jka or Jkb antigens on the RBC you also have Jk3 antigen. – Anti- Jk3 is against Jka,Jkb, Jk3 antigens, transfuse with Jk(a-b-) blood, very difficult to find Homozygous Heterozygous for Jka or Jkb for JKa and Jkb.
    [Show full text]
  • Mirepoix LLC on Behalf of Caris Life Sciences, June 22, 2020 No Revisions to These Recommendations
    0211U Oncology (pan-tumor), DNA and RNA by next generation sequencing, utilizing formalin-fixed paraffin-embedded tissue, interpretative report for single nucleotide variants, copy number alterations, tumor mutational burden, and microsatellite instability, with therapy association Submitted by Joel de Jesus, Mirepoix LLC on behalf of Caris Life Sciences, June 22, 2020 No revisions to these recommendations 0211U: MI Cancer Seek™ - NGS analysis C. Public Comment Rationale • Recommendation to crosswalk 0211U MI Cancer Seek is a combined whole transcriptome AND whole exome to 0019U (NLA=$3675.00) + 0036U sequencing test that is equivalent to (NLA=$4780.00) performing both: • 0019U: Oncology, RNA, gene expression • 1x multiplier for each by whole transcriptome sequencing, formalin-fixed paraffin-embedded tissue • Recommendation of an NLA equal to or fresh frozen tissue, predictive $8455 for 0211U algorithm reported as potential targets for therapeutic agents • 0036U: Exome (ie, somatic mutations), paired formalin-fixed paraffin-embedded tumor tissue and normal specimen, sequence analyses Submitted by Joel de Jesus, Mirepoix LLC on behalf of Caris Life Sciences, June 22, 2020 No revisions to these recommendations 0211U: MI Cancer Seek™ - NGS analysis C. 0019U* 0211U 0036U** Assay type Whole Whole Whole Whole Transcriptome Transcriptome Exome Exome Sequencing Sequencing Sequencing Sequencing Platform NGS NGS (Illumina) NGS (Illumina) RNASeq RNASeq & DNASeq DNASeq Samples tested FFPE & frozen tumor tissue FFPE tumor tissue FFPE tumor tissue
    [Show full text]
  • The Phylogeny of 48 Alleles, Experimentally Verified at 21 Kb
    Srivastava et al. J Transl Med (2019) 17:43 https://doi.org/10.1186/s12967-019-1791-9 Journal of Translational Medicine RESEARCH Open Access The phylogeny of 48 alleles, experimentally verifed at 21 kb, and its application to clinical allele detection Kshitij Srivastava1, Kurt R. Wollenberg2 and Willy A. Flegel1* Abstract Background: Sequence information generated from next generation sequencing is often computationally phased using haplotype-phasing algorithms. Utilizing experimentally derived allele or haplotype information improves this prediction, as routinely used in HLA typing. We recently established a large dataset of long ERMAP alleles, which code for protein variants in the Scianna blood group system. We propose the phylogeny of this set of 48 alleles and identify evolutionary steps to derive the observed alleles. Methods: The nucleotide sequence of > 21 kb each was used for all physically confrmed 48 ERMAP alleles that we previously published. Full-length sequences were aligned and variant sites were extracted manually. The Bayesian coalescent algorithm implemented in BEAST v1.8.3 was used to estimate a coalescent phylogeny for these variants and the allelic ancestral states at the internal nodes of the phylogeny. Results: The phylogenetic analysis allowed us to identify the evolutionary relationships among the 48 ERMAP alleles, predict 4243 potential ancestral alleles and calculate a posterior probability for each of these unobserved alleles. Some of them coincide with observed alleles that are extant in the population. Conclusions: Our proposed strategy places known alleles in a phylogenetic framework, allowing us to describe as-yet-undiscovered alleles. In this new approach, which relies heavily on the accuracy of the alleles used for the phylogenetic analysis, an expanded set of predicted alleles can be used to infer alleles when large genotype data are analyzed, as typically generated by high-throughput sequencing.
    [Show full text]
  • Blood Product Molecular Antigen Typing
    UnitedHealthcare® Medicare Advantage Policy Guideline Blood Product Molecular Antigen Typing Guideline Number: MPG388.01 Approval Date: February 10, 2021 Terms and Conditions Table of Contents Page Related Medicare Advantage Policy Guidelines Policy Summary ............................................................................. 1 • Clinical Diagnostic Laboratory Services Applicable Codes .......................................................................... 2 • Molecular Pathology/Molecular References ..................................................................................... 7 Diagnostics/Genetic Testing Guideline History/Revision Information ....................................... 8 Purpose .......................................................................................... 9 Related Medicare Advantage Coverage Summaries Terms and Conditions ................................................................... 9 • Genetic Testing • Laboratory Tests and Services Policy Summary See Purpose Overview Based on the Centers for Medicare & Medicaid Services (CMS) Program Integrity Manual (100-08), this policy addresses the circumstances under which the item or service is reasonable and necessary under the Social Security Act, §1862(a)(1)(A). For laboratory services, a service can be reasonable and necessary if the service is safe and effective; and appropriate, including the duration and frequency that is considered appropriate for the item or service, in terms of whether it is furnished in accordance with accepted
    [Show full text]
  • An Introduction to Blood Groups
    1405153490_4_001.qxd 8/16/06 9:21 AM Page 1 An introduction to blood groups CHAPTER 1 What is a blood group? In 1900, Landsteiner showed that people could be divided into three groups (now called A, B, and O) on the basis of whether their red cells clumped when mixed with separated sera from people. A fourth group (AB) was soon found. This is the origin of the term ‘blood group’. A blood group could be defined as, ‘An inherited character of the red cell surface, detected by a specific alloantibody’. Do blood groups have to be present on red cells? This is the usual meaning, though platelet- and neutrophil-specific antigens might also be called blood groups. In this book only red cell surface antigens are considered. Blood groups do not have to be red cell specific, or even blood cell specific, and most are also detected on other cell types. Blood groups do have to be detected by a specific antibody: polymorphisms suspected of being present on the red cell surface, but only detected by other means, such as DNA sequencing, are not blood groups. Furthermore, the antibodies must be alloantibod- ies, implying that some individuals lack the blood group. Blood group antigens may be: • proteins; • glycoproteins, with the antibody recognising primarily the polypeptide backbone; • glycoproteins, with the antibody recognising the carbohydrate moiety; • glycolipids, with the antibody recognising the carbohydrate portion. Blood group polymorphisms may be as fundamental as representing the presence or absence of the whole macromolecule (e.g. RhD), or as minor as a single amino acid change (e.g.
    [Show full text]
  • The Kidd System
    A review: the Kidd system R. MOUGEY After the rediscovery of the principle of the an- The antibody is not thought to be merely anti-Jk sup(a) + tiglobulin test and its introduction as the direct or in- anti-Jksup(b), because immunized Jk(a- b - ) individuals make direct "Coombs" test, there was a period of rapid anti-Jk3 whether they are sensitized by the Jksup(a) or Jk sup(b) discovery of new blood group systems that were im- antigen. Also the sera of Jk(a-b-) individuals often portant to blood transfusion therapy. One of the most contain a separable anti-Jksup(a) or -Jksup(b) component. Since important was the recognition of the Kidd blood group no individual has yet been found that is Jk(a+) or Jk(b+) system in 1951.sup(1) The patient, a Mrs. Kidd, had a new and Jk: - 3, the anti-Jk3 is thought to recognize a shared antibody in her serum and gave birth to an infant with determinant that is on all red cells of common Jk hemolytic disease of the newborn (HDN). The antibody phenotypes. The most recent evidence in support of was named anti-Jksup(a) The "J" was added to avoid con- the Jk3 antigen is the discovery of persons who are fusion with the Kell antigen. In retrospect, this case phenotypically Jk(a -b - ), Jk:3.5 of HDN is a curiosity since Kidd antibodies do not There is some controversy about the expression of typically cause significant HDN.sup(2) Other examples were theJk3 antigen in the presence of the Jk gene.
    [Show full text]