DOCSLIB.ORG

Comprehensive Product List

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Comprehensive Product List Catalog # Product Description Retail Price OEM Price 1007 Antibody IL-1R associated kinase 225/100ug 125/100ug 1009 Antibody HIV & chemokine receptor 225/100ug 125/100ug 1012 Antibody HIV & chemokine receptor 225/100ug 125/100ug 1021 Antibody JAK activated transcription 225/100ug 125/100ug 1107 Antibody Tyrosine kinase substrate p62DOK 225/100ug 125/100ug 1112 Antibody HIV & chemokine receptor 225/100ug 125/100ug 1113 Antibody Ligand for DR4 and DR5 225/100ug 125/100ug 1115 Antibody Adapter Molecule 225/100ug 125/100ug 1117 Antibody Adapter Molecule 225/100ug 125/100ug 1120 Antibody Cell Death Receptor 225/100ug 125/100ug 1121 Antibody Ligand for GFRa-2 225/100ug 125/100ug 1123 Antibody CCR3 ligand 225/100ug 125/100ug 1125 Antibody Tyrosine kinase substrate 225/100ug 125/100ug 1128 Antibody A new caspase 225/100ug 125/100ug 1129 Antibody NF-kB inducing kinase 225/100ug 125/100ug 1131 Antibody TNFa converting enzyme 225/100ug 125/100ug 1133 Antibody GDNF receptor 225/100ug 125/100ug 1135 Antibody Neurturin receptor 225/100ug 125/100ug 1137 Antibody Persephin receptor 225/100ug 125/100ug 1139 Antibody Death Receptor for TRAIL 225/100ug 125/100ug 1141 Antibody DNA fragmentation factor & Inhibitor of CAD 225/100ug 125/100ug 1148 Antibody DNA fragmentation factor & Inhibitor of CAD 225/100ug 125/100ug 1150 Antibody Activator of MAPK pathway 225/100ug 125/100ug 1151 Antibody Apoptosis Signal-regulation Kinase 225/100ug 125/100ug 1156 Antibody FLICE inhibitory protein 225/100ug 125/100ug 1158 Antibody Cell Death Receptor 225/100ug 125/100ug 1159 Antibody FLICE inhibitory protein 225/100ug 125/100ug 1161 Antibody FLICE inhibitory protein 225/100ug 125/100ug 1163 Antibody Adapter Molecule 225/100ug 125/100ug 1166 Antibody Cell Death Receptor 225/100ug 125/100ug 1167 Antibody Death Receptor for TRAIL 225/100ug 125/100ug 1170 Antibody HIV coreceptor 225/100ug 125/100ug 2001 Antibody Inhibitor of CAD 225/100ug 125/100ug 2003 Antibody Inhibitor of CAD 225/100ug 125/100ug 2007 Antibody Caspase Activated DNase 225/100ug 125/100ug 2011 Antibody Caspase Activated DNase 225/100ug 125/100ug 2013 Antibody Apoptosis Protease Activating Factor 225/100ug 125/100ug 2015 Antibody Apoptosis Protease Activating Factor 225/100ug 125/100ug 2019 Antibody Death Receptor for TRAIL 225/100ug 125/100ug 2021 Antibody Decoy Receptor 2 for TRAIL 225/100ug 125/100ug 2025 Antibody IkB kinase alpha 225/100ug 125/100ug 2051 Antibody TNFa converting enzyme 225/100ug 125/100ug 2055 Antibody FLICE inhibitory protein 225/100ug 125/100ug 2059 Antibody DNase involved in apoptosis 225/100ug 125/100ug 2065 Antibody A new member in Bcl-2 family 225/100ug 125/100ug 2067 Antibody Apoptosis inducing kinase 225/100ug 125/100ug 2071 Antibody A new caspase 225/100ug 125/100ug 2073 Antibody A new caspase 225/100ug 125/100ug 2075 Antibody RIP-like Interacting CLARP Kinase 225/100ug 125/100ug 2081 Antibody Apoptosis Repressor with CARD domain 225/100ug 125/100ug 2085 Antibody Cell death-Inducing DFF-like Effector 225/100ug 125/100ug 2089 Antibody Cell death-Inducing DFF-like Effector 225/100ug 125/100ug 2091 Antibody Cell death-Inducing DFF-like Effector 225/100ug 125/100ug 2093 Antibody HIV & chemokine receptor 225/100ug 125/100ug 2097 Antibody HIV & chemokine receptor 225/100ug 125/100ug 2101 Antibody HIV coreceptor 225/100ug 125/100ug 2107 Antibody Caspase Activated DNase 225/100ug 125/100ug 2115 Antibody IkB kinase alpha 225/100ug 125/100ug 2117 Antibody IkB kinase alpha 225/100ug 125/100ug 2121 Antibody IkB kinase beta 225/100ug 125/100ug 2123 Antibody IL-1R associated kinase 225/100ug 125/100ug 2125 Antibody Adapter in IL-1 & LPS signal 225/100ug 125/100ug 2127 Antibody Adapter in IL-1 & LPS signal 225/100ug 125/100ug 2129 Antibody IL-1R accessory protein 225/100ug 125/100ug 2131 Antibody IL-1R accessory protein 225/100ug 125/100ug 2133 Antibody Amyloid protein precursor 225/100ug 125/100ug 2136 Antibody Amyloid protein precursor 225/100ug 125/100ug 2140 Antibody Decoy Receptor for FASL and LIGHT 225/100ug 125/100ug 2143 Antibody Silencer Of Death Domains 225/100ug 125/100ug 2147 Antibody DAPK Related Apoptosis-inducing Kinase 225/100ug 125/100ug 2149 Antibody DAPK Related Apoptosis-inducing Kinase 225/100ug 125/100ug 2153 Antibody Caspase Activated DNase 225/100ug 125/100ug 2155 Antibody Caspase Activated DNase 225/100ug 125/100ug 2157 Antibody Death Receptor 6 225/100ug 125/100ug 2161 Antibody Involved in apoptosis and tumor 225/100ug 125/100ug 2179 Antibody Decoy Receptor 1 for TRAIL 225/100ug 125/100ug 2183 Antibody RIP-like Interacting CLARP Kinase 225/100ug 125/100ug 2185 Antibody Apoptosis Repressor with CARD domain 225/100ug 125/100ug 2201 Antibody HIV & chemokine receptor 225/100ug 125/100ug 2209 Antibody HIV coreceptor 225/100ug 125/100ug 2213 Antibody IL-1R Associated Kinase 225/100ug 125/100ug 2215 Antibody Inducer of chromatin condensation 225/100ug 125/100ug 2217 Antibody Inducer of chromatin condensation 225/100ug 125/100ug 2219 Antibody Inducer of chromatin condensation 225/100ug 125/100ug 2221 Antibody B cell Activating Factor in TNF Family 225/100ug 125/100ug 2223 Antibody A new member in the TNF family 225/100ug 125/100ug 2227 Antibody A novel regulator of apoptosis 225/100ug 125/100ug 2233 Antibody A new inhibitor of apoptosis 225/100ug 125/100ug 2235 Antibody A new inhibitor of apoptosis 225/100ug 125/100ug 2237 Antibody A new inhibitor of apoptosis 225/100ug 125/100ug 2239 Antibody Apoptosis Inducing Factor 225/100ug 125/100ug 2241 Antibody Inducer of chromatin condensation 225/100ug 125/100ug 2245 Antibody Evolutionarily Related ICE 225/100ug 125/100ug 2247 Antibody Beta-site APP Cleaving Enzyme 2 225/100ug 125/100ug 2249 Antibody Beta-site APP Cleaving Enzyme 2 225/100ug 125/100ug 2253 Antibody Beta-site APP Cleaving Enzyme 225/100ug 125/100ug 2267 Antibody Apoptosis Inducing Factor 225/100ug 125/100ug 2271 Antibody Homolog of CED4 225/100ug 125/100ug 2279 Antibody A novel death receptor-binding protein 225/100ug 125/100ug 2283 Antibody Mouse Receptor Interacting Protein 3 225/100ug 125/100ug 2287 Antibody A novel CARD-containing adaptor protein 225/100ug 125/100ug 2289 Antibody A new member in Bcl2 family 225/100ug 125/100ug 2299 Antibody Decoy Receptor 1 for TRAIL 225/100ug 125/100ug 2301 Antibody Apoptosis Inducing Factor 225/100ug 125/100ug 2323 Antibody Death-Associated Protein kinase 2 225/100ug 125/100ug 2325 Antibody A casp. in Apoptosis & Alzheimer's Disease 225/100ug 125/100ug 2327 Antibody A new caspase 225/100ug 125/100ug 2329 Antibody IkB Kinase epsilon 225/100ug 125/100ug 2335 Antibody IkB Kinase gamma 225/100ug 125/100ug 2347 Antibody A novel HIV biding protein 225/100ug 125/100ug 2349 Antibody A novel HIV biding protein 225/100ug 125/100ug 2351 Antibody NF-kB activating kinase 225/100ug 125/100ug 2355 Antibody A novel IL-1R Associated Kinase 225/100ug 125/100ug 2383 Antibody A novel ribonucleotide reductase 225/100ug 125/100ug 2391 Antibody A novel check point kinase 225/100ug 125/100ug 2395 Antibody Receptor for BAFF and APRIL 225/100ug 125/100ug 2397 Antibody Receptor for BAFF and APRIL 225/100ug 125/100ug 2409 Antibody IAPs binding protein 225/100ug 125/100ug 2411 Antibody IAPs binding protein 225/100ug 125/100ug 2415 Antibody A new member in the TNF family 225/100ug 125/100ug 2443 Antibody Involved in P53 deacetylation 225/100ug 125/100ug 2447 Antibody MDM2 binding protein 225/100ug 125/100ug 2451 Antibody A mediator of p53 induced apoptosis 225/100ug 125/100ug 2465 Antibody Interleukin 21, related to IL2 and IL15 225/100ug 125/100ug 2469 Antibody Interleukin 21 receptor 225/100ug 125/100ug 2471 Antibody Interleukin 21 receptor 225/100ug 125/100ug 2481 Antibody A new T cell cytokine receptor 225/100ug 125/100ug 2483 Antibody A new T cell cytokine receptor 225/100ug 125/100ug 2489 Antibody Interleukin 22 receptor 225/100ug 125/100ug 2497 Antibody Interleukin 22 receptor 225/100ug 125/100ug 2499 Antibody A novel NF-kB activator 225/100ug 125/100ug 2501 Antibody A novel NF-kB activator 225/100ug 125/100ug 2505 Antibody A novel member in IAP family 225/100ug 125/100ug 2515 Antibody A new CARD-containing protein 225/100ug 125/100ug 3017 Antibody A novel member in IAP family 225/100ug 125/100ug 3025 Antibody An apoptosis related protein 225/100ug 125/100ug 3029 Antibody A new member in Bcl-2 family 225/100ug 125/100ug 3031 Antibody A new member in Bcl-2 family 225/100ug 125/100ug 3035 Antibody Endonuclease G 225/100ug 125/100ug 3041 Antibody A novel member in Bcl-2 family 225/100ug 125/100ug 3043 Antibody A novel member in Bcl-2 family 225/100ug 125/100ug 3045 Antibody Apoptosis-associated p53 target 225/100ug 125/100ug 3097 Antibody Receptor for BAFF 225/100ug 125/100ug 3125 Antibody A member in IRAK/Pelle family 225/100ug 125/100ug 3145 Antibody Regulator of mitochondrion apoptosis 225/100ug 125/100ug 3147 Antibody Regulator of mitochondrion apoptosis 225/100ug 125/100ug 3149 Antibody Regulator of mitochondrion apoptosis 225/100ug 125/100ug 3151 Antibody Regulator of mitochondrion apoptosis 225/100ug 125/100ug 3152 Antibody Regulator of mitochondrion apoptosis 225/100ug 125/100ug 3215 Antibody - New Angiotensin-converting enzyme 2, SARS receptor 225/100ug 125/100ug 3217 Antibody - New Angiotensin-converting enzyme 2, SARS receptor 225/100ug 125/100ug 3227 Antibody - New Angiotensin-converting enzyme 2, SARS receptor 225/100ug 125/100ug 3229 Antibody - New Angiotensin-converting enzyme 2, SARS receptor 225/100ug 125/100ug 3206 Antibody - New Toll-like receptor adaptor protein 225/100ug 125/100ug 3207 Antibody - New Inhibitor of XIAP
Load more

Recommended publications
  • Cytokine Nomenclature
    RayBiotech, Inc. The protein array pioneer company Cytokine Nomenclature Cytokine Name Official Full Name Genbank Related Names Symbol 4-1BB TNFRSF Tumor necrosis factor NP_001552 CD137, ILA, 4-1BB ligand receptor 9 receptor superfamily .2. member 9 6Ckine CCL21 6-Cysteine Chemokine NM_002989 Small-inducible cytokine A21, Beta chemokine exodus-2, Secondary lymphoid-tissue chemokine, SLC, SCYA21 ACE ACE Angiotensin-converting NP_000780 CD143, DCP, DCP1 enzyme .1. NP_690043 .1. ACE-2 ACE2 Angiotensin-converting NP_068576 ACE-related carboxypeptidase, enzyme 2 .1 Angiotensin-converting enzyme homolog ACTH ACTH Adrenocorticotropic NP_000930 POMC, Pro-opiomelanocortin, hormone .1. Corticotropin-lipotropin, NPP, NP_001030 Melanotropin gamma, Gamma- 333.1 MSH, Potential peptide, Corticotropin, Melanotropin alpha, Alpha-MSH, Corticotropin-like intermediary peptide, CLIP, Lipotropin beta, Beta-LPH, Lipotropin gamma, Gamma-LPH, Melanotropin beta, Beta-MSH, Beta-endorphin, Met-enkephalin ACTHR ACTHR Adrenocorticotropic NP_000520 Melanocortin receptor 2, MC2-R hormone receptor .1 Activin A INHBA Activin A NM_002192 Activin beta-A chain, Erythroid differentiation protein, EDF, INHBA Activin B INHBB Activin B NM_002193 Inhibin beta B chain, Activin beta-B chain Activin C INHBC Activin C NM005538 Inhibin, beta C Activin RIA ACVR1 Activin receptor type-1 NM_001105 Activin receptor type I, ACTR-I, Serine/threonine-protein kinase receptor R1, SKR1, Activin receptor-like kinase 2, ALK-2, TGF-B superfamily receptor type I, TSR-I, ACVRLK2 Activin RIB ACVR1B
    [Show full text]
  • Katalog 2015 Cover Paul Lin *Hinweis Förderung.Indd
    Product List 2015 WE LIVE SERVICE Certificates quartett owns two productions sites that are certified according to EN ISO 9001:2008 Quality management systems - Requirements EN ISO 13485:2012 + AC:2012 Medical devices - Quality management systems - Requirements for regulatory purposes GMP Conformity Our quality management guarantees products of highest quality! 2 Foreword to the quartett product list 2015 quartett Immunodiagnostika, Biotechnologie + Kosmetik Vertriebs GmbH welcomes you as one of our new business partners as well as all of our previous loyal clients. You are now member of quartett´s worldwide customers. First of all we would like to introduce ourselves to you. Founded as a family-run company in 1986, quartett ensures for more than a quarter of a century consistent quality of products. Service and support of our valued customers are our daily businesses. And we will continue! In the end 80´s quartett offered radioimmunoassay and enzyme immunoassay kits from different manufacturers in the USA. In the beginning 90´s the company changed its strategy from offering products for routine diagnostic to the increasing field of research and development. Setting up a production plant in 1997 and a second one in 2011 supported this decision. The company specialized its product profile in the field of manufacturing synthetic peptides for antibody production, peptides such as protease inhibitors, biochemical reagents and products for histology, cytology and immunohistology. All products are exclusively manufactured in Germany without outsourcing any production step. Nowadays, we expand into all other diagnostic and research fields and supply our customers in universities, government institutes, pharmaceutical and biotechnological companies, hospitals, and private doctor offices.
    [Show full text]
  • TNF Decoy Receptors Encoded by Poxviruses
    pathogens Review TNF Decoy Receptors Encoded by Poxviruses Francisco Javier Alvarez-de Miranda † , Isabel Alonso-Sánchez † , Antonio Alcamí and Bruno Hernaez * Centro de Biología Molecular Severo Ochoa, Consejo Superior de Investigaciones Científicas, Campus de Cantoblanco, Universidad Autónoma de Madrid, Nicolás Cabrera 1, 28049 Madrid, Spain; [email protected] (F.J.A.-d.M.); [email protected] (I.A.-S.); [email protected] (A.A.) * Correspondence: [email protected]; Tel.: +34-911-196-4590 † These authors contributed equally. Abstract: Tumour necrosis factor (TNF) is an inflammatory cytokine produced in response to viral infections that promotes the recruitment and activation of leukocytes to sites of infection. This TNF- based host response is essential to limit virus spreading, thus poxviruses have evolutionarily adopted diverse molecular mechanisms to counteract TNF antiviral action. These include the expression of poxvirus-encoded soluble receptors or proteins able to bind and neutralize TNF and other members of the TNF ligand superfamily, acting as decoy receptors. This article reviews in detail the various TNF decoy receptors identified to date in the genomes from different poxvirus species, with a special focus on their impact on poxvirus pathogenesis and their potential use as therapeutic molecules. Keywords: poxvirus; immune evasion; tumour necrosis factor; tumour necrosis factor receptors; lymphotoxin; inflammation; cytokines; secreted decoy receptors; vaccinia virus; ectromelia virus; cowpox virus Citation: Alvarez-de Miranda, F.J.; Alonso-Sánchez, I.; Alcamí, A.; 1. TNF Biology Hernaez, B. TNF Decoy Receptors TNF is a potent pro-inflammatory cytokine with a broad range of biological effects, Encoded by Poxviruses. Pathogens ranging from the activation of inflammatory gene programs to cell differentiation or 2021, 10, 1065.
    [Show full text]
  • TRAIL and Cardiovascular Disease—A Risk Factor Or Risk Marker: a Systematic Review
    Journal of Clinical Medicine Review TRAIL and Cardiovascular Disease—A Risk Factor or Risk Marker: A Systematic Review Katarzyna Kakareko 1,* , Alicja Rydzewska-Rosołowska 1 , Edyta Zbroch 2 and Tomasz Hryszko 1 1 2nd Department of Nephrology and Hypertension with Dialysis Unit, Medical University of Białystok, 15-276 Białystok, Poland; [email protected] (A.R.-R.); [email protected] (T.H.) 2 Department of Internal Medicine and Hypertension, Medical University of Białystok, 15-276 Białystok, Poland; [email protected] * Correspondence: [email protected] Abstract: Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a pro-apoptotic protein showing broad biological functions. Data from animal studies indicate that TRAIL may possibly contribute to the pathophysiology of cardiomyopathy, atherosclerosis, ischemic stroke and abdomi- nal aortic aneurysm. It has been also suggested that TRAIL might be useful in cardiovascular risk stratification. This systematic review aimed to evaluate whether TRAIL is a risk factor or risk marker in cardiovascular diseases (CVDs) focusing on major adverse cardiovascular events. Two databases (PubMed and Cochrane Library) were searched until December 2020 without a year limit in accor- dance to the PRISMA guidelines. A total of 63 eligible original studies were identified and included in our systematic review. Studies suggest an important role of TRAIL in disorders such as heart failure, myocardial infarction, atrial fibrillation, ischemic stroke, peripheral artery disease, and pul- monary and gestational hypertension. Most evidence associates reduced TRAIL levels and increased TRAIL-R2 concentration with all-cause mortality in patients with CVDs. It is, however, unclear Citation: Kakareko, K.; whether low TRAIL levels should be considered as a risk factor rather than a risk marker of CVDs.
    [Show full text]
  • Development and Validation of a Protein-Based Risk Score for Cardiovascular Outcomes Among Patients with Stable Coronary Heart Disease
    Supplementary Online Content Ganz P, Heidecker B, Hveem K, et al. Development and validation of a protein-based risk score for cardiovascular outcomes among patients with stable coronary heart disease. JAMA. doi: 10.1001/jama.2016.5951 eTable 1. List of 1130 Proteins Measured by Somalogic’s Modified Aptamer-Based Proteomic Assay eTable 2. Coefficients for Weibull Recalibration Model Applied to 9-Protein Model eFigure 1. Median Protein Levels in Derivation and Validation Cohort eTable 3. Coefficients for the Recalibration Model Applied to Refit Framingham eFigure 2. Calibration Plots for the Refit Framingham Model eTable 4. List of 200 Proteins Associated With the Risk of MI, Stroke, Heart Failure, and Death eFigure 3. Hazard Ratios of Lasso Selected Proteins for Primary End Point of MI, Stroke, Heart Failure, and Death eFigure 4. 9-Protein Prognostic Model Hazard Ratios Adjusted for Framingham Variables eFigure 5. 9-Protein Risk Scores by Event Type This supplementary material has been provided by the authors to give readers additional information about their work. Downloaded From: https://jamanetwork.com/ on 10/02/2021 Supplemental Material Table of Contents 1 Study Design and Data Processing ......................................................................................................... 3 2 Table of 1130 Proteins Measured .......................................................................................................... 4 3 Variable Selection and Statistical Modeling ........................................................................................
    [Show full text]
  • Dcr2 (Decoy Receptor 2, TRAIL-R4, TRUNDD)/Fc Chimera Human, Recombinant Expressed in Mouse NSO Cells
    DcR2 (Decoy Receptor 2, TRAIL-R4, TRUNDD)/Fc Chimera Human, Recombinant Expressed in mouse NSO cells Product Number D9813 Product Description Reagents Recombinant human DcR2 (TRAIL-R4, TRUNDD) is a DcR2 is supplied as approximately 100 mg of protein chimeric protein expressed in mouse NSO cells. The lyophilized from a 0.2 mm filtered solution in phosphate 1, 2 extracellular domain of human DcR2 is fused to the buffered saline. carboxy-terminal 6X histidine-tagged Fc portion of human IgG1 by a polypeptide linker. Mature Preparation Instructions recombinant human DcR2 is a disulfide-linked Reconstitute the contents of the vial using sterile homodimeric protein. The reduced DcR2 monomer has phosphate-buffered saline (PBS) containing at least a molecular mass of approximately 44.2 kDa. Due to 0.1% human serum albumin or bovine serum albumin. glycosylation, recombinant human DcR2 migrates as an Prepare a stock solution of no less than 50 mg/ml. approximately 70-80 kDa protein in SDS-PAGE under reducing conditions. Storage/Stability Store at -20°C. Upon reconstitution, store at 2°-8°C for Apoptosis or programmed cell death is induced in cells one month. For extended storage, freeze in working by a group of death domain-containing receptors aliquots. Repeated freezing and thawing is not including TNFR1, Fas, DR3, DR4, and DR5. Binding of recommended. ligand to these receptors sends signals that activate members of the caspase family of proteases. The Product Profile signals ultimately cause the degradation of chromo- DcR2 is measured by its ability to neutralize apoptosis somal DNA by activating DNase. of mouse L929 cells treated with 50 ng/ml TRAIL.
    [Show full text]
  • Biolegend.Com
    Mechanisms of Cell Death TRAIL (TNFSF10) TNF-α Death Receptor 4 (TNFRSF10A/TRAIL-R1) Death Receptor 5 Zombie Dyes (TNFRSF10B/TRAIL-R2) Propidium Iodide (PI) BAT1, TIM-4 TNF RI (TNFRSF1A) 7-Amino-Actinomycin (7-AAD) MER TNF RII (TNFRSF1B) FAS-L GAS6 (TNFSF6/CD178) TRAIL (TNFSF10) Apoptotic Cell Death Domain Zombie Dyes Phosphatidylserine K63 Ubiquitin NH2 Removal ICAM3? ROCK1 NH CD14 2 Eat-Me Signals FAS Death Inducing Cytoskeletal Rearrangement, (TNFRSF6/CD95) Signaling Complex (DISC) TRADD Cytoskeletal Rearrangement, TRADD Decoy Receptor 2 FADD (TNFRSF10D/TRAIL-R4) Actomysin Contraction Engulfment RIP1 TWEAK RIP1 oxLDL (TNFSF12) FADD CIAP1/2 K63 Ubiquitination Blebbing CD36 Death Receptor 3 TWEAK (TNFSF12) PI FADD (TNFRSF25, APO-3) 7-AAD TRAF1 FADD Procaspase 8,10 TRAF 3 Phagocyte FLIP PANX1 Macrophage Monocyte Neutrophil Dendritic Cell Fibroblast Mast Cell Procaspase 8,10 NF-kB TWEAK-R (TNFRSF12A/Fn14) Find-Me Signals Lysophosphocholine C Caspase 8,10 TRAF5 TRAF2 Sphingosine-1-Phosphate G2A? Nucleotides A Decoy TRAIL Receptor R1 (TNFRSF23) Bid Cell Survival ATP, UTP Decoy TRAIL Receptor R2 (TNFRSF22) Sphingosine-1 TRADD Phosphate Receptor Decoy Receptor 1 (TNFRSF10C/TRAIL-R3) Procaspase 3 Proliferation RIP1 G P2y2 t-Bid Bcl-2 T Chemotaxis, Caspase 3 Bcl-2-xL, MCL-1 ? ICAD RIP1 Engulfment Degradation Bax, Bak Oligomerization TRADD Death Receptor 6 Extracellular ATP Bacterial pore-forming toxins TRAIL (TNFSF10) ICAD (TNFRSF21) Monosodium urate crystals Cholesterol crystals Death Receptor DNA Fragmentation Cholera toxin B, Mitochondria
    [Show full text]
  • WO 2018/027204 Al 08 February 2018 (08.02.2018) W !P O PCT
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2018/027204 Al 08 February 2018 (08.02.2018) W !P O PCT (51) International Patent Classification: only): F. HOFFMANN-LA ROCHE AG [CH/CH]; Gren- C07K 16/28 (2006.01) A61K 39/00 (2006.01) zacherstrasse 124, 4070 Basel (CH). (21) International Application Number: (72) Inventor; and PCT/US20 17/045642 (71) Applicant: HARRIS, Seth [US/US]; c/o Genentech, Inc., 1 DNA Way, South San Francisco, California 94080 (US). (22) International Filing Date: 04 August 2017 (04.08.2017) (72) Inventors: LAZAR, Greg; c/o Genentech, Inc., 1 DNA Way, South San Francisco, California 94080 (US). YANG, (25) Filing Language: English Yanli; c/o Genentech, Inc., 1 DNA Way, South San Fran (26) Publication Language: English cisco, California 94080 (US). CHRISTENSEN, Erin H.; c/ o Genentech, Inc., 1 DNA Way, South San Francisco, Cali (30) Priority Data: fornia 94080 (US). HANG, Julie; 6606 Wisteria Way, San 62/371,671 05 August 2016 (05.08.2016) US Jose, California 95 129 (US). KIM, Jeong; c/o Genentech, (71) Applicant (for all designated States except AL, AT, BA, BE, Inc., 1 DNA Way, South San Francisco, California 94080 BG, CH, CN, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, (US). HR, HU, IE, IN, IS, IT, LT, LU, LV, MC, MK, MT, NL, (74) Agent: JONES, Kevin et al; Morrison & Foerster LLP, NO, PL, PT RO, RS, SE, SI, SK, SM, TR): GENENTECH, 425 Market Street, San Francisco, California 94105-2482 INC.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • Defining Molecular Adjuvant Effects on Human B Cell Subsets
    DEFINING MOLECULAR ADJUVANT EFFECTS ON HUMAN B CELL SUBSETS A DISSERTATION SUBMITTED TO THE GRADUATE DIVISION OF THE UNIVERSITY OF HAWAIʻI AT MĀNOA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN BIOMEDICAL SCIENCES (TROPICAL MEDICINE) August 2019 By Jourdan Posner Dissertation Committee: Sandra P. Chang, Chairperson George Hui Saguna Verma William Gosnell Alan Katz ACKNOWLEDGMENTS First and foremost, I would like to express my gratitude to my PhD advisor and mentor, Dr. Sandra Chang. Her passion for science, scientific rigor, and inquisitive nature have been an inspiration to me. I am very grateful for her continuous support and mentorship. I would also like to thank my committee members, Dr. George Hui, Dr. Saguna Verma, Dr. William Gosnell, and Dr. Alan Katz, for their advice and support on this dissertation work. To my parasitology “dads”, Dr. Kenton Kramer and Dr. William Gosnell, I am forever grateful for all of the opportunities you’ve given to me. Your mentorship has guided me through the doctoral process and helped me to maintain “homeostasis”. Last, but not least, I’d like to thank my parents and brother who have been so supportive throughout my entire graduate career. I greatly appreciate all of the encouraging words and for always believing in me. And to my future husband, Ian, I could not have completed this dissertation work without your endless support. You are my rock. ii ABSTRACT Recent advances in vaccine development include the incorporation of novel adjuvants to increase vaccine immunogenicity and efficacy. Pattern recognition receptor (PRR) ligands are of particular interest as vaccine adjuvants.
    [Show full text]
  • Decoy TRAIL Receptor CD264: a Cell Surface Marker of Cellular Aging for Human Bone Marrow-Derived Mesenchymal Stem Cells Sean D
    Madsen et al. Stem Cell Research & Therapy (2017) 8:201 DOI 10.1186/s13287-017-0649-4 RESEARCH Open Access Decoy TRAIL receptor CD264: a cell surface marker of cellular aging for human bone marrow-derived mesenchymal stem cells Sean D. Madsen1,2,3, Katie C. Russell1,2,3, H. Alan Tucker3, Julie Glowacki4, Bruce A. Bunnell2,3,5 and Kim C. O’Connor1,2,3,5* Abstract Background: Mesenchymal stem cells (MSCs) are a mixture of progenitors that are heterogeneous in their regenerative potential. Development of MSC therapies with consistent efficacy is hindered by the absence of an immunophenotype of MSC heterogeneity. This study evaluates decoy TRAIL receptor CD264 as potentially the first surface marker to detect cellular aging in heterogeneous MSC cultures. Methods: CD264 surface expression, regenerative potential, and metrics of cellular aging were assessed in vitro formarrowMSCsfrom12donorsages20–60 years old. Male and female donors were age matched. Expression of CD264 was compared with that of p16, p21, and p53 during serial passage of MSCs. Results: When CD264+ cell content was 20% to 35%, MSC cultures from young (ages 20–40 years) and older (ages 45–60 years) donors proliferated rapidly and differentiated extensively. Older donor MSCs containing < 35% CD264+ cells had a small size and negligible senescence despite the donor’s advanced chronological age. Above the 35% threshold, CD264 expression inversely correlated with proliferation and differentiation potential. When CD264+ cell content was 75%, MSCs were enlarged and mostly senescent with severely compromised regenerative potential. There was no correlation of the older donors’ chronological age to either CD264+ cell content or the regenerative potential of the donor MSCs.
    [Show full text]
  • A Comparison of the Cytoplasmic Domains of the Fas Receptor and the P75 Neurotrophin Receptor
    Cell Death and Differentiation (1999) 6, 1133 ± 1142 ã 1999 Stockton Press All rights reserved 13509047/99 $15.00 http://www.stockton-press.co.uk/cdd A comparison of the cytoplasmic domains of the Fas receptor and the p75 neurotrophin receptor 1,2 1,2 1 ,1 H Kong , AH Kim , JR Orlinick and MV Chao* Introduction 1 Molecular Neurobiology Program, Skirball Institute, New York University The p75 receptor is the founding member of the TNF Medical Center, 540 First Avenue, New York, NY 10016, USA receptor superfamily.1 Structural features shared by several 2 The ®rst two authors contributed equally to this study members of this family include a cysteine-rich extracellular * Corresponding author: MV Chao, Molecular Neurobiology Program, Skirball domain repeated two to six times and an intracellular motif Institute, New York University Medical Center, 540 First Avenue, New York, NY termed the `death domain'. The term `death domain' was 10016, USA. Tel: +1 212-263-0722; Fax: +1 212-263-0723; E-mail: [email protected] coined from its functional role in mediating apoptosis, particularly via the p55 TNF receptor and FasR.2,3 The Received 15.7.98; revised 20.8.99; accepted 23.8.99 death domain is a protein association motif4,5 that binds to Edited by C Thiele cytoplasmic proteins, which can trigger the caspase protease cascade or other signal transduction pathways. Multiple adaptor and death effector proteins that bind to the Abstract death domains of the p55 TNF and Fas receptors have The p75 neurotrophic receptor (p75) shares structural been identified.
    [Show full text]