ZENTRUM FÜR KINDER- UND JUGENDMEDIZIN, SEKTION PÄDIATRISCHE

GENETIK

Universitätsklinikum Freiburg im Breisgau

The role of non-coding RNAs for Skeletal development and diseases

Inaugural-Dissertation zur Erlangung der Doktorwürde der Fakultät für Biologie der Albert-Ludwigs-Universität Freiburg im Breisgau

vorgelegt von

Franziska Friedrich geb. Eckmann

geboren in Freiburg im Breisgau

Freiburg im Breisgau Dezember 2017

Dekanin der Fakultät für Biologie: Prof. Dr. Bettina Warscheid Promotionsvorsitzender: Prof. Dr. Andreas Hiltbrunner

Betreuer der Arbeit: Prof. Dr. med. Bernhard Zabel Weiterer Betreuer der Arbeit: Tim J.M. Welting, PhD, Associate Professor of Molecular Cartilage Biology, Maastricht UMC+, the Netherlands

Betreuer an der Fakultät für Biologie: Prof. Dr. Annette Neubüser

Referentin: Prof. Dr. Annette Neubüser Ko-Referent: Dr. Georgios Pyrowolakis Drittprüfer: Prof. Dr. Wolfgang Driever

Datum der mündlichen Prüfung: 19.01.2018

Erklärung

1. Ich erkläre hiermit, dass ich die vorliegende Arbeit ohne unzulässige Hilfe Dritter und ohne Benutzung anderer als der angegebenen Hilfsmittel angefertigt habe. Die aus anderen Quellen direkt oder indirekt übernommenen Daten und Konzepte sind unter Angabe der Quellen gekennzeichnet. Insbesondere habe ich hierfür nicht die entgeltliche Hilfe von Vermittlungs- beziehungsweise Beratungsdiensten (Promotionsberater oder anderer Personen) in Anspruch genommen. Niemand hat von mir unmittelbar oder mittelbar geldwerte Leistungen für Arbeiten erhalten, die im Zusammenhang mit dem Inhalt der vorgelegten Dissertation stehen. 2. Die Arbeit wurde bisher weder im In- noch im Ausland in gleicher oder ähnlicher Form einer anderen Prüfungsbehörde vorgelegt. 3. Die Bestimmungen der Promotionsordnung der Fakultät für Biologie sind mir bekannt, insbesondere weiß ich, dass ich vor Vollzug der Promotion zur Führung des Doktortitels nicht berechtigt bin.

Datum und Unterschrift

Table of contents SUMMARY...... IV

ZUSAMMENFASSUNG ...... VI

INDEX OF FIGURES ...... VIII

INDEX OF TABLES ...... XI

ABBREVIATIONS ...... XII

1 INTRODUCTION ...... 1

1.1 SKELETAL DEVELOPMENT ...... 1 1.1.1 Development of Bones: Endochondral ossification ...... 1 1.1.2 Wnt signalling is linked to bone development ...... 3 1.1.3 The role of hypoxia during chondrogenesis and bone development ...... 5

1.2 DISORDERS OF THE SKELETON ...... 7

1.3 CARTILAGE-HAIR HYPOPLASIA ...... 8

1.4 RMRP AND THE RNASE MRP COMPLEX ...... 10

2 AIM AND OBJECTIVES OF THIS STUDY ...... 14

3 MATERIALS AND METHODS ...... 15

3.1 MATERIALS ...... 15 3.1.1 Antibiotics ...... 15 3.1.2 Antibodies and sera ...... 15 3.1.3 Bacterial strains ...... 15 3.1.4 Buffers and solutions ...... 15 3.1.5 Cell lines ...... 17 3.1.6 Chemicals and reagents ...... 17 3.1.7 Enzymes ...... 19 3.1.8 Equipment ...... 19 3.1.9 Kits ...... 20 3.1.10 Ladder ...... 21 3.1.11 Materials for cell culture ...... 21 3.1.12 Plasmids ...... 21 3.1.13 Software and databases ...... 22 3.1.14 Supplies ...... 22 3.1.15 Oligonucleotides ...... 23

3.2 METHODS ...... 25 3.2.1 Biochemical Methods...... 25 3.2.2 Cell culture methods ...... 27 i

3.2.3 Cloning of DNA fragments ...... 30 3.2.4 CRISPR/Cas9 knockout ...... 31 3.2.5 DNA standard methods ...... 31 3.2.6 Ethical statement ...... 32 3.2.7 Histological methods ...... 33 3.2.8 Polymerase chain reaction (PCR) techniques ...... 34 3.2.9 RNA standard methods ...... 37 3.2.10 RNA-Seq ...... 38 3.2.11 Statistical Analysis ...... 38 3.2.12 Work with Zebrafish ...... 39

4 RESULTS ...... 42

4.1 NEWLY MUTATIONS IN RMRP CAUSE CARTILAGE-HAIR HYPOPLASIA VARIANT ...... 42

4.2 CHH MOUSE MODEL ...... 45 4.2.1 General Considerations ...... 45 4.2.2 Analysis of the mouse model ...... 50 4.2.3 Alternative approach ...... 50

4.3 CHH ZEBRAFISH MODEL ...... 54 4.3.1 General consideration ...... 54 4.3.2 Analysis of the zebrafish model ...... 57 4.3.3 Planned alternative approach ...... 61

4.4 RMRP IS UP-REGULATED AT EARLY STAGES OF HYPERTROPHIC DIFFERENTIATION ...... 64 4.4.1 Many signalling pathways are altered in CHH patients ...... 68

4.5 WNT SIGNALLING HAS AN INFLUENCE ON RMRP EXPRESSION ...... 72 4.5.1 ß-Catenin can bind to the RMRP promoter and Increases The RMRP RNA Level ...... 72 4.5.2 The expression of RMRP RNA is linked to WNT9A ...... 75

4.6 RMRP PROMOTER STUDIES ...... 81

4.7 RMRP EXPRESSION IS LINKED TO HIF1A AND HYPOXIA ...... 86

5 DISCUSSION ...... 91

5.1 NEWLY FOUND MUTATIONS IN RMRP ARE PATHOGENIC ...... 91

5.2 EXPRESSION OF RMRP IS ESSENTIAL FOR HYPERTROPHIC DIFFERENTIATION ...... 92

5.3 IMPORTANT SIGNALLING PATHWAYS ARE LINKED TO RMRP EXPRESSION ...... 95

6 CONCLUSION AND FINAL REMARKS ...... 99

7 REFERENCES ...... 102

8 PUBLICATIONS & CONFERENCE CONTRIBUTIONS ...... 116

ii

9 ACKNOWLEDGMENTS ...... 118

10 APPENDICES ...... 119

iii

SUMMARY

Cartilage-hair hypoplasia (CHH) is a rare genetic disease caused by mutations in the RNA component of mitochondrial RNA-processing endoribonuclease (RMRP, OMIM #157660) gene. Some patients have hypopigmented, fine hair (hypotrichosis) and changes in both the structure and number of hair leading to the name CHH. It is now recognised that not all patients with CHH undergo these changes and other symptoms include short-limbed dwarfism, metaphyseal chondrodysplasia, combined immune deficiencies and increased susceptibility to certain types of cancer. The RMRP gene encodes a long non-coding RNA, which is part of a ribonucloeprotein complex called RNase MRP complex. The MRP complex is important for processing pre-5.8S rRNA as well as cyclin B2 mRNA and it also takes part in mitochondrial DNA replication. In recent years, more and more functions and interaction partners of the RMRP RNA, like telomerase reverse transcriptase (TERT), have been identified. As skeletal defects are the main symptom of CHH, we hypothesized that RMRP RNA must play a crucial role during skeletal development. We showed that RMRP RNA expression increased during differentiation of cell lines and primary cells towards a chondrogenic phenotype, providing first evidence towards our hypothesis. To further investigate the impact of mutations in the RMRP gene on skeletal development, we established different approaches to generate animal models using several techniques to knockout or knockdown the expression of RMRP RNA. In addition to our cell line and animal approaches, we focussed on CHH patients and their mutation in the RMRP gene. We identified and characterised two novel pathogenic RMRP mutations in a patient with the characteristic phenotype of CHH. We also discovered two consensus sequences within the RMRP promoter, and found that one or both of these sequences were duplicated in known CHH-causing RMRP promoter mutations. We also analysed the expression of more than 12,000 genes of healthy human dermal fibroblasts as well as CHH patient-derived dermal fibroblasts in a chondrogenic-like condition using RNA-sequencing (RNA- seq) to figure out possible defects in signalling in CHH patients. We focussed on two specific signalling pathways essential for bone development, Wnt signalling and hypoxia, to determine the correlation between these pathways and the RMRP RNA. Our results clearly indicate that expression of RMRP RNA and certain components of these signalling pathways are linked. Our observations that RMRP RNA expression was increased during chondrogenic differentiation in different murine and human cell lines as well as our RNA-seq data confirmed our hypothesis that RMRP RNA must play a crucial role during skeletal development. We also showed that mutations of the RMRP gene result in alterations not only in RMRP RNA level, but also affect important signalling pathways in humans. These results provide a starting point for

iv further studies, which could lead to a better understanding of the CHH pathomechanism. In addition, our findings could provide a basis for the exploration and development of therapeutic approaches, leading to better clinical treatment of CHH patients.

v

ZUSAMMENFASSUNG

Die Knorpel-Haar-Hypoplasie (im Englischen Cartilage-hair hypoplasia, CHH) ist eine seltene genetische Erkrankung, die durch Mutationen in der RNA-Komponente des mitochondrialen RNA-verarbeitenden Endoribonuklease (RMRP, OMIM #157660)-Gens verursacht wird. Einige Patienten haben hypopigmentiertes, feines Haar (Hypotrichose) und Veränderungen sowohl der Struktur als auch der Anzahl der Haare, die zum Namen CHH führten. Mittlerweile ist bekannt, dass nicht alle Patienten mit CHH diese Veränderungen aufweisen und andere Symptome wie Kleinwuchs, metaphysäre Chondrodysplasie, kombinierte Immunschwäche und erhöhte Anfälligkeit für bestimmte Krebsarten auftreten können. Das RMRP-Gen kodiert für eine lange nicht-kodierende RNA, die Teil eines Ribonukleoprotein-Komplexes ist, der als RNase MRP-Komplex bezeichnet wird. Dieser MRP-Komplex ist wichtig für die Prozessierung von prä- 5.8S-rRNA sowie Cyclin-B2-mRNA und nimmt auch an der mitochondrialen DNA-Replikation teil. In den letzten Jahren wurden immer mehr Funktionen und Interaktionspartner der RMRP- RNA, wie z.B. Telomerase Reverse Transkriptase (TERT), identifiziert. Da Skelettdefekte das Hauptsymptom von CHH sind, haben wir die Hypothese aufgestellt, dass die RMRP-RNA eine entscheidende Rolle bei der Skelettentwicklung spielen muss. Wir zeigten, dass die RMRP-Expression während der Differenzierung von Zelllinien und Primärzellen hin zu einem chondrogenen Phänotyp ansteigt und damit erste Hinweise auf die Richtigkeit unsere Hypothese liefert. Um die Auswirkungen von Mutationen im RMRP-Gen auf die Skelettentwicklung weiter zu untersuchen, haben wir mehrere Ansätze zur Generierung von Tiermodellen unter Verwendung verschiedener Techniken etabliert, um entweder einen Knockout oder Knockdown der RMRP-RNA-Expression zu erlangen. Neben unserer Arbeit mit Zelllinien und Tiermodellen konzentrierten wir uns auf CHH- Patienten und deren Mutation im RMRP-Gen. Wir identifizierten und charakterisierten zwei neu entdeckte pathogene RMRP-Mutationen bei einem Patienten mit charakteristischem CHH- Phänotyp. Desweiteren haben wir zwei Konsensus-Sequenzen im RMRP-Promotor entdeckt und festgestellt, dass eine oder beide dieser Sequenzen in bekannten CHH-verursachenden RMRP- Promotor-Mutationen dupliziert werden. Wir analysierten die Expression von mehr als 12.000 Genen von gesunden menschlichen Haut-Fibroblasten sowie von Haut-Fibroblasten von CHH- Patienten während der Differenzierung hin zu einem chondrogenen Phänotyp mit Hilfe von RNA- Sequenzierung (RNA-seq), um mögliche Defekte in Signalwegen bei CHH-Patienten herauszufinden. Wir konzentrierten uns auf zwei spezifische Signalwege, der Wnt-Signalweg und der Hypoxie-Signalweg, die für die Knochenentwicklung essentiell sind, um die Korrelation zwischen diesen Signalwegen und der RMRP-RNA zu bestimmen. Unsere Ergebnisse zeigen

vi deutlich, dass die Expression von RMRP-RNAverknüpft ist mit bestimmten Komponenten dieser Signalwege. Unsere Beobachtungen, dass die RMRP-Expression während der chondrogenen Differenzierung in verschiedenen murinen und menschlichen Zelllinien erhöht ist sowie unsere RNA-seq Daten bestätigten unsere Hypothese, dass die RMRP–RNA eine entscheidende Rolle bei der Skelettentwicklung spielen muss. Wir konnten zeigen, dass Mutationen des RMRP-Gens zu Veränderungen nicht nur in der RMRP-RNA-Expression führen, sondern auch wichtige Signalwege beim Menschen beeinflussen. Diese Ergebnisse liefern einen Ausgangspunkt für weitere Studien, die zu einem besseren Verständnis des CHH-Pathomechanismus führen könnten. Darüber hinaus könnten unsere Erkenntnisse eine Grundlage für die Erforschung und Entwicklung von therapeutischen Ansätzen bilden, was zu einer besseren klinischen Behandlung von CHH- Patienten führt.

vii

INDEX OF FIGURES

Figure 1: Schematic illustration of endochondral ossification...... 1 Figure 2: Organization of the embryonic growth plate...... 3 Figure 3: Schematic illustration of the canonical Wnt signalling pathway...... 4 Figure 4: HIF-1α is active only under hypoxic conditions...... 6 Figure 5: Cartilage-hair hypoplasia patients show short-limbed dwarfism and metaphyseal chondrodysplasia...... 8 Figure 6: Schematic structure of the RMRP promoter...... 10 Figure 7: Known pathogenic mutations in the RMRP RNA...... 11 Figure 8: The human RNase MRP complex...... 12 Figure 9: Cellular Functions of the RNase MRP complex...... 12 Figure 10: Clinical appearance of patient with newly found mutations...... 42 Figure 11: Homozygous state of mutations within the RMRP gene...... 43 Figure 12: Reduced RMRP RNA expression in patient with novel mutation in the RMRP gene. .... 44 Figure 13: Accumulation of pre-5.8S rRNA in patient with RMRPn.128C>G (homo); n.145C>A (homo) mutation...... 44 Figure 14: The RMRP sequence is highly conserved between human and mouse...... 45 Figure 15: Increase in Rmrp RNA expression is linked to the start of hypertrophic differentiation. 46 Figure 16: Rmrp is located on chromosome 4...... 47 Figure 17: Only a small region of Rmrp can be deleted without disturbing the Ccdc107 gene...... 48 Figure 18: Decreased Rmrp promoter activity when Rmrp promoter lacks nucleotides from -290 until -18 of the promoter sequence...... 49 Figure 19: Mutated Rmrp promoter shows lower promoter activity...... 50 Figure 20: No significant changes in Pop1 mRNA expression during development...... 51 Figure 21: POP1 is detected in the hypertrophic zone of the growth plate...... 52 Figure 22: A modified Pop1 gene is used for the generation of chimeric mice...... 54 Figure 23: RMRP is conserved in humans and zebrafish...... 54 Figure 24: RNase_MRP RNA can be detected during the first 5 days post fertilization...... 55 Figure 25: A designed RNase_MRP TALEN construct cut the RNA between nucleotide 22 and 37 of the exon...... 56 Figure 26: RNase_MRP morpholino targets the possible Pop1 binding domain P3...... 57 Figure 27: Knockdown of RNase_MRP is successfully achieved using morpholino oligomers...... 58 Figure 28: No changes in cartilage/bone development and morphology when RNase_MRP was knocked down...... 59

viii

Figure 29: No alterations in body length when RNase_MRP is knocked down...... 60 Figure 30: No rescue of RNase_MRP RNA expression when RNase_MRP RNA is co-injected with morpholino...... 61 Figure 31: Human POP1 shows highly conserved region with zebrafish pop1...... 62 Figure 32: pop1 mRNA expression is decreased during development...... 62 Figure 33: A pop1-specific TALEN construct targets exon 3 of the zebrafish pop1 gene...... 63 Figure 34: A pop1splice morpholino targets the transition of exon 3 to intron 3-4...... 63 Figure 35: Rmrp RNA is highly up-regulated during hypertrophic differentiation...... 65 Figure 36: The expression of Rmrp RNA is increased in ATDC5 cells during hypertrophic differentiation...... 66 Figure 37: RMRP RNA is highly up-regulated at early stages of chondrogenic transdifferentiation of human dermal fibroblast...... 67 Figure 38: RMRP RNA expression is significantly reduced in CHH patients as compared to healthy controls...... 69 Figure 39: Venn diagram of the differentially expressed genes of day 1vs.day 0 and day 3 vs. day 0 of differentiation...... 71 Figure 40: Two TCF/Lef1 binding sites are located in the Rmrp promoter...... 73 Figure 41: β-Catenin and Rmrp RNA are up-regulated during differentiation of ATDC5 cells...... 73 Figure 42: The expression of Rmrp RNA is up-regulated earlier than CTNNB1 expression in differentiating MCT cells towards a chondrocytic phenotype...... 74 Figure 43: Ctnnb1 over expression results in significantly increased Rmrp RNA expression during chondrogenic differentiation...... 75 Figure 44: The expression of WNT9A is significantly altered in CHH patients compared to healthy controls...... 75 Figure 45: Decreased expression of RMRP RNA and WNT9A in CHH patients on the first day of chondrogenic transdifferentiation can be confirmed...... 76 Figure 46: The expression of WNT9A and Rmrp RNA is up-regulated during chondrogenic differentiation...... 77 Figure 47: Wnt9a mRNA expression is reduced upon Rmrp knockdown...... 78 Figure 48: Rmrp RNA expression is increased during differentiation due to over expression of Wnt9a...... 78 Figure 49: Knockdown of Wnt9a results in reduced Rmrp RNA expression...... 79 Figure 50: Rmrp RNA expression is significantly decreased when Wnt9a is knocked down...... 80 Figure 51: No rescue of RMRP RNA expression in CHH patients when cells are stimulated with recombinant WNT9A during chondrogenic differentiation...... 81

ix

Figure 52: No difference in WT RMRP promoter activity between the -1500 promoter and the - 200 promoter...... 83 Figure 53: CHH-causing promoter mutations result in decreased promoter activity...... 84 Figure 54: Reduced promoter activity of the -200 WT RMRP promoter in SW1353 cells...... 85 Figure 55: The -200 mutated RMRP promoter shows increased promoter activity...... 85 Figure 56: RMRP RNA expression is increased under hypoxia-like conditions...... 86 Figure 57: No increase of RMRP RNA under hypoxia-like conditions in SW1353...... 87 Figure 58: Rmrp RNA expression is increased under hypoxia-like conditions...... 87 Figure 59: Rmrp RNA and HIF1A expression is up-regulated in similar stages of chondrogenic differentiation...... 88 Figure 60: Components of the hypoxia signalling pathway are up-regulated in CHH patients during chondrogenic differentiation...... 89 Figure 61: A putative HIF-1α/ARNT (and X-box binding protein 1) binding site is located within the RMRP promoter sequence...... 89 Figure 62: Two signalling pathways can be linked to RMRP RNA expression ...... 101

x

INDEX OF TABLES

Table 1: Three types of skeletal disorders can be distinguished...... 7 Table 2: Composition of SDS polyacrylamide gels used for SDS-PAGE...... 26 Table 3: Ethanol/Xylene series used for dehydration of tissue...... 33 Table 4: Staining conditions for IHC...... 34 Table 5: Incubation times and temperatures used for the enzymatic clean-up of amplified DNA. ... 35 Table 6: Incubation times and temperatures for cDNA synthesis...... 37 Table 7: Sequences targeted by RNase_MRP TALEN constructs...... 40 Table 8: Dermal fibroblasts of CHH patients used for RNA-seq analysis and the corresponding mutations in RMRP...... 68 Table 9: Expression of many RNAs is altered in CHH patients compared to healthy controls...... 70 Table 10: Altered gene expression during differentiation...... 70 Table 11: List of the 29 differentially expressed genes...... 71 Table 12: Consensus sequences of RMRP promoter mutations...... 81 Table 13: Patient-related mutations, which were cloned into the pSEAP2-basic vector...... 84 Table 14: The HIF1A/ARNT binding site is duplicated in many CHH patients with RMRP promoter mutations...... 90

xi

ABBREVIATIONS

µg Microgram µm Micrometre AAD Anauxetic dysplasia Ab Antibody ACAN Aggrecan ACTB Actin Beta AP Alkaline phosphatase ARNT Aryl Hydrocarbon Receptor Nuclear Translocator dATP Deoxyadenosintriphosphat AXIN axis inhibition protein BEST1 Bestrophin 1 BMPs Bone morphogenic proteins bp Base pair BSA Bovine serum albumin C Cysteine °C Degrees Celsius ca. Circa cDNA complementary DNA CHH Cartilage-hair hypoplasia CLB2 Cyclin B2 cm Centimetre Ctrl Control CTNNB1 Catenin Beta 1 CoCl2 Cobalt chloride COL2A1 Collagen type 2, alpha 1 DAAM1 Dishevelled-associated activator of morphogenesis 1 dCTP Deoxycytidintriphosphat DDX5 DEAD-Box Helicase 5 DEPC Diethylpyrocarbonate dGTP Deoxyguanosintriphosphat DNA Deoxyribonucleic acid dNTP Deoxyribonukleosidtriphosphate DTT Dithiothreitol dTTP Deoxythymidintriphosphat dpf Days post fertilization DVL Dishevelled E Embryonic day EDTA Ethylenediaminetetraacetic acid EtOH Ethanol ECM Extra cellular matrix ER endoplasmatic reticulum FCS fetal calf serum FDC fibroblasts transdifferentiate into chondrocyte-like cells Fzd Frizzled g Gram GOI Gene of interest GPCR G protein-coupled receptor GSK3β Glycogen synthase kinase 3 beta h Hour/s H2Onuk Nuclease-free water HBS HEPES-buffered saline HDAC4 Histone Deacetylase 4 xii

HIF1A Hypoxia-inducible factor 1, alpha subunit HIF2A Hypoxia-inducible factor 2, alpha subunit IHH Indian hedgehog IPTG Isopropyl-β-D-thiogalactopyranosid ITS1 Internal transcribed spacer J Joule JNK c-Jun N-terminale kinases Kb Kilobases kDa Kilodalton KO Knockout L Leucin LB lysogeny broth Lef lymphoid enhancer factor LiCl Lithium chloride LRP lipoprotein receptor-related protein max. maximal MCDS Metaphyseal chondrodysplasia, Schmid-type MCT mouse chondrocytes immortalized by SV40 temperature-sensitive large T antigen MDWH metaphyseal dysplasia without hypotrichosis MEFs Mouse embryonal fibroblasts MEF2C Myocyte Enhancer Factor 2C min Minute/s Mio. Million ml Millilitre mM Millimolar MMLV-RT Moloney Murine Leukemia Virus Reverse Transcriptase nm Nanometer MMP13 Matrix metalloproteinase-13 NTC No Template Control OD Optical density OMIM Online Mendelian Inheritance in Man OS Omenn syndrome Pax1 Paired box protein 1 PBS phosphate buffered saline PCP noncanonical planar cell polarity pathway (PCP) PCR Polymerase Chain Reaction Pen/Strep Penicillin Streptomycin PFA Paraformaldehyde PHD prolyl hydroxylases PKC Protein kinase C PLB Passive Lysis Buffer PSE proximal sequence element POP1 POP1 homolog, ribonuclease P/MRP subunit qPCR Quantitative PCR PTHrP Parathyroid hormone-related protein PTU 1-phenyl 2-thiourea R Arginine RAC1 Ras-related C3 botulinum toxin substrate 1 RIN RNA integrity number RIPA Radio Immunoprecipitation Assay RLU Relative light unit RMRP RNA component of mitochondrial RNA processing endoribonuclease RNA Ribonucleic acid mRNA messenger ribonucleic acid miRNA micro ribonucleic acid ncRNA Non-coding ribonucleic acid xiii rRNA Ribosomal ribonucleic acid tRNA Transfer ribonucleic acid RNAi Ribonucleic acid interference ROCK Rho-associated kinase RT Room temperature RT-PCR Reverse transcriptase PCR Runx2 Runt-related transcription factor 2 SCID severe combined immunodeficiency sec seconds Ser Serine SMURF2 SMAD Specific E3 Ubiquitin Protein Ligase 2 SOX9 SRY (Sex-Determining Region Y)-Box 9 SP1 Specificity Protein 1 SSC saline-sodium citrate TBE TRIS-Borat-EDTA TH17 T helper 17 cell TRIS Tris-(hydroxymethyl)-aminomethan tRNA transfer-RNA rpm Rounds per minute UTR untranslated region UV light ultraviolet light V Volt VEGF Vascular Endothelial Growth Factor pVHL von Hippel–Lindau tumor suppressor Viperin Virus inhibitory protein, endoplasmic reticulum-associated, interferon-inducible vs. versus WT Wild-type WNT9A Wnt Family Member 9A X-Gal 5-Brom-4-chlor-3-indoxyl-β-D-galactopyranosid

xiv 1.1 Skeletal development

1 INTRODUCTION

1 . 1 S k e l e t a l development

The skeleton of an adult person consists of more than 200 components (Karsenty and Wagner, 2002) and has different functions. In addition to supporting functions, it also serves as a storage location for various substances, enables movement and protects the internal organs. Cartilage and bones are the elements of the skeleton and derive from three distinct lineages: the lateral plate mesoderm generates the limb skeleton, the paraxial mesoderm gives rise to the vertebral and craniofacial bones, and the cranial neural crest generates some of the craniofacial bones and cartilage (Zabel and Winterpacht, 2000; Karsenty and Wagner, 2002; Gilbert and Barresi, 2016).

1.1.1 DEVELOPMENT OF BONES: ENDOCHONDRAL OSSIFICATION

Two different modes of bone formation are known. Intramembranous ossification is the direct conversion of mesenchyme into bone. By this kind of ossification several bones arise, e.g. skull bones or parts of the clavicle (Karaplis, 2008). However, several parts of the skull, ribs and limbs are formed by the differentiation of mesenchymal cells into cartilage, which is later replaced by bones. This process is called endochondral ossification and occurs at two distinct sites in the vertebrate long bone: either at the primary (diaphyseal) site or at the secondary (epiphyseal) site of ossification (Ortega et al., 2004). Several stages can be distinguished during this process, as seen in Figure 1.

Figure 1: Schematic illustration of endochondral ossification. Mesenchymal cells commit to become chondrocytes (cartilage cells) (A). Chondrocytes condense and form the cartilage model of bone (B). Proliferating chondrocytes differentiate into hypertrophic chondrocytes and 1 1 Introduction undergo apoptosis while secreting matrix components essential for the later mineralization (C). Blood vessels can invade (D) and osteoblasts immigrate, which bind to the degenerating cartilaginous matrix and deposit bone matrix (E, F). Homeostasis of proliferating, hypertrophic, and mineralizing chondrocytes is achieved and secondary ossification centers form near the tips of the bone (G, H). Source: http://skeletalsystemdev.weebly.com/uploads/7/0/4/3/7043675/5513674_orig.jpg?467 The first step in endochondral ossification is the condensation of mesenchymal cells and the formation of a cartilaginous model of the developing bone (Figure 1 A, B). These cells then differentiate from resting chondrocytes to proliferating chondrocytes and finally mature to hypertrophic chondrocytes. This differentiation process is called chondrogenesis (Horton, 1993; Mundlos, 1994; Luo et al., 1995). The transcription factor SOX9 plays a major role in the regulation of the differentiation of mesenchymal cells into chondrocytes and activates the expression of other genes and transcription factors, including type II Collagen (COL2A1) and Aggrecan (ACAN) (Bi et al., 1999). Both COL2A1 and ACAN expression is critical for cartilage formation. RUNX2 (Runt-related transcription factor 2) is essential for the induction of chondrocyte hypertrophy and its expression remains during terminal differentiation of chondrocytes (Inada et al., 1999; Kim et al., 1999, Takeda et al., 2001; Ueta et al., 2001) (Figure 1 C). Other markers for hypertophic chondrocytes are MEF2C (Myocyte Enhancer Factor 2C) and type X Collagen (COL10A1) (Shen, 2005; Arnold et al., 2007). Defects in the hypertrophy of chondrocytes result in shortening of the bones as hypertrophic cartilage regulates the final size of long bones (Cooper et al., 2013). A last dramatic phenotypic change is started when hypertrophic chondrocytes step into their terminal stage. The expression of COL10A1 stops and other factors are expressed, e.g. alkaline phosphatase (AP), matrix metalloproteinase-13 (MMP13) and osteopontin (SPP1), which enables the matrix to become mineralized (Lefebvre and Smits, 2005). During the mineralisation, vascular endothelial growth factor (VEGF), a homodimeric glycoprotein involved in angiogenesis, is secreted and blood vessels start to invade. The cartilage model becomes more and more invaded by blood vessels and osteoblasts and osteoclasts migrate into the bones (Figure 1 D, E) (Gerber et al., 1999; Haigh et al., 2000; Ferrara et al., 2003; Zelzer and Olsen, 2005). Osteoblasts begin to form a bone matrix and differentiate into mature bone cells (osteocytes) (Hatori et al., 1995; Bruder and Caplan, 2009) (Figure 1 E-H). Osteoclasts are multinucleated cells that process the leftovers of apoptotic chondrocytes and thus creating the bone marrow cavity (Manolagas and Jilka, 1995). Figure 2 shows the organization of the embryonic growth plate and the several parts.

2 1.1 Skeletal development

Figure 2: Organization of the embryonic growth plate. Different chondrocyte subpopulations can be distinguished during bone formation. Round, low-proliferating chondrocytes can be found at the distal ends of the developing cartilage formation (light orange) and differentiate into high-proliferating, columnar chondrocytes (orange). During bone development, these cells differentiate into pre-hypertrophic (light red) and hypertrophic (dark red) chondrocytes. In the last step, hypertrophic chondrocytes undergo apoptosis and are subsequently replaced by bone (blue) and bone marrow. Cells in the flanking perichondrium (yellow line) differentiate into bone forming osteoblasts (blue) at the same time. Safranin–Weigert staining labels chondrocytes in red and bone and the surrounding tissue in blue. Modified: (Jochmann et al., 2014) After the growth of the bones have finished, the bone is constantly remodelled by osteoclasts and osteoblasts (Karsenty, 1999).

1.1.2 WNT SIGNALLING IS LINKED TO BONE DEVELOPMENT

The development and homeostasis of many different tissues and organs, including skeletal development, is regulated by secreted, cysteine-rich glycoproteins called Wnt proteins (Liu et al., 2008; Kim et al., 2013). These molecules are part of the Wnt signalling pathway (Cadigan and Nusse, 1997; Willert et al., 2003). Different types of Wnt signalling are known: the canonical Wnt signalling pathway (or Wnt/ß-Catenin pathway) with its key component ß-Catenin and several subtypes of the non-canonical Wnt signalling pathway (Komiya and Habas, 2008; Rao and Kuhl, 2010; Sugimura and Li, 2010; De, 2011). During the inactive state of the canonical Wnt signalling, ß-Catenin is phosphorylated by the degradation complex, consisting of AXIN, GSK3β (glycogen synthase kinase 3 β) and APC

3 1 Introduction

(adenomatous polyposis coli), and undergoes proteosomal degradation (Figure 3) (Behrens, 1998; Liu et al., 2002).

Figure 3: Schematic illustration of the canonical Wnt signalling pathway. In the active state of canonical Wnt signalling, Wnt ligands bind to frizzled (Fzd) receptor and its co- receptor low-density lipoprotein receptor-related protein (LRP)-5/6, subsequently activating Disheveled (DVL), which inhibits glycogen synthase kinase 3β (GSK3β) from phosphorylating β-catenin. β-Catenin translocates into the nucleus, binds to transcriptional factors T-cell factor (TCF)/lymphoid enhancer-binding factor (LEF-1) and the expression of target genes is upregulated. When no Wnt Ligand is present, the degradation complex constitutively phosphorylates β-catenin which leads to ubiquitination and proteosomal degradation. Thus, the target gene expression remains low. Modified: (Kim et al., 2013) Binding of Wnt proteins to the Frizzled (Fzd) receptor and low-density lipoprotein receptor– related protein 5 and 6 (LRP5/6) activates the signalling cascade and the protein Dishevelled (DVL) is recruited to the membrane. Then, DVL disrupts the degradation complex and inhibits GSK3β, resulting in hypophosphorylation of ß-Catenin (Hay et al., 2005; Piao et al., 2008). ß- Catenin now enters the nucleus and binds to DNA binding proteins TCF (transcriptional factors T- cell factor) and LEF (lymphoid enhancer-binding factor), inducing the expression of Wnt target genes (Behrens et al., 1996; Tetsu and McCormick, 1999; Hay et al., 2005). The non-canonical planar cell polarity pathway (PCP) and the non-canonical Wnt/calcium pathway are the best studied subtypes of non-canonical Wnt signalling pathways. PCP signalling is initiated upon binding of Wnt to its receptor Fzd. DVL is activated and formation of a complex consisting of activated DVL as well as Dishevelled-associated activator of morphogenesis 1 (DAAM1) is induced, which in turn activates the Rho GTPase (Habas et al., 2001; Wallingford and Habas, 2005; Tanegashima et al., 2008). This signal transduction cascade activates Rho- associated kinase (ROCK) as well as myosin and results in modifications and rearrangement of the actin cytoskeleton (Marlow et al., 2002; Weiser et al., 2007). PCP signalling can also activate

4 1.1 Skeletal development

Rac (Ras-related C3 botulinum toxin substrate 1) GTPases independently of Daam1 and stimulates JNK (c-Jun N-terminale kinases) activity (Li et al., 1999; Habas et al., 2003; Wallingford and Habas, 2005). The non-canical Wnt/calcium pathway shares a number of PCP components and further modulates canonical signalling and the PCP signalling. Binding of some Wnts stimulates this signalling pathway and result in the release of calcium from the endoplasmatic reticulum (ER) (Kohn and Moon, 2005; Gordon and Nusse, 2006; Slusarski and Pelegri, 2007; Komiya and Habas, 2008). In the recent years, Wnt signalling pathways have drawn more attention regarding bone development. Several diseases with bone pathologies, e.g. high–bone mass syndrome (OMIM601884), sclerosteosis (OMIM269500) or craniodiaphyseal dysplasia (OMIM122860) could be linked to aberrant Wnt signalling (Monroe et al., 2012; Baron and Kneissel, 2013). But the effect of Wnt signalling on bone development is complex and can vary in a context- depending manner. Depending on the differentiation state of the cells, both stimulatory and inhibitory effects are known (Church, 2002).

1.1.3 THE ROLE OF HYPOXIA DURING CHONDROGENESIS AND BONE DEVELOPMENT

Oxygen plays a major role in several metabolic pathways, e.g. mitochondrial respiration or tissue development, and adaptation to hypoxic situations is essential for normal development and differentiation. During these temporary hypoxic conditions, the expression of hypoxia-inducible transcription factors (HIFs) is induced. Both HIF-1 and HIF-2 are key mediators of the response machinery to low-oxygen levels (Giaccia et al., 2004; Dunwoodie, 2009). HIF-1 forms a complex consisting of two ubiquitously expressed subunits, named HIF-1α and ARNT (aryl hydrocarbon receptor nuclear translocator) (Hu et al., 2016). Under normoxic conditions, HIF-1α prolyl residues are hydroxylated by cellular oxygen sensor called PHDs (prolyl hydroxylase (Egl nine homologs 1 and 2)). Phosphorylated von Hippel-Lindau (pVHL) binds to the hydroxylated HIF- 1α and acts as the recognition component of the E3-ubiquitin ligase complex. The result is a proteasomal degradation of HIF-1α (Pugh and Ratcliffe, 2003) (Figure 4).

5 1 Introduction

Figure 4: HIF-1α is active only under hypoxic conditions. In normoxia, hypoxia-inducible transcription factor 1 alpha (HIF-1α) is hydroxylated, leading to its proteosomal degradation mediated by the E3 ubiquitin ligase von Hippel–Lindau protein (pVHL). When oxygen levels drops below 5%, HIF-1α is not ubiquitinylated or degraded and enters the nucleus. Here, it binds to hypoxia response element (HREs) and induce the expression of target genes, including angiogenesis-promoting vascular endothelial growth factor (VEGF) as well as genes involved in anaerobic metabolism. Abbreviations: PHD, prolyl hydroxylase (Egl nine homologs 1 and 2); VEGFR, VEGF receptor. Modified: (Maes et al., 2012) Hypoxia inhibits PHDs and HIF-1α is not hydroxylated. Therefore, HIF-1α can enter the nucleus, forms the HIF-1 complex, binds to hypoxia response elements (HREs) within the promoter of hypoxia-responsive genes and activates the expression of target genes (Keith et al., 2011). One of this target genes is VEGF, an important component during angiogenesis (Gerber et al., 1999; Haigh et al., 2000; Ferrara et al., 2003; Zelzer and Olsen, 2005). Several studies investigated the correlation between hypoxia and bone development. In 2001, Schipani et al. stated that the cartilage model, including the growth plate, is an avascular mesenchymal tissue that become hypoxic during the growth of endochondral bones (Schipani et al., 2001). The expression of angiogenic stimuli, like VEGF, and the attraction of blood vessels coincides with the differentiation of chondrocytes to hypertrophic chondrocytes (Zelzer and Olsen, 2005). Stabilization of HIF-1α as well as HIF-2α due to the depletion of pVHL results in matrix deposition and increased COL2A1 levels in primary chondrocytes (Pfander et al., 2004). Under hypoxic conditions, HIF-1α was also shown to bind to the SOX9 promoter and enhance its expression. This interaction as well as increased COL2A1 levels and matrix deposition because of stabilized HIF-1α are essential for the differentiation of chondrocytes and therefore for the development of bones of endochondral origin as SOX9, COL2A1 and matrix deposition are key components of this process (Murphy and Polak, 2004; Amarilio et al., 2007; Lafont, 2010).

6 1.2 Disorders of the Skeleton

1 . 2 Disorders of the S k e l e t o n

The development of the skeleton is a strictly regulated process in which minor deviations can have drastic consequences. Up to date, more than 400 different genetic disorders of the skeleton are known, and more than 300 of these skeletal disorders are linked to mutations in one or more genes (Bonafe et al., 2015). The incidence varies between 4:10 000 and 10:10 000 and some of them are very rare (Zabel and Winterpacht, 2000). Table 1 shows the different types of skeletal disorders (Krakow and Rimoin, 2010; Spranger et al., 2012).

Table 1: Three types of skeletal disorders can be distinguished. 3 different types of skeletal disorders are known and are classified on the basis of molecular, clinical, and radiographic criteria. The table lists all 3 types as well as a short description of each type. Type Description Disruptions - Malformations of the bones, which are secondary and not genetic - - e.g. by temporally limited exposure to toxic substances Dysostoses - malformations resulting from disturbed morphogenesis during early embryonic development - by mutations in signal molecules with a time-limited expression - affect an individual bone or group of bones - often asymmetrical Skeletal dysplasias - general disturbance of the signalling pathways - generalized disorders of cartilage and bones - still present after birth - incidence almost 1:5 000 - cause disturbed proliferation, degeneration or function of a tissue

Skeletal dysplasias, also known as osteochondrodysplasias, are a very heterogeneous group and rang from mild to lethal. All of the patients show varying short stature or dwarfism and orthopaedic complications (Krakow and Rimoin, 2010). Based on molecular, radiographic and/or biochemical criteria, skeletal dysplasias were classified into several groups (Bonafe et al., 2015). A distinction is also made in primary or secondary dysplasias. Primary dysplasias are a result of mutations which are expressed in bone/cartilage whereas secondary dysplasias are triggered by metabolic or hormonal disorders and the influence on the skeleton is a secondary effect (Spranger et al., 2012). Skeletal dysplasia can be recognized at birth if the mutated genes are already active prenatally (Zabel and Winterpracht, 2000).

7 1 Introduction

1 . 3 C a r t i l a g e - hair hypoplasia

Cartilage-hair hypoplasia (CHH, OMIM #250250), also known as metaphyseal chondrodysplasia, McKusick-type, is a skeletal dysplasia and was first described in 1965 by Viktor McKusick (McKusick et al., 1965). The hallmark symptom of CHH is disproportionate short-limbed dwarfism (van der Burgt et al., 1991; Mäkitie and Kaitila, 1993). Radiographs of CHH patients show shortening of tubular bones as well as strong bending of femur and conical epiphyses of the phalanges. Metaphyses are often sclerotic and dilated, and the margins are usually not clearly defined, jagged and irregular (McKusick et al., 1965; Giedion, 1998; Bonafé et al., 2002). Figure 5 shows two CHH patients (A, C) and skeletal changes typical for CHH (B, D).

Figure 5: Cartilage-hair hypoplasia patients show short-limbed dwarfism and metaphyseal chondrodysplasia. CHH patient with homozygous 70A>G mutation shows dwarfism and hypotrichosis (A). Metaphyseal changes are visible in the legs of CHH patient with homozygous 70A>G mutation (B). Short-limbed dwarfism is one of the main symptoms of CHH (C). CHH patients show shortening of tubular bones (D). Arrows indicate the metaphyseal changes. Patients are likely to have gastrointestinal problems and increased risk of developing certain cancers such as skin cancer, liver carcinoma, Non-Hodgkin lymphoma or basal cell

8 1.3 Cartilage-hair hypoplasia carcinoma (Roberts and Arnold, 1984; Mäkitie et al., 1999; Thiel and Rauch, 2011). An increased mortality among CHH patients is due to complications because of the severe defects in the immune system, characterized by lymphopenia, defects in T-lymphocyte function and/or proliferation, deficient humoral immunity and up to severe combined immune deficiencies (SCID) (Mäkitie and Kaitila, 1993; Mäkitie et al., 1999; Makitie, 2001; Horn et al., 2010; Ip et al., 2015; Huang et al., 2015, 2016; Kostjukovits et al., 2017). Other symptoms of CHH are hypopigmented fine hair (hypotrichosis), change in the hair structure and number as well as abnormal joint hypermobility (Polmar and Pierce, 1986; Hermanns et al., 2005, 2006). Symptoms can occur in all combinations and cannot be correlated with a specific genotype (Kavadas et al., 2008; Rider et al., 2009). CHH is caused by mutations in the RMRP gene. The founder mutation can be found in the population of old order Amish and also in the Finnish population (McKusick et al., 1965) but isolated cases are reported all over the world (Ridanpaa et al., 2002; Iqbal et al., 2016). Heredity is autosomal recessive and incidence was estimated to be 1:23 000 (Mäkitie, 1992). The n.70A>G mutation can be found in 100% of patients of the old order Amish population, in 92% of patients of the Finnish population and in 48% of the remaining patients (Thiel et al., 2007). Body size is below the third percentile while men have an average height of 131 cm (110 – 149 cm) and women have an average height of 123 cm (104 – 137 cm) (Mäkitie, 1992). Growth hormones have almost no influence on the final body size (Bocca et al., 2004). One of the suspected causes of this reduced body size is a defect in cartilage development: the proliferative zone of the growth plate is scaled down and the number of hypertrophic chondrocytes is decreased (Hermanns et al., 2005). In 2017, Steinbusch et al. suggested that RMRP RNA plays a crucial in chondrogenesis. They postulated a possible link between the RNase MRP expression and hypertrophic chondrocytes in the growth plate as well as a negative cross-talk between PTHrP (parathyroid hormone-related peptide) and RMRP RNA levels (Steinbusch et al., 2017). A recent sudy highlighted a CHH patient with normal height in childhood (Klemetti et al., 2017). The patient carries a compound heterozygous 70A>G mutation and a 10-nucleotide duplication at position −13 (TACTCTGTGA) in the RMRP promoter. Three more patients were identified with the same genotype and two of them also showed unusually mild growth failure. These results broaden the phenotypic variability in CHH regarding the body height to include normal childhood height. In 2011, Glazov et al. could show that mutations of the POP1 gene result in anauxetic dysplasia (AAD, OMIM 607095), which shows clinical and radiographic features comparable to

9 1 Introduction clinical and radiographic features of CHH (Glazov et al., 2011). A second case report by Elalaoui et al. in 2016 consolidated mutations in POP1 to be the cause of AAD (Elalaoui et al., 2016).

1 . 4 RMRP and the RNase MRP complex

Non-coding RNAs (ncRNAs) are a group of non-protein-coding nucleic acids such as transfer RNAs (tRNAs), ribosomal RNAs (rRNAs) but also micro RNAs (miRNAs) or small interfering RNAs (siRNAs). The non-coding RNA RMRP (RNA component of mitochondrial RNA-processing endoribonuclease, OMIM #157660) is an intronless gene with a length of 267 bases (in humans). The gene is thought to be transcribed by the RNA Polymerase III (Schramm and Hernandez, 2002; Hermanns et al., 2005). In humans, RMRP is located on chromosome 9p13.3 (Sulisalo et al., 1993; 1995) and the sequence is highly conserved among different species (Li et al., 2002). The promoter sequence includes a TATA box, a proximal sequence element (PSE) as well as different potential binding areas for transcription factors (Yuan and Reddy, 1991; Kiss et al., 1992; Paule and White, 2000; Li et al., 2002; Schramm and Hernandez, 2002; Woodhams et al., 2007). Figure 6 shows a schematic structure of the RMRP promoter.

Figure 6: Schematic structure of the RMRP promoter. The red box indicates the RMRP transcript (+1 to +267). The putative promoter elements are shown: TATA box in green, PSE element in grey, octamer in blue and SP1 binding element in purple. The distances and length of each element are indicated below. Yuan and Reddy showed in 1991 that the region from -84 to +1 of the RMRP promoter is sufficient for in vitro transcription of the RMRP gene (Yuan and Reddy, 1991), but the distance between TATA box and start of transcription has to be 24-26 bp (Thiel et al., 2007). Mutations in the RMRP gene can cause CHH (Ridanpää et al., 2001), but also other diseases can be linked to RMRP mutations. Metaphyseal dysplasia without hypotrichosis (MDWH; OMIM #250460) exclusively shows skeletal changes, and is often referred to as the mildest CHH variant or allelic variant (Bonafé et al., 2002). Anauxetic dysplasia (AAD; OMIM #607095) differs from CHH due to the extreme dwarfism and a spondylometaepiphyseal dysplasia (Horn et al., 2001). AAD patients have a maximum body length of 85 cm and have a slight mental retardation (Horn et al., 10 1.4 RMRP and the RNase MRP complex

2001). Omenn syndrome (OS; OMIM #603554) is characterized by a combination of severe combined immunodeficiency, erythroderma, eosinophilia and increased susceptibility to many pathogens (Roifman et al., 2006). All mutations related to these diseases are found among highly conserved areas in the RMRP gene, whereas polymorphisms are found in less conserved areas (Bonafé et al., 2005). Until today, more than 80 CHH-causing mutations are known. Most of the mutations are located within the exon (Figure 7), but mutations in the promoter region of RMRP have also been described (Ridanpää et al., 2001; 2002).

Figure 7: Known pathogenic mutations in the RMRP RNA. CHH-causing mutations are indicated in red, AD in light magenta, MDWH in cyan and OS in yellow. Modified: (Martin and Li, 2007) Point mutations can cause instability of the mutated transcript (Nakashima et al., 2007), whereas promoter mutations cause a decreased RMRP transcription rate (Hermanns et al., 2005; Nakashima et al., 2007). Homozygous promoter mutations were thought to be lethal (Ridanpää et al., 2001; Nakashima et al., 2007), but in recent years, two homozygous promoter mutations in patients with CHH were reported (Kavadas et al., 2008; Vatanavicharn et al., 2010). RMRP, as well as 10 different protein subunits, is part of the RNase MRP (RNase mitochondrial RNA processing) complex (Figure 8), which was identified in the mitochondria in 1987 by Chang and Clayton (Chang and Clayton, 1987). In 1992, Kiss and Filipowicz could also show that the RNase MRP complex can be found in nucleoli and the cytoplasm (Kiss and Filipowicz, 1992). The P3 domain of the RMRP RNA is essential for the localization of the RNase MRP complex in the nucleoli (Jacobson et al., 1995).

11 1 Introduction

Figure 8: The human RNase MRP complex. The non-coding RNA RMRP is part of the protein-RNA complex RNase MRP. The model shows all RNA- protein interactions as well as all protein-protein interactions. Modified: (Welting et al., 2004) The cellular function of RNase MRP depends on its localization. In mitochondria, the RNase MRP complex cleaves RNA transcripts to obtain primers for mtDNA (mitochondrial DNA) replication (Figure 9 A) (Lee and Clayton, 1997). In nucleoli, it is essential for the ribosome biogenesis through the cleavage of ribosomal RNA precursor within the internal transcribed spacer 1 (ITS 1) at the A3 site to obtain long and short forms of 5.8S rRNA (Figure 9 B) (Kiss et al., 1992; Lygerou et al., 1996; Goldfarb and Cech, 2017). The RNase MRP complex is also responsible for the canonical processing of 35S rRNA precursor (Lindahl et al., 2009). The cellular function of RNase MRP in the cytoplasm is processing 5’ UTR B2 Cyclin mRNA (CLB2), allowing its degradation and therefore regulating mitosis (Figure 9 C) (Gill et al., 2004).

Figure 9: Cellular Functions of the RNase MRP complex. 12 1.4 RMRP and the RNase MRP complex

RNase MRP is involved in the processing of mitochondrial RNA that functions as a primer for mitochondrial DNA replication in mitochondria (A). RNase MRP functions in the pre-rRNA processing in S. cerevisiae in nucleoli (B). RNase MRP processes the 5'-UTR of CLB2 mRNA in cytoplasmic temporal asymmetric MRP (TAM) bodies. RNase MRP specifically cleaves the CLB2 mRNA in its 5'-UTR to allow rapid 5' to 3' degradation (C). Modified: (Martin and Li, 2007) It has been shown that the enzymatic activity originates from the RNA component while the protein subunits stabilize the correct structure (Esakova et al., 2008). Several studies assume that mutations in RMRP directly affect the enzymatic function or the assembly of the RNase MRP complex (Shadel et al., 2000; Hermanns et al., 2005; Thiel et al., 2005; Welting et al., 2008; Mattijssen et al., 2010) RMRP RNA and the RNase MRP complex was the subject of several investigations, leading to new insights in the function of both the RNA and the complex. Esakova et al. reported about the ability to recognize single-stranded RNA and to cut these (Esakova et al., 2011). Aulds et al. discovered new substrates for RNAse MRP including SIC1 (a S-phase cyclin/CDK inhibitor and the yeast homolog of the mammalian p27(Kip1)); CTS1, a cell cycle-regulated transcript; and the U2 RNA component of the spliceosome (Aulds et al., 2012). The participation in the degradation of viral RNA and RNA recombination was shown by Jaag and colleagues (Jaag et al., 2011). The interaction of RNase MRP and Viperin mRNA and their role for the immune system was investigated by Mattijssen and colleagues (Mattijssen et al., 2011). The RMRP RNA can also form a complex together with telomerase reverse transcriptase (TERT) and this complex shows RNA- dependent RNA polymerase activity (Maida et al., 2009). A Dicer-depending processing of double-stranded RNA towards siRNA starts and the expression of RMRP RNA is regulated. The effects of mutations in RMRP on the RMRP-TERT complex are not known until now. In 2017, a new study showed that lymphocyte cultures obtained from patients with CHH displayed growth defects in vitro. These defects are consistent with an immunodeficiency cellular phenotype suggesting that telomere deficiency is implicated in the CHH disease phenotype through an as yet unidentified mechanism (Aubert et al., 2017). The generation of two small RNAs derived from the RMRP RNA, which have gene-silencing activity relevant to CHH, was postulated in 2014 (Rogler et al., 2014).

13 2 Aim and objectives of this study

2 AIM AND OBJECTIVES OF THIS STUDY

CHH is a severe skeletal disorder with an incidence of 1:23 000 (Mäkitie, 1992) and is caused by mutations in the RMRP gene. In recent years, more and more functions of the RMRP RNA have been revealed, but the relation to bone growth remained unclear. We addressed three questions within this study: 1. What role does RMRP RNA play in the development and elongation of bones? 2. Which signalling pathways are linked to RMRP RNA? 3. Can we generate an animal model for CHH using new techniques? During bone development and longitudinal growth, chondrocytes in the growth plate become hypertrophic and differentiate into mineralized chondrocytes. The process of maturation of chondrocytes is essential for the elongation of developing bones and therefore, we used different well-established chondrogenic cell lines (MCT cells and ATDC5 cells) to determine the expression pattern of RMRP RNA during chondrogenic differentiation. We also compared human dermal fibroblasts of healthy controls and CHH patients during transdifferentiation into chondrocyte-like cells and checked for differences in RMRP RNA expression as well as chondrogenic potential. To find out which signalling pathways are linked to RMRP RNA, we performed RNA-seq analysis of 4 healthy controls and 4 CHH patients during proliferation and chondrogenic-like transdifferentiation. Comparison of these two groups highlighted altered signalling pathways in patients with CHH and could be the first hint for signalling pathways linked to RMRP RNA. In the last few years, several attempts to generate Rmrp mouse model failed so we used the new CRISPR/Cas9 technology to generate a mouse model with aberrant RMRP RNA expression (collaboration with Dr. Malte Spielmann, Max Planck Institut for Molecular Genetics, Berlin) and also tried to knockdown RMRP in the zebrafish using TALEN (collaboration with Prof. Raimund Wagener, Institute for Biochemistry II, Cologne) and morpholino oligomers (collaboration with Theresa Schredelseker, Institute for Biology I, Freiburg).

14 3.1 Materials

3 MATERIALS AND METHODS

3 . 1 M a t e r i a l s

3.1.1 ANTIBIOTICS

Ampicillin Roche (Mannheim) Spectinomycin Sigma-Aldrich (Steinheim) Tetracycline Sigma-Aldrich (Steinheim)

3.1.2 ANTIBODIES AND SERA

3.1.2.1 Primary antibodies

Actin, monoclonal, mouse Sigma-Aldrich (Steinheim) Beta-Catenin, active, monoclonal, mouse Merck Millipore (Darmstadt) Beta-Catenin, polyclonal, rabbit Cell signaling (USA) HIF1a Novus Biologicals, LLC (USA) WNT9A Abcam (UK) Pop1 (A302-220A) Bethyl Laboratories (USA) Pop1 (A302-221A) Bethyl Laboratories (USA) 3.1.2.2 Secondary antibodies

Swine anti-rabbit, polyclonal, HRP-conjugated Dako (Hamburg) Rabbit anti-mouse, polyclonal, HRP-conjugated Dako (Hamburg) Donkey anti-goat, polyclonal, HRP-conjugated Santa Cruz (Heidelberg)

3.1.3 BACTERIAL STRAINS

OneShot TOP10 chemically competentE.coli Thermo Fisher Scientific (USA) Library Efficiency® DH5α™ competent E.coli Thermo Fisher Scientific (USA)

3.1.4 BUFFERS AND SOLUTIONS

Acid-free Alcian Blue stock solution Acid-free Alcian Blue staining solution 0.4% Alcian Blue in 70% EtOH 7.5 ml Alcian Blue stock solution 1 ml 1 M MgCl2 1.5 ml H2O

Alizarin Red stock solution Ampicillinstock solution 0.5% Alizarin Red in H2Onuk 100 mg/ml in H2Odd

10% APS ATDC5 differentiation medium 10% Ammonium persulfate in H2Odd DMEM/F-12 medium 15 3 Materials and Methods

5% FCS (fetal calf serum) 1% NEAA (non-essential amino acids) 1% Penicillin/Streptomycin 10 µg/ml insulin 10 µg/ml transferrin 30 nM sodium selenite

Citrate buffer DEPC water 4,5 ml 0,1 M citric acid 0,1% Diethylpyrocarbonate 20,5 ml 0,1 M sodium citrate 225 ml H2Odest

60x E3 buffer 1x E3 buffer 295 mM NaCl 167 ml 60x E3 buffer 10 mM KCl H2Odd ad 10 l 20 mM CaCl2 x 2 H2O 2 drops of methylene blue 20 mM MgSO4 x 7 H2O H2Odd ad 2 l Autoclave

FDC differentiation medium Freeze Medium DMEM/F-12 medium 10% DMSO in FCS 10% FCS (fetal calf serum) 1% NEAA (non-essential amino acids) 1% ITS (Insulin-Transferrin-Selenium) 50 µg/ml ascorbic acid 1 ng/ml TGF-β3

IHC-PBS-T IPTG stock solution 1x PBS 1 mM IPTG in H2Odd 0,1% Tween-20

LB agar plates 10x PBS pH 7.4 40 g Luria agar 80 g NaCl H2Odd ad 1 l 2 g KCl 11,5 g Na2HPO4 x 7 H2O 2 g KH2PO4 H2Odd ad 1 l

1x PBS-T Peroxidase block buffer 1x PBS 3% H2O2 in tap water 0,1% Tween 20

1-phenyl 2-thiourea (PTU) solution Proteinase K buffer for DNA isolation 0.2 mM PTU in 1x E3 buffer 100 mM NaCl 10 mM Tris-HCl pH 8.0 50 mM EDTA pH 8.0 0.5% SDS 20 µg/ml RNase A 0.1 mg/ml Proteinase K

10x PhosStop buffer RIPA Stock solution 1 tablet PhosStop 1% NP-40 H2Odd ad 1 ml 1% sodiumdeoxychelate 0,1% SDS 16 3.1 Materials

150 mM NaCl 1 mM sodium phosphate pH 7.2 2 mM EDTA H2Odd ad 1 l

RIPA lysis buffer Staining solution 1 ml RIPA stock solution 1 ml Alcian Blue staining solution 1 mM DTT 10 µl Alizarin Red stock solution Benzonase (5 U/ml) 2% Protease Inhibitor 100 µl 10x PhosStop buffer

TALEN injection solution 1x TE buffer 2 µl TAL1 (1 µg/µl) 10 mM Tris, pH 8.0 2 µl TAL2 (1 µg/µl) 1 mM EDTA 2 µl phenol red 4 µl H2Onuk

10x TBS pH 7.6 1x TBS-T 24,2 g Tris base 1x TBS 80 g NaCl 0,1% Tween 20 H2Odd ad 1 l

Trypsin solution for zebrafishes 10x Immunoblotting running buffer 0.025 g Trypsin in DPBS 30,3 g Tris 44 g Glycine 1% SDS H2Odd ad 1 l

6x Immunoblotting loading buffer 350 mM Tris-HCL (pH 6.8) 34,4% glycerol 10%SDS 10% ß-Mercaptoethanol 0,06% Bromophenol blue

3.1.5 CELL LINES

ATDC5 cells Kind gift from Tim Welting HeLa cells Kind gift from Tim Welting MCT cells Kind gift from Tim Welting Patient-derived skin fibroblasts Obtained from different patients SW1353 cells Kind gift from Tim Welting

3.1.6 CHEMICALS AND REAGENTS

Acetone VWR (France) Acrylamide Rotiphorese Gel 30 (37.5:1) Roth (Karlsruhe) Agarose AG Plus Santa Cruz (Heidelberg) Agarose QA MP Biomedicals (France) Alcian Blue 8GX Sigma-Aldrich (Steinheim)

17 3 Materials and Methods

Alizarin Red S Sigma-Aldrich (Steinheim) Betaine Sigma-Aldrich (Steinheim) Bio-Rad Protein Assay Bio-Rad(Munich) Bromophenol blue Sigma-Aldrich (Steinheim) BSA (Bovine Serum Albumin) Sigma-Aldrich (Steinheim) Butanol Roth (Karlsruhe) Chloroform Sigma-Aldrich (Steinheim) Citric acid Merck (Darmstadt) Complete Phosphatase Inhibitor Roche (Mannheim) DAPI (4‘,6-Diamidin-2-phenylindol) Sigma-Aldrich (Steinheim) DMSO (Dimethyl sulfoxide) Sigma-Aldrich (Steinheim) DAB (Diaminobenzidine) Roth (Karlsruhe) DEPC (Diethylpyrocarbonate) Sigma-Aldrich (Steinheim) DTT (Dithiothreitol) Bio-Rad (München) dNTPs (10 mM) Thermo Fisher Scientific (USA) Ethanol Sigma-Aldrich (Steinheim) Ethidium bromide Applichem (Darmstadt) EDTA (Ethylene Diamine Tetra acetic Acid) MP Biomedicals (France) Formaldehyde Sigma-Aldrich (Steinheim) Formamide Sigma-Aldrich (Steinheim) Glycerol MP Biomedicals (France) Glycine AppliChem (Darmstadt) Haematoxylin Sigma-Aldrich (Steinheim) HEPES Gerbu (Gaiberg) Hi-Di Formamide Thermo Fisher Scientific (USA) HistomountDPX Mountant for histology Sigma-Aldrich (Steinheim) IGEPAL (NP-40) Sigma-Aldrich (Steinheim) Isopropanol Sigma-Aldrich (Steinheim) IPTG (Isopropyl-ß-D-thiogalactopyranoside) AppliChem (Darmstadt) Potassium chloride (KCl) Merck (Darmstadt) Potassium ferricyanide Sigma-Aldrich (Steinheim) Potassium ferrocyanide Sigma-Aldrich (Steinheim) Potassium hydrogen phosphate Merck (Darmstadt) Luria Agar Sigma-Aldrich (Steinheim) Luria Broth Sigma-Aldrich (Steinheim) Magnesium chloride Sigma-Aldrich (Steinheim) Magnesium sulphate Sigma-Aldrich (Steinheim) ß-Mercaptoethanol Sigma-Aldrich (Steinheim) Methanol Roth (Karlsruhe) Milk powder, Blotting grade Roth (Karlsruhe) Sodium acetate Merck (Darmstadt) Sodium citrate Merck (Darmstadt) Sodium chloride (NaCl) Sigma-Aldrich (Steinheim) Sodium deoxycholate AppliChem (Darmstadt) Sodium dodecyl sulphate (SDS) Gerbu (Gaiberg) Sodium hydrogen phosphate Merck (Darmstadt) di-sodium hydrogen phosphateheptahydrate Merck (Darmstadt) Sodium phosphate Merck (Darmstadt) Sodium hydroxide Merck (Darmstadt) Orange G Sigma-Aldrich (Steinheim) Paraformaldehyde (PFA) Serva (Heidelberg) PhosStop Roche (Mannheim) RiboLock RNase Inhibitor Fermentas (St. Leon-Roth) RotiHistol Roth (Karlsruhe) Hydrochloric acid (HCl) Merck (Darmstadt) Sephadex G-50 Fine GE Healthcare (Freiburg) 18 3.1 Materials

N,N,N‘,N‘-Tetramethylethylenediamine (TEMED) Sigma-Aldrich (Steinheim) Tris base Biomol (Hamburg) Tris, ultra pure Biomol (Hamburg) TRIzol Reagent Thermo Fisher Scientific (USA) Tween-20 Sigma-Aldrich (Steinheim) Water, Aqua ad iniectabilia Braun (Melsungen) Water, LiChrosolv for Chromatography Merck (Darmstadt) Water, nuclease-free Thermo Fisher Scientific (USA) Hydrogen peroxide Merck (Darmstadt) Xylol Roth (Karlsruhe) Yellow Sub Geneo (Hamburg) RBC Lysis Solution Qiagen (Hilden) Cell Lysis Solution Qiagen (Hilden) Protein Precipitation solution Qiagen (Hilden)

3.1.7 ENZYMES

Alkaline Phosphatase Roche (Mannheim) Alkaline Phosphatase, Calf Intestinal (CIP) New England Biolabs (Frankfurt) Antarctic Phosphatase New England Biolabs (Frankfurt) Benzonase Merck (Darmstadt) DNase I Roche (Mannheim) M-MLV Reverse Transcriptase Thermo Fisher Scientific (USA) Platinum Taq Thermo Fisher Scientific (USA) Proteinase K Roche (Mannheim) Restriction endonucleases New England Biolabs (Frankfurt) RNase A Qiagen (Hilden) Sp6 RNA Polymerase Roche (Mannheim) T4 DNA Polymerase New England Biolabs (Frankfurt) T4 DNA-Ligase Roche (Mannheim) T7 RNA Polymerase Roche (Mannheim) Taq DNA Polymerase Qiagen (Hilden) Taq DNA Polymerase (2x PCR Master Mix) Promega (Mannheim) Taq DNA Polymerase (Quick Load 2x Master mix) New England Biolabs (Frankfurt)

3.1.8 EQUIPMENT

8-channel eLINE electronic pipette Biozym (HessischOldendorf) Bacterial incubator B6200 Thermo Electron (Langenselbold) 2100Bioanalyzer Agilent (USA) C1000 Thermal Cycler Bio-Rad (München) CFX384 real-time PCR detection system Bio-Rad (München) Ice machine ZBE Ziegra (Isernhagen) Fusion FX VilberLourmat (Eberhardzell) Erlenmeyer flask Schott AG (Mainz) Precision scale Sartorius basic Sartorius (Göttingen) Fluorescence microscopAxioskop Zeiss (Jena) Gel documentation device VilberLourmat (Eberhardzell) Gel system Mini Protean 3 gel + transblotsystem Bio-Rad (München) Gel system Perfect Blue S,M,L PeqlabBiotechnologie (Erlangen) Incubator T5042E Thermo Fisher; Heraeus (Hanau) Incubator TECO 20 Selutec (Hechingen) Luminometer LUMAT LB 9507 Berthold Technologies (USA) 19 3 Materials and Methods

Magnetic stirrer VMS-A VWR (Darmstadt) MicroscopApoptome Carl Zeiss Microscopy (Göttingen) Microscop ID03 Zeiss (Jena) Microscop Nikon Eclipse TS100 Nikon (Japan) Microscop camera Axio Cam MRc5 Zeiss (Jena) Microscop camera Leica EC3 Leica Microsystems (Wetzlar) Microwave NN-E245W Panasonic (Hamburg) TECAN Infinite® 200 PRO NanoQuant Tecan Group (Switzerland) Power Supply EV243 PeqlabBiotechnologie (Erlangen) pH-Meter lab 850 Schott Instruments (Mainz) Pipet Boy VWR International (USA) Shaker Duomax 1030 Heidolph (Schwabach) Shaker WT 12 Biometra (Göttingen) Sequencer 3130 XL Genetic Analyzer Thermo Fisher Scientific (USA) Laminar flow cabinet HERA Safe KS 12 Thermo Electron (Langenselbold) Tankblotter, Mini Blotter EBU-204 C.B.S. Scientific (USA) Thermomixer PocketBloc Biozym (HessischOldendorf) Centrifuge Qik Spin QS 7000 SLG (Gauting) Bioruptor Plus® Diagenode (Belgium) Vortexer MS1 Minishaker IKA Labortechnik (Staufen) Scale LC 2201S Sartorius (Göttingen) Centrifuge Biofugepico Thermo Fisher Scientific (USA) Centrifuge 5415 C Eppendorf (Hamburg) Centrifuge 5417 R Eppendorf (Hamburg) Centrifuge Megafuge 1 Thermo Fisher Scientific (USA) Centrifuge Multifuge 3S-R Thermo Fisher Scientific (USA) Centrifuge Sorvall RT 6000 B DuPont Sorvall (USA) Centrifuge Z233 Hermle (Wehingen) Trans-Blot® Turbo Transfer System Bio-Rad (München)

3.1.9 KITS

BigDye® Terminator v3.1 Cycle Sequencing Kit Thermo Fisher Scientific (USA) EndoFree Plasmid Maxi Kit QIAGEN (Hilden) Zippy™ Plasmid Miniprep Kit Zymo Research (Freiburg) QIAquick PCR Purification Kit QIAGEN (Hilden) QIAquick Gel Extraction Kit QIAGEN (Hilden) QuantiTect SYBR Green PCR Kit QIAGEN (Hilden) RNA 6000 Nano Kit Agilent (USA) RNeasy Mini Kit QIAGEN (Hilden) GreatEscapeSEAPChemiluminescence Kit Clontech Takara (France) TA Cloning® Kit (with pCR® II Vector) with Thermo Fisher Scientific (USA) One Shot® TOP10 Chemically Competent E. coli QIAGEN Plasmid Mini Kit QIAGEN (Hilden) Golden Gate TALEN and TAL Effector Kit 2.0 The plasmid kit used for generation of TALENs was a gift from Daniel Voytas and Adam Bogdanove (Addgene kit # 1000000024) mMessagemMachine T3 Kit Thermo Fisher Scientific (USA) ZymoPURE™ Plasmid Midiprep Kit Zymo Research (Freiburg) Renilla-Glo® Luciferase Assay Kit Promega (Mannheim) BioLux®Gaussia Luciferase Assay Kit New England Biolabs (Frankfurt) DAB Peroxidase (HRP) Substrate Kit (with Nickel), 3,3’- Vector Laboratories, Inc. (USA) diaminobenzidine

20 3.1 Materials

Lipofectamine® 3000 Transfection Kit Thermo Fisher Scientific (USA) Lipofectamine® LTX Transfection Kit Thermo Fisher Scientific (USA) mirVana miRNA Isolation Kit, with phenol Thermo Fisher Scientific (USA)

3.1.10 LADDER

50 bp DNA ladder New England Biolabs (Frankfurt) 100 bp DNA ladder New England Biolabs (Frankfurt) 1 kb DNA ladder New England Biolabs (Frankfurt) 2 log DNA ladder New England Biolabs (Frankfurt) Page Ruler Prestained Protein Ladder Fermentas (St. Leon-Roth) Spectra Multicolor HighRange Protein Ladder Thermo Fisher Scientific (USA)

3.1.11 MATERIALS FOR CELL CULTURE

Dimethylsulfoxid (DMSO) Sigma-Aldrich (Steinheim) DMEM + GlutaMAX™ Thermo Fisher Scientific (USA) DMEM/F-12 + GlutaMAX™ Thermo Fisher Scientific (USA) Fetal calf serum Sigma-Aldrich (Steinheim) 1xPBS Thermo Fisher Scientific (USA) Trypsin-EDTA 0.05% Thermo Fisher Scientific (USA) NEAA (Non-essential amino acids) Thermo Fisher Scientific (USA) Trypsin Thermo Fisher Scientific (USA) Insulin Sigma-Aldrich (Steinheim) Transferrin Sigma-Aldrich (Steinheim) Sodium selenite Sigma-Aldrich (Steinheim) Insulin-Transferrin-Selenium Thermo Fisher Scientific (USA) Polyethylenimine, Linear (MW 25,000) Polysciences, Inc. (Hirschberg an der Bergstrasse) Recombinant Human TGF-beta 3 Protein R&D Systems, Inc. (USA) WNT9A (Human) Recombinat Protein Abnova (Taiwan) Wnt9a stealth siRNA ThermoFisher Scientific, USA

3.1.12 PLASMIDS

pCR4-TOPO Thermo Fisher Scientific (USA) pCRII-TOPO Thermo Fisher Scientific (USA) pcDNA3.1 Thermo Fisher Scientific (USA) pEGFP-C1 Clontech Takara (France) pGL4.74 Promega (Mannheim) pGLuc-Basic New England Biolabs (Frankfurt) pSEAP2 basic Clontech Takara (France) pSEAP2 control Clontech Takara (France) RCIscript-GoldyTALEN Addgene (UK)

21 3 Materials and Methods

3.1.13 SOFTWARE AND DATABASES

Axio Vision release 4.6.3 Carl Zeiss Microscopy (Göttingen)

Bio-Rad CFX manager Bio-rad (München)

Ensembl http://www.ensembl.org/index.html

LAS EZ 2.0.0 Leica Application suite Leica Microsystems (Wetzlar) Microsoft Office Microsoft Corporation NCBI Gene http://www.ncbi.nlm.nih.gov/gene NCBI-Primer BLAST http://www.ncbi.nlm.nih.gov/tools/pri mer-blast/ NCBI Pubmed http://www.ncbi.nlm.nih.gov/pubmed/ New England Biolabs-Cutter http://tools.neb.com/NEBcutter2/ Optimase Protocol writer http://www.mutationdiscovery.com/m d/MD.com/ screens/optimase/OptimaseInput.html ?action=none Primer3 http://primer3.ut.ee/ Human BLAT Search https://genome-euro.ucsc.edu/cgi- bin/hgBlat?command=start Software zur Erstellung von Stammbäumen http://pedigree.cegat.de/ New England Biolabs – Double Digest Finder https://www.neb.com/tools-and- resources/interactive-tools/double- digest-finder The Human Protein Atlas http://www.proteinatlas.org/ STRING: functional protein association networks http://string-db.org/ Genomatix Software GmbH https://www.genomatix.de/ Sequencher, Version 4.9 Gene codes Corporation (USA) Sequencing Analysis, Version 5.4 Thermo Fisher Scientific (USA) TALEN targeter 2.0 https://tale-nt.cac.cornell.edu/ SEQUENCEPilot 3.5.2 JSI medical systems GmbH (Ettenheim) GraphPad Prism 6 GraphPad Software (USA) Mfold http://unafold.rna.albany.edu/?q=mfol d Gene Tools, LLC Design Request Website Gene Tools, LLC (USA)

3.1.14 SUPPLIES

Blotting paper, Whatman 3MM GE Healthcare; Whatman (Freiburg) Chamber slides, Lab-Tek 1 Well glass slide Thermo Fisher Scientific (USA) Coverslips 23x50mm, No1 Marienfeld (Lauda-Königshofen) Filter tips 10 μl Biozym (HessischOldendorf) Filter tips 20 µl Peqlab (Erlangen) Filter tips 100 μl Biozym (HessischOldendorf) Filter tips 300 μl Biozym (HessischOldendorf) Filter tips 1250 μl Biozym (HessischOldendorf) Glas beads Roth (Karlsruhe) Hybond ECL Nitrocellulose membrane GE Healthcare (Freiburg) Amersham ECL Prime Western Blotting Detection Reagent GE Healthcare (Freiburg) PCR plate seal foil Bio-Rad (München) Slides, Super Frost Plus R Langenbrinck (Emmendingen) 22 3.1 Materials

Parafilm® M Laboratory Film Brand (Wertheim) PCR plates, 384 well; white Bio-Rad (München) PCR plate, 96 well; transparent Bio-Rad (München) PCR tubes 0.2 ml Biozym (HessischOldendorf) Serological pipettes:1 ml, 5 ml, 10 ml, 25 ml Corning Incorporated (USA) Plate septa, 96 well Thermo Fisher Scientific (USA) PP tube, 15 ml BD (Heidelberg) PP tube, 50 ml Greiner (Frickenhausen) Tube, 1.5 ml Sarstedt (Nümbrecht) Tube, safe lock, 2 ml Eppendorf (Hamburg) Tube, safe lock, 1.5 ml Eppendorf (Hamburg) Round-bottom tube,5 ml BD Biosciences (Heidelberg) Scalpel Feather (Japan) Syringe filters, 0.45 µm, Cellulose Acetate membrane VWR International (USA) Syringe filters, 0.22 µm, Cellulose Acetate membrane VWR International (USA) Counting chamber,Neubauer improved Peqlab (Erlangen) Toothpick Hygiene GMI (Alterkülz) Cell culture flasks with filter, 25 cm2 BD (Heidelberg) Cell culture flasks with filter 75 cm2r Greiner bio-one (Frickenhausen) Cell culture flasks with filter 175 cm2 Greiner bio-one (Frickenhausen) Cell culture plates, 24 well Corning Incorporated (USA) Cell culture plates, 6 well Greiner bio-one (Frickenhausen) Cell culture plates, 12 well Greiner bio-one (Frickenhausen) Cell culture dishes, 10 cm TPP (Schweiz) Cell scraper BD (Heidelberg) Centrifuge cup 200 ml Thermo Fisher Scientific (USA) Trans-Blot® Turbo™ Midi PVDF Transfer Packs Bio-Rad (München)

3.1.15 OLIGONUCLEOTIDES

3.1.15.1 Oligos for CHH diagnostics

RMRP F 5’-GGG CCA GAC CAT ATT TGC ATA AG-3’ RMRP R 5’-AAG GCC AAG AAC AGC GTA AAG C-3’ RMRPseq F 5’-CTC ACG CCA CCA ACT TTC TCA C-3’ RMRPseq R 5’-CGC CTG CGG TCC CAA CTA C-3’

3.1.15.2 Housekeeping genes

RPL13 F 5’-CGG AAT GGC ATG GTC TTG AAG C-3’ RPL13 R 5’-GCC TTA CGT CTG CGG ATC TTA C-3’ HPRT1 F 5’-GAG TCC TAT TGA CAT CGC CAG T-3’ HPRT1 R 5’-CAG TTT AGG AAT GCA GCA ACT GA-3’ Actin F 5’-CGC CAC CAG GTA AGC AGG GAC-3’ Actin R 5’-CGC GGG AAT GTG GCT GCA AAG-3’ Gapdh F 5’-TGC ACC ACC AAC TGC TTA GC-3’ Gapdh R 5’-GGC ATG GAC TGT GGT CAT GAG-3’

23 3 Materials and Methods

3.1.15.3 Quantitative Real-Time PCR oligos for human (h) and murine (m) samples

RMRP F (h, m) 5’-TCG TGC TGA AGG CCT GTA TCC T-3’ RMRP R (h, m) 5’-GGA GCT GAC GGA TGA CGC CC-3’ COL10A1 F (h, m) 5’-ATG ATG AAT ACA CCA AAG GCT ACC T-3’ COL10A1 R (h, m) 5’-ACG CAC ACC TGG TCA TTT TCT G-3’ SOX9 F (h, m) 5’-AGT ACC CGC ACC TGC ACA AC-3’ SOX9 R (h, m) 5’-CGC TTC TCG CTC TCG TTC AG-3’ RUNX2 F (h, m) 5’-TGA TGA CAC TGC CAC CTC TGA-3’ RUNX2 R (h, m) 5’-GCA CCT GCC TGG CTC TTC T-3’ COL2A1 F (h, m) 5’-TGG GTG TTC TAT TTA TTT ATT GTC TTC CT-3’ COL2A1 R (h, m) 5’-GCG TTG GAC TCA CAC CAG TTA GT-3’ WNT9A F (h) 5’-GGG CAG ACG GTC AAG CAA-3’ WNT9A R (h) 5’-CCA CGA GGT TGT TGT GGA AGT-3’ Wnt9a F (m) 5’-GCA GCA AGT TTG TCA AGG AGT TC-3’ Wnt9a R (m) 5’-CTC GTG GAA GGG TGC TAG CT-3’

3.1.15.4 Housekeeping genes for zebrafish samples

tbp F 5’-CGG TGG ATC CTG CGA ATT A-3’ tbp R 5’-TGA CAG GTT ATG AAG CAA AAC AAC A-3’ ef1a F 5’-CTT CTC AGG CTG ACT GTG C-3’ ef1a R 5’-CCG CTA GCA TTA CCC TCC-3’

3.1.15.5 Quantitative Real-Time PCR oligos for zebrafish samples

RNase_MRP F 5’-CTA AGC TAC GCA CGG GGA AC-3’ RNase_MRP R 5’-CAA TGC AAG CCA CTG ATC TGC-3’ pop1 F 5’-ATC AGC CGA GGA GTG TTC AGT-3’ pop1 R 5’-CTG TGA TGT GTT TGG GCA GGT-3’

3.1.15.6 Oligos for mutagenesis PCR

Universal forward 5’-TAG CTA TTC TGC TAG CCA CAA TGC C-3’ -23/-15dup_Rev 5’-GGA ATT CGA TAC AGG CCT TCA GCA CGA ACC ACG TCC TCA GCT TCA CAG AGT ACA CAG AGT AGT ATT TTA TAG CC-3’ -22/-10dup_Rev 5’-GGA ATT CGA TAC AGG CCT TCA GCA CGA ACC ACG TCC TCA GCT TCA CAG AGT AGC TTC ACA GAG TAG TAT TTT ATA GCC-3’ -20/-14dup_Rev 5’-GGA ATT CGA TAC AGG CCT TCA GCA CGA ACC ACG TCC TCA GCT TCA CAG ATC ACA GAG TAG TAT TTT ATA GCC-3' -15/-8dup_Rev 5’-GGA ATT CGA TAC AGG CCT TCA GCA CGA ACC ACG TCC TCA GCT TCT CAG CTT CAC AGA GTA GTA TTT TAT AGC C-3’

24 3.2 Methods

3.1.15.7 Oligos for sequencing of plasmids

pSEAP2 basic F 5’-CTA GCA AAA TAG GCT GTC CC-3’ pSEAP2 basic R 5’-CCT CGG CTG CCT CGC GGT TCC-3’ M13 F 5’-TGT AAA ACG ACG GCC AGT-3’ M13 R 5’-CAG GAA ACA GCT ATG AC-3’ T3 5’-GCA ATT AAC CCT CAC TAA AGG-3’ SP6 5’-ATT TAG GTG ACA CTA TAG-3’

3.1.15.8 Other oligos

RNase_MRP full- 5’-TCG ATG TGT ATA TAT CTT GTG CCG C-3’ length F RNase_MRP full- 5’-CGG TTG TTC AAT TGA ATG TCA TCC AG-3’ length R

3 . 2 M e t h o d s

3.2.1 BIOCHEMICAL METHODS

3.2.1.1 Protein extraction from adherent cells

For the investigation of protein expression, proteins were isolated from cells. Cells were washed once with 1x DPBS and 1 ml of RIPA lysis buffer was added. Cells were detached using a cell scraper and transferred into a 1.5 ml tube. Cell/protein lysis buffer mix was incubated for 20 min on ice and sonicated for 10 cycles of 30 sec on/30 sec off. After 10 min at 13 000 rpm and 4°C, supernatant containing the proteins was transferred into a new tube.

3.2.1.2 Protein quantification and precipitation

Bio-Rad Protein assay was used to quantify protein concentration. This assay is based on the method of Bradford (Bradford, 1976). BSA (bovine serum albumin; Sigma-Aldrich, Steinheim) was used to generate standard curves. For SDS-PAGE and immunoblotting analysis, 100 µg of the sample was precipitated overnight with 9 volumes acetone. On the next morning, sample was centrifuged for 10 min at 13 000 rpm and 4°C. Supernatant was decanted and pellet was air-dried on ice. Protein pellet was then resuspended in 13 µl 2x Immunoblotting loading buffer. Sample was either used directly or was stored at -20°C until further use.

25 3 Materials and Methods

3.2.1.3 SDS polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting

Proteins can be separated in an electric field according to their molecular weight using SDS- PAGE. Polypeptides were run on a 10% separation gel (Table 2) and transferred to a 0.2 µm PVDF membrane by electroblotting.

Table 2: Composition of SDS polyacrylamide gels used for SDS-PAGE. Given are the compositions of a 10% separation gel and a general stacking gel. Separation gel 1 gel Stacking gel 1 gel

H2Odd 1.9 ml H2Odd 2.1 ml 1,5 M Tris, pH 8,8 1.3 ml 1 M Tris, pH 6,8 0.38 ml 10% SDS 50 µl 10% SDS 30 µl 10% APS 50 µl 10% APS 30 µl 30% Acrylamid 1.7 ml 30% Acrylamid 0.5 ml TEMED 2 µl TEMED 3 µl

Membrane was incubated overnigth with primary antibody (dilution range 1:200 – 1:1000) at 4°C with gentle rotation. Bound primary antibodies were detected with horseradish peroxidase- conjugated secondary antibodies and visualized by enhanced chemiluminescence (ECL).

3.2.1.4 Secreted alkaline phosphatase (SEAP) assay

To investigate the effect of RMRP promoter mutations on the RMRP promoter activity, different sizes (-1500_-1 or -200_-1) of either the wild-type or mutated RMRP promoter region (- 23_-15dupTACTCTGTG, -22_-10dupACTCTGTGAAGCT, -20_-14dupTCTGTGA and -15_- 8dupGAAGCTGA) were cloned into the pSEAP2-basic vector. Different cell lines were transfected with these plasmids and analysis was done on day 2 post transfection using the reagents of the ‘Great EscAPe™ SEAP Chemiluminescence Kit 2.0’ (Clontech Takara, France). Supernatant was collected and centrifuged for 30 sec at 13 000 rpm to pellet cell debris. Supernatant was transferred to a new tube and could be stored until further analysis at -20°C. 25 µl of the sample was mixed with 75 µl 1x dilution buffer and incubated for 30 min at 65°C. Subsequently, sample was put on ice for 3 min and then was allowed to come to RT. 100 µl of SEAP substrate solution was prepared in a luminescence tube and sample was added. After 30 min of incubation at RT, RLU (relative light unit) was measured.

3.2.1.5 Gaussia luciferase assay

The desired promoter region of the gene of interest was cloned into pGLuc-Basic and this plasmid was transfected into cells. After 24 hours, 48 hours and 72 hours, supernatant was

26 3.2 Methods collected and promoter activity was measured using the BioLux®Gaussia Luciferase Kit (New England Biolabs, Frankfurt). Luminometer was set to 5 sec of measuring time and 20 µl of supernatant was mixed with 50 µl of stabilized assay solution. After 40 sec of incubation at RT, samples were measured.

3.2.1.6 Renilla luciferase assay

To normalize transfection efficiency for promoter activity experiments, a mammalian co- reporter vector containing the wild-type Renilla luciferase (pGL4.74 or pRL-TK) were used. The expression of Renilla luciferase was measured using the Renilla-Glo™ Luciferase assay (Promega, Mannheim) according to the manufacturer.

3.2.2 CELL CULTURE METHODS

3.2.2.1 General cull culture

Subculturing of cells was performed whenever cells reached a confluency of 70-90% to avoid density-related side effects. Cells were washed once with 1x DPBS and trypsinized using an appropriate amount of 0.05% Trypsin-EDTA (Thermo Fisher Scientific, USA). After 5 min at 1 300 rpm, supernatant was removed and resuspended pellet was split to a new cell culture flask. For long-term storage, cells were trypsinized and pellet was resuspended in Freeze-medium. After a few days at -80°C to cool down the samples slowly, cells were transferred to liquid nitrogen. Cultured cells were tested for Mycoplasma sp. contamination after starting culturing the cells or prior cryopreservation. To test the cells, ‘Mycoplasma Test Kit II‘ (Applichem, Darmstadt) was used according to the protocol of the manufacturer. Positive tested cells were treated with BM- Cyclin (Roche, Mannheim) for three weeks as specified in the manual.

3.2.2.2 Culturing of patient-derived skin fibroblast

To obtain patient-derived skin fibroblasts, a small piece of human skin was dissected from patients during a surgery or during their stay at the hospital. This piece of skin was cut into smaller pieces and was cultured in a 6 well cell culture plate in DMEM/F-12 media supplemented with 10% fetal calf serum (FCS; Sigma-Aldrich, Steinheim), 1% non-essential amino acids (NEAA; Thermo Fisher Scientific, USA) and 1% Penicillin/Streptomycin (Thermo Fisher Scientific, USA) at 37°C and 5% CO2. Once fibroblasts were visible, cells were transferred into a cell culture flask.

27 3 Materials and Methods

3.2.2.3 Culturing of HeLa cells

HeLa cells are human cells derived from cervical cancer (Rahbari et al., 2009). To culture HeLa cells, DMEM media supplemented with 10% FCS and 1% Penicillin/Streptomycin at 37°C and 5% CO2 was used.

3.2.2.4 Culturing of SW1353 cells

In 1977, A. Leibovitz isolated adherent fibroblasts, called SW1353, from a primary grade II chondrosarcoma of the right humerus (source: www.lgcstandards-ATCC.org; also Gebauer et al.,

2005). SW1353 were cultured at 37°C and 5% CO2 in DMEM/F-12 medium supplemented with 10% FCS and 1% Penicillin/Streptomycin.

3.2.2.5 Culturing of ATDC5 cells

ATDC5 cells (Atsumi et al., 1990; Shukunami et al., 1996) were cultured in proliferation medium (DMEM/F-12, 5% FCS, 1% Penicillin/Streptomycin and 1% NEAA). To start hypertrophic differentiation of ATDC5s, cells were cultured in differentiation medium. This medium contains proliferation medium supplemented with 10 µg/ml insulin (Sigma-Aldrich, Steinheim), 10 µg/ml transferrin (Sigma-Aldrich, Steinheim) and 30 nM sodium selenite (Sigma- Aldrich, Steinheim).

3.2.2.6 Culturing of MCT cells

An easy cell line to mimic hypertrophic differentiation is called MCT cells (Lefebvre et al, 1995). These MCTs are mouse endochondral chondrocytes which are immortalized with a temperature-sensitive simian virus 40 large tumor antigen. Cells are kept in a proliferative state when cultured at 32°C and 8% CO2. A change of the culture conditions from 32°C and 8% CO2 to

37°C and 5% CO2 result in hypertrophic differentiation of the cells. Standard culture medium consisted of DMEM+GlutaMAX, 10% FCS, 1% NEAA and 1% Penicillin/Streptomycin.

3.2.2.7 Transient transfection of adherent cells

HeLa The day before transfection, HeLa cells were seeded at 10 000 –20 000 cells/cm2. On the day of transfection, 1 µg DNA was dissolve in 500 µl Opti-MEM (Thermo Fisher Scientific, USA) and was incubated for 5 min at RT. After the incubation, DNA was mixed carefully with 5 µl of Lipofectamine® LTX (Thermo Fisher Scientific, USA) and again incubated for 25 min at RT. Cell medium was replaced with 1.5 ml of fresh medium. DNA/Lipofectamine® LTX solution was

28 3.2 Methods added dropwise. Cell medium was removed on the next morning and fresh medium was added. Analysis was performed after 48 hours or differently according to the experimental setup. SW1353 SW1353 cells were seeded one day prior to transfection at 20 000 cells/cm2. On the day of transfection, DNA was diluted in 100 µl /F-12 (without supplements) at RT. PEI (Polyethylenimine, Linear, MW 25.000; Polysciences, Inc. Hirschberg an der Bergstrasse) was added in a ratio of 1:3 DNA (µg)/PEI (µl). DNA/PEI solution was incubated for 15 min at RT and cell medium was replaced with fresh DMEM/F-12 medium with either 10% FCS (SW1353) but without other supplements. DNA/PEI complexes were added drop-wise per well. After 5 hours, medium was replaced with fresh complete medium. Analysis was performed after 48 hours or differently according to the experimental setup. ATDC5 and MCT For the transfection of proliferating ATDC5 and MCT cells, cells were seeded at 20 000 cells/cm2. For experiments using differentiating ATDC5 cells, cells were plated on day -1 at 6 400 cells/cm2 and differentiation was initiated on day 0. Medium was changed on day 2 and transfection was performed on day 4. 3-4 hours after seeding, cells were transfected with 1 µg DNA. 3.75 µl Lipofectamine® 3000 (Thermo Fisher Scientific, USA) was diluted in 125 µl Opti- MEM. DNA was diluted in 125 µl Opti-MEM and P3000™ Reagent (2 µl/µg DNA) was added (not for RNAi experiments). The diluted DNA was mixed in a ratio of 1:1 with the diluted Lipofectamine® 3000 and incubated for 5 min at RT. Cell medium was replaced with fresh medium and DNA-lipid complex was added to the cells. Cells were cultivated either at 37°C (ATDC5) or 32°C (MCT) overnight. On the next morning, medium was changed and were either cultivated at 32°C (proliferating MCT) or 37°C (ATDC5 and differentiating MCT). Analysis was performed after 48 hours or differently according to the experimental setup.

3.2.2.8 Induction of hypoxia-like conditions

Hypoxia-like conditions were induced using different concentrations of Cobalt chloride 2 (CoCl2) (Piret et al., 2002; Wu and Yotnda, 2011). Cells were plated at day -1 at 20 000 cells/cm .

On day 0, cell medium was replaced with fresh medium supplemented with 100 µM CoCl2. RNA and/or proteins were isolated after 24 hours.

3.2.2.9 Over expression of proteins

Full length cDNA of different genes in pcDNA3.1 were used for over expression experiments. An appropriate amount of plasmid was transfected into cells according to the protocols mentioned in section 3.2.2.7.RNA and/or proteins were isolated after 48 hours. 29 3 Materials and Methods

3.2.2.10 Fibroblasts transdifferentiated into chondrocyte-like cells (FDC)

Patient-derived skin fibroblasts can be used to mimic chondrogenic differentiation (French et al., 2004). Each well of a 24 well plates was coated with 5 µg Aggrecan (Sigma-Aldrich, Steinheim). On the next morning, cells were plated at 200 000 cells/well in FDC differentiation medium (normal fibroblast medium supplemented with 1% Insulin-Transferrin-Selenium (Thermo Fisher Scientific, USA), 50 µg/ml ascorbic acid and 1 ng/ml TGF-β3 (R&D Systems, Inc., USA). For stimulation during chondrogenic differentiation, differentiation medium was supplemented with 15 ng/ml recombinant WNT9A protein (Abnova, Taiwan). Total RNA and proteins were isolated at different time points according to the experimental setup. FDC differentiation medium was changed every second day.

3.2.3 CLONING OF DNA FRAGMENTS

3.2.3.1 TOPO cloning

Amplified DNA was mixed with 1 µl 10 mM dATP, 5 µl 10x PCR Buffer, 1.5 µl 50 mM

MgCl2 and 1 Unit Taq polymerase. Reaction was filled up to 50 µl with H2Onuk and incubated for 15 min at 72°C to generate a poly-A overhang. After cooling, 1 µl of the reaction mix was added to 1 µl salt solution (provided in the TA Cloning® Kit (with pCR® II Vector) by Thermo Fisher Scientific (USA)) and 4 µl pCRII TOPO vector. After 5 min at RT, 1 µl of the plasmid was transformed into competent E. coli cells (see 3.2.3.3).

3.2.3.2 Restriction site-directed cloning

For restriction site-directed cloning of PCR products, amplification primer enclosed a unique restriction site. PCR product and destination vector were digested with restriction enzymes and digestion was checked on a gel. Plasmid DNA was dephosphorylated using 10 Units of CIP (alkaline phosphatase, calf intestinal) and purified by gel extraction. Digested PCR product and plasmid DNA was mixed in a 3:1 molar ratio and ligation was performed overnight at 4°C using 5 Units of T4 DNA ligase (Roche, Mannheim).

3.2.3.3 Transformation of competent E.coli

Plasmids were transformed into One Shot® TOP10 Chemically Competent E. coli according to the manual of the TA Cloning® Kit (with pCR® II Vector) to increase the amount of plasmid DNA. 1 µl of the previous generated plasmid was added to one vial of competent cells and incubated for 20 min on ice. After heat shocking the cells for 30 sec at 42°C, cells were cooled 30 3.2 Methods down for 2 min on ice. 350 µl pre-warmed S.O.C. medium was added and cells were started to grow for 1 h at 37°C and 225 rpm. 100 µl of the grown culture was plated on pre-warmed LB agar plates and incubated overnight at 37°C. On the next morning, a single colony was picked using a sterile toothpick and mini cultures were started.

3.2.4 CRISPR/CAS9 KNOCKOUT

A Rmrp mouse model lacking the -290_-18 Rmrp promoter was kindly generated by Malte Spielmann using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 technique (Kraft et al., 2015; Lupiáñez et al., 2015). In short, sgRNAs flanking the nucleotides -290 until -18 of the Rmrp promoter, complementary strands were annealed, phosphorylated, and cloned into an appropriate CRISPR/Cas vector. G4 embryonic stem cells were transfected with the CRISPR construct and positive cells were selected via antibiotic resistance, genotyped and mice were generated by diploid or tetraploid aggregation.

3.2.5 DNA STANDARD METHODS

3.2.5.1 Isolation of genomic DNA from blood

25 ml of RBC Lysis Solution™ (QIAGEN, Hilden) was mixed with the blood sample obtained from patients. After 20 min incubation on a shaker, sample was centrifuged for 5 min at 2 500 rpm. Supernatant was decanted and pellet was re-suspended with 1 ml Cell Lysis Solution™ (QIAGEN, Hilden) per 1 ml of blood. 5 µl RNase A (QIAGEN, Hilden) per 1 ml blood was added, gently mixed and incubated at 37°C for 15 min. After incubation for 5 min on ice, 1 ml Protein Precipitation Solution™ (QIAGEN, Hilden) per 3 ml sample was mixed ant vortexed for 20 sec. Sample was centrifuged for 5 min at 2 500 rpm and supernatant was decanted into a new tube. 1 volume of Isopropanol was added, sample was centrifuged again for 5 min at 2 500 rpm and pellet was washed with 70% EtOH. DNA pellet was dissolved in 100 µl TE buffer and was ready to use. DNA concentration was determined using the TECANInfinite®200 PRO NanoQuant (TECAN, Switzerland).

3.2.5.2 Isolation of genomic DNA from cells

Cells were trypsinized (see 3.2.2.1) and centrifuged for 5 min at 1 300 rpm. Supernatant was removed and pellet was re-suspended in 300 µl of Proteinase K buffer for DNA isolation. After overnight incubation at 54°C and 750 rpm, 1 volume of buffered Phenol/Chloroform was added

31 3 Materials and Methods and mixed thoroughly by vortexing. Sample was then centrifuged for 15 min at 13 000 rpm. Aqueous phase was transferred to a new tube. 1/10th volume ice-cold 3 M sodium acetate and 2 volumes of 100% EtOH was added. DNA was precipitated at -20°C for at least 1 hour and centrifuged for 20 min at 13 000 rpm. The pellet was washed once and dissolved in 20 µl H2Onuk. DNA concentration was determined using the TECAN Infinite® 200 PRO NanoQuant (TECAN, Switzerland).

3.2.5.3 Isolation of plasmid DNA from bacteria

Depending on the need of amount and quality of the DNA, different Kits were used to isolate plasmid DNA from bacterial cultures according to the manual. For PCRs and sequencing, DNA was isolated using the ‘Zippy™ Plasmid Miniprep Kit’ (Zymo Research, Freiburg). DNA needed for subcloning and transfection experiments was isolated using either the ‘ZymoPURE™ Plasmid Midiprep Kit’ (Zymo Research, Freiburg) or the ‘EndoFree® Plasmid Maxi Kit’ (Qiagen, Hilden). DNA concentration was determined using the TECAN Infinite® 200 PRO NanoQuant (TECAN, Switzerland).

3.2.5.4 Isolation of DNA after gel electrophoresis

Whenever needed, DNA was isolated from agarose gels. This was done using the ‘QIAquick Gel Extraction Kit’ (QIAGEN, Hilden) according to the manual.

3.2.5.5 DNA digestion with restriction enzymes

For the investigations, which effects RMRP promoter mutations have on the RMRP promoter activity compared to wild-type RMRP promoter, various RMRP promoter sequences were cloned into pSEAP2-basic. First, either wild-type or mutated RMRP promoter sequences were generated using mutagenesis PCRs (see 3.2.8.4). Sequences were checked on a gel for specificity and DNA was isolated as described in section 3.2.5.4.

3.2.6 ETHICAL STATEMENT

Ethical permission for the collection and use of dermal fibroblasts was obtained from the medical ethical Institutional Review Board of Freiburg University Hospital. Methods and experimental protocols to obtain dermal fibroblasts were carried out in accordance with the Freiburg University Hospital medical ethical Institutional Review Board, according to German law. Informed consent was obtained from all subjects.

32 3.2 Methods

Animal experiments have been approved by Institutional Animal Care and Use Committee (IACUC) and have been conducted according to applicable national and international guidelines.

3.2.7 HISTOLOGICAL METHODS

3.2.7.1 Paraffin embedding of tissue

Tissue was fixed in 4% PFA (Paraformaldehyde in PBS) at 4°C overnight and dehydrated using an ethanol/xylene series shown in Table 3.

Table 3: Ethanol/Xylene series used for dehydration of tissue. To be able to cut tissue for histological approaches, tissue samples have to be dehydrated and embedded in paraffin. An ethanol series with increasing amount of ethanol, two steps of pure xylene as well as one step of 1:1 xylene/paraffin and one step of 100% paraffin was used to prepare the samples for final paraffin embedding. Solution Duration 50% ethanol 1 hour 70% ethanol 1 hour 90% ethanol 1 hour 100% ethanol 1 hour 100% xylene 1 hour 100% xylene 1 hour 1:1 xylene/paraffin 1 hour 100% paraffin Over night

Tissue was embedded in fresh new paraffin.

3.2.7.2 Immunohistochemistry staining (IHC)

Tissue sections (5 µm) were deparaffinised and rehydrated in a decreasing ethanol/xylene series. Last rehydration step was carried out in IHC-PBS-T for 5 min. Citrate buffer was boiled for 5 min at 750 watt and slides were incubated for 30 min in buffer when it cools down followed by 5 min in IHC-PBS-T. Slides were incubated for 5 min in Peroxidase block buffer at RT in a humidified chamber and washed for 5 min with IHC-PBS-T. Non-specific binding sites were blocked with 10% normal serum (depending on primary antibody) in IHC-PBS-T for 30 min at RT in humidified chamber. Then, slides were washed for 5 min in IHC-PBS-T and incubated at 4°C in a humidified chamber overnight with primary antibody diluted in IHC-PBS-T (Table 4).

33 3 Materials and Methods

Table 4: Staining conditions for IHC. Each primary antibody needs special conditions for optimal IHC staining. Conditons for POP1 IHC staining are listed below. Antibody Concentration Blocking serum POP1 1:100 Normal goat serum

On the next day, slides were washed two times for 5 min with IHC-PBS-T and secondary antibody (1:1 000 in IHC-PBS-T) was added. After 2 h incubated at RT in humidified chamber, slides were washed twice in IHC-PBS-T for 5 min. An appropriate amount of DAB staining solution (Vector Laboratories, Inc., USA) was added to each specimen and incubated for a maximum of 10 min. Colouring reaction was stopped by placing slides in H2Odest. Slides were counter-stained for 30 sec in haematoxylin solution (Sigma-Aldrich, Steinheim) and incubated in slowly running tap water for 10 min. Slides were mounted with Histomount DPX mountant (Sigma-Aldrich, Steinheim) after rehydration.

3.2.8 POLYMERASE CHAIN REACTION (PCR) TECHNIQUES

3.2.8.1 Standard PCR

Amplification of specific genomic regions was done using standard polymerase chain reaction (PCR). 100 ng DNA was mixed with 12.5 µl QuickLoad 2x Master Mix (New England

Biolabs, Frankfurt), 1 µM of each primer and 9.5 µl H2Onuk. General PCR conditions are listed below. Step 1: 94°C 2 min Step 2: 94° 30 sec Step 3: x°C 1 min Step 4: 72°C 2 min Step 5: Repeat Step 2-4 34 times Step 6: 72°C 5 min Step 7: 12°C forever

In this list, x represents the different primer temperatures. If PCR was not working, PCR master mix was supplemented with 1 M Betaine Solution (Sigma-Aldrich, Steinheim) or 2% DMSO.

34 3.2 Methods

3.2.8.2 Quantitative polymerase chain reaction (qPCR)

Quantitative PCR (qPCR) was used to quantify the levels of cDNA targets. RNA was reverse transcribed into cDNA (see 3.2.9.3). The QuantiTect SYBR® Green PCR Master Mix (QIAGEN, Hilden) was used according to the protocol for Bio-Rad Cycler in the QuantiTect® SYBR® Green PCR Handbook. Adjustments of the protocol were as follow: reaction volume was adjusted to 10 µl and the final concentration of cDNA was set to 100 ng. The PCR conditions were listed below. Step 1: 95°C 15 min Step 2: 95° 15 sec Step 3: 60°C 30 sec Step 4: 72°C 30 sec Step 5: Repeat Step 2-4 41 times Step 6: 72°C 5 min Step 7: Melt curve Step 8: 15°C forever

Gene expression analysis was done using the software Bio-rad CFX manager (Bio-rad, München) and statistical analysis was performed using GraphPad Prism 6 (GraphPad Software, USA).

3.2.8.3 Sanger sequencing

Sanger sequencing was used to analyse a samples’ DNA sequence (Sanger and Coulson, 1975; Sanger et al., 1977). 100 ng genomic DNA was amplified using standard PCR (see 3.2.8.1) and checked on a gel for the specificity of the primers. DNA was cleaned enzymatically using 5 Units Antarctic phosphatase (NEB, Frankfurt), 10 Units exonuclease I (Fermentas, St. Lean-

Roth) and 3.5 µl H2Onuk. Samples were incubated as indicated in Table 5.

Table 5: Incubation times and temperatures used for the enzymatic clean-up of amplified DNA. Prior to sequencing, PCR samples were enzymatically cleaned-up with Antarctic phosphatase and exonuclease I. Incubation conditions of the samples for clean-up are listed in the table. Temperature Duration 37°C 15 min 80°C 15 min 10°C 15 min 12°C forever

35 3 Materials and Methods

1 µl of the cleaned PCR product was mixed with 2 µl 5x reaction buffer for ampliTaq FS, 1 µl Big

Dye Terminator V3.1, 1 µM primer (forward or reverse), 5% DMSO and 4.5 µl H2Onuk.Reaction was performed using the following conditions: Step 1: 96°C 1 min Step 2: 96°C 30 sec Step 3: 59°C 4 min Step 4: Repeat Step 2-3 24 times Step 5: 4°C forever

Samples were sequenced using a 3130xl Genetic Analyzer (Applied Biosystems, USA). Data was analysed using Sequencing Analysis 5.4 (Applied Biosystems, USA) and SEQUENCEPilot 3.5.2 (JSI Medical Systems, Kippenheim) or Sequencher Version 4.9 (Gene Codes Corporation, USA).

3.2.8.4 Mutagenesis PCR

Some CHH patients have mutations within the promoter region of RMRP. To investigate which effect these mutations have on RMRP promoter activity, some of the known RMRP promoter mutations were cloned into the pSEAP2 basic vector (also see 3.2.1.4). As genomic DNA from some patients with the desired RMRP promoter mutation was not available, amplicons were generated using primer containing the desired mutation sequence. Primers were kindly designed by Tim Welting (see 3.1.15.6). For this approach, the Platinum™ Pfx DNA Polymerase (Thermo Fisher Scientific, USA) was used according to the manual. In short: the PCR reaction was set up with 5 µl 10x Pfx Amplification buffer, 1.5 µl 10 mM dNTP mixture, 1 µl 50 mM

MgSO4, 1.5 µM Primer (each), 100 ng template DNA, 5 µl 10x Enhancer Solution and 1 U

Platinum™ Pfx DNA Polymerase and filled up with H2Onuk to a final volume of 50 µl. Optimal PCR conditions were as follows: Step 1: 94°C 3 min Step 2: 94°C 15 sec Step 3: 60°C 30 sec Step 4: 68°C 1 min Step 5: Repeat Step 2-4 34 times Step 6: 4°C forever

Samples were check on an agarose gel and then cloned into pSEAP2 basic using restriction site-directed cloning (see 3.2.3.2).

36 3.2 Methods

3.2.9 RNA STANDARD METHODS

3.2.9.1 Extraction of total RNA from adherent cells

Cells were washed once with 1x DPBS and 1 ml TRIzol® (Thermo Fisher Scientific, USA) was added to the cells. After 15 min incubation at RT, cells were detached using a cell scraper and transferred into a nuclease-free tube. Cell/TRIzol® solution was mixed with 200 µl Chloroform and left for 15 min at RT followed by centrifugation for 15 min at 13 000 rpm and 4°C. Aqueous phase was transferred into a new tube and precipitated with 500 µl Isopropanol. RNA was pelleted for 10 min at 13 000 rpm and 4°C. Supernatant was decanted and pellet was washed with 1 ml

100% EtOH. RNA pellet was air-dried for 5-10 min and re-suspended in 20 µl H2Onuk.

3.2.9.2 RNA purification

Isolated RNA was incubated with 10 U DNase I (Roche, Mannheim) and 20 U RiboLock RNase inhibitor (Thermo Fisher Scientific, USA) for 1 h at 37°C. Afterwards, RNA was cleaned up using the Qiagen RNeasy Mini Kit (Qiagen, Hilden) according to the protocol.RNA concentration was determined using the TECAN Infinite® 200 PRO NanoQuant (TECAN, Switzerland).

3.2.9.3 cDNA synthesis

RNA was reverse transcribed into cDNA using the M-MLV Reverse transcriptase (ThermoFisher Scientific, USA). At least 0.5 µg RNA was denaturated for 5 min at 65°C and cooled down on ice for a few minutes. Then, RNA was mixed with 0.5 mM dNTP, 0.01 M DTT, 1x FS buffer, 40 U RiboLock RNase inhibitor (ThermoFisher Scientific, USA), 300 U M-MLV Reverse Transcriptase and 0.5 µg random hexamer primer and incubated as shown in Table 6.

Table 6: Incubation times and temperatures for cDNA synthesis. RNA was reverse transcribed into cDNA using optimal conditions for M-MLV Reverse transcriptase and random hexamer primer. Temperature duration 25°C 10 min 37°C 50 min 70°C 15 min .

3.2.9.4 Quality control of RNA

The quality of isolated RNA decides whether further analysis is possible or not. To check RNA quality, Agilents’ 2100 Bioanalyzer and the RNA 6000 Nano Kit (Agilent, USA) was used 37 3 Materials and Methods according to the manual. RNA with a RNA Integrity Number (RIN) smaller than 9 was excluded from analysis.

3.2.9.5 RNA interference (RNAi) experiments

Knockdown of Rmrp was performed in ATDC5 cells by Mandy Meekels-Steinbusch in Maastricht (the Netherlands). For these experiments, ATDC5 cells were plated at day -1 (6 400 cells/cm2) and differentiation was started on day 0. Cells were transfected with 30 nM siRNA on day 2 of differentiation and were transfected a second time with 10 nM siRNA on day 5 of differentiation. RNA was isolated on day 7 and was stored at -80°C until further use.

Knockdown of Wnt9a was performed with 50 µM stealth siRNA (ThermoFisher Scientific, USA) in ATDC5 and MCT cells according to the protocol in section 3.2.2.7.

3.2.9.6 Northern Blot

Northern blot experiments were performed by Don A Surtel (Laboratory for Experimental Orthopaedics, Maastricht University Medical Center+).

3.2.10 RNA-Seq

Human dermal fibroblasts of CHH patients and healthy controls were transdifferentiated into chondrocyte-like cells according the protocol described in 3.2.2.10. RNA was isolated on day 0, day 1 and day 3 using the ‘mirVana miRNA Isolation Kit, with phenol’ (Thermo Fisher Scientific, USA) according to the protocol. The isolated RNA was then shipped to VIB Nucleomics Core (Belgium) to perform RNA-seq analysis. Bioinformatic evaluation was also done by VIB Nucleomics Core (Belgium). Genes were defined as up-regulated when log 2-ratio > 1 and p < 0.05 whereas down-regulated genes had log 2-ratio < -1 and p < 0.05.

3.2.11 STATISTICAL ANALYSIS

In the figures, bars represent the average value of 4 technical replicates plus standard deviation. For statistical evaluation, an independent samples t-test or ANOVA was performed relative to the corresponding controls using GraphPad Prism 7 (La Jolla, CA, USA).

38 3.2 Methods

3.2.12 WORK WITH ZEBRAFISH

3.2.12.1 Design of morpholino oligomers

Morpholino oligomers (later named as morpholino(s)) were designed using the Gene Tools, LLC Design Request Website targeting a preselected area. For RNase_MRP (ENSDARG00000080987), morpholino oligomers were designed targeting a RNA molecule. For pop1 (ENSDARG00000102087), morpholino oligomers were designed to modify the splicing of pop1 mRNA. For each gene, a non-overlapping control was used as control morpholino as well as the standard control of Gene Tools, LLC.

3.2.12.2 Injection of zebrafish eggs and breeding

Fertilized zebrafish eggs were injected at the 1-cell stadium with different concentrations of morpholino oligomer. Injected eggs were kept in 1x E3 buffer at 28°C until the day of analysis. Uninjected eggs were used as controls. To avoid pigmentation of the zebrafishes, 1x E3 buffer was supplemented with 0.2 mM 1-phenyl 2-thiourea (PTU).

3.2.12.3 Analysis of the zebrafish

Zebrafish were analyzed at day 1; day 3 and day 5 after injection. To check for expression of cDNA targets and to confirm knockdown of the target gene, zebrafish tissue was homogenized in TRIzol® reagent (Thermo Fisher Scientific, USA) using a needle and RNA isolation was performed according to the previously described methods (see 3.2.9) followed by qPCR (see 3.2.8.2). Body lengths were determined at each time point, while acid-free Alcian Blue and Alizarin Red staining (see 3.2.12.4) was done only for 5-days old zebrafish.

3.2.12.4 Acid-free alcian blue and alizarin red staining

5 days old zebrafish were stained with acid-free Alcian Blue and Alizarin Red to check for differences in cartilage and bone development. Zebrafish stored in 100% MetOH were slowly rehydrated and washed two times with 0.1% PBS-T. After incubation in 50% EtOH (in 0.1% PBS-T) over night at 4°C, zebrafish were stained with 1 ml of freshly prepared staining solution for 2 h at RT with gentle agitation. Staining solution was removed and zebrafish were washed twice with 0.1& PBS-T. Then, 1 ml of trypsin solution for zebrafish was added and incubation was carried out at 37°C. Trypsinization status was checked every 10 min until most of the excess coloring was removed. Trypsin solution was discarded and zebrafish were washed two times with 0.1% PBS-T. An appropriate volume of 20% glycerol + 0.25% KOH was added and zebrafish

39 3 Materials and Methods were incubated overnight at RT with gentle agitation. The next morning, glycerol solution was replaced by 50% glycerol + 0.25% KOH and zebrafish were again incubated overnight at RT with gentle agitation. Zebrafish were kept in 50% glycerol + 0.25% KOH until further analysis.

3.2.12.5 Generation of rescue plasmids

Rescue of the phenotype via over expression of gene of interest (GOI) mRNA was performed to confirm the specificity of the phenotype. Full length cDNA of the GOI was amplified using standard PCR methods (see 3.2.8.1), cloned into the pCRII TOPO vector (see 3.2.3.1) and capped mRNA was generated using in vitro transcription technique (see 3.2.12.7).

3.2.12.6 Generation of TALEN plasmids

Golden Gate TALEN and TAL Effector Kit 2.0 was used to generate RNase_MRP specific TALEN (transcription activator-like effector nuclease) constructs according to the recommended protocol. The RVDs (repeat variable diresidues) used for these constructs are indicated in Table 7.

Table 7: Sequences targeted by RNase_MRP TALEN constructs. RMRP-specific TALEN plasmids were generated and injected into zebrafish. The sequences of these plasmids are listed below.

Name RVD sequence DNA Sequence

RNase_MRP NN HD HD NG NN NI NININI HD NG NG 5'-GCC TGA AAA CTT GCA T-3' TAL 1 NN HD NI NG RNase_MRP NN NN HD NN NI NINI HD NN NI NN NN 5'-GGG AAC CTC GTT TCG CC-3' TAL 2 NG NG HD HDHD

3.2.12.7 In vitro transcription

Plasmid DNA had to be transcribed into RNA before injection into zebrafish eggs. First, plasmids were linearized with a restriction enzyme downstream of the insert to be transcribed. 10 µg of plasmid DNA was digested with either EcoRV (for Sp6) or SpeI (for T7) in a final volume of 50 µl. To terminate the reaction, 1/20th volume 0.5 M EDTA, 1/10th volume of 3 M sodium acetate and 2 volumes of 100% ethanol was added and chilled at -20°C overnight. DNA was centrifuged for 15 min at 4°C and 13 000 rpm to pellet the DNA. Supernatant was completely removed and pellet was re-suspended in 15 µl H2Onuk. Capped transcription was setup according to the manual of the mMessagemMachine T7/Sp6 Kit (Thermo Fisher Scientific, USA). 0.5 µg of linearized plasmid DNA was used and incubation was performed for 2 hours at 37°C. 1 µl of

40 3.2 Methods

TURBO DNase was added and reaction was incubated for 15 min at 37°C. RNA was recovered via lithium chloride (LiCl) precipitation. 1 µl 0.5 M EDTA (pH 8.0), 2.5 µl 4 M LiCl and 75 µl ice-cold 100% EtOH was added and chilled overnight at -20°C. RNA was pelleted for 30 min in a microcentrifuge at 13 000 rpm and 4°C. Supernatant was removed and pellet was dissolved in

30 µl H2Onuk. RNA concentration was determined and was set to 1 µg/µl.

41 4 Results

4 RESULTS

4 . 1 N e w l y mutations in RMRP cause C a r t i l a g e - hair hypoplasia v a r i a n t

Cartilage-hair hypoplasia (CHH) is a rare skeletal disorder and patients show a variety of symptoms, including short-limbed dwarfism, metaphyseal chondrodysplasia of tubular bones, abnormal joint hypermobility and also other symptoms (Polmar and Pierce, 1986; Eisner and Russell, 2006; Hermanns et al., 2006). On the basis of these symptoms, physical examination and radiographs can provide a first indication of a possible CHH. We were introduced to a 5-year old girl at the time with disproportional dwarfism and a slight delay in motor development. Survey of the clinical history showed that the patient is the child of consanguineous parents (cousins with generation shift) from morocco and has already been tested in another genetic department on Noonan syndrome 1 and 4 (OMIM # 163950 resp. # 610733) and Achondrodysplasia (OMIM # 100800). No disease-causing mutations could be detected and the patient was referred to our lab for further diagnostics. Physical examination confirmed the disproportional dwarfism (Figure 10 A) and radiographs of the hand and the knees showed metaphyseal changes comparable to those found in CHH (Figure 10 B and C).

A B

C

Figure 10: Clinical appearance of patient with newly found mutations. 5-year old girl with disproportional dwarfism (A) and metaphyseal changes in hands (B) and knees (C).

42 4.1 Newly mutations in RMRP cause Cartilage-hair hypoplasia variant

We screened the blood of our patient and both parents for mutations within the RMRP gene. In the patient, we found two homozygous mutations in RMRP (n.128C>G and n.145C>A), which are not known as disease-inducing until now (Figure 11 A, first panel).

Figure 11: Homozygous state of mutations within the RMRP gene. Sanger sequencing of patient (first panel) revealed two new mutations in RMRP in a homozygous state. Parents (second and third panel) have the mutations heterozygous. All sequences were compared to a control sequence (fourth panel). Sequences shown are representative examples of two independent Sanger sequencing analyses of two biological replicates (A). Both parents are carrier of both mutations. Patient has inherited both mutations from parents. (B) Sanger sequencing of the parents’ blood samples showed that both parents have the same mutations in a heterozygous state (Figure 11 A, second and third panel). The inheritance pattern is autosomal recessive which corresponds to the known inheritance pattern of CHH (Figure 11 B). To test whether the newly identified mutations cause a decrease in RMRP RNA level similar to known CHH-causing mutations, we used human dermal fibroblasts of our patient, healthy controls (N = 2) as well as a CHH patient carrying a homozygous n.70A>G mutation, the most common mutation of CHH, and determined RMRP RNA expression . Here, our qPCR results showed that RMRPn.128C>G (homo); n.145C>A (homo) mutations (Figure 12 A; left open bar) resulted in a significant decrease in relative RMRP RNA expression as compared to healthy controls (Figure 12 A; black bar). The reduced level of RMRP RNA was comparable to the RMRP RNA level measured in the RMRPn.70A>G (homo) CHH patient (Figure 12 A; middle open bar). The decreased RMRP RNA level in both patients, carrying either RMRPn.128C>G (homo); n.145C>A (homo) or RMRPn.70A>G (homo) mutations, were confirmed using northern blot technique (Figure 12 B). Northern blot experiments were performed by Don A Surtel (Laboratory for Experimental Orthopaedics, Maastricht University Medical Center+).

43 4 Results

A 1 .5

B

n

o i

s

s 1 2 3 4

e r

p 1 .0

x

e

P

R RMRP

M R

e 0 .5 v

i * * * *

t a

l * * * *

e r

0 .0 n.1 2 8 C > G ( ho m o ) n.7 0 A > G ( ho m o ) R M R P R M R P C tr ls U6 n.1 4 5 C > A ( ho m o ) R M R P (N = 2 )

Figure 12: Reduced RMRP RNA expression in patient with novel mutation in the RMRP gene. QPCR analysis of human dermal skin fibroblasts showed that RMRP RNA level is decreased in patient with RMRPn.128C>G (homo); n.145C>A (homo) mutation as compared to healthy controls (N = 2) and RMRPn.70A>G (homo) (A). Northern blot analysis was used to confirm decreased RMRP RNA level in patients with RMRP mutations as compared to healthy controls. Lane 1: RMRPn.128C>G (homo); n.145C>A (homo) mutation, Lane 2: RMRPn.70A>G (homo), Lane 3: healthy control 1, Lane 4: healthy control 2 (B). Gene expression data was normalized to RPL13 and HPRT1 mRNA levels and data is presented as relative expression relative to healthy controls (N=2). Values represent the average value of 4 technical replicates plus standard deviation. The p-value is indicated as follow: **** p ≤ 0.0001 (A).U6 was used as loading control in Northern blot experiments (B) Presented graphs are representative examples of at least three (qPCR)/two (Northern blot) independent experiments. Mutations in RMRP can have influence on binding affinity and thus on RNase MRP complex formation and activity. The novel found n.145C>A mutation is located at the RMRP binding site of POP1. Therefore, we investigated whether the patient with RMRPn.128C>G (homo); n.145C>A (homo) mutations show decreased expression of RNase MRP components and alterations in RNA processing. We could not detect any significant changes in expression of components of the RNase MRP complex in our preliminary data (data not shown) but increased level of pre-5.8S rRNA were measured in the patient carrying RMRPn.128C>G (homo); n.145C>A (homo) mutations (Figure 13 A, left open bar) as well as in the patient carrying the RMRPn.70A>G (homo) mutation (Figure 13 A, right open bar) as compared to healthy controls (N = 2) (Figure 13 A, black bar).

A 5 .0 B

1 .5

4 .0

A

n

N

o

i

R

s

r

e

n

s

r

S

e

o u

i 3 .0

8 r

t 1 .0

.

s

a

p

5

s

-

x

m

e

e

e

r

r

e

p

p

A

v

x

2 .0 i

N

e

t

e

v

a

R

i

l

r

t

e 0 .5

a

r

S

l

8

e .

r 1 .0 5

0 .0 0 .0 n.1 2 8 C > G ( ho m o ) n.7 0 A > G ( ho m o ) n.1 2 8 C > G ( ho m o ) n.7 0 A > G ( ho m o ) R M R P R M R P C tr ls R M R P R M R P C tr ls n.1 4 5 C > A ( ho m o ) n.1 4 5 C > A ( ho m o ) R M R P (N = 2 ) R M R P (N = 2 )

Figure 13: Accumulation of pre-5.8S rRNA in patient with RMRPn.128C>G (homo); n.145C>A (homo) mutation. Expression of pre-5.8S rRNA were increased in patients with mutation sin the RMRP gene as compared to healthy controls (N =2) (A) while expression of mature 5.8S rRNA showed no significant changes in CHH patients as compared to healthy controls (N=2) (B). Preliminary gene expression data was normalized to 44 4.2 CHH mouse model

RPL13 and HPRT1 mRNA levels and data is presented as relative expression relative to healthy controls (N = 2). Values represent the average value of 4 technical replicates. Presented graphs show data of one experiment. (A, B) While expression of pre-5.8S rRNA were increased in both patients with mutations in the RMRP gene as compared to healthy controls (N = 2), we could not detect a significant decrease in the expression of mature 5.8S rRNA (Figure 13 B). The increased amount of pre-5.8S rRNA indicates a possible alteration in RNA processing because of impaired RNase MRP activity. QPCR analysis of the RNase MRP components and the RNA processing was performed by Don A Surtel (Laboratory for Experimental Orthopaedics, Maastricht University Medical Center+). Altogether, our results lead to the suggestion that the newly found mutations in the RMRP gene are not only single nucleotide polymorphisms, but they are more likely to be pathogenic.

4 . 2 CHH mouse model

4.2.1 GENERAL CONSIDERATIONS

In vivo models are a good approach to investigate disease-causing mechanisms. The sequence of RMRP is highly conserved between humans and mouse (Figure 14), making a mouse model a reasonable model to investigate the functions of RMRP.

RMRP GTTCGTGCTGAAGGCCTGTATCCTAGGCTACACACTGAGGACTCTGTTCCTCCCCTTTCC Rmrp GCTCGCTCTGAAGGCCTGTTTCCTAGGCTACATACGAGGG-ACATGTTCCTTATCCTTTC * *** ************ ************ ** ** ******* * ** *

RMRP GCCTAGGGGAAAGTCCCCGGACCTCGGGCAGAGAGTGCCACGTGCATACGCACGTAGACA Rmrp GCCTAGGGGAAAGTCCCCGGACCACGGGCAGAGAGTGCCGCGTGCACACGCGCGTAGACT *********************** *************** ****** **** *******

RMRP TTCCCCGCTTCCCACTCCAAAGTCCGCCAAGAAGCGTATCCCG------CTGAGCGG Rmrp TCCCCCGCAAGTCACTGTTAGCCCGCCAAGA-AGCGACCCCTCCGGGGCGAGCTGAGCGG * ****** **** * * * * **** ** ********

RMRP CGTGGCGCGGGGGCGTCATCCGTCAGCTCCCTCTAGTTACGCAGGCAGTG--CGTGTCCG Rmrp CGTGCA-GCGGGGCGTCATCCGTCAGCTCAC-ATAGTGACGCAGGCAGTGCGACCTGGCT **** ******************** * **** ************ *

RMRP CGCACCAACCACACGGGGCTCATTCTCAGCGCGGC Rmrp CGCACCAACCACACGGGGCTCATTCTCAGCGCGGC ***********************************

Figure 14: The RMRP sequence is highly conserved between human and mouse. Stars indicate a conserved base along human (264 bases; ENSG00000277027; indicated as RMRP) and mouse (271 bases; ENSMUSG00000088088; indicated as Rmrp) RMRP sequence. The skeletal phenotype of CHH patients indicates changes in chondrogenesis and therefore, we hypothesized that Rmrp RNA expression plays a major role during stages of hypertrophic

45 4 Results differentiation. We isolated total RNA of WT mice at different embryonic stages and confirmed hypertrophic differentiation of our samples (Figure 15 A – C).

A C o l1 0 a 1 B R u n x 2

5 .0 3 0 .0 *

2 5 .0 * *

4 .0 n

n *

o

o

i

i s

s 2 0 .0

s

s

e

e r

3 .0 r

p

p x

x 1 5 .0

e

e

e

e v

2 .0 v

i

i

t

t a

a 1 0 .0

l

l

e

e

r r 1 .0 5 .0

0 .0 0 .0 E 1 2 .5 E 1 3 .5 E 1 4 .5 E 1 6 .5 E 1 2 .5 E 1 3 .5 E 1 4 .5 E 1 6 .5 D e v e lo p m e n ta l s ta g e D e v e lo p m e n ta l s ta g e

C C o l2 a 1 D R m r p

2 .0 2 .0

n

n o

o 1 .5 1 .5

i

i

s

s

s

s

e

e

r

r

p

p

x x

1 .0 e 1 .0

e

e

e

v

v

i

i

t

t

a

a

l

l

e

e r r 0 .5 0 .5

0 .0 0 .0 E 1 2 .5 E 1 3 .5 E 1 4 .5 E 1 6 .5 E 1 2 .5 E 1 3 .5 E 1 4 .5 E 1 6 .5 D e v e lo p m e n ta l s ta g e D e v e lo p m e n ta l s ta g e Figure 15: Increase in Rmrp RNA expression is linked to the start of hypertrophic differentiation. The expression of Col10a1 (A), Runx2 (B) and Col2a1 (C) indicate hypertrophic differentiation. Rmrp RNA expression is increased in later embryonic stages (D). Gene expression data was normalized to β-actin and Gapdh mRNA levels and data is presented as relative expression relative to E12.5. Values represent the average value of 3 biological replicates/group and 4 technical replicates plus standard deviation. The p- values are indicated as follow: * p ≤ 0.05, ** p ≤ 0.01 (A – D). Presented graphs are representative examples of three independent experiments. Contrary to our hypothesis, no significant up-regulation of Rmrp RNA expression was detected between E12.5 and E16.5 (Figure 15 D). To further investigate the role of Rmrp RNA during development, we tried to generate a conditional knockout model so we can block Rmrp RNA expression at different developmental stages. First, we checked the up-to-date genomic localisation of Rmrp. It turned out that Rmrp partially overlaps with the 5’ UTR of Ccdc107 transcript variant 4 (Figure 16).

46 4.2 CHH mouse model

Figure 16: Rmrp is located on chromosome 4. The Rmrp gene partially overlaps with the first exon of Ccdc107 transcript variant 4. Knockout of the complete Rmrp gene would not be possible without deleting at least the first exon of Ccdc107. To circumvent these difficulties, we decided to use CRISPR/Cas9 technology, which enables us to manipulate a small region of the Rmrp gene. We aligned the first exon of Ccdc107 transcript variant 4 and the whole Rmrp gene (including the Rmrp promoter) and determined a small region of the proximal Rmrp promoter that could be deleted without disturbing the Ccdc107 gene (Figure 17, highlighted in yellow). This region covers the nucleotides from -290 until -18 of the Rmrp promoter.

47 4 Results

Ccdc107 agagaaaccctgtcaaaaaaccaaaatacaaacaaacaaaaataaataaataaaagtgta Rmrp agagaaaccctgtcaaaaaaccaaaatacaaacaaacaaaaataaataaataaaagtgta ************************************************************

Ccdc107 gccgcgctgagaatgagccccgtgtggttggtgcgagccaggtcgcactgcctgcgtcac Rmrp GCCGCGCTGAGAATGAGCCCCGTGTGGTTGGTGCGAGCCAGGTCGCACTGCCTGCGTCAC ************************************************************

Ccdc107 tatgtgagctgacggatgacgccccgctgcacgccgctcagctcgccccggaGGGGTCGC Rmrp TATGTGAGCTGACGGATGACGCCCCGCTGCACGCCGCTCAGCTCGCCCCGGAGGGGTCGC ************************************************************

Ccdc107 TTCTTGGCGGGCTAACAGTGACTTGCGGGGGAAGTCTACGCGCGTGTGCACGCGGCACTC Rmrp TTCTTGGCGGGCTAACAGTGACTTGCGGGGGAAGTCTACGCGCGTGTGCACGCGGCACTC ************************************************************

Ccdc107 TCTGCCCGTGGTCCGGGGACTTTCCCCTAGGCGAAAGGATAAGGAACATGTCCCTCgtat Rmrp TCTGCCCGTGGTCCGGGGACTTTCCCCTAGGCGAAAGGATAAGGAACATGTCCCTCGTAT ************************************************************

Ccdc107 gtagcctaggaaacaggccttcagagcgagctgccttagcttctaggcgcgactaattta Rmrp GTAGCCTAGGAAACAGGCCTTCAGAGCGAGCtgccttagcttctaggcgcgactaattta ************************************************************

Ccdc107 tgactctacaacaggcttaattttttggttatggtgagaaaattggtctctctaggtaga Rmrp tgactctacaacaggcttaattttttggttatggtgagaaaattggtctctctaggtaga ************************************************************

Ccdc107 aaaacaatgagccattgttttaggcatgatactttatcctgaaagattctggagacataa Rmrp aaaacaatgagccattgttttaggcatgatactttatcctgaaagattctggagacataa ************************************************************

Ccdc107 ttgtttaagaaagctataaatagataggtcattaattaatgtaggaacgctaggtgggcg Rmrp ttgtttaagaaagctataaatagataggtcattaattaatgtaggaacgctaggtgggcg ************************************************************

Ccdc107 tggtttatgcaaatattgcttaaacccatcctgagatgggcgtggccgccttaagggact Rmrp tggtttatgcaaatattgcttaaacccatcctgagatgggcgtggccgccttaagggact ************************************************************

Ccdc107 cagcccccccgatgtaggcgtggtctcctgcgcgtgcgcactacggccggaggcccagcg Rmrp cagcccccccgatgtaggcgtggtctcctgcgcgtgcgcactacggccggaggcccagcg ************************************************************

Ccdc107 ctggaacgcggggtacccggcgtgcgattctggtgggccaggcatggagggcgctggccc Rmrp ctggaacgcggggtacccggcgtgcgattctggtgggccaggcatggagggcgctggccc ************************************************************

Figure 17: Only a small region of Rmrp can be deleted without disturbing the Ccdc107 gene. Ccdc107 exon is indicated in capital letters, Ccdc107 intron is indicated in lowercase letters; Rmrp Exon is indicated in capital letters italic, Rmrp 5’flanking region is indicated in lowercase letters italic, Rmrp promoter region deleted in mice is highlighted in yellow, stars indicate similar bases. For better clarity, Rmrp is shown in reverse complement. Before generating a mouse model carrying an RmrpΔ-290_-18 mutation, we wanted to ensure that this deletion had functional consequences for the transcriptional activity of the Rmrp gene. We constructed a luciferase reporter construct of the -1000_-1 Rmrp promoter. The cloned promoter sequence was either wildtype (named WT Rmrp promoter) or lacking the nucleotides - 290 until -18 (named RmrpΔ-290_-18 promoter). Promoter activity of these two constructs was then tested in different cell lines. The activity of the Rmrp∆-290_-18 promoter was significantly reduced in transfected HeLa cells compared to WT Rmrp promoter, indicating less transcriptional activity of the RmrpΔ-290_-18 promoter (Figure 18).

48 4.2 CHH mouse model

1 .5

y

t

i

v

i

t

c a

1 .0

r

e

t

o

m

o r

p * * * *

e

v 0 .5

i

t

a

l

e r

0 .0 -2 9 0 _ -1 8 W T R m rp R m rp  p ro m o te r p ro m o te r

Figure 18: Decreased Rmrp promoter activity when Rmrp promoter lacks nucleotides from -290 until -18 of the promoter sequence. HeLa cells were transfected with either WT Rmrp promoter construct or RmrpΔ-290_-18 promoter construct. Promoter activity is highly reduced when Rmrp promoter is mutated as compared to WT Rmrp promoter. Bioluminescence was normalized to Renilla luciferase signals. Normalized relative promoter activity of WT RMRP promoter was set at 1 and condition relative promoter activity was calculated relative to the control promoter activity. Data represents the average value of 4 technical replicates plus standard deviation. The p- value is as follow: **** p ≤ 0.001. Graph is representative example of 3 individual experiments. Furthermore, we tested Rmrp promoter activity in a chondrogenic condition using MCT cells as well as ATDC5 cells. Activity of the RmrpΔ-290_-18 promoter was also significantly decreased as compared to WT Rmrp promoter in both proliferating MCT and proliferating ATDC5 cells (Figure 19 A, B).

A B

1 .5 1 .5

y

y

t

t

i

i

v

v

i

i

t

t

c

c a

1 .0 a

1 .0

r

r

e

e

t

t

o

o

m

m

o

o

r

r

p

p

e

e v

0 .5 v 0 .5

i

i

t

t

a

a l

* * * * l * * * *

e

e

r r

0 .0 0 .0  -2 9 0 _ -1 8 -2 9 0 _ -1 8 W T R m rp R m rp W T R m rp R m rp  p ro m o te r p ro m o te r p ro m o te r p ro m o te r

49 4 Results

C D

1 .5

1 .5

y

y

t

t

i

i

v

v

i

i

t

t

c

c

a

a

1 .0

r 1 .0

r

e

e

t

t o

o *

m

m

o o

r *

r

p

p

e e

v 0 .5 0 .5

i

v

t

i

t

a

l

a

e

l

r

e r

0 .0 0 .0 -2 9 0 _ -1 8 -2 9 0 _ -1 8  W T R m rp R m rp  W T R m rp R m rp p ro m o te r p ro m o te r p ro m o te r p ro m o te r

Figure 19: Mutated Rmrp promoter shows lower promoter activity. Rmrp promoter activity is significantly decreased in proliferating MCT cells (A), in differentiating MCT cells (B), proliferating ATDC5 cells (C) and differentiating ATDC5 cells (D). Bioluminescence was normalized to Renilla luciferase signals. Normalized relative promoter activity of WT RMRP promoter was set at 1 and condition relative promoter activity was calculated relative to the control promoter activity. Data represents the average value of 4 technical replicates plus standard deviation. The p-values are as follow: * p ≤ 0.05, **** p ≤ 0.001. Graphs are representative examples of 3 individual experiments. During differentiation towards a chondrogenic phenotype of MCT and ATDC5 cells, the significantly lowered promoter activity of the Rmrp∆-290_-18 promoter was confirmed (Figure 19 C, D). These results indicate that deletion of the nucleotides -290 until -18 of the Rmrp promoter has functional consequences for the transcriptional activity of the Rmrp gene and therefore could be a possible way to generate a knockdown model of Rmrp.

4.2.2 ANALYSIS OF THE MOUSE MODEL

The RmrpΔ-290_-18 mouse model using the CRISPR/Cas9 technology was kindly generated by Malte Spielmann and colleagues according to the previously published method (Kraft et al. 2015; Lupiáñez et al. 2015). The analysis of the generated RmrpΔ-290_-18 mouse model was not possible since the mouse model was not ready until the end of this thesis.

4.2.3 ALTERNATIVE APPROACH

As both RMRP RNA and POP1 are part of the RNase MRP complex and mutations of these genes cause similar phenotypes, we decided to also generate a Pop1 knockout mouse model to investigate the role of the RNase MRP complex during skeletal development.

50 4.2 CHH mouse model

We checked for Pop1 mRNA and protein expression at several embryonic stages and showed that Pop1 mRNA expression was not increased between E12.5 and E16.5 as compared to E12.5 (Figure 20).

P o p 1

1 .5

n

o i

s 1 .0

s

e

r

p

x

e

e

v

i t

a 0 .5

l

e r

0 .0 E 1 2 .5 E 1 3 .5 E 1 4 .5 E 1 6 .5 D e v e lo p m e n ta l s ta g e

Figure 20: No significant changes in Pop1 mRNA expression during development. The expression of Pop1 mRNA in the extremities of WT mice are not increased during development as compared to E12.5. Gene expression data was normalized to β-actin and Gapdh mRNA levels and data is presented as relative expression relative to E12.5. Values represent the average value of multiple biological samples (N = 3-4/group) and 4 technical replicates plus standard deviation. Presented graphs are representative examples of three independent experiments. We hypothesized that Pop1 expression is regulated on a translational basis instead of transcriptional basis during embryonic development. To address this hypothesis, we investigated the protein expression of POP1 in developing bones. We used bone sections of WT mice at different embryonic stages and performed immunohistochemistry for POP1. A spatiotemporal increase in POP1 expression was detected in bone sections with highest expression in the hypertrophic zone of the growth plate at E16.5 (Figure 21, black arrows).

51

Control antibody POP1 antibody Control antibody POP1 antibody

Figure 21: POP1 is detected in the hypertrophic zone of the growth plate.

52

Expression of POP1 starts at later stages of embryonic development and is detected in the hypertrophic zone of the growth plate (black arrows). Five micrometer-thick formalin-fixed paraffin-embedded tissue sections of WT NMRI mice at different developmental stages and slides were stained with either POP1 or control antibody and counterstained with hematoxylin. Black arrows indicate the POP1 expression in the hypertrophic zones of growth plates.

53 4 Results

This result indicates that Pop1 expression is translational regulated during skeletal development. Furthermore, up-regulation of POP1 levels in the hypertrophic zone of the growth plate may indicate that Pop1 is needed for skeletal development. We ordered embryonic stem (ES) cells from the International Mouse Phenotyping Consortium (IMPC) Project 76583 and commissioned a company in Zurich to generate chimeric mice. Figure 22 shows the transgene which was used by IMPC for the ES cells.

Figure 22: A modified Pop1 gene is used for the generation of chimeric mice. Source: https://www.i-dcc.org/imits/targ_rep/alleles/6706/allele-image?simple=true.jpg Several attempts have failed and no chimeric embryo could be generated until the end of this thesis.

4 . 3 CHH zebrafish model

4.3.1 GENERAL CONSIDERATION

Zebrafish is a well-known model to investigate human diseases: manipulations of the genome are easy to introduce and the developmental cycle of zebrafish is short. Due to the evolutionary conservation of RMRP in humans and zebrafish (RMRP zebrafish homologue is called RNase_MRP) (Figure 23), we decided to generate an RNase_MRP knockout zebrafish model.

RMRP -GTTCGTGCTGAAGGCCTGTATCCTAGGCTACACACTGAGGACTCTGTTCCTCCCCTTTC RNase_MRP GCGCATGCCTGAAAACTTGCATCCTAAGCTACGCACGGGGAACGTCGTT-TCGCCATCAC ***** * ** ****** ***** *** * * ** *** ** * *

RMRP CGCCTAGGGGAAAGTCCCCGGACCTCGGGCAGAGAGTGCCACGTGCATACGCACGTAGAC RNase_MRP TGCTTAGGGGAAAGTCCCCGGACACTGGGCAGAGATGTCCTGCATACAGCGCAGATCAGT ** ******************* ********* ** **** *

RMRP ATTCCCCGCTTCCCACTCCAAAGTCCGCCAAGAAGCGTATCCCGCTGAGCGGCGTGGCGC RNase_MRP G------GCTTGCATTGCGTATTCATGCTAAGACGTCCACGTGACTGAGCAGAGCGCTTA **** * * * ** **** * * ****** * * *

RMRP GGGGGCGTCATCCGTCAGCTCCCTCTAGTTACGCAGGCAGTGCGTGTCCGCGCACCAACC RNase_MRP GCA--AGCCATGTTTGTCAATAAGATAGTTACGCAAGTGTCGTACACTCGTACTTCTACA * * *** * ********** * * ** * * **

RMRP ACACGGGGCTCATTCTCAGCGCGGC RNase_MRP GAACGGGGCTCATTCTCAGCATACG ******************

Figure 23: RMRP is conserved in humans and zebrafish.

54 4.3 CHH zebrafish model

Stars indicate a conserved base along human RMRP (264 bases; ENSG00000277027; indicated as RMRP) and zebrafish RNase_MRP (256 bases; ENSDARG00000080987; indicated as RNase_MRP) First, we figured out if RNase_MRP expression can be detected in zebrafish and how the expression changes during the first days of zebrafish development. We isolated total RNA at different time points and detected low amounts of RNase_MRP RNA. The relative expression of RNase_MRP RNA was higher at 1 day post fertilization (dpf) as compared to later developmental time points (Figure 24).

R N a s e _ M R P 0 .8

n 0 .6

o

i

s

s

e

r p

x * *

0 .4

e

e

v * * *

i t

a * * * *

l e r 0 .2

0 .0 1 2 3 5 d a y s p o s t fe r tiliz a tio n

Figure 24: RNase_MRP RNA can be detected during the first 5 days post fertilization. The relative expression of RNase_MRP at 1 dpf was higher as compared to later developmental stages. Gene expression data was obtained via qPCR and was normalized to tbp and ef1a mRNA levels. Data is presented as relative expression and values represent the average value of multiple biological samples (N = 5- 10)/group and 4 technical replicates plus standard deviation. The p-values are indicated as follow: ** p ≤ 0.01; *** p ≤ 0.001, **** p ≤ 0.0001. Presented graphs are representative examples of three independent experiments. The low levels of RNase_MRP RNA allow the assumption that RNase_MRP RNA is either not relevant during early stages of development or RNase_MRP RNA is essential during the first couple of hours post fertilization and expression decreases at later developmental stages. We used transcription activator-like effector nucleases (TALENs) to generate RNase_MRP specific TALEN constructs, which should cut the RNase_MRP sequence within nucleotide 22 and 37 of the exon (Figure 25; orange line) and abolish RNase_MRP RNA expression.

55 4 Results

RMRP -GTTCGTGCTGAAGGCCTGTATCCTAGGCTACACACTGAGGACTCTGTTCCTCCCCTTTC RNase_MRP GCGCATGCCTGAAAACTTGCATCCTAAGCTACGCACGGGGAACGTCGTT-TCGCCATCAC ***** * ** ****** ***** *** * * ** *** ** * *

RMRP CGCCTAGGGGAAAGTCCCCGGACCTCGGGCAGAGAGTGCCACGTGCATACGCACGTAGAC RNase_MRP TGCTTAGGGGAAAGTCCCCGGACACTGGGCAGAGATGTCCTGCATACAGCGCAGATCAGT ** ******************* ********* ** **** *

RMRP ATTCCCCGCTTCCCACTCCAAAGTCCGCCAAGAAGCGTATCCCGCTGAGCGGCGTGGCGC RNase_MRP G------GCTTGCATTGCGTATTCATGCTAAGACGTCCACGTGACTGAGCAGAGCGCTTA **** * * * ** **** * * ****** * * *

RMRP GGGGGCGTCATCCGTCAGCTCCCTCTAGTTACGCAGGCAGTGCGTGTCCGCGCACCAACC RNase_MRP GCA--AGCCATGTTTGTCAATAAGATAGTTACGCAAGTGTCGTACACTCGTACTTCTACA * * *** * ********** * * ** * * **

RMRP ACACGGGGCTCATTCTCAGCGCGGC RNase_MRP GAACGGGGCTCATTCTCAGCATACG ******************

Figure 25: A designed RNase_MRP TALEN construct cut the RNA between nucleotide 22 and 37 of the exon. Orange line indicates the region where the TALEN was meant to initiate the break of the strand. 100% of the RNase_MRP TALEN injected fishes died within 24 hours post injection. We also injected control TALEN constructs to exclude technical problems and could figure out that only our RNase_MRP TALEN construct result in lethality. This effect could be an effect of decreased RNase_MRP expression due to efficient TALEN knockdown or due to high toxicity of our TALEN constructs. We tried to generate a second RNase_MRP TALEN construct to distinguish between these two possibilities but failed in the first steps of the Golden Gate reaction. Another way to achieve gene knockdown in zebrafish is using morpholino oligomers (Partridge et al., 1996; Stein et al., 1997; Summerton et al., 1997; Summerton and Weller, 1997; Nasevicius and Ekker, 2000). We designed two morpholino oligomers targeting different but adjacent regions of the RNase_MRP sequence. In humans, RMRP RNA was shown to bind to POP1 via the P3 binding domain (Figure 26, highlighted in green). We decided to target this P3 domain with the first morpholino oligomer (later named as RMRP P3) (Figure 26, red line). A second morpholino oligomer (later named as RMRP S1), targeting the sequence of RMRP-S1, which is known to function as miRNA in humans (Rogler et al. 2014), was used as non-overlapping control (Figure 26, purple line).

56 4.3 CHH zebrafish model

RMRP -GTTCGTGCTGAAGGCCTGTATCCTAGGCTACACACTGAGGACTCTGTTCCTCCCCTTTC RNase_MRP GCGCATGCCTGAAAACTTGCATCCTAAGCTACGCACGGGGAACGTCGTT-TCGCCATCAC ***** * ** ****** ***** *** * * ** *** ** * *

RMRP CGCCTAGGGGAAAGTCCCCGGACCTCGGGCAGAGAGTGCCACGTGCATACGCACGTAGAC RNase_MRP TGCTTAGGGGAAAGTCCCCGGACACTGGGCAGAGATGTCCTGCATACAGCGCAGATCAGT ** ******************* ********* ** **** *

RMRP ATTCCCCGCTTCCCACTCCAAAGTCCGCCAAGAAGCGTATCCCGCTGAGCGGCGTGGCGC RNase_MRP G------GCTTGCATTGCGTATTCATGCTAAGACGTCCACGTGACTGAGCAGAGCGCTTA **** * * * ** **** * * ****** * * *

RMRP GGGGGCGTCATCCGTCAGCTCCCTCTAGTTACGCAGGCAGTGCGTGTCCGCGCACCAACC RNase_MRP GCA--AGCCATGTTTGTCAATAAGATAGTTACGCAAGTGTCGTACACTCGTACTTCTACA * * *** * ********** * * ** * * **

RMRP ACACGGGGCTCATTCTCAGCGCGGC RNase_MRP GAACGGGGCTCATTCTCAGCATACG ******************

Figure 26: RNase_MRP morpholino targets the possible Pop1 binding domain P3. The sequence of the known human miRNA RMRP-S1 is highlighted in pink; the sequence of the known human miRNA RMRP-S2 is highlighted in blue and the known region of the human RMRP P3 domain is highlighted in green. Red line indicates the morpholino target site (RMRP P3); purple line indicates the non- overlapping control morpholino targeting the region of the known human RMRP-S1 miRNA (RMRP S1). A standard control morpholino (later named as Std Ctrl, supplied by Gene Tools LLC.) was used as a negative control.

4.3.2 ANALYSIS OF THE ZEBRAFISH MODEL

We injected either 0.5 ng or 1 ng of morpholino into fertilised eggs of zebrafish at the 1-cell stadium. Injections with higher concentrations of morpholino oligomers resulted in the death of all injected zebrafish within one day post injection (data not shown). Both uninjected eggs and eggs injected with Std Ctrl morpholino were used as controls. Total RNA was isolated at 1 dpf or 5 dpf and expression of RNase_MRP RNA relative to uninjected eggs were determined (Figure 27).

57 4 Results

R N a s e _ M R P

1 .5

* * * *

n

o

i s

s 1 .0

e

r p

x * * * * * * * *

e

e

v i

t 0 .5

a

l e r * * * * * * * * n .a . 0 .0 l l d r r 3 3 1 1 e t t P P S S t C C c P P P P je td td R R R R n i S S M M M M n g g R R R R u n n g g g g .5 1 n n n n 0 .5 1 .5 1 0 0

Figure 27: Knockdown of RNase_MRP is successfully achieved using morpholino oligomers. The RNase_MRP expression at different conditions was determined 24hpf and was compared to uninjected. Injection of 0.5 ng morpholino oligomer decreases the RNase_MRP expression significantly. 1 ng of RMRP S1 seems to be lethal. Gene expression data was normalized to tbp and ef1a mRNA levels and data is presented as relative expression relative to uninjected controls (N=5). Values represent the average value of multiple biological samples (N = 5-10) /group and 4 technical replicates plus standard deviation. The p- values are indicated as follow: **** p ≤ 0.0001. Presented graph is representative example of three independent experiments. After 1 dpf, the injection of 0.5 ng Std Ctrl morpholino resulted in a significant decrease of RNase_MRP RNA level whereas the injection of 1 ng Std Ctrl morpholino led to a significant increase of RNase_MRP RNA level (Figure 27, dark grey bars). Injection of 0.5 ng RNase_MRP morpholino (both RMRP P3 and RMRP S1) caused a significant decrease of RNase_MRP expression. Approx. 90% of the 0.5 ng RMRP S1 injected zebrafish died within 24 hours post injection and only 2 zebrafish survived until 5 dpf. 1 ng RMRP P3 also reduced RNase_MRP RNA expression in a significant manner whereas 1 ng RMRP S1 was lethal (Figure 27, light grey and white bars). RNase_MRP RNA expression was not detectable at 5 dpf (data not shown). We performed Alcian Blue/Alizarin Red staining with 5 dpf zebrafish to visualize cartilage (Alcian Blue) and bone (Alizarin Red) development and address the question if knockdown of RNase_MRP RNA in zebrafish result in defects of the cartilage/bone. No significant differences in the staining intensity or the morphology of the stained zebrafish could be detected between uninjected zebrafish, Std Ctrl injected zebrafish and RMRP P3 injected zebrafish (Figure 28). Due to the lethality, RMRP S1 injected zebrafishes could not be stained.

58

4.3 CHH zebrafish model

-

Un

injected

Ctrl

0.5 ng Std ng 0.5

Ctrl

1 ng Std ng 1

0.5 ng 0.5

RMRP P3 RMRP

P3 1 ng RMRP ng 1

Figure 28: No changes in cartilage/bone development and morphology when RNase_MRP was knocked down. 5 dpf zebrafish were stained with Alcian Blue and Alizarin Red to visualize the cartilage and bone development as well as morphology of the developing cartilage after knockdown of RNase_MRP. No change in bone/cartilage development was detected. Scale represents 100 µM each. Presented stainings are representative examples of three independent experiments and 10 biological replicats.

59 4 Results

As one of the main symptoms of CHH is dwarfism, we also checked for body length on 5 dpf after knockdown of RNase_MRP. We were not able to detect alterations in body length between Std Ctrl injected zebrafish and morpholino-injected zebrafish (Figure 29).

4 2 0

]

t

i n 4 0 0 N = 1 2

u N = 7

N = 4 N = 7 y

r N = 1 2 a

r 3 8 0

t

i

b

r

a [

3 6 0

h

t g

n 3 4 0

e

l

y d

o 3 2 0 b n .a . n .a . 3 0 0 l l d r r 3 3 1 1 e t t P P S S t C C c P P P P je td td R R R R n i S S M M M M n g g R R R R u n n g g g g .5 1 n n n n 0 .5 1 .5 1 0 0

Figure 29: No alterations in body length when RNase_MRP is knocked down. No differences in body lengths were detected on day 5 post fertilization. Values represent the average value of 4-12 biological replicates plus standard deviation. Presented graph is representative example of three independent experiments. Again, no RMRP S1 injected zebrafish survived until 5 dpf. This lethality could be a result of the missing RNase_MRP at the beginning of the development. To confirm the specificity of RMRP S1 morpholino, we performed RNA rescue experiments (Bill et al., 2009). We injected zebrafish with 0.5 ng morpholino oligomers in several combinations: only RMRP S1, Std Ctrl with 100 ng GFP mRNA (control), Std Ctrl with 100 ng RNase_MRP RNA; RMRP S1 with 100 ng GFP mRNA or RMRP S1 with 100 ng RNase_MRP RNA. Expression of RNase_MRP RNA was analysed 1 dpf via qPCR (Figure 30).

60 4.3 CHH zebrafish model

R N a s e _ M R P

2 .0

* * * *

n o

i 1 .5

s

s

e

r

p x

e 1 .0

e v

i * *

t a l 0 .5

e * * * * r

n .a . 0 .0

d 1 A A A A te S N N N N c P R R R R e j R m P m P n i M P R P R n R F M F M u _ _ G e G e + s + s l a a r N 1 N t S C R R P d + + t l R r 1 S t M S C R P td R S M R

Figure 30: No rescue of RNase_MRP RNA expression when RNase_MRP RNA is co-injected with morpholino. The expression of RNase_MRP are significantly reduced when RMRP S1 morholino was injected but are not increased when zebrafish were co-injected with RNase_MRP RNA as compared to uninjected zebrafish. Gene expression data was normalized to tbp and ef1a mRNA levels and data is presented as relative expression relative to uninjected controls. Values represent the average value of multiple biological samples (N = 5-10)/ group and 4 technical replicates plus standard deviation. The p-values are indicated as follow: ** p ≤ 0.01, **** p ≤ 0.0001. Presented graphs are representative examples of three independent injections/experiments. We could not show a rescue of the knock downed RNase_MRP levels when RMRP S1 was injected with 100 ng RNase_MRP RNA (Figure 30) as this condition was lethal within 24 hours post injection.

4.3.3 PLANNED ALTERNATIVE APPROACH

We decided to also explore the possibility to generate a knockdown model of POP1 in zebrafish and checked for the conservation of both human POP1 and zebrafish pop1 protein sequence. The sequence of human POP1 and zebrafish pop1 show highly conserved regions (Figure 31), making the knockdown of pop1 an interesting approach for investigating the role of POP1 during development.

61 4 Results

Figure 31: Human POP1 shows highly conserved region with zebrafish pop1. The three protein coding transcripts of the human POP1 (ENSG00000104356; indicated as POP1_1 [1024 amino acids]; POP1_2 [1024 amino acids] and POP1_4 [183 amino acids]) have highly conserved regions as compared to zebrafish pop1 (ENSDART00000167040; indicated as pop1 [455 amino acids]). These conserved regions include the amino acids 1-23, 68-77 and 92-185 (amino acids reference: POP1_1). Following amino acids are less conserved between human and zebrafish. We determined the relative mRNA expression of pop1 during the development of zebrafish and showed significantly decreased pop1 mRNA levels 2 dpf, 3 dpf and 5 dpf (Figure 32).

p o p 1

0 .8

n 0 .6

o

i

s

s

e

r p

x 0 .4 e

* * * *

e

v i

t * * * *

a l

e * * * * r 0 .2

0 .0 1 2 3 5 d a y s p o s t fe r tiliz a tio n

Figure 32: pop1 mRNA expression is decreased during development.

62 4.3 CHH zebrafish model

The expression of pop1 mRNA is significantly decreased at 2 dpf, 3 dpf and 5 dpf. Gene expression data was normalized to tbp and ef1a mRNA levels and data is presented as relative expression. Values represent the average value of multiple biological replicates (N = 5-10)/group and 4 technical replicates plus standard deviation. The p-values are indicated as follow: **** p ≤ 0.0001. Presented graph is representative example of three independent experiments. This expression profile coincides with the expression profile of RNase_MRP RNA seen in Figure 24, indicating a possible similar function or common need for both pop1 and RNase_MRP RNA during development. We generated a pop1 specific TALEN construct targeting a sequence within exon 3 of the pop1 gene (Figure 33, star).

Figure 33: A pop1-specific TALEN construct targets exon 3 of the zebrafish pop1 gene. The black star indicates the region where the TALEN was meant to initiate the break of the strand. Similar to the injected RNase_MRP specific TALEN, 100% of the injected eggs died within one day post injection. We decided to also use morpholino oligomers instead of TALEN constructs to generate a pop1 zebrafish model. The pop1 splice morpholino targets the last 8 nucleotides of exon 3 and the first 15 nucleotides of intron 3-4 to obtain a missplice mutation (Figure 34, black arrow).

Figure 34: A pop1splice morpholino targets the transition of exon 3 to intron 3-4. Black arrow indicates splice morpholino target site. The exact target site for this morpholino contains the last 8 nucleotides of exon 3 and the first 15 nucleotides of intron 3-4; orange arrow indicates the non- overlapping control morpholino targeting the intron 7/exon 8 splice boundary A non-overlapping control targeting the intron 7/exon 8 splice boundary was designed to confirm the specificity of the potential resulting phenotype (Figure 34, orange arrow). Due to the lack of phenotype of the RNase_MRP injected zebrafish, we decided to not inject the pop1 morpholino as part of this thesis rather than use these morpholinos as part of an independent investigation.

63 4 Results

4 . 4 R M R P i s u p - regulated at early stages o f hypertrophic differentiation

Although more and more information about the functions of RMRP RNA becomes available, the link between mutations in RMRP and defects in bone development remain unclear. We used different cell models to investigate the role of RMRP RNA in chondrogenic differentiation. First, we used MCT cells and differentiated them towards hypertrophic chondrocytes for 5 days. We checked for the expression of chondrogenic markers (Figure 35 A-D) and Rmrp RNA (Figure 35 E) using qPCR.

C o l1 0 a 1 A B R u n x 2

1 2 5 * * * * 3 .0

1 0 0 2 .5 * * * *

7 5 * * * * n

n * * * * o o * * * *

* * * * i * * * * i 5 0 * * * * * * * *

s 2 .0

s * * * * * * * * * * * * * * *

s

s e

e * * * * r

r 2 5

p

p x

x 1 .5

e

e

5 .0

e

e

v

v

i

i t

t 4 .0

a

a l

l 1 .0

e

e r r 3 .0

2 .0 0 .5 1 .0

0 .0 0 .0 0 .0 0 .5 1 .0 1 .5 2 .0 2 .5 3 .0 3 .5 4 .0 5 .0 0 .0 0 .5 1 .0 1 .5 2 .0 2 .5 3 .0 3 .5 4 .0 5 .0

d a y s o f d iffe r e n tia tio n d a y s o f d iffe r e n tia tio n

C C o l2 a 1 D S o x 9

2 5 8 .0 * * * * * * * * 7 .0 * * * * 2 0 * * * * * * * *

n 6 .0 n

o * * * * i

* * * * o

i

s

s

s s

e 1 5 5 .0 * * * * * * * *

r e

r * * * *

p p

x * * * * x

e * * * *

4 .0 * * * * e

* * * *

e

e

v i

1 0 v

i

t t

a 3 .0 l

a * * *

l

e e

r * * r 2 .0 5

1 .0

0 0 .0 0 .0 0 .5 1 .0 1 .5 2 .0 2 .5 3 .0 3 .5 4 .0 5 .0 0 .0 0 .5 1 .0 1 .5 2 .0 2 .5 3 .0 3 .5 4 .0 5 .0 d a y s o f d iffe r e n tia tio n d a y s o f d iffe r e n tia tio n

64 4.4 RMRP is up-regulated at early stages of hypertrophic differentiation

E R m r p

3 .0 *

2 .5

n o

i 2 .0

s

s

e r

p 1 .5

x

e

e

v 1 .0

i

t

a

l e r 0 .5 * *

n .a. 0 .0 0 .0 0 .5 1 .0 1 .5 2 .0 2 .5 3 .0 3 .5 4 .0 5 .0 d a y s o f d iffe r e n tia tio n

Figure 35: Rmrp RNA is highly up-regulated during hypertrophic differentiation. The expression of Col10a1 (A), Runx2 (B), Col2a1 (C) and Sox9 (D) indicate the successful induction of chondrogenic differentiation of MCT cells. A significant increase in Rmrp RNA expression is detected on day 1.5 of differentiation in MCT cells (E). Gene expression data was normalized to β-actin and Gapdh mRNA levels and data is presented as relative expression relative to d0. Values represent the average value of 4 technical replicates plus standard deviation. The p-values are indicated as follow:* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001. Presented graphs are representative examples of four independent experiments (A – E). Differentiation of MCT cells towards a chondrogenic phenotype was shown by increased expression of the chondrogenic markers Col10a1 (Figure 35 A), Runx2 (Figure 35 B), Col2a1 (Figure 35 C) and Sox9 (Figure 35 D). The expression of Rmrp RNA was highly decreased at day 0.5 of differentiation and highly increased at day 1.5. No significant changes in Rmrp RNA expression was detected at later time points (Figure 35 E). We used ATDC5 cells as another model for chondrogenic differentiation. Again, we determined the expression of different chondrogenic marker genes to confirm hypertrophic differentiation (Figure 36 A-C) as well as expression of Rmrp RNA (Figure 36 D) during the differentiation of the cells towards a chondrocytic phenotype.

65 4 Results

B C o l2 a 1 A R u n x 2 5 0 1 0 .0 * * * * 4 5 * * * * * * * * 9 .0 n

o 4 0

i n

8 .0 s

o i

s 3 5 s

7 .0 e s

r 3 0

e p

r 6 .0

x p

e 2 5 x

5 .0

e e * * * * * * *

v 2 0 e

4 .0 i

v t

i * * t * * a 1 5 l * *

a 3 .0

l

e r e 1 0 r 2 .0 1 .0 5 0 .0 0 0 1 2 3 4 5 6 7 8 1 0 1 1 1 2 1 3 1 4 0 1 2 3 4 5 6 7 8 1 0 1 1 1 2 1 3 1 4

d a y s o f d iffe r e n tia tio n d a y s o f d iffe r e n tia tio n

D R m r p C S o x 9 7 .0 * * * *

8 .0 n

6 .0 o

i * * * *

7 .0 s n

* * * * s 5 .0

o

e i

6 .0 r

s * * *

p

s x e 4 .0 * *

r 5 .0

e

p e

x * * * * * v

e 4 .0

i 3 .0

t

e

a

v l i 3 .0 * * *

t * * e

a * * 2 .0

r l

e 2 .0 r 1 .0 1 .0 * * 0 .0 0 .0 0 1 2 3 4 5 6 7 8 1 0 1 1 1 2 1 3 1 4 0 1 2 3 4 5 6 7 8 1 0 1 1 1 2 1 3 1 4 d a y s o f d iffe r e n tia tio n d a y s o f d iffe r e n tia tio n

Figure 36: The expression of Rmrp RNA is increased in ATDC5 cells during hypertrophic differentiation. ATDC5 cells were differentiated towards hypertrophic chondrocytes for 14 days. Expression of Runx2 (A), Col2a1 (B) and Sox9 (C) was measured to confirm chondrogenic differentiation. Rmrp RNA expression increases at early stages of chondrogenic differentiation with a peak at day 6, followed by a drop in expression and again an increase in later stages (D). Gene expression data was normalized to β-actin and Gapdh mRNA levels and data is presented as relative expression relative to d0. Values represent the average value of 4 technical replicates plus standard deviation. The p-values are indicated as follow: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001. Presented graphs are representative examples of three independent experiments. The expression of Runx2 (Figure 36 A), Col2a1 (Figure 36 B) and Sox9 (Figure 36 C) was up-regulated in ATDC5 cells, indicating a successfully induced hypertrophic differentiation. Rmrp RNA expression increased at day 6, followed by a significantly drop in expression at day 7 and highly increase in expression at later stages (Figure 36 D). These results strengthen our hypothesis that Rmrp RNA plays a distinct role during hypertrophic differentiation. To verify our obtained cell line data in a primary model for chondrogenesis, we used human dermal fibroblasts in a chondrogenic transdifferentiation system called FDC (fibroblasts transdifferentiate into chondrocyte-like cells) (French et al., 2004). In short, human dermal fibroblasts were plated at very high-density on Aggrecan coated plates and stimulated with ascorbic acid, insulin and transferrin to start a transdifferentiation of dermal fibroblasts into chondrocytic-like cells. We transdifferentiated human dermal fibroblasts of healthy controls (N = 3) into chondrogenic-like cells for 14 days and expression of different genes was determined at different time points. Chondrogenic transdifferentiation was successfully induced shown by the

66 4.4 RMRP is up-regulated at early stages of hypertrophic differentiation expression of COL10A1 (Figure 37 A), RUNX2 (Figure 37 B), COL2A1 (Figure 37 C) and SOX9 (Figure 37 D).

B R U N X 2 A C O L 1 0 A 1 2 .5 1 4 0 0 * * * 1 2 0 0 * * * *

2 .0 * *

n o n 1 0 0 0

i *

o s

i * * s

s 8 0 0 e

s * * 1 .5

r

e

r

p p

6 0 0 x

x

e

e 6 0

e e

v 1 .0

i

v

t

i

t

a

l a

l 4 0

e

r e r 0 .5 2 0

0 0 .0 0 1 3 5 7 1 4 0 1 3 5 7 1 4

d a y s o f d iffe r e n tia tio n d a y s o f d iffe r e n tia tio n

C O L 2 A 1 C D S O X 9

1 .5 8 .0

7 .0 n

n 6 .0 * * * *

o

o

i

i

s s

1 .0 s s

e 5 .0 * * * *

e

r

r

p

p x

x 4 .0

e

e

e

e * * * *

v

v i

i * *

t 3 .0

t

a a

0 .5 l

l

e

e r r 2 .0

1 .0

0 .0 0 .0 0 1 3 5 7 1 4 0 1 3 5 7 1 4 d a y s o f d iffe r e n tia tio n d a y s o f d iffe r e n tia tio n

E R M R P

4 .0

3 .5 * * * *

n 3 .0

o i

s * * * * * * s

e 2 .5 * * *

r p

x 2 .0

e

e

v i

t 1 .5

a

l e

r 1 .0

0 .5

0 .0 0 1 3 5 7 1 4 d a y s o f d iffe r e n tia tio n

Figure 37: RMRP RNA is highly up-regulated at early stages of chondrogenic transdifferentiation of human dermal fibroblast. Relative expression of COL10A1 (A) RUNX2 (B), COL2A1 (C) and SOX9 (D) was determined using qPCR showing the successful induced transdifferentiation of human dermal fibroblasts into cells with a chondrocytic phenotype. The expression of RMRP RNA increased within 24 hours of differentiation and stayed at high level. Only on day 7, the expression is not significantly increased. Gene expression data was normalized to RPL13 and HPRT1 mRNA levels and data is presented as relative expression relative to day 0. Values represent the average value of 3 biological samples/group and 4 technical replicates plus standard deviation. The p-values are indicated as follow: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001 (A – D). Presented graphs are representative examples of at least three independent experiments.

67 4 Results

RMRP RNA expression was highly up-regulated within one day of transdifferentiation, stayed up-regulated until day 5 followed by a drop at day 7 and again, a significant up-regulation at day 14 (Figure 37 E). The obtained data clearly indicate that expression of RMRP RNA is important during hypertrophic differentiation.

4.4.1 MANY SIGNALLING PATHWAYS ARE ALTERED IN CHH PATIENTS

The broad range of symptoms seen in CHH patients suggests that many different pathways are affected. We used human dermal fibroblasts of 4 healthy controls and 4 CHH patients, which inherit different mutations in the RMRP gene (Table 8) in a FDC setup followed by RNA-seq analysis to investigate possible alterations in chondrogenic differentiation, RNA expression and signalling pathways in CHH patients as compared to healthy individuals.

Table 8: Dermal fibroblasts of CHH patients used for RNA-seq analysis and the corresponding mutations in RMRP. Human dermal fibroblasts of four different patients were used for RNA-seq experiments. The table lists all four CHH patients and their corresponding mutation(s) in the RMRP gene. Patient Mutation in RMRP 1 n.127G>A, n.261C>G 2 n.4C>T; n.77C>T 3 n.70A>G (homozygous) 4 n.127G>A; n.261C>G

Total RNA was isolated at three different time points (0, 1 and 3 days of transdifferentiation) and RNA expression was analysed at each time point and compared between CHH patients and healthy controls. Statistical analysis was performed and RNA expression with a log 2-ratio > 1 and p < 0.05 was considered as up-regulated whereas RNA expression with a log 2-ratio < −1 and p < 0.05 was considered as down-regulated. First, we checked for the expression of several differentiation markers to confirm successfully induced transdifferentiation of dermal fibroblasts into chondrogenic-like cells (Figure 38 A - D).

68 4.4 RMRP is up-regulated at early stages of hypertrophic differentiation

A C O L 1 0 A 1 B R U N X 2

8 .0 3 5 0 + + + + + + + + 3 0 0 7 .0 6 .0

2 5 0 e

e 5 .0 + + + +

2 0 0 g g 1 5 0 + + + + n 4 .0

n H e a lth y (N = 4 ) H e a lth y (N = 4 ) a

a 1 0 0 h

h C H H (N = 4 ) C H H (N = 4 )

5 0 c c

1 .5

d d

1 .5 l

l o

o 1 .0 f f 1 .0 * * * * * * 0 .5 0 .5 0 .0 0 .0 0 1 3 0 1 3

d a y s o f d iffe r e n tia tio n d a y s o f d iffe r e n tia tio n

C S O X 9 D A C A N

7 .0 * * 6 0 * * * 6 .0 5 0 * * *

e + + e

g 5 .0 4 0

g n

H e a lth y (N = 4 ) n 3 0 H e a lth y (N = 4 ) a

4 .0 a h 2 0 * C H H (N = 4 ) h

c C H H (N = 4 )

c

3 .0 1 0

d

l

d l

o 1 .5 f 2 .0 o f 1 .0 1 .0 0 .5 + 0 .0 0 .0 0 1 3 0 1 3 d a y s o f d iffe r e n tia tio n d a y s o f d iffe r e n tia tio n

R M R P E

2 .5

e 2 .0

g n

a H e a lth y (N = 4 )

1 .5 h

c C H H (N = 4 )

d 1 .0

l

o f 0 .5 * * * * * * * * * * * *

0 .0 0 1 3 d a y s o f d iffe r e n tia tio n

Figure 38: RMRP RNA expression is significantly reduced in CHH patients as compared to healthy controls. Increased expression of COL10A1 (A), RUNX2 (B) and SOX9 (C) as well as decreased expression of ACAN (D) show induced differentiation of fibroblasts into chondrocyte-like cells. CHH patients show significantly decreased expression of RMRP RNA during differentiation towards a chondrocytic phenotype as compared to healthy controls (E). RNA-seq data is presented as fold change relative to the corresponding control condition. Values represent the average value of 4 biological and 4 technical replicates. The p-values are indicated as follow: significance of CHH patients against healthy controls for each day of differentiation: * p ≤ 0.05; ** p ≤ 0.01, *** p ≤ 0.001**** p ≤ 0.0001, significance of healthy controls compared to healthy controls on day 0: ++ p ≤ 0.01, ++++ p ≤ 0.0001 (A – E). Expression of COL10A1 mRNA and RUNX2 mRNA increased during transdifferentiation in healthy controls while in CHH patients, the expression of both COL10A1 mRNA and RUNX2 mRNA were less increased (Figure 38 A, B). Also, CHH patients showed increased expression of SOX9 mRNA at day 0 of transdifferentiation (Figure 38 C) and increased expression of ACAN mRNA at all time points (Figure 38 D). These results indicate altered differentiation potential of CHH patients. Furthermore, expression of RMRP RNA was increased during transdifferentiation of dermal fibroblasts towards a chondrocytic phenotype in healthy controls but was significantly down-regulated in CHH patients (Figure 38 E). Our results showed that not only the expression of RMRP RNA and chondrogenic differentiation markers varied in CHH patients: 252 RNAs were up-regulated and 111 RNAs were 69 4 Results down-regulated in CHH patients as compared to healthy controls on day 0 of differentiation (Table 9 second column). The number of differentially expressed RNAs increased on day 1 (575 up-regulated genes and 322 down-regulated genes, Table 9 third column) and day 3 (583 up- regulated genes and 473 down-regulated genes, Table 9 last column).

Table 9: Expression of many RNAs is altered in CHH patients compared to healthy controls. The expression of more than 12 000 RNAs were analyzed and compared between CHH patients and healthy controls at different time points during chondrogenic-like differentiation. Up-regulated genes had (log 2- ratio > 1 and p < 0.05 whereas down-regulated genes had log 2-ratio < −1 and p < 0.05. Day 0 Day 1 Day 3 Total 12038 12179 12126 Up-regulated genes 252 575 583 Down-regulated genes 111 322 473

Expression of several genes was up- or down-regulated at a distinct time point but was not altered the whole time. To figure out genes, which are differentially expressed over time, we analysed gene expression at day 1 versus day 0 as well as day 3 versus day 0. 55 genes were up-regulated and 33 genes were down-regulated on day 1 versus day 0 (Table 10 second column). Analysing day 3 versus day 0, we showed that 68 genes were up-regulated and 38 genes were down-regulated on both days (Table 10 third column).

Table 10: Altered gene expression during differentiation. The expression of genes with altered expression at day 1 or day 3 compared to day 0 of differentiation were analyzed. Up-regulated genes had (log 2-ratio > 1 and p < 0.05 whereas down-regulated genes had log 2- ratio < −1 and p < 0.05. Day 1 vs. Day 0 Day 3 vs. Day 0 Up-regulated genes 55 68 Down-regulated genes 33 38

When searching for overlapping genes for both conditions (day1 vs. day 0 and day 3 vs. day 0), we found out that 29 genes were overlapping and were either up- or down-regulated (Figure 39).

70 4.4 RMRP is up-regulated at early stages of hypertrophic differentiation

Figure 39: Venn diagram of the differentially expressed genes of day 1vs.day 0 and day 3 vs. day 0 of differentiation. 88 genes are altered in expression at day 1 vs. day 0 respectively 106 genes are altered in expression at day 3 vs. day 0 of differentiation. 29 genes are overlapping. Table 11 shows all 29 overlapping genes and their log fold change at the different time points.

Table 11: List of the 29 differentially expressed genes. RNA-seq analysis revealed 29 differentially expressed genes in CHH patients as compared to healthy controls during chondrogenic differentiation. Listed are the Gene names, the full name of each gene, the expression as compared to healthy controls as well as the log fold change of t1 vs t0 resp. t3 vs. t0. Log fold change Gene Full name Expression t1 vs. t0 t3 vs. t0 DHRS3 Dehydrogenase/Reductase 3 Up-regulated 2.72 4.22 SOD2 Superoxide Dismutase 2, Mitochondrial Up-regulated 2.92 4.22 C10orf10 Chromosome 10 Open Reading Frame 10 Up-regulated 4.16 3.90 RDH10 Retinol Dehydrogenase 10 (All-Trans) Up-regulated 3.07 3.70 ATP Binding Cassette Subfamily A ABCA1 Up-regulated 3.07 3.32 Member 1 CEBPD CCAAT/Enhancer Binding Protein Delta Up-regulated 3.23 2.97 COL5A2 Collagen Type V Alpha 2 Chain Up-regulated 2.47 2.47 NCOA7 Nuclear Receptor Coactivator 7 Up-regulated 2.09 2.19 BEST1 Bestrophin 1 Up-regulated 2.31 2.11 Nuclear Protein 1, Transcriptional NUPR1 Up-regulated 2.35 2.06 Regulator TTC39B Tetratricopeptide Repeat Domain 39B Up-regulated 2.33 1.85 SLC3A2 Solute Carrier Family 3 Member 2 Up-regulated 2.09 1.79 BTG1 BTG Anti-Proliferation Factor 1 Up-regulated 1.44 1.65 Proline Rich Nuclear Receptor Coactivator PNRC1 Up-regulated 1.67 1.62 1 C10orf54 Chromosome 10 Open Reading Frame 54 Up-regulated 2.03 1.53

71 4 Results

TCP11L2 T-Complex 11 Like 2 Up-regulated 1.76 1.49 DSEL Dermatan Sulfate Epimerase-Like Up-regulated 1.77 1.49 TUBE1 Tubulin Epsilon 1 Up-regulated 1.87 1.42 DFNA5, Deafness Associated Tumor DFNA5 Up-regulated 1.68 1.39 Suppressor AGTRAP Angiotensin II Receptor Associated Protein Up-regulated 1.19 1.25 AZI2 5-Azacytidine Induced 2 Up-regulated 1.46 1.20 IDI1 Isopentenyl-Diphosphate Delta Isomerase 1 Down-regulated -1.38 -1.27 ARHGAP22 Rho GTPase Activating Protein 22 Down-regulated -2.17 -1.75 STK17B Serine/Threonine Kinase 17b Down-regulated -1.61 -1.90 WNT9A Wnt Family Member 9A Down-regulated -2.14 -2.00 SMAD Specific E3 Ubiquitin Protein SMURF2 Down-regulated -1.79 -2.03 Ligase 2 IL16 Interleukin 16 Down-regulated -4.49 -3.38 LIPG Lipase G, Endothelial Type Down-regulated -6.74 -5.40

We linked all 29 genes to possible signalling pathways (see Appendix 1 for further details) and focused on two different signalling pathways, which are both important for differentiation, named Wnt signalling (section 4.5) and hypoxia signalling (section 4.7).

4 . 5 W n t s i g n a l l i n g h a s an influence on RMRP expression

4.5.1 ß-CATENIN CAN BIND TO THE RMRP PROMOTER AND INCREASES THE RMRP RNA LEVEL

Several studies showed that Wnt signalling is essential for the development of different tissues, including bones (Logan and Nusse, 2004; Liu et al., 2008; Yang, 2012; Kim et al., 2013). As we showed that RMRP RNA also plays an important role during bone development, we hypothesized that components of the Wnt signalling pathway may interact with RMRP.We had a closer look at the Rmrp promoter for possible binding sites for components of the Wnt signalling pathway and found two putative TCF/Lef1 binding sites within the -1500 Rmrp promoter: the first one is located at -102 and the second one at -1152 (Figure 40).

72 4.5 Wnt signalling has an influence on RMRP expression

Rmrp -1152 -102

Figure 40: Two TCF/Lef1 binding sites are located in the Rmrp promoter. Two TCF/Lef1 binding sites are located within the -1500 Rmrp promoter sequence. Stars representing TCF/Lef1 binding sites, Box represents the Rmrp gene ß-CATENIN (CTNNB1) binds to TCF/Lef1 binding sites and induces the expression of downstream targets (Cadigan and Waterman, 2012). Therefore, CTNNB1 could bind to the two putative TCF/Lef1 binding sites within the Rmrp promoter sequence and influence the expression of Rmrp RNA. We analysed the correlation between CTNNB1 expression and Rmrp RNA expression during chondrogenic differentiation using again the ATDC5 cell line (Figure 41) as well as the MCT cell line (Figure 42). During differentiation of ATDC5 cells towards a chondrocytic phenotype, expression of CTNNB1 was up-regulated from day 3/4 of differentiation with highest expression level on day 5/6 (Figure 41 A). Rmrp RNA expression was highly up- regulated at day 6 and from day 11 on (Figure 41 B).

A

Day: 0 1 2 3 4 5 6 7 8 10 11 12 13 14 ActiveCTNNB1 (92 kDa)

CTNNB1 (92 kDa)

ACTB (42 kDa)

B R m r p 7 .0 * * * *

n 6 .0 o

i * * * * s

s 5 .0 e

r * * * p

x 4 .0 * *

e

e * v

i 3 .0

t

a l

e 2 .0 r

1 .0 * * 0 .0 0 1 2 3 4 5 6 7 8 1 0 1 1 1 2 1 3 1 4 d a y s o f d iffe r e n tia tio n Figure 41: β-Catenin and Rmrp RNA are up-regulated during differentiation of ATDC5 cells. The expression of CTNNB1 is up-regulated from day 3 on with highest expression at day 5/6 shown by immunoblotting (A). Rmrp RNA expression was determined via qPCR and is highly increased at day 6, followed by a significant drop at day 7 and is highly increased again from day 11 on (B). Active CTNNB1 antibody recognizes active (dephosphorylated) form of β-Catenin. CTNNB1 antibody recognizes the endogenous levels of total β-Catenin. Actin Beta (ACTB) was used as loading control in immunoblotting (A). Gene expression data was normalized to β-actin and Gapdh mRNA levels and data is presented as 73 4 Results relative expression relative to d0. Values represent the average value of 4 technical replicates plus standard deviation. The p-values are indicated as follow: * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001, **** p ≤ 0.0001 (B). Presented graphs are representative examples of at least three independent experiments. During differentiation of MCT cells towards hypertrophic chondrocytes, CTNNB1 expression was increased on day 2 of differentiation (Figure 42 A) while Rmrp RNA expression was significantly increased at day 1.5 (Figure 42 B).

A Day: 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 5.0

Active CTNNB1 (92 kDa)

CTNNB1 (92 kDa)

ACTB (42 kDa)

B R m r p

3 .0 *

2 .5

n

o

i s

s 2 .0

e

r p

x 1 .5

e

e v

i 1 .0

t

a

l e r 0 .5 * *

n .a. 0 .0 0 .0 0 .5 1 .0 1 .5 2 .0 2 .5 3 .0 3 .5 4 .0 5 .0 d a y s o f d iffe r e n tia tio n Figure 42: The expression of Rmrp RNA is up-regulated earlier than CTNNB1 expression in differentiating MCT cells towards a chondrocytic phenotype. The expression of CTNNB1 is up-regulated from day 2 (A) while Rmrp RNA expression is highest at day 1.5 (B). Active CTNNB1 antibody recognizes active (dephosphorylated) form of β-Catenin. CTNNB1 antibody recognizes the endogenous levels of total β-Catenin. ** p ≤ 0.01 Actin Beta (ACTB) was used as loading control in immunoblotting (A). Gene expression data was normalized to β-actin and Gapdh mRNA levels and data is presented as relative expression relative to d0. Values represent the average value of 4 technical replicates plus standard deviation. The p-value is indicated as follow: ** p ≤ 0.01 (B). Presented graphs are representative examples of at least three independent experiments. We used a constitutive active Ctnnb1 plasmid to over-express Ctnnb1 to further investigate the correlation of β-Catenin and Rmrp. Rmrp RNA expression was not increased during proliferation of ATDC5 cells when Ctnnb1 was over expressed (Figure 43 A) but was significantly up-regulated during differentiation of ATDC5 cells upon over-expression of Ctnnb1 (Figure 43 B).

74 4.5 Wnt signalling has an influence on RMRP expression

B R m r p A R m r p

2 .0

1 .5 * *

n

n

o

o i

i 1 .5

s

s

s

s e

e 1 .0

r

r

p

p x

x 1 .0

e

e

e

e

v

v

i

i t

t 0 .5

a

a l

l 0 .5

e

e

r r

0 .0 0 .0 e m p ty v e c to r C tn n b 1 e m p ty v e c to r C tn n b 1

Figure 43: Ctnnb1 over expression results in significantly increased Rmrp RNA expression during chondrogenic differentiation. Ctnnb1 over expression has no influence on the expression of Rmrp RNA during proliferation (A) but results in a highly significant increase of Rmrp RNA expression during chondrogenic differentiation (B) of ATDC5 cells. Gene expression data was normalized to β-actin and Gapdh mRNA levels and data is presented as relative expression relative to empty vector. Values represent the average value of 4 technical replicates plus standard deviation. The p-value is indicated as follow: ** p ≤ 0.01 (A, B). Presented graphs are representative examples of four independent experiments. Altogether, these data clearly indicate that Rmrp RNA expression is linked to CTNNB1 expression and additional experiments (e.g. immunoprecipitation) can further manifest this possible correlation.

4.5.2 THE EXPRESSION OF RMRP RNA IS LINKED TO WNT9A

ß-CATENIN is a major but not the only component of the Wnt signalling pathway. Therefore, we investigated our RNA-seq data on whether we find other components of this signalling pathway to be altered in CHH patients or not. WNT9A twas one of the most differentially expressed genes in CHH patients as compared to healthy controls during chondrogenic transdifferentiation (Figure 44, also see Table 11 and Appendix 1).

W N T 9 A

6 .0 + + + +

5 .0

e g

n 4 .0 H e a lth y (N = 4 ) a

h 3 .0 + + + + C H H (N = 4 )

c

d

l 2 .0 *

o f 1 .0 * * * * * * * * 0 .0 0 1 3 d a y s o f d iffe r e n tia tio n

Figure 44: The expression of WNT9A is significantly altered in CHH patients compared to healthy controls.

75 4 Results

The expression of WNT9A is significantly up-regulated in healthy controls during chondrogenic differentiation. RNA-seq data is presented as fold change relative to healthy controls at d0. Values represent the average value of 4 biological and 4 technical replicates. The p-values are indicated as follow: significance of CHH patients against healthy controls for each day of differentiation: * p ≤ 0.05; **** p ≤ 0.0001, significance of healthy controls compared to healthy controls on day 0: ++++ p ≤ 0.0001 CHH patients showed significantly increased WNT9A mRNA levels at day 0 as compared to healthy controls (Figure 44, left). In healthy controls, the expression of WNT9A was highly up- regulated during transdifferentiation of dermal fibroblasts towards a chondrocytic phenotype while CHH patients showed a highly significant decrease in WNT9A expression at day 1 and day 3 of transdifferentiation (Figure 44 middle and right). The reduced expression of RMRP RNA and WNT9A in CHH patients on day 1 of differentiation compared to healthy controls was confirmed via qPCR by Mandy Meekels-Steinbusch (Laboratory for Experimental Orthopaedics, Maastricht University Medical Center+) (Figure 45 A, B).

W N T 9 A R M R P B A

1 .5 1 .5

n

n

o

o

i

i

s

s s

s 1 .0 1 .0

e

e

r

r

p

p

x

x

e

e

e

e

v

v i

i * * * * * t

t 0 .5 0 .5

a

a

l

l

e

e

r r

0 .0 0 .0 H e a lth y (N = 4 ) C H H (N = 4 ) H e a lth y (N = 4 ) C H H (N = 4 )

Figure 45: Decreased expression of RMRP RNA and WNT9A in CHH patients on the first day of chondrogenic transdifferentiation can be confirmed. RMRP RNA expression (A) as well as WNT9A expression (B) is significantly down-regulated in CHH patients on day 0 of chondrogenic differentiation as compared to healthy controls. Gene expression data was normalized to RPL13 and HPRT1 mRNA levels and data is presented as relative expression relative to healthy controls. Values represent the average value of 4 biological and 4 technical replicates plus standard deviation. The p-values are indicated as follow: ** p ≤ 0.01; *** p ≤ 0.001. Presented graphs are representative examples of at least two independent RNA isolations plus RNA-seq samples. To further investigate the correlation between WNT9A and RMRP, we used again MCT cells. First, we compared the expression of Rmrp RNA and WNT9A during chondrocytic-like differentiation of this cell line. The expression of WNT9A was up-regulated on day 1.5 of differentiation in MCT cells (Figure 46 A, lower blots) while the expression of active CTNNB1 was up-regulated on day 2 of differentiation (Figure 46 A, upper blots). Rmrp RNA expression was also up-regulated on day 1.5 of differentiation (Figure 46 B).

76 4.5 Wnt signalling has an influence on RMRP expression

B R m r p

3 .0 *

2 .5

n

o

i s

s 2 .0

e

r p

x 1 .5

e

e v

i 1 .0

t

a

l e r 0 .5 * *

n .a. 0 .0 0 .0 0 .5 1 .0 1 .5 2 .0 2 .5 3 .0 3 .5 4 .0 5 .0 d a y s o f d iffe r e n tia tio n

Figure 46: The expression of WNT9A and Rmrp RNA is up-regulated during chondrogenic differentiation. In MCT cells, the expression of WNT9A (A, lower blots) and Rmrp RNA (B) is up-regulated on day 1.5 of differentiation towards a chondrocytic phenotype while CTNNB1 is up-regulated at day 2 (A, upper blots). Actin Beta (ACTB) was used as loading control in immunoblotting (A). Gene expression data, obtained via qPCR, was normalized to β-actin and Gapdh mRNA levels and data is presented as relative expression relative to d0. Values represent the average value of 4 technical replicates plus standard deviation. The p- value is indicated as follow: ** p ≤ 0.01 (B). Presented blots and graph are representative examples of at least three independent experiments. Next, we transfected ATDC5 cells during differentiation towards hypertrophic chondrocytes with Rmrp siRNA to knockdown Rmrp RNA expression comparable to the situation in CHH patients and checked for Wnt9a expression (Rmrp siRNA experiments were performed by Mandy Meekels-Steinbusch, Laboratory for Experimental Orthopaedics, Maastricht University Medical Center+). Knockdown of Rmrp RNA could be confirmed via qPCR (Figure 47 A) and expression of Wnt9a mRNA was decreased as compared to controls upon Rmrp RNA knockdown (Figure 47 B).

77 4 Results

A B R m r p W n t9 a

1 .5 1 .5

n

n

o

o

i

i

s

s s

s 1 .0 1 .0

e

e

r

r

p

p

x

x

e

e

e

e * * *

v

v

i

i t

t 0 .5 0 .5

a

a

l

l

e

e

r r

0 .0 0 .0 s c ra m b le d s iR N A R M R P s iR N A s c ra m b le d s iR N A R M R P s iR N A

Figure 47: Wnt9a mRNA expression is reduced upon Rmrp knockdown. Rmrp RNA expression is significantly reduced using Rmrp siRNA (A). The knockdown of Rmrp results in decreased expression of Wnt9a (B). Experiments were performed using ATDC5 cells. Gene expression data was normalized to β-actin and Gapdh mRNA levels and data is presented as relative expression relative to scrambled siRNA treated controls. Values represent the average value of 4 technical replicates plus standard deviation. The p-values are indicated as follow: * p ≤ 0.05; ** p ≤ 0.01 (A, B). Presented graphs are representative examples of three independent experiments. The previous obtained data suggests that Wnt signalling influences the expression of Rmrp RNA. As Wnt9a is an upstream molecule of CTNNB1, which was shown to stimulate Rmrp RNA expression, we over expressed Wnt9a and checked for Rmrp RNA expression during proliferation and differentiation of ATDC5 cells. We showed that Rmrp RNA expression was not altered during proliferation (Figure 48 A, grey bar) while Rmrp RNA expression was significantly increased during differentiation when Wnt9a was over expressed (Figure 48 B, grey bar).

A R m r p B R m r p

2 .0 2 .0 * *

*

n

n o

o 1 .5 1 .5

i

i

s

s

s

s

e

e

r

r

p

p x

x 1 .0 1 .0

e

e

e

e

v

v

i

i

t

t

a

a

l

l e

0 .5 e 0 .5

r r

0 .0 0 .0 e m p ty v e c to r W n t9 a C tn n b 1 e m p ty v e c to r W n t9 a C tn n b 1

Figure 48: Rmrp RNA expression is increased during differentiation due to over expression of Wnt9a. No alteration in the expression of Rmrp RNA in proliferating ATDC5 cells when Wnt9a or Ctnnb1 was over expressed as compared to cells transfected with an empty vector (A). In differentiating ATDC5 cells, over expression of Wnt9a or Ctnnb1 result in significantly increased Rmrp RNA expression as compared to cells transfected with an empty vector (B). Gene expression data was normalized to β-actin and Gapdh mRNA levels and data is presented as relative expression relative to empty vector controls. Values represent the

78 4.5 Wnt signalling has an influence on RMRP expression average value of 3 biological and 4 technical replicates plus standard deviation. The p-values are indicated as follow: * p ≤ 0.05; ** p ≤ 0.01 (A, B). Combined results of three independent experiments in ATDC5 cells were shown. Over expression of Ctnnb1 was used as positive control and resulted in increased expression of Rmrp RNA during differentiation (Figure 48 B; white bar; also see Appendix 2). As over expression of Wnt9a resulted in increased Rmrp RNA expression, we also wanted to test if knockdown of Wnt9a results in decreased Rmrp RNA expression. Stealth siRNA was used because of the increased stability (source: ThermoFisher Scientific) that allows us to perform knockdown experiments with ATDC5 cells and MCT cells, which need several days to differentiate. Wnt9a knockdown was successfully achieved in ATDC5 cells (Figure 49 A, B) and MCT cells (Figure 50 A, B) during proliferation and differentiation of the cells. In ATDC5 cells, the expression of Rmrp RNA was highly down-regulated during proliferation as well as differentiation (Figure 49 C, D).

A W n t9 a B 1 .5 W n t9 a 1 .5

n * * *

n

o

i

o

i

s s

s 1 .0

s

e r

e 1 .0

r

p

p

x

x

e

e

e

e

v

i v

t 0 .5

i t

a 0 .5 l

* * * * a * * * *

l

e

r

e r

0 .0 0 .0 u n tra n s fe c te d C o n tro l s iR N A W n t9 a s iR N A u n tra n s fe c te d C o n tro l s iR N A W n t9 a s iR N A

C R m r p D R m r p

1 .5 1 .5

n

n

o

o

i

i

s

s s

1 .0 s e

e 1 .0

r

r

p

p x

x * * *

e

e

* * * *

e

e v

* * * * v

i

i t

0 .5 t 0 .5

a

a

l

l

e

e

r r

0 .0 0 .0 u n tra n s fe c te d C o n tro l s iR N A W n t9 a s iR N A u n tra n s fe c te d C o n tro l s iR N A W n t9 a s iR N A

Figure 49: Knockdown of Wnt9a results in reduced Rmrp RNA expression. ATDC5 cells were transfected with either a control siRNA (light grey bars) or a Wnt9a siRNA (dark grey bars) during proliferation (A, C) or differentiation (B, D). Knockdown of Wnt9a is successfully achieved (A, B). The expression of Rmrp RNA is highly significantly reduced during proliferation and differentiation (C, D) as compared to untransfected controls. Gene expression data was normalized to β-actin and Gapdh mRNA levels and data is presented as relative expression relative to euntransfected controls. Values represent the average value of 3 biological and 4 technical replicates plus standard deviation. The p-values

79 4 Results are indicated as follow: *** p ≤ 0.001; **** p ≤ 0.0001 (A - D). Combined results of three independent experiments in ATDC5 cells were shown. In MCT cells, Wnt9a knockdown resulted in significantly decreased Rmrp RNA levels during differentiation (Figure 50 D) while Rmrp RNA expression was not altered in proliferating cells (Figure 50 C).

A B W n t9 a W n t9 a

1 .5 1 .5

n

n

o

o

i

i

s

s

s s

e 1 .0

e 1 .0

r

r

p

p

x

x

e

e

e

e * * *

v v

i * * * *

i t

0 .5 t 0 .5

a

a

l

l

e

e

r r

0 .0 0 .0 u n tra n s fe c te d C o n tro l s iR N A W n t9 a s iR N A u n tra n s fe c te d C o n tro l s iR N A W n t9 a s iR N A

D C R m r p R m r p

1 .5 1 .5

n

n

o

o

i

i

s

s

s

s e

1 .0 e 1 .0

r

r p

p *

x

x

e

e

e

e

v

v

i

i t

0 .5 t 0 .5

a

a

l

l

e

e

r r

0 .0 0 .0 u n tra n s fe c te d C o n tro l s iR N A W n t9 a s iR N A u n tra n s fe c te d C o n tro l s iR N A W n t9 a s iR N A

Figure 50: Rmrp RNA expression is significantly decreased when Wnt9a is knocked down. MCT cells were transfected with either a control siRNA (light grey bars) or a Wnt9a siRNA (dark grey bars) during proliferation (A, C) or differentiation (B, D). Knockdown of Wnt9a is successfully achieved (A, B). The expression of Rmrp RNA is highly significantly reduced during proliferation and differentiation (C, D) as compared to untransfected controls. Gene expression data was normalized to β-actin and Gapdh mRNA levels and data is presented as relative expression relative to euntransfected controls. Values represent the average value of 3 biological and 4 technical replicates plus standard deviation. The p-values are indicated as follow: * p ≤ 0.05, *** p ≤ 0.001; **** p ≤ 0.0001 (A - D). Combined results of three independent experiments in MCT cells were shown. These results showed that low expression of WNT9A decreases the expression of RMRP RNA and high expression of WNT9A increases RMRP RNA expression. To find out if we can rescue the decreased RMRP RNA expression of CHH patients during chondrogenic differentiation by adding recombinant WNT9A, we transdifferentiated dermal fibroblasts of healthy controls (N = 3) as well as dermal fibroblasts of CHH patients (N = 2) towards a chondrocytic phenotype in a preliminary experiment and either stimulated the cells with or without recombinant WNT9A (presence of WNT9A was confirmed by immunoblotting, data not shown). RMRP RNA

80 4.6 RMRP promoter studies expression of CHH patients could not be increased by adding WNT9A during chondrogenic transdifferentiation (Figure 51).

R M R P

+ + + +

+ + + +

+ + 1 5

* * * * n

o H e a lth y w ith o u t W N T 9 A i

s (N = 3 )

s 1 0 e

r + H e a lth y w ith W N T 9 A

p (N = 3 )

x e

* * * * * * * * * C H H w ith o u t W N T 9 A e

v (N = 2 ) i

t 5

a C H H w ith W N T 9 A l

e (N = 2 ) r

0 0 1 3 d a y s o f d iffe r e n tia tio n

Figure 51: No rescue of RMRP RNA expression in CHH patients when cells are stimulated with recombinant WNT9A during chondrogenic differentiation. Fibroblasts of both healthy controls and CHH patients were transdifferentiated into chondrocyte-like cells. Differentiation medium was supplemented with or without 15 ng/µl recombinant WNT9A. Expression of RMRP RNA is not increased when differentiation medium was supplemented with WNT9A as compared to CHH patient cells treated without WNT9A. Gene expression data was normalized to RPL13 and HPRT1 mRNA levels and data is presented as relative expression relative to healthy controls at d0. Values represent the average value of 4 technical replicates plus standard deviation. The p-values are indicated as follow: healthy controls with and without recombinant WNT9A as compared to healthy controls on day 0 of differentiation: ** p ≤ 0.01, *** p ≤ 0.001; **** p ≤ 0.0001; Healthy control without recombinant WNT9A as compared to CHH fibroblasts with and without WNT9A at the corresponding time point: + p ≤ 0.05, ++ p ≤ 0.01; ++++ p ≤ 0.0001. Presented data is obtained from one experiment. This experiment should be repeated with different concentrations of recombinant WNT9A to ensure that the failure of the experiment was not due to a faulty concentration of WNT9A.

4 . 6 R M R P p romoter studies

Almost all RMRP promoter mutations are either duplications or triplications of a RMRP promoter sequence so we tried to find a common pattern for these mutations. We aligned all known promoter mutations and found two consensus sequences, which were present in all duplications or triplications (Table 12, bold and italic resp. underlined).

Table 12: Consensus sequences of RMRP promoter mutations. CHH-causing mutations can appear within the only exon of RMRP or within the RMRP promoter. Analysis of all known RMRP promoter mutations revealed multiplication of two different consensus sequences, TCTGTG (bold, italic) and AAGC (underlined) in most of the analysed mutations.

81 4 Results

-28_-1dupAATACTACTCTGTGAAGCTGAGGACGTG -26_-5dupTACTACTCTGTGAAGCTGAGAA -25_-6dupACTACTCTGTGAAGCTGAGA -25_-5dupACTACTCTGTGAAGCTGAGGA -25_-11tripACTACTCTGTGAAGC -25_-11dupACTACTCTGTGAAGC -25_-10tripACTACTCTGTGAAGCT -25_-10dupACTACTCTGTGAAGCT -25_-10dupACTACTCTGTGAAGC -25_-13dupACTACTCTGTGAA -25_-19dupACTACTC(homo) -24_-15dupCTACTCTGTG -24_-11dupCTACTCTGTGAAGC (hetero) -24_+2dupCTACTCTGTGAAGCTGAGGACGTGGT (hetero) -23_-8dupTACTCTGTGAAGCTGA (hetero) -23_-7dupTACTCTGTGAAGCTGAG (hetero) -23_-4dupTACTCTGTGAAGCTGAGGAC -23_-15dupTACTCTGTG -23_-14dupTACTCTGTGA -22_-10dupACTCTGTGAAGCT -21_-9dupCTCTGTGAAGCTG (hetero) -21_-14tripCTCTGTGA -21_-1dupCTCTGTGAAGCTGAGGACGTG -21_+2dupCTCTGTGAAGCTGAGGACGTGGT (hetero) -20_ ins TCTGTGA -20_-4dupTCTGTGAAGCTGGGGAC -20_-14dupTCTGTGA -16_-7dupTGAAGCTGAG -15_-8dupGAAGCTGA -15_2dupGAAGCTGAGGACGTGGT -14_-7dupAAGCTGAG -14_-3dupAAGCTGAGGACG -14_-1dupAAGCTGAGGACGTG -13_ ATCTGTG

82 4.6 RMRP promoter studies

-11_-10insTACTCTGTGAAGTACTCTGTGAAGCTGA -11_-5delCTGAGGAins28bp -9_-2dupGAGGACGT -8_-1dupAGGACGTG -7_-6insCCTGAG -7_-6insAACGAAGCTGAG -7_3dupGGACGTGGTT -6_-5ins ACTACTACTCTGTGAAGCTGAGG (hetero) -5_-4insGGACGTGGTT -4_-1dupCGTG

Due to the fact that TCF/Lef1 binding sites are within the -1500 RMRP promoter region, we cloned both the -200_+1 RMRP promoter (later called -200RMRP promoter) and the -1500_+1 RMRP promoter (later called -1500RMRP promoter) and investigated the different promoter activities for both lengths. First, we transfected HeLa cells with -1500 RMRP promoter and the - 200 RMRP promoter to investigate possible differences in promoter activity. We detected no changes in promoter activity between the two different WNT RMRP promoter constructs (Figure 52).

1 .5

y

t

i

v

i

t

c

a

r 1 .0

e

t

o

m

o

r

p

e 0 .5

v

i

t

a

l

e r

0 .0 -1 5 0 0 W T R M R P -2 0 0 W T R M R P p r o m o te r p r o m o te r

Figure 52: No difference in WT RMRP promoter activity between the -1500 promoter and the -200 promoter. No differences in promoter activity of the -200 WT RMRP promoter construct as compared to the -1500 WT RMRP promoter construct. HeLa cells were used in these transfection experiments.Bioluminescence/relative promoter activity was normalized to Renilla luciferase signals. Normalized relative promoter activity of - 1500 RMRP promoter was set at 1 and relative promoter activity was calculated relative to the control relative promoter activity. Data represents the average value of 4 technical replicates plus standard deviation. Graph is representative example of 3 individual experiments. Next, we compared the WT RMRP promoter activity and RMRP promoter activity of four RMRP promoter mutations (indicated in Table 13), which were found in CHH patients.

83 4 Results

Table 13: Patient-related mutations, which were cloned into the pSEAP2-basic vector. Database of all known patient-related mutations of the RMRP promoter were analyzed and 4 different types of RMRP promoter mutations were chosen to be cloned into the pSEAP2-basic vector for promoter activity studies. Consensus sequence 1 (bold) and consensus sequence 2 (underlined) are indicated in the table. Mutation -23_-15dupTACTCTGTG -22_-10dupACTCTGTGAAGCT -20_-14dupTCTGTGA -15_-8dupGAAGCTGA

We could not show differences in promoter activity when different -1500 RMRP promoter activities were compared (Figure 53 A).

A -1 5 0 0 R M R P p r o m o te r B -2 0 0 R M R P p r o m o te r

1 .5 1 .5

y

t

y

i

t

i

v

i

v

t

i

t

c

c

a a 1 .0

1 .0

r

r

e

e

t

t

o

o

m m

o *

o

r

r p

p *

e

e v

v 0 .5 0 .5

i

i

t

t

a

a

l

l

e

e

r r

0 .0 0 .0 r p p p p e r p p p p t u u u u e u u u u o d d d d t 5 0 4 8 o d d d d m - 5 0 4 8 -1 -1 -1 m 1 1 1 - o _ o - - - _ r _ _ _ 5 r _ _ _ 5 p 3 2 0 1 p 3 2 0 1 2 2 2 - 2 2 2 - T - - - T - - - W W

Figure 53: CHH-causing promoter mutations result in decreased promoter activity. Promoter activity was not altered when the -1500 RMRP promoter was mutated (A). In the -200 RMRP promoter, some of the CHH-causing promoter mutations resulted in a significantly decrease in promoter activity (B). Bioluminescence was normalized to the Gaussia luciferase signals. Normalized relative promoter activity of WT RMRP promoter was set at 1 and relative promoter activity was calculated relative to the corresponding WT RMRP promoter. Data represents the average value of 3 technical replicates plus standard deviation. The p-value is as follow: * p ≤ 0.05 (A, B). Presented graphs are representative examples of 3 individual experiments in HeLa cells. When using the -200 RMRP promoter, the -23_+15dup and the -20_-14dup resulted in significantly reduced promoter activity as compared to WT RMRP promoter (Figure 53 B). To investigate the effects of RMRP promoter mutations in a chondrogenic context, we transfected SW1353 cells with the previously obtained WT RMRP promoter constructs and checked for promoter activity. The -200 WT RMRP promoter showed reduced promoter activity as compared to the -1500 WT RMRP promoter (Figure 54).

84 4.6 RMRP promoter studies

1 .5

y

t

i

v

i

t c

a 1 .0

r

e

t

o

m

o

r

p

e

v 0 .5 i

t * * * *

a

l

e r

0 .0 -1 5 0 0 W T R M R P -2 0 0 W T R M R P p r o m o te r p r o m o te r

Figure 54: Reduced promoter activity of the -200 WT RMRP promoter in SW1353 cells. The -200 WT RMRP promoter showed reduced promoter activity as compared to the -1500 WT RMRP promoter. Bioluminescence was normalized to Renilla luciferase signals. Normalized relative promoter activity of -1500 RMRP promoter was set at 1 and relative promoter activity was calculated relative to the control relative promoter activity. Data represents the average value of 4 technical replicates plus standard deviation. The p-values are as follow: **** p ≤ 0.0001. Graph is representative examples of 3 individual experiments in SW1353 cells. Next, we transfected SW1353 cells with WT RMRP promoter construct as well as the four different mutated RMRP promoter constructs. -1500 mutated RMRP promoter showed no alterations in promoter activity except the -22_-10dup. This mutation showed a significant increase in promoter activity as compared to WT RMRP promoter (Figure 55 A).

A -1 5 0 0 R M R P p r o m o te r B -2 0 0 R M R P p r o m o te r

2 .0 1 .5

y *

t

i y

* * v

i

t

i

t v

c 1 .5

i a

t *

c

r

a

e

1 .0 t

r

o

e

t m

o 1 .0

o

r

m

p

o

r

e

p

v

i e 0 .5 t

v 0 .5

a

i

l

t

e

a

r

l

e r

0 .0 0 .0 r p p p p te u u u u o d d d d r p p p p 5 0 4 8 e u u u u m 1 1 1 - t o - - - _ o d d d d r _ _ _ 5 5 0 4 8 3 2 0 m 1 1 1 - p -1 o - - - _ 2 2 2 r _ _ _ 5 T - - - p 3 2 0 1 W 2 2 2 - T - - - W

Figure 55: The -200 mutated RMRP promoter shows increased promoter activity. The -1500 -22_-10dup RMRP promoter mutation results in significantly increased promoter activity as compared to the -1500 WT RMRP promoter (A). Significantly higher promoter activity in the -200 mutated RMRP promoter as compared to the -200 WT RMRP promoter (B). SW1353 cells were used in these experiments. Bioluminescence was normalized to Gaussia luciferase signals. Normalized relative promoter activity of WT RMRP promoter was set at 1 and relative promoter activity was calculated relative to the 85 4 Results corresponding WT RMRP promoter. Data represents the average value of 4 technical replicates plus standard deviation. The p-values are as follow: * p ≤ 0.05, ** p ≤ 0.01 (A, B). Presented graphs are representative examples of 3 individual experiments in SW1353 cells. When we used the -200 RMRP promoter constructs, all promoter mutations resulted in increased promoter activity as compared to WT RMRP promoter (Figure 55 B). In summary, we showed that mutations of the RMRP promoter do affect RMRP promoter activity depending on the cellular context.

4 . 7 RMRP expression is linked to H I F 1 A and h y p o x i a

In addition to the previously studied Wnt signalling pathway, hypoxia signalling also plays an important role during chondrogenesis and we decided to investigate the possible correlation between hypoxia and RMRP.

We used a well-known chemical inducer of HIF-1, named cobalt chloride (CoCl2) to induce hypoxia-like conditions (Piret et al., 2002; Wu and Yotnda, 2011). Successful induction of hypoxia-like conditions was determined by the increased HIF1A expression, a key components of the hypoxia signalling pathway (Figure 56 A, HeLa cells, and Figure 57 A, SW1353 cells) (Hu et al., 2016). RMRP RNA expression was increased under hypoxia-like conditions in HeLa cells (Figure 56 B).

B R M R P A 4 .0

3 .5

n o

i 3 .0

s

s e

r 2 .5

p x

e 2 .0

(132 kDa) e

HIF1A v i

t 1 .5

a

l e

r 1 .0

0 .5 (42 kDa) ACTB 0 .0 N o r m o x ia H y p o x ia -lik e

Figure 56: RMRP RNA expression is increased under hypoxia-like conditions.

HeLa cells were treated with 100 µM CoCl2 to induce a hypoxia-like condition. The hypoxia signalling pathway is successfully induced (A). The expression of RMRP RNA is increased under hypoxia-like conditions (B). Actin Beta (ACTB) was used as loading control in immunoblotting (A). Gene expression data was normalized to RPL13 and HPRT1 mRNA levels and data is presented as relative expression relative to the corresponding control condition. Values represent the average value of 4 technical replicates plus standard deviation (B). Presented graphs are representative examples of at least three independent experiments. 86 4.7 RMRP expression is linked to HIF1A and hypoxia

This increase in RMRP RNA expression could not be detected when hypoxia-like conditions were induced in human chondrogenic SW1353 cells (Figure 57 B).

B R M R P

1 .5 n

A o

i

s s

e 1 .0

r

p

x

e

e

v i t 0 .5

HIF1A (132 kDa) a

l

e r

0 .0 ACTB (42 kDa) N o r m o x ia H y p o x ia -lik e

Figure 57: No increase of RMRP RNA under hypoxia-like conditions in SW1353. HIF1A expression is induced (A) but no increase in RMRP RNA expression is detected when SW1353 cells were stimulated with 100 µM CoCl2 (B). Actin Beta (ACTB) was used as loading control in immunoblotting (A). Gene expression data was normalized to RPL13 and HPRT1 mRNA levels and data is presented as relative expression relative to the corresponding control condition. Values represent the average value of 4 technical replicates plus standard deviation (B). Presented graphs are representative examples of at least three independent experiments. We also tested MCT cells during proliferation and differentiation towards hypertrophic chondrocytes under normoxia as well as hypoxia-like conditions and found that Rmrp RNA expression was not significantly changed in proliferating (Figure 58 A) and differentiating (Figure 58 B).

A R m r p B R m r p 2 .0

1 .5

n

n

o i

1 .5 o

i

s

s

s

s e

e 1 .0

r

r

p

p x

1 .0 x

e

e

e

e

v

v

i

i

t t

a 0 .5

a

l l

e 0 .5

e

r r

0 .0 0 .0 N o rm o x ia H y p o x ia -lik e N o rm o x ia H y p o x ia -lik e

Figure 58: Rmrp RNA expression is increased under hypoxia-like conditions. Induction of hypoxia-like conditions resulted in increased Rmrp RNA expression during proliferation (A) and differentiation (B) of MCT cells. Gene expression data was normalized to β-actin and Gapdh mRNA levels and data is presented as relative expression relative to normoxia controls. Values represent the average value of 4 technical replicates plus standard deviation (A, B). Presented graphs are representative examples of at least three independent experiments. We investigate a possible temporal overlap of the expression of Rmrp RNA and HIF1A using ATDC5 cells. HIF1A showed highest expression at day 7 and day 8 of differentiation (Figure 87 4 Results

59 A) while Rmrp RNA expression was highly up-regulated on day 6 of differentiation (Figure 59 B).

AA 0 1 2 3 4 5 6 7 8 10 11 12 13 14 days of differentiation HIF1A (132kDa )

ACTB (42 kDa)

B R m r p 7 .0 * * * *

n 6 .0 o

i * * * * s

s 5 .0 e

r * * * p

x 4 .0 * *

e

e * v

i 3 .0

t

a l

e 2 .0 r

1 .0 * * 0 .0 0 1 2 3 4 5 6 7 8 1 0 1 1 1 2 1 3 1 4 d a y s o f d iffe r e n tia tio n Figure 59: Rmrp RNA and HIF1A expression is up-regulated in similar stages of chondrogenic differentiation. ATDC5 cells were differentiated for 14 days towards a chondrogenic phenotype and expression of HIF1A and Rmrp RNA were analyzed on each day of differentiation. HIF1A protein levels increase during differentiation and show highest levels at day 7 and day 8 of differentiation (A). Rmrp RNA expression was determined via qPCR and is highly increased at day 6, followed by a significant drop at day 7 and is highly increased again from day 11 on (B). Actin Beta (ACTB) was used as loading control in immunoblotting (A). Gene expression data was normalized to β-actin and Gapdh mRNA levels and data is presented as relative expression relative to d0. Values represent the average value of 4 technical replicates plus standard deviation. The p-values are indicated as follow: * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001, **** p ≤ 0.0001 (B). Presented blots/graph are representative examples of at least three independent experiments. Due to the increase in HIF1A expression shortly after the induction of Rmrp RNA, we hypothesized that Rmrp RNA expression and hypoxia signalling pathway are linked. To further address this hypothesis, we checked in our complete RNA-seq data if HIF1A or other components of the hypoxia machinery show altered expression in CHH patients (Figure 60 A - C).

A H IF 1 A B A R N T

4 .0 2 .0 * *

* * * e

3 .0 e 1 .5 * *

g

g n

H e a lth y (N = 4 ) n H e a lth y (N = 4 )

a

a h C H H (N = 4 ) h C H H (N = 4 )

c 2 .0

c 1 .0

d

d

l

l

o

o f 1 .0 f 0 .5

0 .0 0 .0 0 1 3 0 1 3 d a y s o f d iffe r e n tia tio n d a y s o f d iffe r e n tia tio n

88 4.7 RMRP expression is linked to HIF1A and hypoxia

C V E G F A

5 .0 * * * *

4 .0

e g

n H e a lth y (N = 4 )

a 3 .0

h C H H (N = 4 ) c

*

d 2 .0

l

o f 1 .0

0 .0 0 1 3 d a y s o f d iffe r e n tia tio n

Figure 60: Components of the hypoxia signalling pathway are up-regulated in CHH patients during chondrogenic differentiation. HIF1A (A), ARNT (B) and VEGFA (C) are significantly up-regulated in CHH patients during chondrogenic differentiation as compared to healthy controls. RNA-seq data is presented as fold change relative to healthy controls (N=4). Values represent the average value of 4 biological and 4 technical replicates. The p-values are indicated as follow (significance of CHH patients against healthy controls for each day of differentiation): * p ≤ 0.05; ** p ≤ 0.01, *** p ≤ 0.001; **** p ≤ 0.0001 (A – C). HIF1A was significantly up-regulated in CHH patients on day 1 of transdifferentiation as compared to healthy controls (Figure 60 A) and expression of ARNT and VEGFA was significantly increased on day 1 and day 3 of transdifferentiation as compared to healthy controls (Figure 60 B, C). This data indicates that RMRP RNA may regulate components of the hypoxia signalling pathway. We also wanted to investigate the effects of hypoxia on mutated RMRP promoter as this is a common condition in CHH patients. Transcription factor binding site analysis revealed that the consensus sequence of HIF-1α/ARNT (and X-box binding protein 1) binding site can be found within the RMRP promoter sequence (Figure 61).

Figure 61: A putative HIF-1α/ARNT (and X-box binding protein 1) binding site is located within the RMRP promoter sequence. The red box indicates the RMRP transcript (+1 to +267). Putative promoter elements are shown: TATA box in green, PSE element in grey, octamer in blue and SP1 binding element in purple. The distances and length of each element are indicated below. The black box enlarges the sequence of the RMRP promoter containing the putative HIF-1α/ARNT (and X-box binding protein 1). Underlined in the enlargement is the consensus sequence of the putative HIF-1α/ARNT (and X-box binding protein 1) This potential HIF-1α/ARNT (and X-box binding protein 1) binding site is duplicated in known RMRP promoter mutations (Table 14).

89 4 Results

Table 14: The HIF1A/ARNT binding site is duplicated in many CHH patients with RMRP promoter mutations. Some CHH patients show mutations within the RMRP promoter. Closer analysis of these RMRP promoter mutations revealed that the HIF1A/ARNT binding site ACGTG (underlined) is duplicated.

-28_-1dupAATACTACTCTGTGAAGCTGAGGACGTG

-24_+2dupCTACTCTGTGAAGCTGAGGACGTGGT (hetero)

-21_-1dupCTCTGTGAAGCTGAGGACGTG

-21_+2dupCTCTGTGAAGCTGAGGACGTGGT (hetero)

-15_2dupGAAGCTGAGGACGTGGT

-14_-1dupAAGCTGAGGACGTG

-8_-1dupAGGACGTG

-5_-4insGGACGTGGTT

To investigate the effect of the duplicated HIF-1α/ARNT (and X-box binding protein 1) binding site, promoter activity studies can be performed using either WT RMRP promoter constructs or RMRP promoter constructs carrying one of the duplicated promoter sequence listed in Table 14.

90 5.1 Newly found mutations in RMRP are pathogenic

5 DISCUSSION

5 . 1 N e w l y found mutations in RMRP are p a t h o g e n i c

CHH is a rare skeletal dysplasia, which is caused by mutation in the RMRP gene. During this study, we were introduced to a 5-year old girl with disproportional dwarfism and a slight delay in motor development. Radiographs showed metaphyseal changes comparable to those found in CHH patients (Figure 10). We analysed the blood of the patient as well as the parents’ blood for RMRP mutations and found two homozygous mutations within the RMRP gene (RMRPn.128C>G (homo); n.145C>A (homo)) in the patient (Figure 11 A, upper panel). These mutations were found to be heterozygous in the parents (Figure 11 A, second and third panel). This inheritance pattern corresponds to that of CHH, indicating that these mutations could be pathogenic. Closer investigations of the surrounding area of the two novel mutations revealed that both mutations are located in the immediate vicinity of already known mutations. We hypothesized that these regions could be possible hot spots for RMRP mutations but to proof this hypothesis, more patients carrying the novel mutations have to be found and statistical analysis of the incidence of these mutations has to be performed. We isolated total RNA and compared the RMRP RNA expression of our patient with the RMRP RNA expression of healthy controls (N=2) and a CHH patient carrying the most common CHH-causing mutation RMRPn.70A>G (homo) (Figure 12). QPCR and Northern blot results showed that RMRP RNA expression was significantly decreased in the patient with RMRPn.128C>G (homo); n.145C>A (homo) mutations as compared to healthy controls (Figure 12 A, left white bar and Figure 12 B, left band). The decrease was comparable to the decrease found in the CHH patient with the RMRPn.70A>G (homo) mutation (Figure 12 A, right white bar and Figure 12 B, second band). As one of our newly found mutations is located within the POP1 binding sequence of RMRP, we hypothesized that this mutation results in aberrant complex formation and therefore impair complex activity. In a preliminary experiment, we measured the relative expression of the components of the RNase MRP complex and the unprocessed pre-5.8S rRNA as well as the mature 5.8S rRNA to determine the impact of the mutated alleles on the functional integrity and activity of the RNase MRP complex. We detected no significant changes in the expression of other components of the RNase MRP complex than RMRP RNA (data not shown) but showed an accumulation of pre-5.8S rRNA in our patient as compared to healthy controls (N=2) (Figure 13

91 5 Discussion

A), demonstrating that the activity of the RNase MRP complex could be impaired in our patient carrying RMRPn.128C>G (homo); n.145C>A (homo) mutations. The accumulation of pre-5.8S rRNA was also found in the CHH patient carrying the RMRPn.70A>G (homo) mutation. Due to the fact that both RMRPn.128C>G (homo); n.145C>A (homo) mutation and RMRPn.70A>G (homo) mutation result in impaired RNase MRP activity, the hypothesis that the newly found mutation within the POP1 binding site is responsible for the decreased activity could not be confirmed as the RMRPn.70A>G (homo) mutation is not located within the POP1 binding site. However, the similarity in impairments of both patients once again indicates the pathogenicity of the newly found RMRPn.128C>G (homo); n.145C>A (homo) mutations. These findings should be taken into consideration when patients are screened for possible CHH-causing mutations.

5 . 2 Expression of RMRP is essential for hypertrophic differentiation

Although many different functions of both the RMRP RNA itself and the RNase MRP complex are known (chapter 1.4), the exact pathomechanism of CHH remains unclear. Based on the most prominent symptom in CHH, dwarfism, we hypothesized that RMRP RNA could play a major role in chondrogenesis and bone development. Several groups generated Rmrp knockout/in mice (Nakashima et al. 2007, Rosenbluh et al., 2011, Reicherter, 2013, Huang et al. 2015, 2016) and although all of these studies showed that Rmrp RNA expression is essential for the embryonic development, the major problem of almost every study was the high lethality of mice upon Rmrp mutations. A possible reason for this effect could be the genomic localisation of Rmrp, which partially overlaps with the first exon of Ccdc107 transcript 4 (Figure 16). In our study, we targeted a small region of the Rmrp promoter, which does not overlap with the first exon of Ccdc107 (Figure 17). We generated an RmrpΔ-290_-18 promoter reporter vector and showed that this promoter mutation resulted in decreased promoter activity (Figure 18 and Figure 19), indicating that Rmrp RNA expression is down-regulated rather than abolished. CHH patients also show a significant decrease in RMRP RNA levels but no complete lack of RMRP RNA. We used CRISPR/Cas9 technology to generate a mouse with this Rmrp promoter mutation. The analysis of the generated RmrpΔ-290_-18 mouse model was not possible since the mouse model was not ready until the end of this thesis but we planned to do several analyses: we wanted to check the size of the mice to see if the mice show dwarfism/aberrant growth; examine the physical condition of the mice; check for alterations in the

92 5.2 Expression of RMRP is essential for hypertrophic differentiation growth plate as well as isolate mouse embryonal fibroblasts (MEFs) for cell culture experiments. Some CHH patients show a combination of RMRP promoter mutations and mutations within the RMRP exon. To mimic this kind of CHH situation, we planned to cross the RmrpΔ-290_-18 mouse model with the n.70A>G (het) knock in mouse, which is ready at hand. We also generated a zebrafish model by using different methods: TALEN (Transcription activator-like effector nucleases) technique as well as morpholinos. We generated an RNase_MRP specific TALEN construct and injected fertilized zebrafish eggs at the 1-cell stadium. A control TALEN (kindly gift of Theresa Schredelseker, Institute for Biology I, Freiburg) was used to exclude errors during the injection, e.g. too large injection volume or too high concentration of the TALEN RNA. While injection of the control TALEN resulted in the desired effect, several attempts with the RNase_MRP TALEN resulted in high lethality. To check whether this lethality is due to a high toxicity of the RNase_MRP construct or a distinct phenotype because of a lack of RNase_MRP in the developing zebrafish, we tried to generate a second RNase_MRP specific TALEN. This attempt failed and we decided to use morpholino oligomers to knockdown RNase_MRP. The injection of different types and concentrations of morpholinos resulted in efficient RNase_MRP RNA knockdown and injection of RMRP P3 morpholino was less lethal than injection of RMRP S1 morpholino (Figure 27). The fact that we did not detect differences in body length (Figure 29) or in bone/cartilage development (Figure 28) could be the result of a previous described side effect of morpholinos: knockdown of the gene of interest can be compensated by the increased expression of other genes (Rossi et al., 2015). Gene expression analysis after RNase_MRP RNA knockdown has to be done to check if other genes are increased in expression and would confirm this side effect. Another explanation could be that our time point of analysis is too early to see differences in body length and/or bone/cartilage development. An analysis at later stages of the zebrafish development should be done to exclude or confirm this possibility. Rescue experiments are used to examine the specificity of the morpholino oligomers (Eisen and Smith, 2008). Depending on the morpholino type, rescuing RNA can be either wild-type form (splice morpholino) or a mutated RNA, which won’t be recognized by the morpholino any more (translation block morpholino). In our case, we could not insert mutations due to the fact that we do not know if these mutations change the structural form or activity of RNase_MRP RNA. We injected wild-type RNase_MRP RNA but could not rescue the decreased RNase_MRP RNA expression (Figure 30). A reason for this could be that we generated capped RNA and this artificial RNA differs from the endogenous RNase_MRP RNA and is not working in the same way. Our next step would be injection of lower morpholino concentrations (0.25 ng and 0.125 ng) until the RNase_MRP RNA expression is not affected by injection of the Std Ctrl.

93 5 Discussion

We also planned to use a more endogenous RNase_MRP-like RNA for a repeat of the rescue experiments. Although animal models are a very good approach to investigate the role and function of different genes, in vitro experiments can also be useful therein. We used two different murine cell lines, named ATDC5 and MCT cells, to analyse the expression profile of RMRP RNA during differentiation towards a chondrocytic phenotype. We demonstrated that Rmrp RNA expression is significantly increased at day 1.5 of hypertrophic differentiation in MCT cells, indicating a possible role for RMRP RNA in hypertrophic differentiation (Figure 35). We confirmed the up- regulation of Rmrp RNA during hypertrophic differentiation using ATDC5 cells. Here, we detected a significant increase in Rmrp RNA expression at day 6 and also at later days of hypertrophic differentiation (Figure 36). Next, we used human dermal fibroblasts of healthy controls (N = 3) in a chondrogenic transdifferentiation experiment and analysed RMRP RNA expression at different time points. We detected a highly significant fold induction in RMRP RNA expression within 1 day of transdifferentiation (Figure 37). These results emphasize the essential role of RMRP RNA for chondrocyte development. In a further experiment, we compared human dermal fibroblasts of 4 CHH patients to human dermal fibroblasts of 4 healthy controls using RNA-seq technology and demonstrated that CHH patients showed significant alterations in chondrogenesis-related genes (Figure 38). Markers for hypertrophic chondrocytes (COL10A1, RUNX2, Figure 38 A and B) are strongly down-regulated in CHH patients as compared to healthy controls while markers for proliferating chondrocytes (SOX9, ACAN) are up-regulated (Figure 38 C and D). Interestingly, BEST1 (Bestrophin 1) was highly up-regulated in CHH patients during hypertrophic differentiation as compared to healthy controls. Masuda and Esumi described SOX9 to be the key regulator of BEST1 expression and up-regulation of its expression seems to be a consequence of the increase in SOX9 expression (Masuda and Esumi, 2010). Metaphyseal chondrodysplasia, Schmid type (MCDS; OMIM #156500) is caused by mutations in COL10A1, a key product of hypertrophic chondrocytes (Linsenmayer et al., 1991). MCDS is characterized by short stature, bowing of the long bones and also alterations in the growth plates (Mäkitie et al., 2005). The similarity of MCDS and CHH may indicate that RMRP RNA has similar functions as COL10A1 and the increased RMRP RNA expression during hypertrophic differentiation further indicates that the RMRP RNA could be an important regulator of hypertrophic differentiation. This hypothesis is supported by our data, which showed that CHH patients have impaired hypertrophic differentiation potential.

94 5.3 Important signalling pathways are linked to RMRP expression

A possible reason for the impaired hypertrophic differentiation potential could be altered RNase MRP complex activity. New possibilities to investigate the role of RNase MRP are the recently described mutations in POP1 (Glazov et al., 2011; Elalaoui et al., 2016). When using mutations in POP1 for the investigation of the role of the RNase MRP complex, it should always be taken into considerations that POP1 is not only part of the RNase MRP complex but also part of the RNase P complex. Therefore pathological issues can also be a result of altered RNase P complex formation. We also wanted to get more insight into the pathomechanism of promoter mutations and searched for common features in all known RMRP promoter mutations. For the first time, we showed that in most cases, at least one out of two specific consensus sequences, TCTGTG and AAGC, is/are duplicated in CHH patients (Table 12). All mutations enlarge the region between TATA box and start of transcription, so we hypothesized that duplications may have an effect on promoter activity and/or may elongate RMRP transcripts. Elongation of the RMRP transcript in turn could result in aberrant transcript stability. We used four different versions of duplication containing either one or both of the consensus sequences and investigated the effect of these mutations on RMRP promoter activity. While RMRP promoter activity was significantly reduced in HeLa cells using plasmids with TCTGTG-mutations (Figure 53), promoter activity of all mutated RMRP promoter were increased in SW1353 cell (Figure 55 B). The contradictory results could be explained by the origin of the used cell lines. HeLa cells derived from cervical cancer; SW1353 cells are a chondrosarcoma cell line. The fact that RMRP RNA is differentially regulated in non-chondrogenic cells than in chondorgenic cells is another hint for the hypothesized role of RMRP RNA during hypertrophic differentiation of chondrocytes. To test whether RMRP promoter mutations result in increased RMRP transcript length or not, total RNA can be isolated from healthy controls as well as CHH patients carrying promoter mutations and could be analysed using Northern blot. RNA stability can be investigated according to experiments performed by Nakashima and colleagues (Nakashima et al., 2007).

5 . 3 I m p o r t a n t s i g n a l ling pathways are linked to RMRP expression

We compared human dermal fibroblasts of 4 healthy controls and 4 CHH patients during a chondrogenic-like transdifferentiation model followed by RNA-seq analysis to identify alterations in signalling pathways in CHH patients, which can be the reason for the broad range of CHH

95 5 Discussion symptoms. The expression of 29 genes was significantly changed in CHH fibroblasts as compared to healthy controls (Table 11, also see Appendix 1 for more detailed information). We focused on genes that are involved in endochondral ossification and found out that WNT9A is significantly down-regulated in CHH patients during hypertrophic differentiation (Figure 45). WNT9A is part of the Wnt signalling pathway and is known to inhibit the expression of Sox9 and Col2a1 mRNA, two key regulators of stable chondrocytes (Dong et al., 2006). We knocked down Rmrp RNA expression in differentiating ATDC5 cells and checked for Wnt9a mRNA levels to confirm the link between Rmrp RNA and Wnt9a (Figure 47). Our data demonstrates that Rmrp RNA expression influences the expression of Wnt9a mRNA. ß-Catenin, a downstream target of WNT9A, was shown to enhance the expression of RMRP RNA (Park and Jeong, 2015). We analysed the expression of Rmrp RNA, CTNNB1 and WNT9A at different stages of hypertrophic differentiation. The temporally very close expression of Rmrp RNA and CTNNB1 respectively WNT9A, illustrates the relationship between Rmrp and activated Wnt signalling (Figure 41 and Figure 46). To further investigate the effect of Ctnnb1 or Wnt9a on Rmrp RNA expression, both Ctnnb1 and Wnt9a were over expressed in ATDC5 cells, resulting in increased Rmrp RNA levels specifically during differentiation (Figure 43 and Figure 48). These results indicate that Rmrp RNA expression is linked to components of the Wnt signalling pathway and we hypothesized that Rmrp RNA expression will be decreased in the absence of Wnt9a. We knocked down Wnt9a in ATDC5 and MCT cells during proliferation as well as hypertrophic differentiation and checked for Rmrp RNA expression. Altered Rmrp RNA levels were measured only during differentiation (Figure 49 and Figure 50). Together with the report of Park and Jeong (Park and Jeong, 2015), our data clearly validates the hypothesis of a link between Rmrp RNA expression and Wnt signalling and offers new ideas for further research. We cannot miss to mention that we also found RDH10 (Retinol Dehydrogenase 10 (All-Trans)) to be up-regulated in CHH patients in our RNA-seq data. A link between Rdh10 and Wnt signalling was published in 2016 (Bonney et al., 2016). Therefore, up-regulation of RDH10 should enhance Wnt signalling by decreased expression of Wnt inhibitors but in CHH patients, downstream components of this signalling pathway are down-regulated. The context of these contradictory facts should be investigated in further experiments. Deleting the TCF/Lef1 binding site in the Rmrp promoter would also be a possible approach to further investigate the role of Wnt signalling for the expression of Rmrp RNA. Our RmrpΔ-290_-18 mouse model fulfils exactly this criterion and would therefore be optimal for this research approach. Another option can be the generation of a TCF/Lef mutated Rmrp promoter reporter which can be used for in vitro experiments.

96 5.3 Important signalling pathways are linked to RMRP expression

It is not surprising that we also found several transcription factor binding sites within the Rmrp promoter. One of these transcription factor-binding sites was the HIF-1α/ARNT binding site (ACGTG). Some CHH patients with promoter mutations show replicated putative HIF-1α/ARNT binding domains, indicating a potential correlation between RMRP RNA expression and hypoxia, which is already known to be important for hypertrophic differentiation (Schipani et al., 2001; Pfander et al., 2004; Murphy and Polak, 2004; Zelzer and Olsen, 2005; Amarilio et al., 2007; Lafont, 2010). We checked in our RNA-seq data for different hypoxia-related genes and found out that HIF1A is slightly decreased in CHH patients on day 0 as compared to healthy controls. Regarding later stages of hypertrophic differentiation, HIF1A as well as ARNT and VEGFA are up-regulated in CHH patients as compared to healthy controls (Figure 60). We hypothesised that RMRP could be a possible target gene of HIF1A during hypertrophic differentiation and investigated the expression profile of RMRP RNA and HIF1A in ATDC5 cells during differentiation towards a hypertrophic phenotype. The expression of Rmrp RNA was significantly increased at day 6 of hypertrophic differentiation while HIF1A levels increased upon day 3 with highest expression on days 7 and 8, followed by a decrease (Figure 59). To test whether the induction of hypoxia-like conditions enhances Rmrp RNA expression, we stimulated different cell types with 100 µM cobalt chloride (CoCl2) to simulate hypoxic conditions. In HeLa cells, RMRP RNA expression was increased upon induction of hypoxia-like conditions (Figure 56) whereas no difference in RMRP RNA expression was detected in human chondrogenic SW1353 cells (Figure 57). We also stimulated MCT cells with CoCl2 and compared normoxia and hypoxia-like conditions during proliferation and hypertrophic differentiation. Only a slight increase was detected in RMRP RNA expression in both proliferation and hypertrophic differentiation (Figure 58). These results do not clearly indicate a link between RMRP and hypoxia and further experiments including chromatin immunoprecipitation (ChIP) experiments should be performed. Also, promoter activity of WT RMRP promoter and mutated RMRP promoter could be determined using normoxia- and hypoxia- conditions. To avoid the possible side-effects of CoCl2, using a hypoxia-chamber or –incubator would be the best option. Our RNA-seq data also revealed other signalling pathways to be altered in CHH patients. Five out of 29 genes can be linked to cell cycle: SOD2 (Superoxide Dismutase 2, Mitochondrial), CEBPD (CCAAT/Enhancer Binding Protein Delta), NUPR1 (Nuclear Protein 1, Transcriptional Regulator), BTG1 (BTG Anti-Proliferation Factor 1) and DFNA5 (DFNA5, Deafness Associated Tumor Suppressor). All of them were up-regulated in CHH patients during hypertrophic differentiation (Table 11 and Appendix 1). Regulation of cell cycle is a critical part of

97 5 Discussion development and smallest differences can have major impact on cells (Coffman, 2004; Budirahardja and Gönczy, 2009; Kubiak, 2011). Our findings offer a potential pathomechanism of growth defects and carcinogenesis in CHH patients due to impaired cell cycle. Immunodeficiencies are a common symptom in CHH patients and several studies showed links between RMRP RNA and components of the immune system (Mattijssen et al., 2011; Huang et al., 2015, 2016; Huang and Littman, 2015). A closer look into our RNA-seq data revealed five possible genes related to the immune system: SOD2, ABCA1 (ATP Binding Cassette Subfamily A Member 1), SLC3A2 (Solute Carrier Family 3 Member 2) and AZI2 (5-Azacytidine Induced 2) are up-regulated in CHH patients during hypertrophic differentiation while IL16 is down-regulated (Table 11 and Appendix 1). The latter is particularly interesting as IL-16 is known to be a regulator of T cell growth and mutations in RMRP are known to have negative impact on T helper

17 (TH17) cell effector functions (Richmond et al., 2014; Huang et al., 2015, 2016; Huang and Littman, 2015). Our data is another proof of the link between RMRP RNA and immunity. In 2017, Hauck and colleagues postulated that the risk of malignancy in patients with CHH can rather be attributed to the intrinsic hematopoietic/myeloid cell defect based on ribosome pathology than to immunosurveillance in the strict sense (Hauck et al., 2017). Another interesting gene found to be differentially expressed in CHH patients during hypertrophic differentiation was SMURF2 (SMAD Specific E3 Ubiquitin Protein Ligase 2), which can be linked to immunity (Pan et al., 2014) as well as endochondral ossification (Wu et al., 2008). The link between RMRP and SMURF2 could be another starting point for further investigations.

98 Conclusion and final remarks

6 CONCLUSION AND FINAL REMARKS

In this study, we addressed three major questions 1. Can we generate an animal model for CHH using new techniques? 2. What role does RMRP RNA play in the development and elongation of bones? 3. Which signalling pathways are linked to RMRP? The high conservation of the RMRP sequence among different species allowed us to investigate the effect of an RMRP knockout or knockdown in an animal model. We figured out the possibility of a conditional knockout of Rmrp in mice but because of an overlap of the Rmrp gene with another gene, Ccdc107, it was not possible to knockout Rmrp without disturbing the reading frame of Ccdc107. The new technique CRISPR/Cas9 targets specific regions of the genome and knockout small parts of the desired gene. We identified a small region within the Rmrp promoter region with can be deleted without disturbing Ccdc107. An RmrpΔ-290_-18 mouse model was generated and will soon be ready for analysis. We also generated a knockdown of RNase_MRP in zebrafish using morpholino oligomers. Although we confirmed a knockdown of RNase_MRP RNA expression, we did not see a phenotype in these zebrafish. Unfortunately, both animal models are not ready to be used as an in vivo model for CHH but can be starting points for further investigations. Dwarfism and metaphyseal chondrodysplasia are main symptoms of CHH, indicating that RMRP RNA could play a major role during development and elongation of bones. By the use of different cell lines (MCT and ATDC5), we showed that Rmrp RNA is up-regulated during hypertrophic differentiation, indicating the important role of Rmrp RNA during bone development. We confirmed these data when we showed that RMRP RNA was also up-regulated during hypertrophic differentiation when patient-derived dermal fibroblasts were transdifferentiated towards a chondrocytic phenotype. CHH patients showed alteration in their chondrogenic differentiation potential. These results provide new knowledge about the role of RMRP RNA during development and clearly indicate that RMRP RNA is essential for hypertrophic differentiation and mutations in RMRP affect bone development. CHH patients not only suffer from altered bone development, they also show a great variety of different symptoms. We performed RNA-seq experiments to investigate signalling pathways that can be linked to RMRP. The expression of more than 12,000 RNAs in dermal fibroblasts of healthy individuals and CHH patients at different time points of chondrogenic transdifferentiation was determined. We found that CHH patients showed aberrant WNT9A expression, a component of the Wnt signalling pathway. Detailed investigations on the correlation between Wnt signaling 99 Conclusion and final remarks and RMRP RNA revealed that RMRP RNA expression is linked to the expression of WNT9A and vice versa. RMRP promoter studies revealed a TCF/Lef binding site within the RMRP promoter sequence. CTNNB1, another component of the Wnt signalling pathway which binds to TCF/Lef binding sites and acts downstream of WNT9A, can be linked to RMRP RNA expression. We hypothesized that increased WNT9A expression result in increased CTNNB1 expression, which in turn increases RMRP RNA expression. Then, RMRP RNA regulates its expression by a positive feedback loop and enhances the expression of WNT9A. Another important signalling pathway during bone development is the hypoxia pathway. We investigate the effect of hypoxia-like conditions on RMRP RNA expression. Only a slight increase in RMRP RNA expression was detected when cells were under hypoxia-like conditions as compared to normoxia conditions. However, analysis of the RNA expression of components of the hypoxia pathway showed increased expression of HIF1A, ARNT and VEGFA during hypertrophic transdifferentiation in CHH patients as compared to healthy individuals. RMRP promoter analysis also revealed a putative HIF1A/ARNT binding site and a duplication of this binding domain in RMRP promoter mutations found in CHH patients. Both the WNT signalling pathway and the hypoxia pathway are known to be important for the development of bones and defects in their regulation result in aberrant bone growth. Therefore, a link between these two pathways and RMRP seem to be very likely and our findings support this hypothesis. Figure 62 summarizes our obtained results on both pathways, how the expression of RMRP could regulate hypertrophic differentiation and provide possible starting points for further investigation of RMRP and the disease-causing mechanisms in CHH.

100 Conclusion and final remarks

RMRP

WNT9A HIF1A

Lef1 CTNNB1

IHH

RUNX2 SOX9

COL10A1 COL2A1 Aggrecan Hypertrophic chondrocytes Stable chondrocytes

activation activation (hypothesis) inhibition inhibition (hypothesis) modulation

Figure 62: Two signalling pathways can be linked to RMRP RNA expression The expression of WNT9A and HIF1A are enhanced by RMRP RNA and vice versa. Green lines indicate activation of the gene which was known before, dotted green lines indicate the hypothesized activation between the genes, red lines indicate previously known inhibition of the gene, dotted red lines indicate hypothesized inhibition and black lines indicate known modulation of genes.

10 1 References

7 REFERENCES

Amarilio, R., Viukov, S.V., Sharir, A., Eshkar-Oren, I., Johnson, R.S., and Zelzer, E. (2007). HIF1alpha regulation of Sox9 is necessary to maintain differentiation of hypoxic prechondrogenic cells during early skeletogenesis. Development (Cambridge, England) 134, 3917-3928.

Arnold, M.A., Kim, Y., Czubryt, M.P., Phan, D., McAnally, J., Qi, X., Shelton, J.M., Richardson, J.A., Bassel-Duby, R., and Olson, E.N. (2007). MEF2C transcription factor controls chondrocyte hypertrophy and bone development. Developmental Cell 12, 377-389.

Atsumi, T., Miwa, Y., Kimata, K., and Ikawa, Y. (1990). A chondrogenic cell line derived from a differentiating culture of AT805 teratocarcinoma cells. Cell differentiation and development : the official journal of the International Society of Developmental Biologists 30, 109-116.

Aubert, G., Strauss, K.A., Lansdorp, P.M., and Rider, N.L. (2017). Defects in lymphocyte telomere homeostasis contribute to cellular immune phenotype in patients with cartilage-hair hypoplasia. The Journal of allergy and clinical immunology 140, 1120-1229.

Aulds, J., Wierzbicki, S., McNairn, A., and Schmitt, M.E. (2012). Global identification of new substrates for the yeast endoribonuclease, RNase mitochondrial RNA processing (MRP). The Journal of biological chemistry 287, 37089-37097.

Baron, R., and Kneissel, M. (2013). WNT signaling in bone homeostasis and disease: from human mutations to treatments. Nature medicine 19, 179-192.

Behrens, J. (1998). Functional Interaction of an Axin Homolog, Conductin, with -Catenin, APC, and GSK3. Science 280, 596-599.

Behrens, J., Kries, J.P. von, Kuhl, M., Bruhn, L., Wedlich, D., Grosschedl, R., and Birchmeier, W. (1996). Functional interaction of beta-catenin with the transcription factor LEF-1. Nature 382, 638-642.

Bi, W., Deng, J.M., Yhang, Y., Behringer, R.R., De Crombrugghe, B. (1999). Sox9 is required for cartilage formation. Nature Genetics 22, 85-89.

Bill, B.R., Petzold, A.M., Clark, K.J., Schimmenti, L.A., and Ekker, S.C. (2009). A primer for morpholino use in zebrafish. Zebrafish 6, 69-77.

Bocca, G., Weemaes, C.M., van der Burgt, I., and and Otten, B.J. (2004). Growth hormone treatment in cartilage-hair hypoplasia: effects on growth and immune system. Journal of Pediatric Endocrinology and Metabolism 17, 47-54.

Bonafe, L., Cormier-Daire, V., Hall, C., Lachman, R., Mortier, G., Mundlos, S., Nishimura, G., Sangiorgi, L., Savarirayan, R., and Sillence, D., et al. (2015). Nosology and classification of genetic skeletal disorders: 2015 revision. American journal of medical genetics. Part A 167A, 2869-2892.

102 References

Bonafé, L., Dermitzakis, E.T., Unger, S., Greenberg, C.R., Campos-Xavier, B.A., Zankl, A., Ucla, C., Antonarakis, S.E., Superti-Furga, A., and Reymond, A. (2005). Evolutionary comparison provides evidence for pathogenicity of RMRP mutations. PLOS Genetics 1, e47.

Bonafé, L., Schmitt, K., Eich, G., Giedion, A., and Superti-Furga, A. (2002). RMRP gene sequence analysis confirms a cartilage-hair hypoplasia variant with only skeletal manifestations and reveals a high density of single-nucleotide polymorphisms. Clinical Genetics 61, 146-151.

Bonney, S., Harrison-Uy, S., Mishra, S., MacPherson, A.M., Choe, Y., Li, D., Jaminet, S.-C., Fruttiger, M., Pleasure, S.J., and Siegenthaler, J.A. (2016). Diverse Functions of Retinoic Acid in Brain Vascular Development. The Journal of neuroscience : the official journal of the Society for Neuroscience 36, 7786- 7801.

Bradford, M.M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72, 248-254.

Bruder, S.P., and Caplan, A.I. (2009). Cellular and Molecular Events During Embryonic Bone Development. Connective Tissue Research 20, 65-71.

Budirahardja, Y., and Gönczy, P. (2009). Coupling the cell cycle to development. Development (Cambridge, England) 136, 2861-2872.

Cadigan, K.M., and Nusse, R. (1997). Wnt signaling. A common theme in animal development. Genes & development 11, 3286-3305.

Cadigan, K.M., and Waterman, M.L. (2012). TCF/LEFs and Wnt signaling in the nucleus. Cold Spring Harbor perspectives in biology 4, a007906.

Chang, D.D., and Clayton, D.A. (1987). A novel endoribonuclease cleaves at a priming site of mouse mitochondrial DNA replication. The EMBO journal 6, 409-417.

Church, V. (2002). Wnt regulation of chondrocyte differentiation. Journal of Cell Science 115, 4809-4818.

Coffman, J.A. (2004). Cell Cycle Development. Developmental Cell 6, 321-327.

Cooper, K.L., Oh, S., Sung, Y., Dasari, R.R., Kirschner, M.W., and Tabin, C.J. (2013). Multiple phases of chondrocyte enlargement underlie differences in skeletal proportions. Nature 495, 375-378.

De, A. (2011). Wnt/Ca2+ signaling pathway: a brief overview. Acta biochimica et biophysica Sinica 43, 745-756.

Dong, Y.-F., Soung, D.Y., Schwarz, E.M., O'Keefe, R.J., and Drissi, H. (2006). Wnt induction of chondrocyte hypertrophy through the Runx2 transcription factor. Journal of Cellular Physiology 208, 77-86.

Dunwoodie, S.L. (2009). The role of hypoxia in development of the Mammalian embryo. Developmental Cell 17, 755-773.

103 References

Eisen, J.S., and Smith, J.C. (2008). Controlling morpholino experiments: don't stop making antisense. Development (Cambridge, England) 135, 1735-1743.

Eisner, J.M., and Russell, M. (2006). Cartilage hair hypoplasia and multiple basal cell carcinomas. Journal of the American Academy of Dermatology 54, S8-10.

Elalaoui, S.C., Laarabi, F.Z., Mansouri, M., Mrani, N.A., Nishimura, G., and Sefiani, A. (2016). Further evidence of POP1 mutations as the cause of anauxetic dysplasia. American journal of medical genetics. Part A 170, 2462-2465.

Esakova, O., Perederina, A., Quan, C., Berezin, I., and Krasilnikov, A.S. (2011). Substrate recognition by ribonucleoprotein ribonuclease MRP. RNA 17, 356-364.

Esakova, O., Perederina, A., Quan, C., Schmitt, M.E., and Krasilnikov, A.S. (2008). Footprinting analysis demonstrates extensive similarity between eukaryotic RNase P and RNase MRP holoenzymes. RNA 14, 1558-1567.

Fagerlund, R.D., Perederina, A., Berezin, I., and Krasilnikov, A.S. (2015). Footprinting analysis of interactions between the largest eukaryotic RNase P/MRP protein Pop1 and RNase P/MRP RNA components. RNA 21, 1591-1605.

Ferrara, N., Gerber, H.-P., and LeCouter, J. (2003). The biology of VEGF and its receptors. Nature medicine 9, 669-676.

French, M.M., Rose, S., Canseco, J., and Athanasiou, K.A. (2004). Chondrogenic differentiation of adult dermal fibroblasts. Annals of biomedical engineering 32, 50-56.

Gebauer, M., Saas, J., Sohler, F., Haag, J., Söder, S., Pieper, M., Bartnik, E., Beninga, J., Zimmer, R., and Aigner, T. (2005). Comparison of the chondrosarcoma cell line SW1353 with primary human adult articular chondrocytes with regard to their gene expression profile and reactivity to IL-1beta. Osteoarthritis and cartilage 13, 697-708.

Gerber, H.P., Vu, T.H., Ryan, A.M., Kowalski, J., Werb, Z., and Ferrara, N. (1999). VEGF couples hypertrophic cartilage remodeling, ossification and angiogenesis during endochondral bone formation. Nature medicine 5, 623-628.

Giaccia, A.J., Simon, M.C., and Johnson, R. (2004). The biology of hypoxia: the role of oxygen sensing in development, normal function, and disease. Genes & development 18, 2183-2194.

Giedion, A. (1998). Phalangeal cone-shaped epiphyses of the hand: their natural history, diagnostic sensitivity, and specificity in cartilage hair hypoplasia and the trichorhinophalangeal syndromes I and II. Pediatric radiology 28, 751-758.

Gilbert, S.F., and Barresi, M.J.F. (2016). Developmental biology (Sunderland Massachusetts: Sinauer Associates Inc).

104 References

Gill, T., Cai, T., Aulds, J., Wierzbicki, S., and Schmitt, M.E. (2004). RNase MRP Cleaves the CLB2 mRNA To Promote Cell Cycle Progression. Novel Method of mRNA Degradation. Molecular and cellular biology 24, 945-953.

Glazov, E.A., Zankl, A., Donskoi, M., Kenna, T.J., Thomas, G.P., Clark, G.R., Duncan, E.L., and Brown, M.A. (2011). Whole-exome re-sequencing in a family quartet identifies POP1 mutations as the cause of a novel skeletal dysplasia. PLOS Genetics 7, e1002027.

Goldfarb, K.C., and Cech, T.R. (2017). Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing. Genes & development 31, 59-71.

Gordon, M.D., and Nusse, R. (2006). Wnt signaling: multiple pathways, multiple receptors, and multiple transcription factors. The Journal of biological chemistry 281, 22429-22433.

Habas, R., Dawid, I.B., and He, X. (2003). Coactivation of Rac and Rho by Wnt/Frizzled signaling is required for vertebrate gastrulation. Genes & development 17, 295-309.

Habas, R., Kato, Y., and He, X. (2001). Wnt/Frizzled Activation of Rho Regulates Vertebrate Gastrulation and Requires a Novel Formin Homology Protein Daam1. Cell 107, 843-854.

Haigh, J.J., Gerber, H.P., Ferrara, N., and Wagner, E.F. (2000). Conditional inactivation of VEGF-A in areas of collagen2a1 expression results in embryonic lethality in the heterozygous state. Development 127, 1445- 1453.

Hatori, M., Klatte, K.J., Teixeira, C.C., and Shapiro, I.M. (1995). End labeling studies of fragmented DNA in the avian growth plate: evidence of apoptosis in terminally differentiated chondrocytes. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 10, 1960- 1968.

Hauck, F., Voss, R., Urban, C., and Seidel, M.G. (2017). Intrinsic and extrinsic causes of malignancies in patients with primary immunodeficiency disorders. The Journal of allergy and clinical immunology 17, 31027-31028.

Hay, E., Faucheu, C., Suc-Royer, I., Touitou, R., Stiot, V., Vayssiere, B., Baron, R., Roman-Roman, S., and Rawadi, G. (2005). Interaction between LRP5 and Frat1 mediates the activation of the Wnt canonical pathway. The Journal of biological chemistry 280, 13616-13623.

Hermanns, P., Bertuch, A.A., Bertin, T.K., Dawson, B., Schmitt, M.E., Shaw, C., Zabel, B., and Lee, B. (2005). Consequences of mutations in the non-coding RMRP RNA in cartilage-hair hypoplasia. Human molecular genetics 14, 3723-3740.

Hermanns, P., Tran, A., Munivez, E., Carter, S., Zabel, B., Lee, B., and Leroy, J.G. (2006). RMRP mutations in cartilage-hair hypoplasia. American journal of medical genetics. Part A 140, 2121-2130.

105 References

Horn, D., Rupprecht, E., Kunze, J., and Spranger, J. (2001). Anauxetic dysplasia, a spondylometaepiphyseal dysplasia with extreme dwarfism. Journal of Medical Genetics 38, 262-265.

Horn, J., Schlesier, M., Warnatz, K., Prasse, A., Superti-Furga, A., Peter, H.-H., and Salzer, U. (2010). Fatal adult-onset antibody deficiency syndrome in a patient with cartilage hair hypoplasia. Human immunology 71, 916-919.

Horton, W.A. and Hecht, J.T. (1993). The Chondrodysplasias. In: Royce PM, Steinmann B (eds) Connective tissue and its heritable disorders. Molecular, genetic, and medical aspects. Wiley-Loss, New York, 541-675.

Hu, J., Bernardini, A., and Fandrey, J. (2016). Optical Analysis of Hypoxia Inducible Factor (HIF)-1 Complex Assembly: Imaging of Cellular Oxygen Sensing. Advances in experimental medicine and biology 903, 247-258.

Huang, W., and Littman, D.R. (2015). Regulation of RORgammat in Inflammatory Lymphoid Cell Differentiation. Cold Spring Harbor symposia on quantitative biology 80, 257-263.

Huang, W., Thomas, B., Flynn, R.A., Gavzy, S.J., Wu, L., Kim, S.V., Hall, J.A., Miraldi, E.R., Ng, C.P., and Rigo, F., et al. (2015). DDX5 and its associated lncRNA Rmrp modulate TH17 cell effector functions. Nature 528, 517-522.

Huang, W., Thomas, B., Flynn, R.A., Gavzy, S.J., Wu, L., Kim, S.V., Hall, J.A., Miraldi, E.R., Ng, C.P., and Rigo, F., et al. (2016). Corrigendum: DDX5 and its associated lncRNA Rmrp modulate TH17 cell effector functions. Nature 533, 130.

Inada, M., Yasui, T., Nomura, S., Miyake, S., Deguchi, K., Himeno, M., Sato, M., Yamagiwa, H., Kimura, T., Yasui, N., Ochi, T., Endo, N., Kitamura, Y., Kishimoto, T., Komori, T. (1999). Maturational disturbance of chondrocytes in Cbfa1-deficient mice. Developmental Dynamics 214, 279–290.

Ip, W., Gaspar, H.B., Kleta, R., Chanudet, E., Bacchelli, C., Pitts, A., Nademi, Z., Davies, E.G., Slatter, M.A., and Amrolia, P., et al. (2015). Variable phenotype of severe immunodeficiencies associated with RMRP gene mutations. Journal of clinical immunology 35, 147-157.

Iqbal, M., Muhammad, N., Ali, S.A., Kostjukovits, S., Makitie, O., and Naz, S. (2016). The Finnish founder mutation c.70 A>G in RMRP causes cartilage-hair hypoplasia in a Pakistani family. Clinical dysmorphology 26, 121-123.

Jaag, H.M., Lu, Q., Schmitt, M.E., and Nagy, P.D. (2011). Role of RNase MRP in viral RNA degradation and RNA recombination. Journal of virology 85, 243-253.

Jacobson, M.R. (1995). Dynamic localization of RNase MRP RNA in the nucleolus observed by fluorescent RNA cytochemistry in living cells. The Journal of Cell Biology 131, 1649-1658.

106 References

Jochmann, K., Bachvarova, V., and Vortkamp, A. (2014). Reprint of: Heparan sulfate as a regulator of endochondral ossification and osteochondroma development. Matrix biology : journal of the International Society for Matrix Biology 35, 239-247.

Karaplis, A.C. (2008). Embryonic Development of Bone and Regulation of Intramembranous and Endochondral Bone Formation, Principles of Bone Biology (Third Edition), Chapter 3, Academic Press, 53– 84.

Karsenty, G (1999). The genetic transformation of bone biology. Genes & Development 13, 3037-3051.

Karsenty, G., and Wagner, E.F. (2002). Reaching a Genetic and Molecular Understanding of Skeletal Development. Developmental Cell 2, 389-406.

Kavadas, F.D., Giliani, S., Gu, Y., Mazzolari, E., Bates, A., Pegoiani, E., Roifman, C.M., and Notarangelo, L.D. (2008). Variability of clinical and laboratory features among patients with ribonuclease mitochondrial RNA processing endoribonuclease gene mutations. The Journal of allergy and clinical immunology 122, 1178-1184.

Keith, B., Johnson, R.S., and Simon, M.C. (2011). HIF1alpha and HIF2alpha: sibling rivalry in hypoxic tumour growth and progression. Nature reviews. Cancer 12, 9-22.

Kim, I.S., Otto, F., Zabel, B., Mundlos, S. (1999).. Regulation of chondrocyte differentiation by Cbfa1. Mechanisms of Development 80, 159–170.

Kim, J.H., Liu, X., Wang, J., Chen, X., Zhang, H., Kim, S.H., Cui, J., Li, R., Zhang, W., and Kong, Y., et al. (2013). Wnt signaling in bone formation and its therapeutic potential for bone diseases. Therapeutic advances in musculoskeletal disease 5, 13-31.

Kiss, T., Marshallsay, C., and Filipowicz, W. (1992). 7-2/MRP RNAs in plant and mammalian cells: association with higher order structures in the nucleolus. The EMBO journal 11, 3737-3746.

Kiss, T., and Filipowicz, W. (1992). Evidence against a mitochondrial location of the 7-2/MRP RNA in mammalian cells. Cell 70, 11-16.

Klemetti, P., Valta, H., Kostjukovits, S., Taskinen, M., Toiviainen-Salo, S., and Mäkitie, O. (2017). Cartilage-hair hypoplasia with normal height in childhood-4 patients with a unique genotype. Clinical Genetics 92, 204-207.

Kohn, A.D., and Moon, R.T. (2005). Wnt and calcium signaling: beta-catenin-independent pathways. Cell calcium 38, 439-446.

Komiya, Y., and Habas, R. (2008). Wnt signal transduction pathways. Organogenesis 4, 68-75.

Kostjukovits, S., Klemetti, P., Valta, H., Martelius, T., Notarangelo, L.D., Seppänen, M., Taskinen, M., and Mäkitie, O. (2017). Analysis of clinical and immunologic phenotype in a large cohort of children and adults with cartilage-hair hypoplasia. The Journal of allergy and clinical immunology 140, 612-614.e5.

107 References

Kraft, K., Geuer, S., Will, A.J., Chan, W.L., Paliou, C., Borschiwer, M., Harabula, I., Wittler, L., Franke, M., and Ibrahim, D.M., et al. (2015). Deletions, Inversions, Duplications: Engineering of Structural Variants using CRISPR/Cas in Mice. Cell Reports 10, 833-839.

Krakow, D., and Rimoin, D.L. (2010). The skeletal dysplasias. Genetics in medicine : official journal of the American College of Medical Genetics 12, 327-341.

Kubiak, J.Z. (2011). Cell cycle in development (New York: Springer).

Lafont, J.E. (2010). Lack of oxygen in articular cartilage: consequences for chondrocyte biology. International journal of experimental pathology 91, 99-106.

Lee, D.Y., and Clayton, D.A. (1997). RNase mitochondrial RNA processing correctly cleaves a novel R loop at the mitochondrial DNA leading-strand origin of replication. Genes & development 11, 582-592.

Lefebvre, V., and Smits, P. (2005). Transcriptional control of chondrocyte fate and differentiation. Birth defects research. Part C, Embryo today : reviews 75, 200-212.

Lefebvre V et al (1995). Type X Collagen Gene Expression in Mouse Chondrocytes Immortalized by a Temperature-Sensitive Simian Virus 40 Large Tumor Antigen. J. Cell Biol. 128, 239-245.

Li, L., Yuan, H., Xie, W., Mao, J., Caruso, A.M., McMahon, A., Sussman, D.J., and Wu, D. (1999). Dishevelled Proteins Lead to Two Signaling Pathways. J. Biol. Chem. 274, 129-134.

Li, X., Frank, D.N., Pace, N., Zengel, J.M., and Lindahl, L. (2002). Phylogenetic analysis of the structure of RNase MRP RNA in yeast. RNA 8, 740-751.

Lindahl, L., Bommankanti, A., Li, X., Hayden, L., Jones, A., Khan, M., Oni, T., and Zengel, J.M. (2009). RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway. RNA 15, 1407-1416.

Linsenmayer, T.F., Chen, Q., Gibney, E., Gordon, M.K., Marchant, J.K., Mayne, R., and Schmid, T.M. (1991). Collagen types IX and X in the developing chick tibiotarsus_analyses of mRNAs and proteins. Development (Cambridge, England), 191-196.

Liu, C., Li, Y., Semenov, M., Han, C., Baeg, G.-H., Tan, Y., Zhang, Z., Lin, X., and He, X. (2002). Control of β-Catenin Phosphorylation/Degradation by a Dual-Kinase Mechanism. Cell 108, 837-847.

Liu, F., Kohlmeier, S., and Wang, C.-Y. (2008). Wnt signaling and skeletal development. Cellular signalling 20, 999-1009.

Logan, C.Y., and Nusse, R. (2004). The Wnt signaling pathway in development and disease. Annual review of cell and developmental biology 20, 781-810.

Lupiáñez, D.G., Kraft, K., Heinrich, V., Krawitz, P., Brancati, F., Klopocki, E., Horn, D., Kayserili, H., Opitz, J.M., and Laxova, R., et al. (2015). Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell 161, 1012-1025. 108 References

Luo, G., D'Souza, R., Hogue, D., and Karsenty, G. (1995). The matrix Gla protein gene is a marker of the chondrogenesis cell lineage during mouse development. Journal of Bone and Mineral Research 10, 325-334.

Lygerou, Z., Allmang, C., Tollervey, D., and Seraphin, B. (1996). Accurate Processing of a Eukaryotic Precursor Ribosomal RNA by Ribonuclease MRP in Vitro. Science 272, 268-270.

Maes, C., Carmeliet, G., and Schipani, E. (2012). Hypoxia-driven pathways in bone development, regeneration and disease. Nature reviews. Rheumatology 8, 358-366.

Maida, Y., Yasukawa, M., Furuuchi, M., Lassmann, T., Possemato, R., Okamoto, N., Kasim, V., Hayashizaki, Y., Hahn, W.C., and Masutomi, K. (2009). An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. Nature 461, 230-235.

Makitie, O. (2001). Increased mortality in cartilage-hair hypoplasia. Archives of Disease in Childhood 84, 65-67.

Mäkitie, O. (1992). Cartilage-hair hypoplasia in Finland:epidemiological and genetic aspects of 107 patients. Journal of Medical Genetics 29, 652-655.

Mäkitie, O., and Kaitila, I. (1993). Cartilage-hair hypoplasia--clinical manifestations in 108 Finnish patients. European journal of pediatrics 152, 211-217.

Mäkitie, O., Pukkala, E., Teppo, L., and Kaitila, I. (1999). Increased incidence of cancer in patients with cartilage-hair hypoplasia. The Journal of Pediatrics 134, 315-318.

Mäkitie, O., Susic, M., Ward, L., Barclay, C., Glorieux, F.H., and Cole, W.G. (2005). Schmid type of metaphyseal chondrodysplasia and COL10A1 mutations--findings in 10 patients. American journal of medical genetics. Part A 137A, 241-248.

Manolagas, S.C., and Jilka, R.L. (1995). Bone marrow, cytokines, and bone remodeling. Emerging insights into the pathophysiology of osteoporosis. The New England journal of medicine 332, 305-311.

Marlow, F., Topczewski, J., Sepich, D., and Solnica-Krezel, L. (2002). Zebrafish Rho Kinase 2 Acts Downstream of Wnt11 to Mediate Cell Polarity and Effective Convergence and Extension Movements. Current Biology 12, 876-884.

Martin, A.N., and Li, Y. (2007). RNase MRP RNA and human genetic diseases. Cell Research 17, 219-226.

Masuda, T., and Esumi, N. (2010). SOX9, through interaction with microphthalmia-associated transcription factor (MITF) and OTX2, regulates BEST1 expression in the retinal pigment epithelium. The Journal of biological chemistry 285, 26933-26944.

Mattijssen, S., Hinson, E.R., Onnekink, C., Hermanns, P., Zabel, B., Cresswell, P., and Pruijn, G.J. (2011). Viperin mRNA is a novel target for the human RNase MRP/RNase P endoribonuclease.. Cellular and Molecular Life Sciences 68, 2469-2480.

109 References

Mattijssen, S., Welting, T.J.M., and Pruijn, G.J.M. (2010). RNase MRP and disease. Wiley interdisciplinary reviews. RNA 1, 102-116.

McKusick, V.A., Eldridge, R., Hostetler, J.A., Ruangwit, U., and Egeland, J.A. (1965). DWARFISM IN THE AMISH. II. CARTILAGE-HAIR HYPOPLASIA. Bulletin of the Johns Hopkins Hospital 116, 285- 326.

Monroe, D.G., McGee-Lawrence, M.E., Oursler, M.J., and Westendorf, J.J. (2012). Update on Wnt signaling in bone cell biology and bone disease. Gene 492, 1-18.

Mundlos, S. (1994). Expression patterns of matrix genes during human skeletal development. Gustav Fischer Verlag, Stuttgart. Vol 28, No. 3.

Murphy, C. L., and Polak, J. M. (2004). Control of human articular chondrocyte differentiation by reduced oxygen tension. Journal of Cellular Physiology 199, 451-459.

Nakashima, E., Tran, J.R., Welting, T.J.M., Pruijn, G.J.M., Hirose, Y., Nishimura, G., Ohashi, H., Schurman, S.H., Cheng, J., and Candotti, F., et al. (2007). Cartilage hair hypoplasia mutations that lead to RMRP promoter inefficiency or RNA transcript instability. American journal of medical genetics. Part A 143A, 2675-2681.

Nasevicius, A., and Ekker, S.C. (2000). Effective targeted gene 'knockdown' in zebrafish. Nature genetics 26, 216-220.

Ortega, N., Behonick, D.J., and Werb, Z. (2004). Matrix remodeling during endochondral ossification. Trends in Cell Biology 14, 86-93.

Pan, Q., Yu, Y., Chen, Q., Li, C., Wu, H., Wan, Y., Ma, J., and Sun, F. (2008). Sox9, a key transcription factor of bone morphogenetic protein-2-induced chondrogenesis, is activated through BMP pathway and a CCAAT box in the proximal promoter. Journal of Cellular Physiology 217, 228-241.

Pan, Y., Li, R., Meng, J.-L., Mao, H.-T., Zhang, Y., and Zhang, J. (2014). Smurf2 negatively modulates RIG-I-dependent antiviral response by targeting VISA/MAVS for ubiquitination and degradation. Journal of immunology (Baltimore, Md. : 1950) 192, 4758-4764.

Park, J., and Jeong, S. (2015). Wnt activated beta-catenin and YAP proteins enhance the expression of non- coding RNA component of RNase MRP in colon cancer cells. Oncotarget 6, 34658-34668.

Partridge, M., Vincent, A., Matthews, P., Puma, J., Stein, D., and Summerton, J. (1996). A simple method for delivering morpholino antisense oligos into the cytoplasm of cells. Antisense & nucleic acid drug development 6, 169-175.

Paule, M.R., and White, R.J. (2000). SURVEY AND SUMMARY Transcription by RNA polymerases I and III. Nucleic Acids Research 28, 1283-1298.

110 References

Pfander, D., Kobayashi, T., Knight, M.C., Zelzer, E., Chan, D.A., Olsen, B.R., Giaccia, A.J., Johnson, R.S., Haase, V.H., and Schipani, E. (2004). Deletion of Vhlh in chondrocytes reduces cell proliferation and increases matrix deposition during growth plate development. Development (Cambridge, England) 131, 2497-2508.

Piao, S., Lee, S.-H., Kim, H., Yum, S., Stamos, J.L., Xu, Y., Lee, S.-J., Lee, J., Oh, S., and Han, J.-K., et al. (2008). Direct inhibition of GSK3beta by the phosphorylated cytoplasmic domain of LRP6 in Wnt/beta- catenin signaling. PloS one 3, e4046.

Piret, J.-P., Mottet, D., Raes, M., and Michiels, C. (2002). CoCl 2 , a Chemical Inducer of Hypoxia- Inducible Factor-1, and Hypoxia Reduce Apoptotic Cell Death in Hepatoma Cell Line HepG2. Annals of the New York Academy of Sciences 973, 443-447.

Polmar, S.H., and Pierce, G.F. (1986). Cartilage hair hypoplasia. Immunological aspects and their clinical implications. Clinical Immunology and Immunopathology 40, 87-93.

Pugh, C.W., and Ratcliffe, P.J. (2003). The von Hippel–Lindau tumor suppressor, hypoxia-inducible factor- 1 (HIF-1) degradation, and cancer pathogenesis. Seminars in Cancer Biology 13, 83-89.

Rahbari, R., Sheahan, T., Modes, V., Collier, P., Macfarlane, C., and Badge, R.M. (2009). A novel L1 retrotransposon marker for HeLa cell line identification. BioTechniques 46, 277-284.

Rao, T.P., and Kuhl, M. (2010). An updated overview on Wnt signaling pathways: a prelude for more. Circulation research 106, 1798-1806.

Reicherter, K. (2013). Die Rolle von RMRP in Skelettentwicklung, Regulation der Proliferation und Krebsentstehung. https://www.freidok.uni-freiburg.de/data/8908.

Richmond, J., Tuzova, M., Cruikshank, W., and Center, D. (2014). Regulation of cellular processes by interleukin-16 in homeostasis and cancer. Journal of Cellular Physiology 229, 139-147.

Ridanpaa, M., Sistonen, P., Rockas, S., Rimoin, D.L., Makitie, O., and Kaitila, I. (2002). Worldwide mutation spectrum in cartilage-hair hypoplasia: ancient founder origin of the major70A--G mutation of the untranslated RMRP. European journal of human genetics : EJHG 10, 439-447.

Ridanpää, M., van Eenennaam, H., Pelin, K., Chadwick, R., Johnson, C., Yuan, B., vanVenrooij, W., Pruijn, G., Salmela, R., and Rockas, S., et al. (2001). Mutations in the RNA Component of RNase MRP Cause a Pleiotropic Human Disease, Cartilage-Hair Hypoplasia. Cell 104, 195-203.

Rider, N.L., Morton, D.H., Puffenberger, E., Hendrickson, C.L., Robinson, D.L., and Strauss, K.A. (2009). Immunologic and clinical features of 25 Amish patients with RMRP 70 A--G cartilage hair hypoplasia. Clinical immunology (Orlando, Fla.) 131, 119-128.

Roberts, M.A., and Arnold, R.M. (1984). Hodgkin's lymphoma in a child with cartilage-hair hypoplasia: case report. Military Medicine 149, 280-281.

111 References

Rogler, L.E., Kosmyna, B., Moskowitz, D., Bebawee, R., Rahimzadeh, J., Kutchko, K., Laederach, A., Notarangelo, L.D., Giliani, S., and Bouhassira, E., et al. (2014). Small RNAs derived from lncRNA RNase MRP have gene-silencing activity relevant to human cartilage-hair hypoplasia. Human molecular genetics 23, 368-382.

Roifman, C.M., Gu, Y., and Cohen, A. (2006). Mutations in the RNA component of RNase mitochondrial RNA processing might cause Omenn syndrome. The Journal of allergy and clinical immunology 117, 897- 903.

Rosenbluh, J., Nijhawan, D., Chen, Z., Wong, K.-K., Masutomi, K., and Hahn, W.C. (2011). RMRP is a non-coding RNA essential for early murine development. PloS one 6, e26270.

Rossi, A., Kontarakis, Z., Gerri, C., Nolte, H., Holper, S., Kruger, M., and Stainier, D.Y.R. (2015). Genetic compensation induced by deleterious mutations but not gene knockdowns. Nature 524, 230-233.

Sanger, F., and Coulson, A.R. (1975). A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. Journal of Molecular Biology 94, 441-448.

Sanger, F., Nicklen, S., and Coulson, A.R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences 74, 5463-5467.

Schipani, E., Ryan, H.E., Didrickson, S., Kobayashi, T., Knight, M., and Johnson, R.S. (2001). Hypoxia in cartilage: HIF-1alpha is essential for chondrocyte growth arrest and survival. Genes & development 15, 2865-2876.

Schramm, L., and Hernandez, N. (2002). Recruitment of RNA polymerase III to its target promoters. Genes & development 16, 2593-2620.

Shen, G. (2005). The role of type X collagen in facilitating and regulating endochondral ossification of articular cartilage. Orthodontics & Craniofacial Research 8, 11-7.Shukunami, C., Ishizeki, K., Atsumi, T., Ohta, Y., Suzuki, F., and Hiraki, Y. (1997). Cellular hypertrophy and calcification of embryonal carcinoma- derived chondrogenic cell line ATDC5 in vitro. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 12, 1174-1188.

Shukunami, C., Shigeno, C., Atsumi, T., Ishizeki, K., Suzuki, F., and Hiraki, Y. (1996). Chondrogenic differentiation of clonal mouse embryonic cell line ATDC5 in vitro: differentiation-dependent gene expression of parathyroid hormone (PTH)/PTH-related peptide receptor. Journal of Cell Biology 133, 457- 68.

Slusarski, D.C., and Pelegri, F. (2007). Calcium signaling in vertebrate embryonic patterning and morphogenesis. Developmental biology 307, 1-13.

Spranger, J.W., Brill, P.W., Nishimura, G., Superti-Furga, A., and Unger, S. (2012). Bone dysplasias. An atlas of genetic disorders of skeletal development (New York, Oxford: Oxford University Press).

112 References

Stein, D., Foster, E., Huang, S.B., Weller, D., and Summerton, J. (1997). A specificity comparison of four antisense types: morpholino, 2'-O-methyl RNA, DNA, and phosphorothioate DNA. Antisense & nucleic acid drug development 7, 151-157.

Steinbusch, M.M.F., Caron, M.M.J., Surtel, D.A.M., Friedrich, F., Lausch, E., Pruijn, G.J.M., Verhesen, W., Schroen, B.L.M., van Rhijn, L.W., and Zabel, B., et al. (2017). Expression of RMRP RNA is regulated in chondrocyte hypertrophy and determines chondrogenic differentiation. Scientific reports 7, 6440.

Sugimura, R., and Li, L. (2010). Noncanonical Wnt signaling in vertebrate development, stem cells, and diseases. Birth defects research. Part C, Embryo today : reviews 90, 243-256.

Sulisalo, T., Sistonen, P., Hastbacka, J., Wadelius, C., Makitie, O., La Chapelle, A. de, and Kaitila, I. (1993). Cartilage-hair hypoplasia gene assigned to chromosome 9 by linkage analysis. Nature genetics 3, 338-341.

Sulisalo, T., van der Burgt, I., Rimoin, D.L., Bonaventure, J., Sillence, D., Campbell, J.B., Chitayat, D., Scott, C.I., La Chapelle, A. de, and Sistonen, P., et al. (1995). Genetic homogeneity of cartilage-hair hypoplasia. Human Genetics 95, 157-160.

Summerton, J., Stein, D., Huang, S.B., Matthews, P., Weller, D., and Partridge, M. (1997). Morpholino and phosphorothioate antisense oligomers compared in cell-free and in-cell systems. Antisense & nucleic acid drug development 7, 63-70.

Summerton, J., and Weller, D. (1997). Morpholino antisense oligomers: design, preparation, and properties. Antisense & nucleic acid drug development 7, 187-195.

Takeda, S., Bonnamy, J.P., Owen, M.J., Ducy, P., Karsenty, G. (2001). Continuous expression of Cbfa1 in nonhypertrophic chondrocytes uncovers its ability to induce hypertrophic chondrocyte differentiation and partially rescues Cbfa1-deficient mice. Genes & Development 15, 467–481.

Tanegashima, K., Zhao, H., and Dawid, I.B. (2008). WGEF activates Rho in the Wnt-PCP pathway and controls convergent extension in Xenopus gastrulation. The EMBO journal 27, 606-617.

Tetsu, O., and McCormick, F. (1999). Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 398, 422-426.

Thiel, C.T., Horn, D., Zabel, B., Ekici, A.B., Salinas, K., Gebhart, E., Ruschendorf, F., Sticht, H., Spranger, J., and Muller, D., et al. (2005). Severely incapacitating mutations in patients with extreme short stature identify RNA-processing endoribonuclease RMRP as an essential cell growth regulator. American journal of human genetics 77, 795-806.

Thiel, C.T., Mortier, G., Kaitila, I., Reis, A., and Rauch, A. (2007). Type and level of RMRP functional impairment predicts phenotype in the cartilage hair hypoplasia-anauxetic dysplasia spectrum. American journal of human genetics 81, 519-529.

113 References

Thiel, C.T., and Rauch, A. (2011). The molecular basis of the cartilage-hair hypoplasia-anauxetic dysplasia spectrum. Best practice & research. Clinical endocrinology & metabolism 25, 131-142.

Ueta, C., Iwamoto, M., Kanatani, N., Yoshida, C., Liu, Y., Enomoto-Iwamoto, M., Ohmori, T., Enomoto, H., Nakata, K., Takada, K., Kurisu, K., Komori, T. (2001). Skeletal malformations caused by overexpression of Cbfa1 or its dominant negative form in chondrocytes. Journal of Cell Biology 153, 87– 100. van der Burgt, I., Haraldsson, A., Oosterwijk, J.C., van Essen, A.J., Weemaes, C., and Hamel, B. (1991). Cartilage hair hypoplasia, metaphyseal chondrodysplasia type McKusick: description of seven patients and review of the literature. American journal of medical genetics 41, 371-380.

Vatanavicharn, N., Visitsunthorn, N., Pho-iam, T., Jirapongsananuruk, O., Pacharn, P., Chokephaibulkit, K., Limwongse, C., and Wasant, P. (2010). An infant with cartilage-hair hypoplasia due to a novel homozygous mutation in the promoter region of the RMRP gene associated with chondrodysplasia and severe immunodeficiency. Journal of applied genetics 51, 523-528.

Wallingford, J.B., and Habas, R. (2005). The developmental biology of Dishevelled: an enigmatic protein governing cell fate and cell polarity. Development 132, 4421-4436.

Weiser, D.C., Pyati, U.J., and Kimelman, D. (2007). Gravin regulates mesodermal cell behavior changes required for axis elongation during zebrafish gastrulation. Genes & development 21, 1559-1571.

Welting, T.J.M., van Venrooij, W.J., and Pruijn, G.J.M. (2004). Mutual interactions between subunits of the human RNase MRP ribonucleoprotein complex. Nucleic Acids Research 32, 2138-2146.

Welting, T.J., Mattijssen, S., Peters, F.M., van Doorn, N.L., Dekkers, L., van Venrooij, W.J., Heus, H.A., Bonafé, L., and Pruijn, G.J. (2008). Cartilage-hair hypoplasia-associated mutations in the RNase MRP P3 domain affect RNA folding and ribonucleoprotein assembly. Biochimica et Biophysica Acta 1783, 455-466.

Willert, K., Brown, J.D., Danenberg, E., Duncan, A.W., Weissman, I.L., Reya, T., Yates, J.R.3., and Nusse, R. (2003). Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature 423, 448-452.

Woodhams, M.D., Stadler, P.F., Penny, D., and Collins, L.J. (2007). RNase MRP and the RNA processing cascade in the eukaryotic ancestor. BMC evolutionary biology 7 Suppl 1, S13.

Wu, D., and Yotnda, P. (2011). Induction and testing of hypoxia in cell culture. Journal of visualized experiments : JoVE.

Wu, Q., Wang, M., Zuscik, M.J., Di Chen, O'Keefe, R.J., and Rosier, R.N. (2008). Regulation of embryonic endochondral ossification by Smurf2. Journal of orthopaedic research : official publication of the Orthopaedic Research Society 26, 704-712.

Yang, Y. (2012). Wnt signaling in development and disease. Cell & bioscience 2, 14.

114 References

Yuan, Y., and Reddy, R. (1991). 5′ Flanking sequences of human MRP/7-2 RNA gene are required and sufficient for the transcription by RNA polymerase III. Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression 1089, 33-39.

Zabel, B., and Winterpacht, A. Osteochondrodysplasien Genetisch bedingte Störungen der Skelettentwicklung. In Handbuch der Molekularen Medizin, pp. 249–279.

Zelzer, E., and Olsen, B.R. (2005). Multiple Roles of Vascular Endothelial Growth Factor (VEGF) in Skeletal Development, Growth, and Repair. In Current Topics in Developmental Biology, G.P. Schatten, ed. (s.l.: Elsevier textbooks), pp. 169–187.

115 Publications & conference contributions

8 PUBLICATIONS & CONFERENCE CONTRIBUTIONS

Steinbusch MMF, Caron MMJ, Surtel DAM, Friedrich F, Lausch E, Pruijn GJM, Verhesen W, Schroen BLM, van Rhijn LW, Zabel B, Welting TJM (2017) “Expression of RMRP RNA is regulated in chondrocyte hypertrophy and determines chondrogenic differentiation” Published: Scientific reports (July 2017); DOI:10.1038/s41598-017-06809-5 Contribution: provision of study material, manuscript writing, final approval of the manuscript

Eckmann F, Steinbusch MMF, Welting TJM, Wehrle A, Salfelder A, Keppler R, Janocha N, Lausch E and Zabel B (2013) “Mutations in the RMRP promoter lead to increased promoter activity and changes in p21 expression“ Poster at the 3rd Heidelberg Forum for Young Life Scientists 2013 Contribution: conception and design, collection and assembly of data, data analysis and interpretation, layout and writing, final approval of the poster

Wehrle A, Lausch E, Keppler R, Salfelder A, Eckmann F, Janocha N, Zabel B (2013) “Altered cilium-regulated Wnt-siganling in GMAP-210 deficient cells” Poster at the 3rd Heidelberg Forum for Young Life Scientists 2013 Contribution: layout and writing; final approval of the poster

Eckmann F, Steinbusch MMF, Welting TJM, Wehrle A, Salfelder A, Keppler R, Janocha N, Lausch E and Zabel B (2013) “RMRP promoter mutation lead to increased promoter activity and Wnt- independent expression of RMRP and p21“ Poster at the 18th annual meeting of the RNA society 2013 Contribution: conception and design, collection and assembly of data, data analysis and interpretation, layout and writing, final approval of the poster

Steinbusch MMF, Caron MMJ, Eckmann F, Lausch E, Zabel B, Pruijn GJM, van Rhijn LW, Welting TJM (2013) “RNase MRP is involved in chondrogenic differentiation” Poster at the 18th annual meeting of the RNA society 2013

Wehrle A, Salfelder A, , Keppler R, VillavincencioLorini P, Eckmann F, Janocha N, Erlacher M, Schmidts M, Pazour GJ, Zabel B, Lausch E (2013) “Golgia or Cilia? The molecular pathogenesis of TRIP11-associated dieseases” Poster at the Keystone Symposium 2014 on Cilia, Development and Human Disease Contribution: layout and writing; final approval of the poster

116 Publications & conference contributions

Janocha N, Friedrich F, Wehrle A, Salfelder A, Keppler R, Lausch E (2014) “The role of modified fibroblast growth factor (FGF)-signaling in health and disease” Poster at the 3rd International Symposium ‘Protein Trafficking in Health and Disease’ 2014 Contribution: layout and writing; final approval of the poster

Wehrle A, Salfelder A, Friedrich F, Janocha N, Lausch E (2014) “From the Golgi to the ciliary membrane” Poster at the 3rd International Symposium ‘Protein Trafficking in Health and Disease’ 2014 Contribution: layout and writing; final approval of the poster

Salfelder A, Friedrich F, Wehrle A, Keppler R, Janocha N, VillavincencioLorini P, Pröls F, Scaal M, Lausch E (2014) “Membrane-bound O-Acyltransferases (MBOATs) are essential for secreted signalling proteins” Poster at the 3rd International Symposium ‘Protein Trafficking in Health and Disease’ 2014 Contribution: layout and writing; final approval of the poster

Janocha N, Schöller-Mann A, Wehrle A, Salfelder A, Friedrich F, Lausch E (2015) “Glycosylation-dependantsignalling in chondrogenesis” Poster at the Gordon Research Conference ‘Cartilage biology and pathology’ 2015 Contribution: layout and writing; final approval of the poster

Salfelder A, Wehrle A, VillavincencioLorini P, Keppler R, Janocha N, Friedrich F, Lausch E (2015) “A potential role of MBOAT1 in limb development and skeletal pathogenesis” Poster at the Gordon Research Conference ‘Cartilage biology and pathology’ 2015 Contribution: layout and writing; final approval of the poster

Friedrich F, Steinbusch MMF, Velasco A, Zabel B, Lausch E, Welting TJM (2015) “Mutations in RMRP result in increased HIF1A levels during chondrogenesis“ Poster at the 12th International Skeletal Dysplasia Society meeting 2015 Contribution: conception and design, collection and assembly of data, data analysis and interpretation, layout and writing, final approval of the poster

117 Acknowledgments

9 ACKNOWLEDGMENTS

118

10 APPENDICES

Appendix 1: List of all differentially expressed genes found in RNAseq data. During chondrogenic differentiation, 29 genes were differentially expressed in CHH patients as compared to healthy controls. All genes were listed below with their full name, expression compared to healthy controls, log fold change at analysed time points (t1 vs t0, t3 vs t0), known links to pathways/functions and a short comment (if possible). Unless otherwise indicated, information were obtained from Genecards.org.

Log fold change Gene Full name Expression link to … comment t1 vs. t0 t3 vs. t0 Dehydrogen- Catalyzes the reduction of all-trans-retinal to all-trans-retinol DHRS3 Up-regulated 2.72 4.22 - metabolism ase/Reductase 3 in the presence of NADPH

Superoxide - cell cycle anti-apoptotic role against oxidative stress, ionizing radiation, SOD2 Dismutase 2, Up-regulated 2.92 4.22 - cancer and inflammatory cytokines Mitochondrial - immunity expression leads to phosphorylation and activation of ELK1 Chromosome 10 - hypoxia C10orf10 Open Reading Up-regulated 4.16 3.90 up-regulated by hypoxia - autophagy Frame 10 may play a role in autophagy Retinol Rdh10 mutants showed increased expression of Wnt RDH10 Dehydrogenase 10 Up-regulated 3.07 3.70 - WNT signalling inhibitors and decreased Wnt signalling (Bonney et al., 2016) (All-Trans) ATP Binding Cassette Up-regulation in macrophages inhibits progression of ABCA1 Up-regulated 3.07 3.32 - immunity Subfamily A atherosclerotic lesions Member 1 - regulation of CCAAT/Enhancer apoptosis CEBPD Binding Protein Up-regulated 3.23 2.97 probably acts as tumor suppressor - cell Delta cycle/proliferation 119

- cancer Collagen Type V - extracellular COL5A2 Up-regulated 2.47 2.47 key determinant in the assembly of tissue-specific matrices Alpha 2 Chain matrix Nuclear Receptor Enhances the transcriptional activities of several nuclear NCOA7 Up-regulated 2.09 2.19 - AHR pathway Coactivator 7 receptors

BEST1 Bestrophin 1 Up-regulated 2.31 2.11 - chondrogenesis SOX9 as key regulator of BEST1 (Masuda and Esumi, 2010)

Nuclear Protein 1, NUPR1 Transcriptional Up-regulated 2.35 2.06 - cell cycle linked to p21 and chemoresistance Regulator Tetratricopeptide TTC39B Repeat Domain Up-regulated 2.33 1.85 - lipid metabolism may be involved in lipid regulation 39B Solute Carrier comprises the light subunit of the large neutral amino acid SLC3A2 Family 3 Member Up-regulated 2.09 1.79 - immunity transporter (LAT1; also known as CD98) 2 BTG Anti- - cell cycle BTG1 Proliferation Up-regulated 1.44 1.65 negative regulator of cell proliferation - proliferation Factor 1 Proline Rich - signal PNRC1 Nuclear Receptor Up-regulated 1.67 1.62 May play a role in signal transduction transduction Coactivator 1 Chromosome 10 - development C10orf54 Open Reading Up-regulated 2.03 1.53 may stimulate MMP14-mediated MMP2 activation -remodelling Frame 54 T-Complex 11 TCP11L2 Up-regulated 1.76 1.49 Like 2

Dermatan Sulfate GO annotations: sulfotransferase activity and isomerase DSEL Up-regulated 1.77 1.49 - metabolism Epimerase-Like activity

120

- ERK signalling - PAK pathway plays a central role in organization of the microtubules during TUBE1 Tubulin Epsilon 1 Up-regulated 1.87 1.42 - Centrosome centriole duplication cycle/cytoskeleton DFNA5, Deafness DFNA5 Associated Tumor Up-regulated 1.68 1.39 - cell cycle regulated by P53; may be a tumor suppressor gene Suppressor Angiotensin II - hypoxia interacts with the angiotensin II type I receptor and AGTRAP Receptor Up-regulated 1.19 1.25 - heart disease negatively regulates angiotensin II signalling Associated Protein

5-Azacytidine contributes to the activation of NFKB-dependent gene AZI2 Up-regulated 1.46 1.20 - immunity Induced 2 expression by activating IKK-related kinases

- Metabolism Isopentenyl- Down- - Regulation of GO annotations : magnesium ion binding and manganese ion IDI1 Diphosphate Delta -1.38 -1.27 regulated cholesterol binding Isomerase 1 biosynthesis Rho GTPase Down- - GPCR signalling insulin-responsive, dependent on Akt; interaction results in ARHGAP22 Activating Protein -2.17 -1.75 regulated - Rho GTPase cycle regulation of cell motility 22 Serine/Threonine Down- - Apoptosis GO annotations: transferase activity, transferring phosphorus- STK17B -1.61 -1.90 Kinase 17b regulated - Autophagy containing groups and protein tyrosine kinase activity

osteogenic potency together with Wnt3a

Wnt Family Down- WNT9A -2.14 -2.00 - chondrogenesis canonical Wnt/beta-catenin pathway probably mediates Member 9A regulated regulation of Ihh expression in prehypertrophic chondrocytes by Wnt9a;

121

targets TGFBR activated Smad2 and Smad3; high levels of Smurf2 were associated with the differentiative and SMAD Specific - endochondral proliferative stages (ColX); Smurf2 levels decreases as the Down- SMURF2 E3 Ubiquitin -1.79 -2.03 ossification chondrocytes matured toward hypertrophy(Wu et al., 2008) regulated Protein Ligase 2 - immunity negative regulator of virus triggered type I IFN signalling (Pan et al., 2014) Down- IL16 Interleukin 16 -4.49 -3.38 - immunity may be a novel gene associated with OA regulated Lipase G, Down- - Phospholipase may be involved in lipoprotein metabolism and vascular LIPG -6.74 -5.40 Endothelial Type regulated activity biology

Appendix 2: Successfully induced over expression of Ctnnb1 in ATDC5 was confirmed by immunoblotting. ATDC5 cells were transfected with empty vector control (empty pcDNA3.1), Wnt9a pcDNA3.1 or Ctnnb1 pcDNA3.1 and analysed according to the previous mentioned experimental setup. Successfully induced over expression of CTNNB1 was confirmed by immunoblotting. Actin Beta (ACTB) was used as loading control in immunoblotting. Presented graphs are representative examples of at least three independent experiments.

Proliferation Differentiation

Active CTNNB1 (92 kDa) Active CTNNB1 (92 kDa)

CTNNB1 (92 kDa) CTNNB1 (92 kDa)

ACTB (42 kDa) ACTB (42 kDa)

122