DOCSLIB.ORG

Based Learning Bioinformatics Module on Undergraduate Student Engagement and Applied Skillsws

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Based Learning Bioinformatics Module on Undergraduate Student Engagement and Applied Skillsws Biotechnology Education Evaluating the Effectiveness of a Practical James A. L. Brown* Inquiry-Based Learning Bioinformatics Module on Undergraduate Student Engagement and Applied Skillsws From the Department of Biochemistry, School of Natural Sciences, National University of Ireland Galway, Ireland and Discipline of Surgery, School of Medicine, Lambe Institute for Translational Research, National University of Ireland Galway, Ireland Abstract A pedagogic intervention, in the form of an inquiry-based evaluated by assessing the quality and originality of the peer-assisted learning project (as a practical student-led students’ targets through reports, reflecting students’ use bioinformatics module), was assessed for its ability to and understanding of concepts and tools required to increase students’ engagement, practical bioinformatic generate their data. Furthermore, evaluation of the bioin- skills and process-specific knowledge. Elements assessed formatic module was assessed semi-quantitatively using were process-specific knowledge following module com- pre- and post-module quizzes (a non-assessable activity, pletion, qualitative student-based module evaluation and not contributing to their grade), which incorporated pro- the novelty, scientific validity and quality of written student cess- and content-specific questions (indicative of their reports. Bioinformatics is often the starting point for use of the online tools). Qualitative assessment of the laboratory-based research projects, therefore high impor- teaching intervention was performed using post-module tance was placed on allowing students to individually surveys, exploring student satisfaction and other module develop and apply processes and methods of scientific specific elements. Overall, a positive experience was research. Students led a bioinformatic inquiry-based pro- found, as was a post module increase in correct process- ject (within a framework of inquiry), discovering, justifying specific answers. In conclusion, an inquiry-based peer- and exploring individually discovered research targets. assisted learning module increased students’ engage- Detailed assessable reports were produced, displaying data ment, practical bioinformatic skills and process-specific generated and the resources used. Mimicking research set- knowledge. VC 2016 by The International Union of Bio- tings, undergraduates were divided into small collaborative chemistry and Molecular Biology, 44:304–313 2016. groups, with distinctive central themes. The module was Keywords: bioinformatics; practical; inquiry-led; process; content; undergraduate; project; teaching Introduction The introduction, application, and evaluation of bioinfor- matic modules using web-based software packages for peda- Volume 44, Number 3, May/June 2016, Pages 304–313 gogic purposes in the biological sciences has been evolving ws Additional Supporting Information may be found in the online for the last 20 years, requiring constant revision and updat- version of this article. ing to keep pace with the ever changing scientific technolo- *Address for correspondence to: Discipline of Surgery, School of Medi- gies and pedagogic techniques [1–6]. This is due to constant cine, Lambe Institute for Translational Research, National University of Ireland Galway, Ireland. advances and availability of tools, databases, and data sets E-mail: [email protected] that has allowed these online databases and tools to rapidly Received 25 May 2015; Revised 20 November 2015; Accepted 8 grow, evolve, and establish themselves as essential commu- December 2015 nity resources and tools in the last 15 years [7, 8]. This con- DOI 10.1002/bmb.20954 stant evolution has included: massively increased databases Published online in Wiley Online Library (of both size and content), the proliferation of highly specific (wileyonlinelibrary.com) search and modeling tools, algorithm advances, defining of 304 Biochemistry and Molecular Biology Education new biological domains/motifs, and improved interactive Furthermore, pedagogical publications are appearing graphics [9–11]. In addition, the proliferation of accessible that incorporate lists of community specific online services privately maintained databases (i.e., sites offered and which are either available or were used in their research maintained by commercial companies) has significantly com- activities [19–[22, 25]]. Many of these publications employ plemented and enhanced current public research facilities. tools from the NCBI bioinformatic suite- as one of the origi- Supporting this, more advanced, comprehensive, state- nal sites it has become an essential first point of contact. of-the-art online databases and tool suites (many on the cut- Importantly, due to its age and continual evolution it is also ting edge of what is currently possible) often appear rapidly one of the most user-friendly. Additionally, it has the dis- following the introduction of new techniques, technologies tinct advantage of being linked to the world’s largest data- and recently large scale “omics” studies [12, 13]. base of peer-reviewed publications and curated genetic These constantly evolving and growing online data- information. bases have become instrumental in defining how scientists Significantly, many of the larger online repositories/ organise their thinking and experiments [14, 15]. Exploring databases host so many tools that they now have their own the current state of knowledge on a given topic using data- published manuals [14, [20, 23]], in addition to their own bases and repositories is the first step in any project [16]. It online frequently asked questions (FAQ) and help sections. is also important that multiple databases are queried. The These FAQ’s and database help sections allow novices and subsequent research steps are then shaped by the knowl- professionals alike to engage in self-directed learning with edge gleaned from these databases. Searches missing a the software they are exploring, often with helpful examples. key piece of data can be disastrous for a project, in terms Many of the large scientific community-specific (biology) of wasted time and resources. web-based databases provide tools such as; sequence align- Furthermore, scientists’ thinking can be influenced by ment, Basic Local Alignment Search Tool (BLAST), genomic the structure of the databases themselves for example, how maps, literature searches, structural/domain analysis and one subject is linked to another and what it is linked to gene expression information. However, in recent years there within the database. This will influence how a researcher has been a significant rise in the appearance of highly special- interprets this information, particularly if their knowledge ised databases and software tools. Some examples of com- of the subject is limited [9, 17]. monly used specialised databases or research tools available One of the earliest and probably the most famous and are: tissue or cell line specific gene expression databases widely used bioinformatic suite of tools is the National (Oncomine, TiGER), cell cycle specific gene expression data- Centre for Biotechnology Information (NCBI) [10, 18], bases (Cyclebase, GeneCards), interaction networks (String, established in 1988. The NCBI is part of the United States BioGrid), specific protein posttranslational modification data- National Library of Medicine (NLM) administered by the bases (phosphorylation: PhosphoSitePlus, PHOSIDA, NetPhos; National Institute of Health (NIH). Following the global suc- Acetylation: ASEB, Scan-x; Ubiquitylation: UbiProt, hUbiqui- cess of NCBI a number of national institutes followed suit: tome), MicroRNA databases (PicTar, HMDD), genetically the Expert Protein Analysis System (ExPASy) [10, 14] suite modified animal strain databases (JMSR, RGD), cancer cell created by the Swiss Institute of Bioinformatics (SIB) in line databases (CCLE, CGAP) and process-specific databases 1998 and then the European bioinformatics institute (EBI) (CMC, CilDB, MetaCore) [14, [26–34]]. created by the European Molecular Biology Laboratory This proliferation of specialist/niche databases or soft- (EMBL) in 1992, which has only been accessible online ware tools emphasises the need for up-to-date training in since 2004 [17, [19–22]]. general software and database use and evaluation-some data- Currently there are now hundreds of databases, tools and bases look good but the results are based on very a limited set software packages available online, with many curated lists of data (i.e., Cyclebase), which can significantly affect the available (OBRC: Online Bioinformatics Resources Collection; interpretation of any results obtained. Many software pack- http://www.hsls.pitt.edu/obrc/and https://en.wikipedia.org/wiki/ ages return concise but technical results that often take prior List_of_open-source_bioinformatics_software). experience or specialised knowledge to interpret. To use most Recently, in response to this (almost exponential) prolifer- databases they require input in a specific format or search ation of tools the journal Nucleic Acids Research begun issu- terms to be taken from a specific database and many compet- ing an annual, open access, special issue dedicated to detail- ing databases label the same item differently. ing some of the more significant cutting-edge databases or Recently, many published undergraduate modules have software created [10, [14, 23]]. Issues like this are crucial for made significant efforts to mimic real world conditions by compiling and indexing software and
Load more

Recommended publications
  • The Identification of Genetic Determinants of Methanol
    Journal of Fungi Article The Identification of Genetic Determinants of Methanol Tolerance in Yeast Suggests Differences in Methanol and Ethanol Toxicity Mechanisms and Candidates for Improved Methanol Tolerance Engineering Marta N. Mota 1,2, Luís C. Martins 1,2 and Isabel Sá-Correia 1,2,* 1 iBB—Institute for Bioengineering and Biosciences, Instituto Superior Técnico, Universidade de Lisboa, 1049-001 Lisbon, Portugal; [email protected] (M.N.M.); [email protected] (L.C.M.) 2 Department of Bioengineering, Instituto Superior Técnico, Universidade de Lisboa, 1049-001 Lisbon, Portugal * Correspondence: [email protected] Abstract: Methanol is a promising feedstock for metabolically competent yeast strains-based biore- fineries. However, methanol toxicity can limit the productivity of these bioprocesses. Therefore, the identification of genes whose expression is required for maximum methanol tolerance is important for mechanistic insights and rational genomic manipulation to obtain more robust methylotrophic yeast strains. The present chemogenomic analysis was performed with this objective based on the screening of the Euroscarf Saccharomyces cerevisiae haploid deletion mutant collection to search for susceptibility ◦ phenotypes in YPD medium supplemented with 8% (v/v) methanol, at 35 C, compared with an equivalent ethanol concentration (5.5% (v/v)). Around 400 methanol tolerance determinants were Citation: Mota, M.N.; Martins, L.C.; identified, 81 showing a marked phenotype. The clustering of the identified tolerance genes indicates Sá-Correia, I. The Identification of an enrichment of functional categories in the methanol dataset not enriched in the ethanol dataset, Genetic Determinants of Methanol Tolerance in Yeast Suggests such as chromatin remodeling, DNA repair and fatty acid biosynthesis.
    [Show full text]
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • Preclinical Research 2020 Sections
    Sackler Faculty of Medicine Preclinical Research 2020 Sections Cancer and Molecular Therapies 8 Dental Health and Medicine 52 Diabetes, Metabolic and Endocrine Diseases 62 Genomics & Personalized Medicine 78 Hearing, Language & Speech Sciences and Disorders 98 Infectious Diseases 117 Inflammatory and Autoimmune Diseases 137 Medical Education and Ethics 147 Nervous System and Brain Disorders 154 Nursing, Occupational and Physical Therapy 200 Public Health 235 Reproduction, Development and Evolution 263 Stem Cells and Regenerative Medicine 280 Cover images (from bottom left, clockwise): Image 1: Human embryonic stem cell derived cardiomyocytes stained with fluorescent antibodies. The cardiac marker alpha-actinin (green), calcium channel modulator, Ahnak1 (red) – Shimrit Oz, Nathan Dascal. Image 2: Islet of Langerhans containing insulin-producing beta-cells (green) and glucagon- producing alpha-cells (red) – Daria Baer, Limor Landsman. Image 3: β-catenin in C. elegans vulva – Michal Caspi, Limor Broday, Rina Rosin-Arbesfeld. Image 4: Stereocilia of a sensory outer hair cell from a mouse inner ear – Shaked Shivatzki, Karen Avraham. Image 5: Electron scanning micrograph of middle ear ossicles from a mouse ear stained with pseudo colors – Shaked Shivatski, Karen Avraham. Image 6: Resistin-like molecule alpha (red), eosinophil major basic protein (green) and DAPI (blue) staining of asthmatic mice – Danielle Karo-Atar, Ariel Munitz. © All rights reserved Editor: Prof. Karen Avraham Graphic design: Michal Semo Kovetz, TAU Graphic Design Studio February 2020 Sackler Faculty of Medicine Research 2020 2 The Sackler Faculty of Medicine The Sackler Faculty of Medicine is Israel’s largest diabetes, neurodegenerative diseases, infectious medical research and training complex. The Sackler diseases and genetic diseases, including but not Faculty of Medicine of Tel Aviv University (TAU) was imited to Alzheimer’s disease, Parkinson’s disease founded in 1964 following the generous contributions and HIV/AIDS.
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Why Cells and Viruses Cannot Survive Without an ESCRT
    cells Review Why Cells and Viruses Cannot Survive without an ESCRT Arianna Calistri * , Alberto Reale, Giorgio Palù and Cristina Parolin Department of Molecular Medicine, University of Padua, 35121 Padua, Italy; [email protected] (A.R.); [email protected] (G.P.); [email protected] (C.P.) * Correspondence: [email protected] Abstract: Intracellular organelles enwrapped in membranes along with a complex network of vesicles trafficking in, out and inside the cellular environment are one of the main features of eukaryotic cells. Given their central role in cell life, compartmentalization and mechanisms allowing their maintenance despite continuous crosstalk among different organelles have been deeply investigated over the past years. Here, we review the multiple functions exerted by the endosomal sorting complex required for transport (ESCRT) machinery in driving membrane remodeling and fission, as well as in repairing physiological and pathological membrane damages. In this way, ESCRT machinery enables different fundamental cellular processes, such as cell cytokinesis, biogenesis of organelles and vesicles, maintenance of nuclear–cytoplasmic compartmentalization, endolysosomal activity. Furthermore, we discuss some examples of how viruses, as obligate intracellular parasites, have evolved to hijack the ESCRT machinery or part of it to execute/optimize their replication cycle/infection. A special emphasis is given to the herpes simplex virus type 1 (HSV-1) interaction with the ESCRT proteins, considering the peculiarities of this interplay and the need for HSV-1 to cross both the nuclear-cytoplasmic and the cytoplasmic-extracellular environment compartmentalization to egress from infected cells. Citation: Calistri, A.; Reale, A.; Palù, Keywords: ESCRT; viruses; cellular membranes; extracellular vesicles; HSV-1 G.; Parolin, C.
    [Show full text]
  • Heat Stress-Dependent Association of Membrane Trafficking Proteins
    ORIGINAL RESEARCH published: 24 June 2021 doi: 10.3389/fpls.2021.670499 Heat Stress-Dependent Association of Membrane Trafficking Proteins With mRNPs Is Selective Heike Wolff 1, Marc Jakoby 2, Lisa Stephan 2, Eva Koebke 2 and Martin Hülskamp 2* 1 Cluster of Excellence on Plant Sciences (CEPLAS), Botanical Institute, Cologne University, Cologne, Germany, 2 Botanical Institute, Biocenter, Cologne University, Cologne, Germany The Arabidopsis AAA ATPase SKD1 is essential for ESCRT-dependent endosomal sorting by mediating the disassembly of the ESCRTIII complex in an ATP-dependent manner. In this study, we show that SKD1 localizes to messenger ribonucleoprotein complexes upon heat stress. Consistent with this, the interactome of SKD1 revealed differential interactions under normal and stress conditions and included membrane transport proteins as well as proteins associated with RNA metabolism. Localization studies with selected interactome proteins revealed that not only RNA associated proteins but also several ESCRTIII and membrane trafficking proteins were recruited to messenger ribonucleoprotein granules after heat stress. Keywords: SKD1, endosomal trafficking, RNA metabolism, membrane trafficking, ESCRT, heat stress, mRNP Edited by: Abidur Rahman, Iwate University, Japan INTRODUCTION Reviewed by: Xiaohong Zhuang, Ubiquitinylated membrane proteins are targeted for degradation in lysosomes by the multivesicular The Chinese University of Hong body (MVB) pathway. MVB sorting is governed by proteins of the endosomal complex required Kong, China Viktor Zarsky, for transport (ESCRT). Four complexes, ESCRT0, ESCRTI, ESCRTII, and ESCRTIII, assemble Charles University, Czechia sequentially on endosomes to mediate invagination and fission of the MVBs’ outer membrane *Correspondence: (Huotari and Helenius, 2011; Gao et al., 2017). This process leads to the formation of intraluminal Martin Hülskamp vesicles (ILVs), whose content is degraded after fusion of the MVB with the lysosome.
    [Show full text]
  • Deep Multiomics Profiling of Brain Tumors Identifies Signaling Networks
    ARTICLE https://doi.org/10.1038/s41467-019-11661-4 OPEN Deep multiomics profiling of brain tumors identifies signaling networks downstream of cancer driver genes Hong Wang 1,2,3, Alexander K. Diaz3,4, Timothy I. Shaw2,5, Yuxin Li1,2,4, Mingming Niu1,4, Ji-Hoon Cho2, Barbara S. Paugh4, Yang Zhang6, Jeffrey Sifford1,4, Bing Bai1,4,10, Zhiping Wu1,4, Haiyan Tan2, Suiping Zhou2, Laura D. Hover4, Heather S. Tillman 7, Abbas Shirinifard8, Suresh Thiagarajan9, Andras Sablauer 8, Vishwajeeth Pagala2, Anthony A. High2, Xusheng Wang 2, Chunliang Li 6, Suzanne J. Baker4 & Junmin Peng 1,2,4 1234567890():,; High throughput omics approaches provide an unprecedented opportunity for dissecting molecular mechanisms in cancer biology. Here we present deep profiling of whole proteome, phosphoproteome and transcriptome in two high-grade glioma (HGG) mouse models driven by mutated RTK oncogenes, PDGFRA and NTRK1, analyzing 13,860 proteins and 30,431 phosphosites by mass spectrometry. Systems biology approaches identify numerous master regulators, including 41 kinases and 23 transcription factors. Pathway activity computation and mouse survival indicate the NTRK1 mutation induces a higher activation of AKT down- stream targets including MYC and JUN, drives a positive feedback loop to up-regulate multiple other RTKs, and confers higher oncogenic potency than the PDGFRA mutation. A mini-gRNA library CRISPR-Cas9 validation screening shows 56% of tested master regulators are important for the viability of NTRK-driven HGG cells, including TFs (Myc and Jun) and metabolic kinases (AMPKa1 and AMPKa2), confirming the validity of the multiomics inte- grative approaches, and providing novel tumor vulnerabilities.
    [Show full text]
  • Population Genomics in a Disease Targeted Primary Cell Model
    Downloaded from genome.cshlp.org on October 8, 2021 - Published by Cold Spring Harbor Laboratory Press Letter Population genomics in a disease targeted primary cell model Elin Grundberg,1,2,12 Tony Kwan,1,2,12 Bing Ge,2 Kevin C.L. Lam,2 Vonda Koka,2 Andreas Kindmark,3 Hans Mallmin,4 Joana Dias,2 Dominique J. Verlaan,1,2,5 Manon Ouimet,5 Daniel Sinnett,5,6 Fernando Rivadeneira,7,8 Karol Estrada,7 Albert Hofman,8 Joyce M. van Meurs,7 Andre´ Uitterlinden,7,8 Patrick Beaulieu,5 Alexandru Graziani,5 Eef Harmsen,2 O¨ sten Ljunggren,3 Claes Ohlsson,9 Dan Mellstro¨m,9 Magnus K. Karlsson,10 Olle Nilsson,4 and Tomi Pastinen1,2,11,13 1Department of Human Genetics, McGill University, Montre´al H3A 1B1, Canada; 2McGill University and Genome Que´bec Innovation Centre, Montre´al H3A 1A4, Canada; 3Department of Medical Sciences, Uppsala University, Uppsala 75185, Sweden; 4Department of Surgical Sciences, Uppsala University, Uppsala 75185, Sweden; 5Sainte-Justine University Health Center, Montre´al H3T 1C5, Canada; 6Department of Pediatrics, University of Montre´al, Montre´al H3T 1C5, Canada; 7Department of Internal Medicine, Erasmus MC, Rotterdam 3015GE, The Netherlands; 8Department of Epidemiology, Erasmus MC, Rotterdam 3015GE, The Netherlands; 9Center for Bone Research at the Sahlgrenska Academy, Department of Internal Medicine, Go¨teborg University, Gothenburg 41345, Sweden; 10Clinical and Molecular Osteoporosis Research Unit, Department of Clinical Science, Lund University and Department of Orthopaedics, Malmo¨University Hospital, Malmo¨20502, Sweden; 11Department of Medical Genetics, McGill University, Montre´al H3H 1P3, Canada The common genetic variants associated with complex traits typically lie in noncoding DNA and may alter gene regu- lation in a cell type-specific manner.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • Loci Associated with Bone Strength in Laying Hens
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Epsilon Archive for Student Projects Faculty of Veterinary Medicine and Animal Science Department of Animal Breeding and Genetics Loci associated with bone strength in laying hens Biaty Raymond Examensarbete / Swedish University of Agricultural Sciences Master’s Thesis, 30 hp Department of Animal Breeding and Genetics 488 Uppsala 2016 Faculty of Veterinary Medicine and Animal Science Department of Animal Breeding and Genetics Loci associated with bone strength in laying hens Biaty Raymond Supervisors: D.J. De-Koning, SLU, Department of Animal Breeding and Genetics Anna Maria Johansson, SLU, Department of Animal Breeding and Genetics Examiner: Erling Strandberg, SLU, Department of Animal Breeding and Genetics Credits: 30 hp Course title: Degree project in Animal Science Course code: EX0556 Level: Advanced, A2E Place of publication: Uppsala Year of publication: 2016 Name of series: Examensarbete / Swedish University of Agricultural Sciences, Department of Animal Breeding and Genetics, 488 On-line publicering: http://epsilon.slu.se Key words: Osteoporosis, GWAS, Fracture, Genes, QTLs ABSTRACT One of the growing welfare concern in the layer industry is the high incidences of bone fracture. This is thought to result from reduction in bone strength due to osteoporosis which is exacerbated by environmental stresses and mineral deficiencies. Despite these factors however, the primary cause of bone weakness and the resulting fractures is believed to be genetic predisposition. In this study, we performed a genome-wide association study to identify with high reliability the loci associated with bone strength in laying hens. Genotype information and phenotype data were obtained from 752 laying hens belonging to the same pure line population.
    [Show full text]
  • Protein Tyrosine Phosphorylation in Haematopoietic Cancers and the Functional Significance of Phospho- Lyn SH2 Domain
    Protein Tyrosine Phosphorylation in Haematopoietic Cancers and the Functional Significance of Phospho- Lyn SH2 Domain By Lily Li Jin A thesis submitted in conformity with the requirements for the degree of Ph.D. in Molecular Genetics, Graduate Department of Molecular Genetics, in the University of Toronto © Copyright by Lily Li Jin (2015) Protein Tyrosine Phosphorylation in Haematopoietic Cancers and the Functional Significance of Phospho-Lyn SH2 Domain Lily Li Jin 2015 Ph.D. in Molecular Genetics Graduate Department of Molecular Genetics University of Toronto Abstract Protein-tyrosine phosphorylation (pY) is a minor but important protein post-translational modification that modulates a wide range of cellular functions and is involved in cancer. Dysregulation of tyrosine kinases (TKs) and protein-tyrosine phosphatases (PTPs) have been observed in multiple myeloma (MM) and acute myeloid leukemia (AML) and is a subject of study. Using recently developed mass spectrometry-based proteomics techniques, quantitative PTP expression and cellular pY profiles were generated for MM cell lines and mouse xenograft tumors, as well as primary AML samples. Integrated comprehensive analyses on these data implicated a subset of TKs and PTPs in MM and AML, with valuable insights gained on the dynamic regulation of pY in biological systems. In particular, I propose a model that describes the cellular pY state as a functional output of the total activated TKs and PTPs in the cell. My results show that the global pY profile in the cancer models is quantitatively related to the cellular levels of activated TKs and PTPs. Furthermore, the identity of the implicated TK/PTPs is system- ii dependent, demonstrating context-dependent regulation of pY.
    [Show full text]
  • Sackler Faculty of Medicine Preclinical Research 2020 Sections
    Sackler Faculty of Medicine Preclinical Research 2020 Sections Cancer and Molecular Therapies 8 Cardiovascular Research and Diseases 44 Dental Health and Medicine 56 Diabetes, Metabolic and Endocrine Diseases 65 Genomics & Personalized Medicine 78 Hearing, Language & Speech Sciences and Disorders 99 Infectious Diseases 120 Inflammatory and Autoimmune Diseases 139 Medical Education and Ethics 150 Nervous System and Brain Disorders 158 Nursing, Occupational and Physical Therapy 208 Public Health 248 Reproduction, Development and Evolution 277 Stem Cells, Regenerative Medicine and Aging 298 Cover images (from bottom left, clockwise): Image 1: Human embryonic stem cell derived cardiomyocytes stained with fluorescent antibodies. The cardiac marker alpha-actinin (green), calcium channel modulator, Ahnak1 (red) – Shimrit Oz, Nathan Dascal. Image 2: Islet of Langerhans containing insulin-producing beta-cells (green) and glucagon- producing alpha-cells (red) – Daria Baer, Limor Landsman. Image 3: β-catenin in C. elegans vulva – Michal Caspi, Limor Broday, Rina Rosin-Arbesfeld. Image 4: Stereocilia of a sensory outer hair cell from a mouse inner ear – Shaked Shivatzki, Karen Avraham. Image 5: Electron scanning micrograph of middle ear ossicles from a mouse ear stained with pseudo colors – Shaked Shivatski, Karen Avraham. Image 6: Resistin-like molecule alpha (red), eosinophil major basic protein (green) and DAPI (blue) staining of asthmatic mice – Danielle Karo-Atar, Ariel Munitz. © All rights reserved Editor: Prof. Karen Avraham Graphic design: Michal Semo Kovetz, TAU Graphic Design Studio October 2020 Sackler Faculty of Medicine Research 2020 2 The Sackler Faculty of Medicine The Sackler Faculty of Medicine is Israel’s largest diabetes, neurodegenerative diseases, infectious medical research and training complex.
    [Show full text]