Use of Signals of Positive and Negative Selection to Distinguish Cancer
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Thesis Template
Functional and Structural Characterization Reveals Novel FBXW7 Biology by Tonny Chao Huang A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Medical Biophysics University of Toronto © Copyright by Tonny Chao Huang 2018 Functional and Structural Characterization Reveals Novel FBXW7 Biology Tonny Chao Huang Master of Science Department of Medical Biophysics University of Toronto 2018 Abstract This thesis aims to examine aspects of FBXW7 biology, a protein that is frequently mutated in a variety of cancers. The first part of this thesis describes the characterization of FBXW7 isoform and mutant substrate profiles using a proximity-dependent biotinylation assay. Isoform-specific substrates were validated, revealing the involvement of FBXW7 in the regulation of several protein complexes. Characterization of FBXW7 mutants also revealed site- and residue-specific consequences on the binding of substrates and, surprisingly, possible neo-substrates. In the second part of this thesis, we utilize high-throughput peptide binding assays and statistical modelling to discover novel features of the FBXW7-binding phosphodegron. In contrast to the canonical motif, a possible preference of FBXW7 for arginine residues at the +4 position was discovered. I then attempted to validate this feature in vivo and in vitro on a novel substrate discovered through BioID. ii Acknowledgments The past three years in the Department of Medical Biophysics have defied expectations. I not only had the opportunity to conduct my own independent research, but also to work with distinguished collaborators and to explore exciting complementary fields. I experienced the freedom to guide my own academic development, as well as to pursue my extracurricular interests. -
Deciphering the Functions of Ets2, Pten and P53 in Stromal Fibroblasts in Multiple
Deciphering the Functions of Ets2, Pten and p53 in Stromal Fibroblasts in Multiple Breast Cancer Models DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Julie Wallace Graduate Program in Molecular, Cellular and Developmental Biology The Ohio State University 2013 Dissertation Committee: Michael C. Ostrowski, PhD, Advisor Gustavo Leone, PhD Denis Guttridge, PhD Dawn Chandler, PhD Copyright by Julie Wallace 2013 Abstract Breast cancer is the second most common cancer in American women, and is also the second leading cause of cancer death in women. It is estimated that nearly a quarter of a million new cases of invasive breast cancer will be diagnosed in women in the United States this year, and approximately 40,000 of these women will die from breast cancer. Although death rates have been on the decline for the past decade, there is still much we need to learn about this disease to improve prevention, detection and treatment strategies. The majority of early studies have focused on the malignant tumor cells themselves, and much has been learned concerning mutations, amplifications and other genetic and epigenetic alterations of these cells. However more recent work has acknowledged the strong influence of tumor stroma on the initiation, progression and recurrence of cancer. Under normal conditions this stroma has been shown to have protective effects against tumorigenesis, however the transformation of tumor cells manipulates this surrounding environment to actually promote malignancy. Fibroblasts in particular make up a significant portion of this stroma, and have been shown to impact various aspects of tumor cell biology. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
TRIB2 Functions As Novel Oncogene in Colorectal Cancer by Blocking
Hou et al. Molecular Cancer (2018) 17:172 https://doi.org/10.1186/s12943-018-0922-x RESEARCH Open Access TRIB2 functions as novel oncogene in colorectal cancer by blocking cellular senescence through AP4/p21 signaling Zhenlin Hou1, Kaixuan Guo1, Xuling Sun1, Fuqing Hu1, Qianzhi Chen1, Xuelai Luo1, Guihua Wang1, Junbo Hu1 and Li Sun2* Abstract Background: Cellular senescence is a state of irreversible cell growth arrest and senescence cells permanently lose proliferation potential. Induction of cellular senescence might be a novel therapy for cancer cells. TRIB2 has been reported to participate in regulating proliferation and drug resistance of various cancer cells. However, the role of TRIB2 in cellular senescence of colorectal cancer (CRC) and its molecular mechanism remains unclear. Methods: The expression of TRIB2 in colorectal cancer tissues and adjacent tissues was detected by immunohistochemistry and RT-PCR. The growth, cell cycle distribution and cellular senescence of colorectal cancer cells were evaluated by Cell Counting Kit-8 (CCK8) assay, flow cytometry detection and senescence- associated β-galactosidase staining, respectively. Western blot, RT-PCR and luciferase assay were performed to determine how TRIB2 regulates p21. Immunoprecipitation (IP) and chromatin-immunoprecipitation (ChIP) were used to investigate the molecular mechanisms. Results: We found that TRIB2 expression was elevated in CRC tissues compared to normal adjacent tissues and high TRIB2 expression indicated poor prognosis of CRC patients. Functionally, depletion of TRIB2 inhibited cancer cells proliferation, induced cell cycle arrest and promoted cellular senescence, whereas overexpression of TRIB2 accelerated cell growth, cell cycle progression and blocked cellular senescence. Further studies showed that TRIB2 physically interacted with AP4 and inhibited p21 expression through enhancing transcription activities of AP4. -
Machine-Learning and Chemicogenomics Approach Defi Nes and Predicts Cross-Talk of Hippo and MAPK Pathways
Published OnlineFirst November 18, 2020; DOI: 10.1158/2159-8290.CD-20-0706 RESEARCH ARTICLE Machine -Learning and Chemicogenomics Approach Defi nes and Predicts Cross-Talk of Hippo and MAPK Pathways Trang H. Pham 1 , Thijs J. Hagenbeek 1 , Ho-June Lee 1 , Jason Li 2 , Christopher M. Rose 3 , Eva Lin 1 , Mamie Yu 1 , Scott E. Martin1 , Robert Piskol 2 , Jennifer A. Lacap 4 , Deepak Sampath 4 , Victoria C. Pham 3 , Zora Modrusan 5 , Jennie R. Lill3 , Christiaan Klijn 2 , Shiva Malek 1 , Matthew T. Chang 2 , and Anwesha Dey 1 ABSTRACT Hippo pathway dysregulation occurs in multiple cancers through genetic and non- genetic alterations, resulting in translocation of YAP to the nucleus and activation of the TEAD family of transcription factors. Unlike other oncogenic pathways such as RAS, defi ning tumors that are Hippo pathway–dependent is far more complex due to the lack of hotspot genetic alterations. Here, we developed a machine-learning framework to identify a robust, cancer type–agnostic gene expression signature to quantitate Hippo pathway activity and cross-talk as well as predict YAP/TEAD dependency across cancers. Further, through chemical genetic interaction screens and multiomics analyses, we discover a direct interaction between MAPK signaling and TEAD stability such that knockdown of YAP combined with MEK inhibition results in robust inhibition of tumor cell growth in Hippo dysregulated tumors. This multifaceted approach underscores how computational models combined with experimental studies can inform precision medicine approaches including predictive diagnostics and combination strategies. SIGNIFICANCE: An integrated chemicogenomics strategy was developed to identify a lineage- independent signature for the Hippo pathway in cancers. -
Effect of Citric Acid Cycle Genetic Variants and Their Interactions With
cancers Article Effect of Citric Acid Cycle Genetic Variants and Their Interactions with Obesity, Physical Activity and Energy Intake on the Risk of Colorectal Cancer: Results from a Nested Case-Control Study in the UK Biobank Sooyoung Cho 1 , Nan Song 2,3 , Ji-Yeob Choi 2,4,5 and Aesun Shin 1,2,* 1 Department of Preventive Medicine, Seoul National University College of Medicine, Seoul 03080, Korea; [email protected] 2 Cancer Research Institute, Seoul National University, Seoul 03080, Korea; [email protected] (N.S.); [email protected] (J.-Y.C.) 3 Department of Epidemiology and Cancer Control, St. Jude Children’s Research Hospital, Memphis, TN 38105, USA 4 Department of Biomedical Sciences, Graduate School of Seoul National University, Seoul 03080, Korea 5 Medical Research Center, Institute of Health Policy and Management, Seoul National University, Seoul 03080, Korea * Correspondence: [email protected]; Tel.: +82-2-740-8331; Fax: +82-2-747-4830 Received: 18 August 2020; Accepted: 9 October 2020; Published: 12 October 2020 Simple Summary: The citric acid cycle has a central role in the cellular energy metabolism and biosynthesis of macromolecules in the mitochondrial matrix. We identified the single nucleotide polymorphisms (SNPs) of the citrate acid cycle with colorectal cancer susceptibility in UK population. Furthermore, we found the significant interaction of SNPs in the citric acid cycle with the contributors to energy balance and SNP-SNP interactions. Our findings provide clues to the etiology in cancer development related to energy metabolism and evidence on identification of the population at high risk of colorectal cancer. -
Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. -
Mtor Coordinates Transcriptional Programs and Mitochondrial Metabolism of Activated Treg Subsets to Protect Tissue Homeostasis
ARTICLE DOI: 10.1038/s41467-018-04392-5 OPEN mTOR coordinates transcriptional programs and mitochondrial metabolism of activated Treg subsets to protect tissue homeostasis Nicole M. Chapman1, Hu Zeng 1, Thanh-Long M. Nguyen1, Yanyan Wang1, Peter Vogel 2, Yogesh Dhungana1, Xiaojing Liu3, Geoffrey Neale 4, Jason W. Locasale 3 & Hongbo Chi1 1234567890():,; Regulatory T (Treg) cells derived from the thymus (tTreg) and periphery (pTreg) have central and distinct functions in immunosuppression, but mechanisms for the generation and acti- vation of Treg subsets in vivo are unclear. Here, we show that mechanistic target of rapamycin (mTOR) unexpectedly supports the homeostasis and functional activation of tTreg and pTreg cells. mTOR signaling is crucial for programming activated Treg-cell function to protect immune tolerance and tissue homeostasis. Treg-specific deletion of mTOR drives sponta- neous effector T-cell activation and inflammation in barrier tissues and is associated with reduction in both thymic-derived effector Treg (eTreg) and pTreg cells. Mechanistically, mTOR functions downstream of antigenic signals to drive IRF4 expression and mitochondrial metabolism, and accordingly, deletion of mitochondrial transcription factor A (Tfam) severely impairs Treg-cell suppressive function and eTreg-cell generation. Collectively, our results show that mTOR coordinates transcriptional and metabolic programs in activated Treg subsets to mediate tissue homeostasis. 1 Department of Immunology, St. Jude Children’s Research Hospital, 262 Danny Thomas Place, MS 351, Memphis, TN 38105, USA. 2 Department of Pathology, St. Jude Children’s Research Hospital, 262 Danny Thomas Place, MS 250, Memphis, TN 38105, USA. 3 Department of Pharmacology & Cancer Biology, Duke University School of Medicine, Levine Science Research Center C266, Box 3813, Durham, NC 27710, USA. -
Glioblastoma Stem Cells Induce Quiescence in Surrounding Neural Stem Cells Via Notch Signalling
bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 29, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Glioblastoma stem cells induce quiescence in surrounding neural stem cells via Notch signalling. Katerina Lawlor1, Maria Angeles Marques-Torrejon2, Gopuraja Dharmalingham3, Yasmine El-Azhar1, Michael D. Schneider1, Steven M. Pollard2§ and Tristan A. Rodríguez1§ 1National Heart and Lung Institute, Imperial College London, Hammersmith Hospital Campus, Du Cane Road, London W12 0NN, United Kingdom. 2 MRC Centre for Regenerative Medicine & Edinburgh Cancer Research UK Centre, University of Edinburgh, Edinburgh, UK. 3MRC London Institute of Medical Sciences, Institute of Clinical Sciences, Imperial College London, UK §Authors for correspondence: [email protected] and [email protected] Running title: Glioblastoma stem cell competition Keyword: Neural stem cells, quiescence, glioblastoma, Notch, cell competition 1 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 29, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Abstract 2 There is increasing evidence suggesting that adult neural stem cells (NSCs) are a cell of 3 origin of glioblastoma, the most aggressive form of malignant glioma. The earliest stages of 4 hyperplasia are not easy to explore, but likely involve a cross-talk between normal and 5 transformed NSCs. How normal cells respond to this cross-talk and if they expand or are 6 outcompeted is poorly understood. -
Anti-IDH3A Antibody (ARG42205)
Product datasheet [email protected] ARG42205 Package: 100 μl anti-IDH3A antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes IDH3A Tested Reactivity Hu, Ms, Rat Tested Application ICC/IF, IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name IDH3A Antigen Species Human Immunogen Recombinant fusion protein corresponding to aa. 28-366 of Human IDH3A (NP_005521.1). Conjugation Un-conjugated Alternate Names Isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial; EC 1.1.1.41; NAD; Isocitric dehydrogenase subunit alpha; + Application Instructions Application table Application Dilution ICC/IF 1:50 - 1:200 IHC-P 1:50 - 1:200 WB 1:500 - 1:2000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control Raji Calculated Mw 40 kDa Observed Size ~ 40 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.3), 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw www.arigobio.com 1/3 cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol IDH3A Gene Full Name isocitrate dehydrogenase 3 (NAD+) alpha Background Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. -
To Study Mutant P53 Gain of Function, Various Tumor-Derived P53 Mutants
Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By Shama K Khokhar M.Sc., Bilaspur University, 2004 B.Sc., Bhopal University, 2002 2007 1 COPYRIGHT SHAMA K KHOKHAR 2007 2 WRIGHT STATE UNIVERSITY SCHOOL OF GRADUATE STUDIES Date of Defense: 12-03-07 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY SHAMA KHAN KHOKHAR ENTITLED Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science Madhavi P. Kadakia, Ph.D. Thesis Director Daniel Organisciak , Ph.D. Department Chair Committee on Final Examination Madhavi P. Kadakia, Ph.D. Steven J. Berberich, Ph.D. Michael Leffak, Ph.D. Joseph F. Thomas, Jr., Ph.D. Dean, School of Graduate Studies 3 Abstract Khokhar, Shama K. M.S., Department of Biochemistry and Molecular Biology, Wright State University, 2007 Differential effect of TAp63γ mutants on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. p63, a member of the p53 gene family, known to play a role in development, has more recently also been implicated in cancer progression. Mice lacking p63 exhibit severe developmental defects such as limb truncations, abnormal skin, and absence of hair follicles, teeth, and mammary glands. Germline missense mutations of p63 have been shown to be responsible for several human developmental syndromes including SHFM, EEC and ADULT syndromes and are associated with anomalies in the development of organs of epithelial origin. -
Profiling Data
Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8