DOCSLIB.ORG

Thesis Template

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Thesis Template Functional and Structural Characterization Reveals Novel FBXW7 Biology by Tonny Chao Huang A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Medical Biophysics University of Toronto © Copyright by Tonny Chao Huang 2018 Functional and Structural Characterization Reveals Novel FBXW7 Biology Tonny Chao Huang Master of Science Department of Medical Biophysics University of Toronto 2018 Abstract This thesis aims to examine aspects of FBXW7 biology, a protein that is frequently mutated in a variety of cancers. The first part of this thesis describes the characterization of FBXW7 isoform and mutant substrate profiles using a proximity-dependent biotinylation assay. Isoform-specific substrates were validated, revealing the involvement of FBXW7 in the regulation of several protein complexes. Characterization of FBXW7 mutants also revealed site- and residue-specific consequences on the binding of substrates and, surprisingly, possible neo-substrates. In the second part of this thesis, we utilize high-throughput peptide binding assays and statistical modelling to discover novel features of the FBXW7-binding phosphodegron. In contrast to the canonical motif, a possible preference of FBXW7 for arginine residues at the +4 position was discovered. I then attempted to validate this feature in vivo and in vitro on a novel substrate discovered through BioID. ii Acknowledgments The past three years in the Department of Medical Biophysics have defied expectations. I not only had the opportunity to conduct my own independent research, but also to work with distinguished collaborators and to explore exciting complementary fields. I experienced the freedom to guide my own academic development, as well as to pursue my extracurricular interests. Perhaps most significantly, the amount of personal development I have experienced during this journey has significantly changed my views of my myself and my place within the world. For this, there are those who I will be forever grateful for their guidance, mentorship, and friendship. I would like to first thank my supervisor, Brian. His knowledge and expertise helped guide my research, but it was his kindness and support that allowed me the freedom to complete my graduate studies in my own way. I would also like to thank all members of the Raught Lab that I have had the privilege to cross paths with. The camaraderie shared between the graduate students in the Lab has helped me greatly in completing my degree, so for that I would like to thank Meg, Aaron, Deb, Diana, and Adam. I would also like to thank Étienne, Estelle, and Faith for their technical support and for helping me to get started working in the Lab. I have also befriended many wonderful people within the Department who have helped me along the way, including Nina, Parasvi, Justin, Stanley, Javier, and Danton, to name a few. Lastly, I would like to thank my family for their unending support, without which none of this would have been possible. If any regrets were to be had, it would be that I was ultimately unsuccessful in what I had sought out to accomplish at the outset of my studies. While my goals and ambitions now lie elsewhere, I remain hopeful that the contents contained within this thesis may one day be shared beyond the limits of this document. iii Table of Contents Acknowledgments.......................................................................................................................... iii Table of Contents ........................................................................................................................... iv List of Figures ............................................................................................................................... vii List of Tables ................................................................................................................................. ix Abbreviations ...................................................................................................................................x List of Appendices ........................................................................................................................ xii Chapter 1 – Introduction ..................................................................................................................1 Introduction .................................................................................................................................2 1.1 The ubiquitin-proteasome system ........................................................................................2 1.1.1 Ubiquitin-mediated proteolysis ................................................................................3 1.1.2 The ubiquitylation cascade ......................................................................................9 1.1.3 Ubiquitin E3 ligase types .......................................................................................12 1.2 The FBXW7 protein ..........................................................................................................18 1.2.1 F-box proteins and the SCF complex.....................................................................18 1.2.2 Structure and organization of the FBXW7 protein ................................................26 1.2.3 FBXW7 substrates in health and disease ...............................................................30 1.3 Proteomic approaches in studying protein-protein interactions.........................................35 1.3.1 Strategies for the study of protein-protein interactions in vivo ..............................35 1.3.2 Proximity-dependent biotinylation assays .............................................................40 1.3.3 Protein identification via mass spectrometry .........................................................45 1.4 Thesis motivation and outline ............................................................................................48 Chapter 2 – Elucidation of substrate profiles of FBXW7 and mutants through BioID .................49 Elucidation of substrate profiles of FBXW7 isoforms and mutants through BioID .................50 2.1 Chapter overview ...............................................................................................................50 2.2 Contributions......................................................................................................................50 iv 2.3 Materials and methods .......................................................................................................52 2.3.1 Plasmids .................................................................................................................52 2.3.2 Cell lines ................................................................................................................52 2.3.3 BioID and biotin-streptavidin affinity purification ................................................52 2.3.4 Mass spectrometry .................................................................................................53 2.3.5 Immunoblotting......................................................................................................54 2.3.6 Substrate validation via cycloheximide chase .......................................................54 2.3.7 Immunofluorescence imaging ................................................................................55 2.3.8 Data analysis and visualization ..............................................................................55 2.4 Results ................................................................................................................................56 2.4.1 Expression and localization of FlagBirA-FBXW7 isoforms .................................56 2.4.2 FBXW7 isoforms exhibit distinct substrate profiles ..............................................59 2.4.3 CHX chase reveals novel FBXW7 interactors.......................................................64 2.4.4 Effect of hotspot mutations on substrate binding is site- and residue-specific ......70 2.5 Discussion ..........................................................................................................................72 Chapter 3 – Discovery of novel FBXW7 phosphodegron features ...............................................77 Discovery of novel FBXW7 phosphodegron features ..............................................................78 3.1 Chapter overview ...............................................................................................................78 3.2 Contributions......................................................................................................................78 3.3 Materials and methods .......................................................................................................79 3.3.1 Generation of peptide-binding models...................................................................79 3.3.2 Peptide array synthesis and binding .......................................................................79 3.3.3 Mutant phosphodegron cloning and CHX chase ...................................................80 3.3.4 Fluorescence polarization ......................................................................................80 3.4 Results ................................................................................................................................81 3.4.1 Performance of the Cdc4 model ............................................................................81
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Inactivation of Fbxw7 Impairs Dsrna Sensing and Confers Resistance to PD-1 Blockade
    Published OnlineFirst May 5, 2020; DOI: 10.1158/2159-8290.CD-19-1416 RESEARCH ARTICLE Inactivation of Fbxw7 Impairs dsRNA Sensing and Confers Resistance to PD-1 Blockade Cécile Gstalder1,2, David Liu1,3, Diana Miao1, Bart Lutterbach1,2, Alexander L. DeVine1,2, Chenyu Lin4, Megha Shettigar1,2, Priya Pancholi1,2, Elizabeth I. Buchbinder1, Scott L. Carter5,6, Michael P. Manos1, Vanesa Rojas-Rudilla7, Ryan Brennick1, Evisa Gjini8, Pei-Hsuan Chen8, Ana Lako8, Scott Rodig8,9, Charles H. Yoon10, Gordon J. Freeman1, David A. Barbie1, F. Stephen Hodi1, Wayne Miles4, Eliezer M. Van Allen1, and Rizwan Haq1,2 Downloaded from cancerdiscovery.aacrjournals.org on September 26, 2021. © 2020 American Association for Cancer Research. Published OnlineFirst May 5, 2020; DOI: 10.1158/2159-8290.CD-19-1416 ABSTRACT The molecular mechanisms leading to resistance to PD-1 blockade are largely unknown. Here, we characterize tumor biopsies from a patient with melanoma who displayed heterogeneous responses to anti–PD-1 therapy. We observe that a resistant tumor exhibited a loss-of-function mutation in the tumor suppressor gene FBXW7, whereas a sensitive tumor from the same patient did not. Consistent with a functional role in immunotherapy response, inactivation of Fbxw7 in murine tumor cell lines caused resistance to anti–PD-1 in immunocompetent animals. Loss of Fbxw7 was associated with altered immune microenvironment, decreased tumor-intrinsic expression of the double-stranded RNA (dsRNA) sensors MDA5 and RIG1, and diminished induction of type I IFN and MHC-I expression. In contrast, restoration of dsRNA sensing in Fbxw7-deficient cells was suffi- cient to sensitize them to anti–PD-1.
    [Show full text]
  • Mutational Landscape Differences Between Young-Onset and Older-Onset Breast Cancer Patients Nicole E
    Mealey et al. BMC Cancer (2020) 20:212 https://doi.org/10.1186/s12885-020-6684-z RESEARCH ARTICLE Open Access Mutational landscape differences between young-onset and older-onset breast cancer patients Nicole E. Mealey1 , Dylan E. O’Sullivan2 , Joy Pader3 , Yibing Ruan3 , Edwin Wang4 , May Lynn Quan1,5,6 and Darren R. Brenner1,3,5* Abstract Background: The incidence of breast cancer among young women (aged ≤40 years) has increased in North America and Europe. Fewer than 10% of cases among young women are attributable to inherited BRCA1 or BRCA2 mutations, suggesting an important role for somatic mutations. This study investigated genomic differences between young- and older-onset breast tumours. Methods: In this study we characterized the mutational landscape of 89 young-onset breast tumours (≤40 years) and examined differences with 949 older-onset tumours (> 40 years) using data from The Cancer Genome Atlas. We examined mutated genes, mutational load, and types of mutations. We used complementary R packages “deconstructSigs” and “SomaticSignatures” to extract mutational signatures. A recursively partitioned mixture model was used to identify whether combinations of mutational signatures were related to age of onset. Results: Older patients had a higher proportion of mutations in PIK3CA, CDH1, and MAP3K1 genes, while young- onset patients had a higher proportion of mutations in GATA3 and CTNNB1. Mutational load was lower for young- onset tumours, and a higher proportion of these mutations were C > A mutations, but a lower proportion were C > T mutations compared to older-onset tumours. The most common mutational signatures identified in both age groups were signatures 1 and 3 from the COSMIC database.
    [Show full text]
  • 1A Multiple Sclerosis Treatment
    The Pharmacogenomics Journal (2012) 12, 134–146 & 2012 Macmillan Publishers Limited. All rights reserved 1470-269X/12 www.nature.com/tpj ORIGINAL ARTICLE Network analysis of transcriptional regulation in response to intramuscular interferon-b-1a multiple sclerosis treatment M Hecker1,2, RH Goertsches2,3, Interferon-b (IFN-b) is one of the major drugs for multiple sclerosis (MS) 3 2 treatment. The purpose of this study was to characterize the transcriptional C Fatum , D Koczan , effects induced by intramuscular IFN-b-1a therapy in patients with relapsing– 2 1 H-J Thiesen , R Guthke remitting form of MS. By using Affymetrix DNA microarrays, we obtained and UK Zettl3 genome-wide expression profiles of peripheral blood mononuclear cells of 24 MS patients within the first 4 weeks of IFN-b administration. We identified 1Leibniz Institute for Natural Product Research 121 genes that were significantly up- or downregulated compared with and Infection Biology—Hans-Knoell-Institute, baseline, with stronger changed expression at 1 week after start of therapy. Jena, Germany; 2University of Rostock, Institute of Immunology, Rostock, Germany and Eleven transcription factor-binding sites (TFBS) are overrepresented in the 3University of Rostock, Department of Neurology, regulatory regions of these genes, including those of IFN regulatory factors Rostock, Germany and NF-kB. We then applied TFBS-integrating least angle regression, a novel integrative algorithm for deriving gene regulatory networks from gene Correspondence: M Hecker, Leibniz Institute for Natural Product expression data and TFBS information, to reconstruct the underlying network Research and Infection Biology—Hans-Knoell- of molecular interactions. An NF-kB-centered sub-network of genes was Institute, Beutenbergstr.
    [Show full text]
  • P53 and FBXW7: Sometimes Two Guardians Are Worse Than One
    cancers Perspective p53 and FBXW7: Sometimes Two Guardians Are Worse than One María Galindo-Moreno 1, Servando Giráldez 1 , M. Cristina Limón-Mortés 1, Alejandro Belmonte-Fernández 1, Carmen Sáez 2,3 , Miguel Á. Japón 2,3, Maria Tortolero 1 and Francisco Romero 1,* 1 Departamento de Microbiología, Facultad de Biología, Universidad de Sevilla, E-41012 Sevilla, Spain; [email protected] (M.G.-M.); [email protected] (S.G.); [email protected] (M.C.L.-M.); [email protected] (A.B.-F.); [email protected] (M.T.) 2 Instituto de Biomedicina de Sevilla (IBiS), Hospital Universitario Virgen del Rocío/CSIC/Universidad de Sevilla, E-41013 Sevilla, Spain; [email protected] (C.S.); [email protected] (M.Á.J.) 3 Departamento de Anatomía Patológica, Hospital Universitario Virgen del Rocío, E-41013 Sevilla, Spain * Correspondence: [email protected]; Tel.: +34-954557119 Received: 10 February 2020; Accepted: 13 April 2020; Published: 16 April 2020 Abstract: Too much of a good thing can become a bad thing. An example is FBXW7, a well-known tumor suppressor that may also contribute to tumorigenesis. Here, we reflect on the results of three laboratories describing the role of FBXW7 in the degradation of p53 and the possible implications of this finding in tumor cell development. We also speculate about the function of FBXW7 as a key player in the cell fate after DNA damage and how this could be exploited in the treatment of cancer disease. Keywords: FBXW7; p53; tumor suppressor; cancer; proliferation; ubiquitylation FBXW7 (F-box and WD repeat domain-containing 7) is the subunit of the SCF (SKP1-CUL1-F-box protein) (FBXW7) ubiquitin ligase responsible for recruiting substrates.
    [Show full text]
  • PROTEOME of the HUMAN CHROMOSOME 18: GENE-CENTRIC IDENTIFICATION of TRANSCRIPTS, PROTEINS and PEPTIDES Addendum to the Roadmap
    PROTEOME OF THE HUMAN CHROMOSOME 18: GENE-CENTRIC IDENTIFICATION OF TRANSCRIPTS, PROTEINS AND PEPTIDES Addendum to the Roadmap: HEALTH ASPECTS 1. PROTEOMICS MEETS MEDICINE At its very beginning, one of the goals of human proteomics became a disease biomarker discovery. Many works compared diseased and normal tissues and liquids to get diagnostic profiles by many proteomics methods. Of them, some cancer proteome profiling studies were considered too optimistic in terms of clinical applicability due to incorrect experimental design [Petricoin], thereby conferring the negative expectations from proteomics in translational medicine [Diamantidis, Nature]. The interlaboratory reproducibility of proteomics pipelines also was considered as a shortage in some papers, e.g. in the works of Bell et al [2009] who tested the proteome MS methods with 20-protein standard sample. These difficulties at the early stage of proteomics were partly caused by the fact that many attempts were mostly directed to the technique adjustment rather than to the clinically relevant result. However, the recent advances in mass-spectrometry including the use of MRM to quantify peptides of proteome [Anderson Hunter 2006] made the community to have a view of cautious optimism on the problem of translation to medicine [Nilsson 2010]. A reproducibility problem stated in [Bell 2009] was shown to be mainly caused by the bioinformatics misinterpretation whereas the MS itself worked properly. The readiness of MRM-based platforms to the clinical use is illustrated by the attempt to pass FDA with the mock application which describes MS-based quantitation test for 10 proteins [Regnier FE 2010]. In its current state, the test has not got a clearance.
    [Show full text]
  • Insights Into MYC Biology Through Investigation of Synthetic Lethal Interactions with MYC Deregulation
    Insights into MYC biology through investigation of synthetic lethal interactions with MYC deregulation Mai Sato Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Mai Sato All Rights Reserved ABSTRACT Insights into MYC biology through investigation of synthetic lethal interactions with MYC deregulation Mai Sato MYC (or c-myc) is a bona fide “cancer driver” oncogene that is deregulated in up to 70% of human tumors. In addition to its well-characterized role as a transcription factor that can directly promote tumorigenic growth and proliferation, MYC has transcription-independent functions in vital cellular processes including DNA replication and protein synthesis, contributing to its complex biology. MYC expression, activity, and stability are highly regulated through multiple mechanisms. MYC deregulation triggers genome instability and oncogene-induced DNA replication stress, which are thought to be critical in promoting cancer via mechanisms that are still unclear. Because regulated MYC activity is essential for normal cell viability and MYC is a difficult protein to target pharmacologically, targeting genes or pathways that are essential to survive MYC deregulation offer an attractive alternative as a means to combat tumor cells with MYC deregulation. To this end, we conducted a genome-wide synthetic lethal shRNA screen in MCF10A breast epithelial cells stably expressing an inducible MYCER transgene. We identified and validated FBXW7 as a high-confidence synthetic lethal (MYC-SL) candidate gene. FBXW7 is a component of an E3 ubiquitin ligase complex that degrades MYC. FBXW7 knockdown in MCF10A cells selectively induced cell death in MYC-deregulated cells compared to control.
    [Show full text]
  • The TAL1 Complex Targets the FBXW7 Tumor Suppressor by Activating Mir-223 in Human T Cell Acute Lymphoblastic Leukemia
    Article The TAL1 complex targets the FBXW7 tumor suppressor by activating miR-223 in human T cell acute lymphoblastic leukemia Marc R. Mansour,1,3 Takaomi Sanda,1,4 Lee N. Lawton,5 Xiaoyu Li,2 Taras Kreslavsky,2 Carl D. Novina,2,6 Marjorie Brand,7,8 Alejandro Gutierrez,1,9 Michelle A. Kelliher,10 Catriona H.M. Jamieson,11 Harald von Boehmer,2 Richard A. Young,5,12 and A. Thomas Look1,9 Downloaded from http://rupress.org/jem/article-pdf/210/8/1545/1211584/jem_20122516.pdf by guest on 30 September 2021 1Department of Pediatric Oncology and 2Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02216 3Department of Haematology, University College London Cancer Institute, University College London, WC1E 6BT, England, UK 4Cancer Science Institute of Singapore, National University of Singapore, Singapore 117599 5Whitehead Institute for Biomedical Research, , Cambridge, MA 02142 6Broad Institute of Harvard and Massachusetts Institute of Technology, Cambridge, MA 02142 7The Sprott Center for Stem Cell Research, Department of Regenerative Medicine, Ottawa Hospital Research Institute, Ottawa, Ontario K1Y 4E9, Canada 8Department of Cellular and Molecular Medicine, University of Ottawa, Ottawa, Ontario K1H 8M5, Canada 9Division of Hematology/Oncology, Children’s Hospital, Boston, MA 02115 10Department of Cancer Biology, University of Massachusetts Medical School, Worcester, MA 01605 11Department of Medicine and Moores Cancer Center, University of California, San Diego, La Jolla, CA 92093 12Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142 The oncogenic transcription factor TAL1/SCL is aberrantly expressed in 60% of cases of human T cell acute lymphoblastic leukemia (T-ALL) and initiates T-ALL in mouse models.
    [Show full text]
  • Investigation of the Atypical FBXW7 Mutation Spectrum in Human
    Gut Online First, published on May 15, 2013 as 10.1136/gutjnl-2013-304719 Colorectal cancer ORIGINAL ARTICLE Gut: first published as 10.1136/gutjnl-2013-304719 on 15 May 2013. Downloaded from Investigation of the atypical FBXW7 mutation spectrum in human tumours by conditional expression of a heterozygous propellor tip missense allele in the mouse intestines Hayley Davis,1 Annabelle Lewis,1 Axel Behrens,2 Ian Tomlinson1 ▸ Additional material is ABSTRACT published online only. To view Objective FBXW7 encodes the substrate recognition Significance of this study please visit the journal online (http://dx.doi.org/10.1136/ component of a ubiquitin ligase that degrades targets gutjnl-2013-304719). such as Notch1, c-Jun, c-Myc and cyclin E. FBXW7 mutations occur in several tumour types, including 1Molecular and Population What is already known about this subject? Genetics Laboratory, Wellcome colorectal cancers. The FBXW7 mutation spectrum in ▸ FBXW7 is commonly mutated in tumours of Trust Centre for Human cancers is unusual. Some tumours have biallelic loss of diverse origins, including colorectal cancer. Genetics, Oxford University, function mutations but most have monoallelic missense ▸ FBXW7 is classed as a tumour suppressor, but Oxford, UK fi 2 mutations involving speci c arginine residues at has an unusual mutation spectrum whereby Mammalian Genetics β Laboratory, London Research -propellor tips involved in substrate recognition. biallelic, simple loss-of-function mutations are Institute, Cancer Research UK, Design FBXW7 functional studies have generally rare; instead, most mutations are monoallelic London, UK used null systems. In order to analyse the most missense changes involving specific arginine common mutations in human tumours, we created a residues at β-sheet propellor tips that allow the Correspondence to Fbxw7fl(R482Q)/+ mouse and conditionally expressed this Professor I Tomlinson, FBXW7 protein to recognise its substrates.
    [Show full text]
  • The Role of Integrins in Enterovirus Infections and in Metastasis of Cancer
    TURUN YLIOPISTON JULKAISUJA ANNALES UNIVERSITATIS TURKUENSIS _____________________________________________________________________ SARJA – SER. D OSA– TOM. 908 MEDICA - ODONTOLOGICA THE ROLE OF INTEGRINS IN ENTEROVIRUS INFECTIONS AND IN METASTASIS OF CANCER by Åse Karttunen TURUN YLIOPISTO UNIVERSITY OF TURKU Turku 2010 TURUN YLIOPISTON JULKAISUJA ANNALES UNIVERSITATIS TURKUENSIS _____________________________________________________________________ SARJA – SER. D OSA– TOM. 908 MEDICA - ODONTOLOGICA THE ROLE OF INTEGRINS IN ENTEROVIRUS INFECTIONS AND IN METASTASIS OF CANCER by Åse Karttunen TURUN YLIOPISTO UNIVERSITY OF TURKU Turku 2010 From the Department of Virology, University of Turku, Turku, the Department of Virology, Haartman Institute, the Helsinki Biomedical Graduate School, University of Helsinki, Helsinki, and the Department of Biochemistry and Pharmacy, Åbo Akademi University, Turku, Finland. Supervised by Professor Timo Hyypiä Department of Virology University of Turku Turku, Finland Reviewed by Professor Klaus Hedman Haartman Institute Department of Virology University of Helsinki Helsinki, Finland and Docent Arno Hänninen Department of Medical Microbiology and Immunology University of Turku Turku, Finland Opponent Professori Ari Hinkkanen A. I. Virtanen-instituutti Bioteknologia ja molekulaarinen lääketiede Itä-Suomen yliopisto Kuopio, Finland ISBN 978-951-29-4313-5 (PRINT) ISBN 978-951-29-4314-2 (PDF) ISSN 03559483 Helsinki University Printing House Helsinki 2010 To my Family ABSTRACT Åse Karttunen THE ROLE OF INTEGRINS IN ENTEROVIRUS INFECTIONS AND IN METASTASIS OF CANCER The Department of Virology, University of Turku, Turku, the Department of Virology, Haartman Institute, and the Helsinki Biomedical Graduate School, University of Helsinki, Helsinki, and the Department of Biochemistry and Pharmacy, Åbo Akademi University, Turku, Finland. Annales Universitatis Turkuensis, Medica-Odontologica, Yliopistopaino, Helsinki, 2010. Integrins are a family of transmembrane glycoproteins, composed of two different subunits (α and β).
    [Show full text]
  • FBXW7/Hcdc4 Is a General Tumor Suppressor in Human Cancer
    Priority Report FBXW7/hCDC4 Is a General Tumor Suppressor in Human Cancer Shahab Akhoondi,1 Dahui Sun,2 Natalie von der Lehr,1 Sophia Apostolidou,3 Kathleen Klotz,2 Alena Maljukova,1 Diana Cepeda,1 Heidi Fiegl,3 Dimitra Dofou,3 Christian Marth,4 Elisabeth Mueller-Holzner,4 Martin Corcoran,1 Markus Dagnell,1 Sepideh Zabihi Nejad,5 Babak Noori Nayer,5 Mohammad Reza Zali,5 Johan Hansson,1 Susanne Egyhazi,1 Fredrik Petersson,1 Per Sangfelt,6 Hans Nordgren,6 Dan Grander,1 Steven I. Reed,7 Martin Widschwendter,3 Olle Sangfelt,1 and Charles Spruck2 1Cancer Center Karolinska, Karolinska Hospital, Stockholm, Sweden; 2Department of Tumor Cell Biology, Sidney Kimmel Cancer Center, San Diego, California; 3Department of Gynaecological Oncology, Institute for Women’s Health, University College London, London, United Kingdom; 4Department of Obstetrics and Gynecology, Medical University Innsbruck, Innsbruck, Austria; 5Research Center for Gastrointestinal and Liver Disease, Taleghani Hospital, Tehran, Iran; 6Department of Medical Sciences, Pathology, and Gastroenterology, Uppsala University Hospital, Uppsala, Sweden; and 7Department of Molecular Biology, The Scripps Research Institute, La Jolla, California Abstract cycle progression, and cellular division (1). The latter processes are The ubiquitin-proteasome system is a major regulatory primarily regulated by two ubiquitin ligases known as the pathway of protein degradation and plays an important role anaphase-promoting complex (APC) and SCF. SCF ubiquitin ligases in cellular division. Fbxw7 (or hCdc4), a member of the F-box are composed of Cul1, Rbx1 (also called Roc1 or Hrt1), and Skp1 family of proteins, which are substrate recognition compo- bound to a member of the F-box protein family, which provide substrate specificity.
    [Show full text]
  • The Novel Upstream Regulator of Fbxw7
    The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 5-2014 THE NOVEL UPSTREAM REGULATOR OF FBXW7 JI-HYUN SHIN Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Medicine and Health Sciences Commons Recommended Citation SHIN, JI-HYUN, "THE NOVEL UPSTREAM REGULATOR OF FBXW7" (2014). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 434. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/434 This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. THE NOVEL UPSTREAM REGULATOR OF FBXW7 by Ji-hyun Shin, M.S. APPROVED: Mong-Hong Lee, Supervisory Professor Sai-Ching Yeung, M.D. Ph.D. Randy Legerski, Ph.D. Hui-Kuan Lin, Ph.D. Zhimin Lu, Ph.D. APPROVED: Dean, The University of Texas Graduate School of Biomedical Sciences at Houston THE NOVEL UPSTREAM REGULATOR OF FBXW7 A DISSERTATION Presented to the Faculty of The University of Texas Health Science Center at Houston And The University of Texas MD Anderson Cancer Center Graduate School of Biomedical Sciences in Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY by Jihyun Shin, M.S.
    [Show full text]