DOCSLIB.ORG

Campos, Joana Monteiro De (2016) TRIB2 in Human AML: a Biological and Clinical Investigation. Phd Thesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Campos, Joana Monteiro De (2016) TRIB2 in Human AML: a Biological and Clinical Investigation. Phd Thesis Campos, Joana Monteiro de (2016) TRIB2 in human AML: a biological and clinical investigation. PhD thesis. http://theses.gla.ac.uk/7499/ Copyright and moral rights for this thesis are retained by the author A copy can be downloaded for personal non-commercial research or study This thesis cannot be reproduced or quoted extensively from without first obtaining permission in writing from the Author The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the Author When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given Glasgow Theses Service http://theses.gla.ac.uk/ [email protected] TRIB2 in human AML: a biological and clinical investigation Joana Monteiro de Campos BSc, MRes A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy Institute of Cancer Sciences College of Medical, Veterinary and Life Sciences University of Glasgow July 2016 2 Abstract Acute myeloid leukemia (AML) involves the proliferation, abnormal survival and arrest of cells at a very early stage of myeloid cell differentiation. The biological and clinical heterogeneity of this disease complicates treatment and highlights the significance of understanding the underlying causes of AML, which may constitute potential therapeutic targets, as well as offer prognostic information. Tribbles homolog 2 (Trib2) is a potent murine oncogene capable of inducing transplantable AML with complete penetrance. The pathogenicity of Trib2 is attributed to its ability to induce proteasomal degradation of the full length isoform of the transcription factor CCAAT/enhancer-binding protein alpha (C/EBPα p42). The role of TRIB2 in human AML cells, however, has not been systematically investigated or targeted. Across human cancers, TRIB2 oncogenic activity was found to be associated with its elevated expression. In the context of AML, TRIB2 overexpression was suggested to be associated with the large and heterogeneous subset of cytogenetically normal AML patients. Based upon the observation that overexpression of TRIB2 has a role in cellular transformation, the effect of modulating its expression in human AML was examined in a human AML cell line that expresses high levels of TRIB2, U937 cells. Specific suppression of TRIB2 led to impaired cell growth, as a consequence of both an increase in apoptosis and a decrease in cell proliferation. Consistent with these in vitro results, TRIB2 silencing strongly reduced progression of the U937 in vivo xenografts, accompanied by detection of a lower spleen weight when compared with mice transplanted with TRIB2- expressing control cells. Gene expression analysis suggested that TRIB2 modulates apoptosis and cell-cycle sensitivity by influencing the expression of a subset of genes known to have implications on these phenotypes. Furthermore, TRIB2 was found to be expressed in a significant subset of AML patient samples analysed. To investigate whether increased expression of this gene could be afforded prognostic significance, primary AML cells with dichotomized levels of TRIB2 transcripts were evaluated in terms of their xeno- engraftment potential, an assay reported to correlate with disease aggressiveness observed in humans. A small cohort of analysed samples with higher TRIB2 expression did not associate with preferential leukaemic cell engraftment in highly immune-deficient mice, hence, not predicting for an adverse prognosis. However, further experiments including a larger cohort of well characterized AML patients would be needed to clarify TRIB2 significance in the diagnostic setting. Collectively, these data support a functional role for TRIB2 in the maintenance of the oncogenic properties of human AML cells and suggest TRIB2 can be considered a rational therapeutic target. 3 Proteasome inhibition has emerged as an attractive target for the development of novel anti-cancer therapies and results from translational research and clinical trials support the idea that proteasome inhibitors should be considered in the treatment of AML. The present study argued that proteasome inhibition would effectively inhibit the function of TRIB2 by abrogating C/EBPα p42 protein degradation and that it would be an effective pharmacological targeting strategy in TRIB2-positive AMLs. Here, a number of cell models expressing high levels of TRIB2 were successfully targeted by treatment with proteasome inhibitors, as demonstrated by multiple measurements that included increased cytotoxicity, inhibition of clonogenic growth and anti-AML activity in vivo. Mechanistically, it was shown that block of the TRIB2 degradative function led to an increase of C/EBPα p42 and that response was specific to the TRIB2-C/EBPα axis. Specificity was addressed by a panel of experiments showing that U937 cells (express detectable levels of endogenous TRIB2 and C/EBPα) treated with the proteasome inhibitor bortezomib (Brtz) displayed a higher cytotoxic response upon TRIB2 overexpression and that ectopic expression of C/EBPα rescued cell death. Additionally, in C/EBPα-negative leukaemia cells, K562 and Kasumi 1, Brtz-induced toxicity was not increased following TRIB2 overexpression supporting the specificity of the compound on the TRIB2-C/EBPα axis. Together these findings provide pre-clinical evidence that TRIB2- expressing AML cells can be pharmacologically targeted with proteasome inhibition due, in part, to blockage of the TRIB2 proteolytic function on C/EBPα p42. A large body of evidence indicates that AML arises through the stepwise acquisition of genetic and epigenetic changes. Mass spectrometry data has identified an interaction between TRIB2 and the epigenetic regulator Protein Arginine Methyltransferase 5 (PRMT5). Following assessment of TRIB2‟s role in AML cell survival and effective targeting of the TRIB2-C/EBPα degradation pathway, a putative TRIB2/PRMT5 cooperation was investigated in order to gain a deeper understanding of the molecular network in which TRIB2 acts as a potent myeloid oncogene. First, a microarray data set was interrogated for PRMT5 expression levels and the primary enzyme responsible for symmetric dimethylation was found to be transcribed at significantly higher levels in AML patients when compared to healthy controls. Next, depletion of PRMT5 in the U937 cell line was shown to reduce the transformative phenotype in the high expressing TRIB2 AML cells, which suggests that PRMT5 and TRIB2 may cooperate to maintain the leukaemogenic potential. Importantly, PRMT5 was identified as a TRIB2-interacting protein by means of a protein tagging approach to purify TRIB2 complexes from 293T 4 cells. These findings trigger further research aimed at understanding the underlying mechanism and the functional significance of this interplay. In summary, the present study provides experimental evidence that TRIB2 has an important oncogenic role in human AML maintenance and, importantly in such a molecularly heterogeneous disease, provides the rational basis to consider proteasome inhibition as an effective targeting strategy for AML patients with high TRIB2 expression. Finally, the identification of PRMT5 as a TRIB2-interacting protein opens a new level of regulation to consider in AML. This work may contribute to our further understanding and therapeutic strategies in acute leukaemias. 5 Table of Contents Abstract .................................................................................................................................. 2 Table of Contents ................................................................................................................... 5 List of Tables.......................................................................................................................... 8 List of Figures ........................................................................................................................ 9 List of Appendices ............................................................................................................... 10 List of Publications .............................................................................................................. 11 Acknowledgement................................................................................................................ 12 Author‟s Declaration ............................................................................................................ 13 List of Abbreviations............................................................................................................ 14 Chapter 1 .............................................................................................................................. 18 Introduction .......................................................................................................................... 18 1.1 Haemopoiesis ........................................................................................................ 19 1.2 Acute Myeloid Leukaemia .................................................................................... 22 1.2.1 History and classification of leukaemia ......................................................... 22 1.2.2 Pathology, epidemiology and etiology of AML ............................................ 23 1.2.3 AML classification ......................................................................................... 24 1.2.4 Molecular pathogenesis of AML ..................................................................
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • TRIB2 Functions As Novel Oncogene in Colorectal Cancer by Blocking
    Hou et al. Molecular Cancer (2018) 17:172 https://doi.org/10.1186/s12943-018-0922-x RESEARCH Open Access TRIB2 functions as novel oncogene in colorectal cancer by blocking cellular senescence through AP4/p21 signaling Zhenlin Hou1, Kaixuan Guo1, Xuling Sun1, Fuqing Hu1, Qianzhi Chen1, Xuelai Luo1, Guihua Wang1, Junbo Hu1 and Li Sun2* Abstract Background: Cellular senescence is a state of irreversible cell growth arrest and senescence cells permanently lose proliferation potential. Induction of cellular senescence might be a novel therapy for cancer cells. TRIB2 has been reported to participate in regulating proliferation and drug resistance of various cancer cells. However, the role of TRIB2 in cellular senescence of colorectal cancer (CRC) and its molecular mechanism remains unclear. Methods: The expression of TRIB2 in colorectal cancer tissues and adjacent tissues was detected by immunohistochemistry and RT-PCR. The growth, cell cycle distribution and cellular senescence of colorectal cancer cells were evaluated by Cell Counting Kit-8 (CCK8) assay, flow cytometry detection and senescence- associated β-galactosidase staining, respectively. Western blot, RT-PCR and luciferase assay were performed to determine how TRIB2 regulates p21. Immunoprecipitation (IP) and chromatin-immunoprecipitation (ChIP) were used to investigate the molecular mechanisms. Results: We found that TRIB2 expression was elevated in CRC tissues compared to normal adjacent tissues and high TRIB2 expression indicated poor prognosis of CRC patients. Functionally, depletion of TRIB2 inhibited cancer cells proliferation, induced cell cycle arrest and promoted cellular senescence, whereas overexpression of TRIB2 accelerated cell growth, cell cycle progression and blocked cellular senescence. Further studies showed that TRIB2 physically interacted with AP4 and inhibited p21 expression through enhancing transcription activities of AP4.
    [Show full text]
  • Characterization of TRIB2-Mediated Resistance to Pharmacological Inhibition of MEK
    VANESSA MENDES HENRIQUES Characterization of TRIB2-mediated resistance to pharmacological inhibition of MEK Oncobiology Master Thesis Faro, 2017 VANESSA MENDES HENRIQUES Characterization of TRIB2-mediated resistance to pharmacological inhibition of MEK Supervisors: Dr. Wolfgang Link Dr. Bibiana Ferreira Oncobiology Master Thesis Faro, 2017 Título: “Characterization of TRIB2-mediated resistance to pharmacological inhibition of MEK” Declaração de autoria do trabalho Declaro ser a autora deste trabalho, que é original e inédito. Autores e trabalhos consultados estão devidamente citados no texto e constam da listagem de referências incluída. Copyright Vanessa Mendes Henriques _____________________________ A Universidade do Algarve tem o direito, perpétuo e sem limites geográficos, de arquivar e publicitar este trabalho através de exemplares impressos reproduzidos em papel ou de forma digital, ou por qualquer outro meio conhecido ou que venha a ser inventado, de o divulgar através de repositórios científicos e de admitir a sua cópia e distribuição com objetivos educacionais ou de investigação, não comerciais, desde que seja dado crédito ao autor e editor. i Acknowledgements First, I would like to thank the greatest opportunity given by professor doctor Wolfgang Link to accepting me into his team, contributing to my scientific and personal progress. Thank You for all Your knowledge and help across the year. A special thanks to Bibiana Ferreira who stayed by me all year and trained me. Thank You for all you taught me, thank you for all your patience and time and all the support. Thank you for all the great times that You provided me. It was an amazing experience to learn and work with You, which made me grow as a scientist and also as a person.
    [Show full text]
  • TRIB3 Stabilizes High TWIST1 Expression to Promote Rapid APL Progression and ATRA Resistance
    Author Manuscript Published OnlineFirst on June 24, 2019; DOI: 10.1158/1078-0432.CCR-19-0510 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. TRIB3 Stabilizes High TWIST1 Expression to Promote Rapid APL Progression and ATRA Resistance Jian Lin1, 3, Wu Zhang1, 3, *, Li-Ting Niu1, Yong-Mei Zhu1, Xiang-Qin Weng1, Yan Sheng1, Jiang Zhu1 and Jie Xu1, 2, * 1State Key Laboratory for Medical Genomics, Shanghai Institute of Hematology, National Research Center for Translational Medicine, Rui-Jin Hospital, Shanghai Jiao-Tong University School of Medicine and School of Life Sciences and Biotechnology, Shanghai Jiao-Tong University, 197 Ruijin Er Road, Shanghai 200025, China. 2Translational Medicine Ward, Department of Hematology, Rui-Jin Hospital, Shanghai 200025, China. 3These authors contributed equally to this work. *Correspondence: Jie Xu, State Key Laboratory for Medical Genomics and Shanghai Institute of Hematology Rui-Jin Hospital, affiliated to Shanghai Jiao-Tong University School of Medicine, Shanghai, 200025, China. E-mail: [email protected]; and Wu Zhang, State Key Laboratory for Medical Genomics and Shanghai Institute of Hematology Rui-Jin Hospital, affiliated to Shanghai Jiao-Tong University School of Medicine, Shanghai, 200025, China. E-mail: [email protected]; Running title: TRIB3 stabilizes TWIST1 to promote APL progression Key words: Acute promyelocytic leukemia; TWIST1; TRIB3; Early death; ATRA-resistance Conflict of interest statement: The authors declare no potential conflicts of interest. 1 Downloaded from clincancerres.aacrjournals.org on October 1, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on June 24, 2019; DOI: 10.1158/1078-0432.CCR-19-0510 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • The New Antitumor Drug ABTL0812 Inhibits the Akt/Mtorc1 Axis By
    Published OnlineFirst December 15, 2015; DOI: 10.1158/1078-0432.CCR-15-1808 Cancer Therapy: Preclinical Clinical Cancer Research The New Antitumor Drug ABTL0812 Inhibits the Akt/mTORC1 Axis by Upregulating Tribbles-3 Pseudokinase Tatiana Erazo1, Mar Lorente2,3, Anna Lopez-Plana 4, Pau Munoz-Guardiola~ 1,5, Patricia Fernandez-Nogueira 4, Jose A. García-Martínez5, Paloma Bragado4, Gemma Fuster4, María Salazar2, Jordi Espadaler5, Javier Hernandez-Losa 6, Jose Ramon Bayascas7, Marc Cortal5, Laura Vidal8, Pedro Gascon 4,8, Mariana Gomez-Ferreria 5, Jose Alfon 5, Guillermo Velasco2,3, Carles Domenech 5, and Jose M. Lizcano1 Abstract Purpose: ABTL0812 is a novel first-in-class, small molecule tion of Tribbles-3 pseudokinase (TRIB3) gene expression. Upre- which showed antiproliferative effect on tumor cells in pheno- gulated TRIB3 binds cellular Akt, preventing its activation by typic assays. Here we describe the mechanism of action of this upstream kinases, resulting in Akt inhibition and suppression of antitumor drug, which is currently in clinical development. the Akt/mTORC1 axis. Pharmacologic inhibition of PPARa/g or Experimental Design: We investigated the effect of ABTL0812 TRIB3 silencing prevented ABTL0812-induced cell death. on cancer cell death, proliferation, and modulation of intracel- ABTL0812 treatment induced Akt inhibition in cancer cells, tumor lular signaling pathways, using human lung (A549) and pancre- xenografts, and peripheral blood mononuclear cells from patients atic (MiaPaCa-2) cancer cells and tumor xenografts. To identify enrolled in phase I/Ib first-in-human clinical trial. cellular targets, we performed in silico high-throughput screening Conclusions: ABTL0812 has a unique and novel mechanism of comparing ABTL0812 chemical structure against ChEMBL15 action, that defines a new and drugable cellular route that links database.
    [Show full text]
  • TRIB2 Confers Resistance to Anti-Cancer Therapy by Activating the Serine/Threonine Protein Kinase AKT
    ARTICLE Received 23 Nov 2015 | Accepted 23 Jan 2017 | Published 9 Mar 2017 DOI: 10.1038/ncomms14687 OPEN TRIB2 confers resistance to anti-cancer therapy by activating the serine/threonine protein kinase AKT Richard Hill1,2,3, Patricia A. Madureira2, Bibiana Ferreira2, Ineˆs Baptista2, Susana Machado2, Laura Colac¸o2, Marta dos Santos2, Ningshu Liu4, Ana Dopazo5, Selma Ugurel6, Angyal Adrienn7, Endre Kiss-Toth7, Murat Isbilen8, Ali O. Gure8 & Wolfgang Link1,2,9 Intrinsic and acquired resistance to chemotherapy is the fundamental reason for treatment failure for many cancer patients. The identification of molecular mechanisms involved in drug resistance or sensitization is imperative. Here we report that tribbles homologue 2 (TRIB2) ablates forkhead box O activation and disrupts the p53/MDM2 regulatory axis, conferring resistance to various chemotherapeutics. TRIB2 suppression is exerted via direct interaction with AKT a key signalling protein in cell proliferation, survival and metabolism pathways. Ectopic or intrinsic high expression of TRIB2 induces drug resistance by promoting phospho- AKT (at Ser473) via its COP1 domain. TRIB2 expression is significantly increased in tumour tissues from patients correlating with an increased phosphorylation of AKT, FOXO3a, MDM2 and an impaired therapeutic response. This culminates in an extremely poor clinical outcome. Our study reveals a novel regulatory mechanism underlying drug resistance and suggests that TRIB2 functions as a regulatory component of the PI3K network, activating AKT in cancer cells. 1 Department of Biomedical Sciences and Medicine (DCBM), University of Algarve, Campus de Gambelas, Faro 8005-139, Portugal. 2 Centre for Biomedical Research (CBMR), University of Algarve, Campus de Gambelas, Faro 8005-139, Portugal.
    [Show full text]
  • The Cell Biology Behind the Oncogenic PIP3 Lipids Ana C
    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs228395. doi:10.1242/jcs.228395 MEETING REPORT The cell biology behind the oncogenic PIP3 lipids Ana C. Carrera1,* and Richard Anderson2 ABSTRACT favors the interaction of PI3K with the plasma membrane. Thus, α The different mechanisms of phosphoinositide 3-kinase (PI3K) blocking the plasma membrane recruitment of PI3K could be an activation in cancer as well as the events that result in PI3K effective therapeutic approach. pathway reactivation after patient treatment with PI3K inhibitors was Activation of PI3K is triggered by ligand binding to receptor discussed on October 15–17th, 2018, in the medieval town of Baeza tyrosine kinases (RTKs; EGF receptor etc.) and is enhanced by Ras (Universidad Internacional de Andalucıa,́ Spain) at the workshop (Jiménez et al., 2002). The work of Jonathan M. Backer (Albert entitled ‘The cell biology behind the oncogenic PIP3 lipids’. These Einstein College of Medicine, NY) showed that, in addition to topics and the data presented regarding cellular functions altered by RTK-mediated activation, agonist binding to G protein-coupled β PI3K deregulation, the cooperation of PI3K/PTEN mutations with receptors (GPCRs) also activates PI3K ; simultaneous switch on β other tumor drivers, and the lessons learned for PI3K-targeted of RTK and GPCRs induces optimal PI3K activation (Houslay β therapy, are discussed below. et al., 2016) (Fig. 1). PI3K is not frequently mutated in cancer; however, its overexpression is found in several cancer types and can trigger cell transformation (Liu et al., 2009; Denley et al., 2007). Jonathan’s studies on the contribution of PI3Kβ to breast INTRODUCTION cancer metastasis illustrate that GPCR signaling to PI3Kβ is The phosphoinositide 3-kinase (PI3K) family comprises eight kinases required for the formation of invadopodia (Khalil et al., 2016).
    [Show full text]
  • Identification of Oncogenic Driver Mutations by Genome-Wide CRISPR-Cas9 Dropout Screening Michael K
    Kiessling et al. BMC Genomics (2016) 17:723 DOI 10.1186/s12864-016-3042-2 METHODOLOGY ARTICLE Open Access Identification of oncogenic driver mutations by genome-wide CRISPR-Cas9 dropout screening Michael K. Kiessling1, Sven Schuierer2, Silke Stertz3, Martin Beibel2, Sebastian Bergling2, Judith Knehr2, Walter Carbone2, Cheryl de Vallière1, Joelle Tchinda4, Tewis Bouwmeester2, Klaus Seuwen2, Gerhard Rogler1*† and Guglielmo Roma2*† Abstract Background: Genome-wide CRISPR-Cas9 dropout screens can identify genes whose knockout affects cell viability. Recent CRISPR screens detected thousands of essential genes required for cellular survival and key cellular processes; however discovering novel lineage-specific genetic dependencies from the many hits still remains a challenge. Results: To assess whether CRISPR-Cas9 dropout screens can help identify cancer dependencies, we screened two human cancer cell lines carrying known and distinct oncogenic mutations using a genome-wide sgRNA library. We found that the gRNA targeting the driver mutation EGFR was one of the highest-ranking candidates in the EGFR- mutant HCC-827 lung adenocarcinoma cell line. Likewise, sgRNAs for NRAS and MAP2K1 (MEK1), a downstream kinase of mutant NRAS, were identified among the top hits in the NRAS-mutant neuroblastoma cell line CHP-212. Depletion of these genes targeted by the sgRNAs strongly correlated with the sensitivity to specific kinase inhibitors of the EGFR or RAS pathway in cell viability assays. In addition, we describe other dependencies such as TBK1 in HCC-827 cells and TRIB2 in CHP-212 cells which merit further investigation. Conclusions: We show that genome-wide CRISPR dropout screens are suitable for the identification of oncogenic drivers and other essential genes.
    [Show full text]
  • Highlights of the 2Nd International Symposium on Tribbles and Diseases: Tribbles Tremble in Therapeutics for Immunity, Metabolism, Fundamental Cell Biology and Cancer
    Acta Pharmaceutica Sinica B 2019;9(2):443–454 Chinese Pharmaceutical Association Institute of Materia Medica, Chinese Academy of Medical Sciences Acta Pharmaceutica Sinica B www.elsevier.com/locate/apsb www.sciencedirect.com MEETING REPORT Highlights of the 2nd International Symposium on Tribbles and Diseases: tribbles tremble in therapeutics for immunity, metabolism, fundamental cell biology and cancer Bing Cuia, Patrick A. Eyersb, Leonard L. Dobensc, Nguan Soon Tand,e,f,g, Peter D. Maceh, Wolfgang A. Linki,j,k, Endre Kiss-Tothl, Karen Keeshanm, Takuro Nakamuran, Warren S. Pearo, Yodit Fesehap,q, Jessica Johnstonl, Arkatiz Carracedor,s,t,u, Marcel Scheidelerv,w,x,y, Zabran llyasl, Robert C. Bauerz, Jorge D. Erusalimskyaa, Dominika Grzesikab, Juan Salamanca-Viloriaac,ad, Xiaoxi Lva, Yishi Jinae,KeLia,af, Guillermo Velascoag, Shuang Shanga, Jose M. Lizcanoah, Xiaowei Zhanga, Jichao Zhoua, Jiaojiao Yua, Fang Huaa, Feng Wanga, Shanshan Liua, Jinmei Yua, Zhuowei Hua,n aState Key Laboratory of Bioactive Substance and Function of Natural Medicines, Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100050, China bDepartment of Biochemistry, Institute of Integrative Biology, University of Liverpool, Liverpool L69 7ZB, UK cDivision of Molecular Biology and Biochemistry, School of Biological Sciences, University of Missouri-Kansas City, Kansas City, MO 64110, USA dSchool of Biological Sciences, Nanyang Technological University, Singapore 637551, Singapore eLee Kong Chian School of Medicine,
    [Show full text]
  • TRIB2 Modulates Proteasome Function to Reduce Ubiquitin Stability And
    Guo et al. Cell Death and Disease (2021) 12:42 https://doi.org/10.1038/s41419-020-03299-8 Cell Death & Disease ARTICLE Open Access TRIB2 modulates proteasome function to reduce ubiquitin stability and protect liver cancer cells against oxidative stress Susu Guo1,YuxinChen2,YueyueYang1,XiaoZhang3,LifangMa3,XiangfeiXue1, Yongxia Qiao4 and Jiayi Wang 1,3 Abstract The regulation of homeostasis in the Ubiquitin (Ub) proteasome system (UPS) is likely to be important for the development of liver cancer. Tribbles homolog 2 (TRIB2) is known to affect Ub E3 ligases (E3s) in liver cancer. However, whether TRIB2 regulates the UPS in other ways and the relevant mechanisms are still unknown. Here, we reveal that TRIB2 decreased Ub levels largely by stimulating proteasome degradation of Ub. In the proteasome, proteasome 20S subunit beta 5 (PSMB5) was critical for the function of TRIB2, although it did not directly interact with TRIB2. However, poly (rC) binding protein 2 (PCBP2), which was identified by mass spectrometry, directly interacted with both TRIB2 and PSMB5. PCBP2 was a prerequisite for the TRIB2 induction of PSMB5 activity and decreased Ub levels. A significant correlation between TRIB2 and PCBP2 was revealed in liver cancer specimens. Interestingly, TRIB2 suppressed the K48- ubiquitination of PCBP2 to increase its level. Therefore, a model showing that TRIB2 cooperates and stimulates PCBP2 to reduce Ub levels was established. Additionally, the reduction in Ub levels induced by TRIB2 and PCBP2 was dependent on K48-ubiquitination. PCBP2 was one of the possible downstream factors of TRIB2 and their interaction relied on the DQLVPD element of TRIB2 and the KH3 domain of PCBP2.
    [Show full text]
  • Tribbles Homolog 2 (Trib2), a Pseudo Serine/Threonine Kinase In
    Fang et al. Cell Commun Signal (2021) 19:41 https://doi.org/10.1186/s12964-021-00725-y REVIEW Open Access Tribbles homolog 2 (Trib2), a pseudo serine/ threonine kinase in tumorigenesis and stem cell fate decisions Yu Fang1,2*, Angelina Olegovna Zekiy3, Farhoodeh Ghaedrahmati4, Anton Timoshin5, Maryam Farzaneh6 , Amir Anbiyaiee7 and Seyed Esmaeil Khoshnam8 Abstract The family of Tribbles proteins play many critical nonenzymatic roles and regulate a wide range of key signaling pathways. Tribbles homolog 2 (Trib2) is a pseudo serine/threonine kinase that functions as a scafold or adaptor in various physiological and pathological processes. Trib2 can interact with E3 ubiquitin ligases and control protein sta- bility of downstream efectors. This protein is induced by mitogens and enhances the propagation of several cancer cells, including myeloid leukemia, liver, lung, skin, bone, brain, and pancreatic. Thus, Trib2 can be a predictive and valuable biomarker for the diagnosis and treatment of cancer. Recent studies have illustrated that Trib2 plays a major role in cell fate determination of stem cells. Stem cells have the capacity to self-renew and diferentiate into specifc cell types. Stem cells are important sources for cell-based regenerative medicine and drug screening. Trib2 has been found to increase the self-renewal ability of embryonic stem cells, the reprogramming efciency of somatic cells, and chondrogenesis. In this review, we will focus on the recent advances of Trib2 function in tumorigenesis and stem cell fate decisions. Keywords: Pluripotent stem cells, Tribbles homolog 2, Tumorigenesis, Pluripotency, Reprogramming, Stem cell fate, Regenerative medicine Background E3 ubiquitin ligases and control protein stability of down- Tribbles homolog 2 (Trib2) is a pseudo serine/threo- stream efectors [7].
    [Show full text]
  • 1 Title: the BRAF and MEK Inhibitors Dabrafenib and Trametinib
    Author Manuscript Published OnlineFirst on January 14, 2015; DOI: 10.1158/1078-0432.CCR-14-2339 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 1 Title: The BRAF and MEK Inhibitors Dabrafenib and Trametinib: Effects on Immune Function and in Combination with Immunomodulatory Antibodies Targeting PD1, PD-L1 and CTLA-4 Authors: Li Liu1*, Patrick A Mayes1*, Stephen Eastman1, Hong Shi1, Sapna Yadavilli1, Tianqian Zhang1, Jingsong Yang1, Laura Seestaller-Wehr1, Shu-Yun Zhang1, Chris Hopson1, Lyuben Tsvetkov1, Junping Jing2, Shu Zhang3 , James Smothers1, and Axel Hoos1 Affiliations: GlaxoSmithKline, 1Immuno-Oncology & Combination DPU, 2Molecular Medicine Unit, Oncology R&D, 3Statistical Science, Collegeville, PA19426, Pennsylvania, USA, * These authors contributed equally Running title: Dabrafenib and trametinib effect on immune function Financial support: This study was financially supported by GlaxoSmithKline. Corresponding author: Axel Hoos, GlaxoSmithKline, Immuno-Oncology & Combination DPU, 1250 S. Collegeville Rd., Collegeville, PA, USA, 19426. Tel: +1 610 427 3733. Email: [email protected]. Conflict of interest disclosure: L. Liu, P. Mayes, S. Eastman, H. Shi, S. Yadavilli, J. Yang, L. Seestaller-Wehr, C. Hopson, J. Jing, S. Zhang and J. Smothers are employees and stockholders of GlaxoSmithKline. T. Zhang, S-Y. Zhang, L. Tsvetkov and A. Hoos are employees of GlaxoSmithKline. Word count: 4985 Total number of figures and tables: 6 Downloaded from clincancerres.aacrjournals.org on September 27, 2021. © 2015 American Association for Cancer Research. Author Manuscript Published OnlineFirst on January 14, 2015; DOI: 10.1158/1078-0432.CCR-14-2339 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]