DOCSLIB.ORG

Glucocorticoid Receptor Signaling Activates TEAD4 to Promote Breast

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Glucocorticoid Receptor Signaling Activates TEAD4 to Promote Breast Published OnlineFirst July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012 Cancer Molecular Cell Biology Research Glucocorticoid Receptor Signaling Activates TEAD4 to Promote Breast Cancer Progression Lingli He1,2, Liang Yuan3,Yang Sun1,2, Pingyang Wang1,2, Hailin Zhang4, Xue Feng1,2, Zuoyun Wang1,2, Wenxiang Zhang1,2, Chuanyu Yang4,Yi Arial Zeng1,2,Yun Zhao1,2,3, Ceshi Chen4,5,6, and Lei Zhang1,2,3 Abstract The Hippo pathway plays a critical role in cell growth and to the TEAD4 promoter to boost its own expression. Func- tumorigenesis. The activity of TEA domain transcription factor tionally, the activation of TEAD4 by GC promoted breast 4 (TEAD4) determines the output of Hippo signaling; how- cancer stem cells maintenance, cell survival, metastasis, and ever, the regulation and function of TEAD4 has not been chemoresistance both in vitro and in vivo. Pharmacologic explored extensively. Here, we identified glucocorticoids (GC) inhibition of TEAD4 inhibited GC-induced breast cancer as novel activators of TEAD4. GC treatment facilitated gluco- chemoresistance. In conclusion, our study reveals a novel corticoid receptor (GR)-dependent nuclear accumulation and regulation and functional role of TEAD4 in breast cancer and transcriptional activation of TEAD4. TEAD4 positively corre- proposes a potential new strategy for breast cancer therapy. lated with GR expression in human breast cancer, and high expression of TEAD4 predicted poor survival of patients with Significance: This study provides new insight into the role breast cancer. Mechanistically, GC activation promoted GR of glucocorticoid signaling in breast cancer, with potential for interaction with TEAD4, forming a complex that was recruited clinical translation. Introduction MST-LATS kinase cascade phosphorylates YAP/TAZ and restricts theirlocalizationinthecytoplasm, whereas unphosphorylated The Hippo signaling pathway, originally discovered in YAP/TAZ translocate into nucleus and binds with TEADs to Drosophila melanogaster and highly conserved in mammals, activate TEADs transcriptional activity (4, 5). Activated TEADs plays key roles in cell proliferation, cell fate determination, stimulates the expression of genes involved in cell proliferation organ size control, and tumor suppression (1–3). The Hippo and metastasis (CYR61, CTGF, BIRC5, ANKRD1, vimentin, and pathway mainly contains upstream kinase complex, transcrip- N-cadherin) and then promote tumorigenesis and progres- tional cofactor Yes associated-protein (YAP) and its paralog sion (2, 6). Regulators, such as energy/osmotic stress (7, 8), WW domain containing transcription regulator 1 (TAZ), and cell contact/mechanical force (9, 10) and hormones (11) trigger TEA domain transcription factors (TEAD1-4). Upstream core Hippo pathway by controlling YAP/TAZ activity, whereas YAP/TAZ require TEADs binding to regulate target genes (12). Thus,itisofimportancetounderstand the regulation and 1State Key Laboratory of Cell Biology, CAS Center for Excellence in Molecular function of TEADs. Cell Science, University of Chinese Academy of Sciences, Shanghai, People's TEADs have been reported to be phosphorylated by protein 2 Republic of China. Shanghai Institute of Biochemistry and Cell Biology, Chinese kinase A and protein kinase C, which impairs TEADs DNA binding Academy of Sciences, University of Chinese Academy of Sciences, Shanghai, ability (13, 14). TEAD4 is also palmitoylated to enhance its People's Republic of China. 3School of Life Science and Technology, Shanghai Tech University, Shanghai, People's Republic of China. 4Key Laboratory of association with YAP/TAZ and transcriptional activity (15). Animal Models and Human Disease Mechanisms of Chinese Academy of RBM4-facilitated alternative splicing of TEAD4 generates a Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy TEAD4-shorter form to suppress cancer cell proliferation and of Sciences, Kunming, People's Republic of China. 5Institute of Stem Cell and migration (16). In addition, It has been studied that p38 regulates Reproductive Biology, Chinese Academy of Sciences, Beijing, People's Republic TEADs nuclear–cytoplasmic shuttling in response to osmotic 6 of China. KIZ-CUHK Joint Laboratory of Bioresources and Molecular Research in stress (8). Moreover, TEAD4 nuclear localization is critical Common Diseases, Kunming Institute of Zoology, Chinese Academy of Sciences, fi Kunming, People's Republic of China. for establishing the trophectoderm-speci c transcriptional program and segregating trophectoderm from the inner cell mass Note: Supplementary data for this article are available at Cancer Research (17). More importantly, TEAD4 nuclear localization positively Online (http://cancerres.aacrjournals.org/). autoregulates its own transcription and increases its protein Corresponding Authors: Lei Zhang, Chinese Academy of Sciences, Shanghai level in the trophectoderm lineage, and the high TEAD4 con- 200031, China. Phone/Fax: 86-021-4592-1336; E-mail: [email protected]; centration facilitates its nuclear localization as a positive feed- and Ceshi Chen, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China. E-mail: [email protected] back response (17). Recently, it has been reported that the glucocorticoid receptor (GR) binds to the promoter of Cancer Res 2019;79:4399–411 TEAD4 to regulate TEAD4 transcription during adipogen- doi: 10.1158/0008-5472.CAN-19-0012 esis (18). The activity of TEADs is also regulated by its cofactors. Ó2019 American Association for Cancer Research. Besides the most well-known coactivators YAP/TAZ, some other www.aacrjournals.org 4399 Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 2019 American Association for Cancer Research. Published OnlineFirst July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012 He et al. Hippo-independent cofactors have been also identified as TEAD1/2/3/4, TEAD4-N, TEAD4-C and YAP were cloned to TEADs-binding partners, such as the vestigial-like protein fam- vectorpcDNA3.1.GR,GR-DBD,GR-DDBD and GR-2C2A were ily (19), C-terminal binding protein 2 (20), transcription factor cloned to vector pGEX-4T1-GST, and TEAD4 was cloned to 4(21),Kruppel-like€ factor 5 (KLF5; ref. 22) and activator pET28a-His-Sumo for protein purification in E. coli.Allcon- protein-1 (23). Together with their cofactors, TEADs bind to structs for short hairpin RNA (shRNA) were constructed in a the conserved MCAT motif to regulate transcriptional activity modified pLKO.1 vector. The shRNA target sequences as involved in cancer initiation and progression (24, 25). followings. Glucocorticoids (GC), as a kind of steroid hormones, func- YAP-1: GACATCTTCTGGTCAGAGA; tion through GR and play important roles in various biological TEAD4-1: GAGACAGAGTATGCTCGCTAT; processes, such as cell growth, metabolism, immune and TEAD4-2: CCTTTCTCTCAGCAAACCTAT; inflammatory reactions (26, 27). Because of its antiproliferative GR-1: TGGATAAGACCATGAGTATTG; and proapoptotic roles, GCs have been used in various diseases GR-2: CACAGGCTTCAGGTATCTTAT. therapies, such as acute lymphoblastic leukemia and multiple Scramble DNA duplex was also designed as a control: myeloma (27). Nevertheless, GCs treatment has side effect TTCTCCGAACGTGTCACGT. for the emergence of GC-induced apoptosis resistance (28). It has been shown that GCs promote cancer cells survival and Cell culture protect cells from chemotherapy-induced apoptosis (29, 30). HEK293T cells, MDA-MB-231, MDA-MB-453, and BT-549 For example, dexamethasone treatment inhibits paclitaxel- were cultured in DMEM (Invitrogen) supplemented with 10% induced apoptosis especially in breast cancer (11, 31, 32). FBS and antibiotics at 37 Cwith5%CO2 in a humidified Consistently, high expression of GC-related GR correlates with incubator (Thermo Fisher Scientific), NIH/3T3 cells were cul- poor survival and poor prognosis in patients with breast tured in DMEM with 10% NCS and antibiotics. MCF10A cells cancer (11, 33). However, the molecular mechanism and the were maintained in DMEM/F12 medium (Sigma D6421) con- key mediators that respond to GC-GR signaling and induce cell taining 5% horse serum (Sigma H1270), 10 mg/mL insulin growth, remain unclear. (Sigma I6634), 20 ng/mL hEGF (Sigma E4269), 100 ng/mL Breast cancer is the most common malignancy in women. In cholera toxin (Sigma C8052), 0.5 mg/mL hydrocortisone (Sig- clinical diagnosis, breast cancers are divided into four subtypes ma H4001), and antibiotics. Cells were obtained from Shang- based on the expression of the markers: estrogen receptor (ER), hai Life Academy of Sciences cell library (Shanghai, China) in progesterone receptor (PR), and HER2. Among the different June 2016, then the short tandem repeat analysis was per- subtypes, patients with triple-negative breast cancer (TNBC), formed to authenticate the cell lines. Multiple aliquots were characterized by ER/HER2/PR negative, have the highest frequen- frozen within 10 days when the cells were purchased and cy of lymph node metastasis and poorest prognosis (34). TNBC thawed. For experimental use, aliquots were resuscitated and has a relatively good response to chemotherapy, however, che- cultured for about 20 passages (every 2 days for 6 weeks) before moresistance is an alarming issue following treatment (34). The being discarded. All cell lines were ensured to be negative for Hippo signaling pathway has been linked to breast cancer pro- Mycoplasma contamination. gression. The high expression of YAP and TAZ contribute to breast cancer cell survival and metastasis dependent on TEAD4 interac-
Load more

Recommended publications
  • TEAD3 (NM 003214) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC210621 TEAD3 (NM_003214) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: TEAD3 (NM_003214) Human Tagged ORF Clone Tag: Myc-DDK Symbol: TEAD3 Synonyms: DTEF-1; ETFR-1; TEAD-3; TEAD5; TEF-5; TEF5 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC210621 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATAGCGTCCAACAGCTGGAACGCCAGCAGCAGCCCCGGGGAGGCCCGGGAGGATGGGCCCGAGGGCCTGG ACAAGGGGCTGGACAACGATGCGGAGGGCGTGTGGAGCCCGGACATCGAGCAGAGCTTCCAGGAGGCCCT GGCCATCTACCCGCCCTGCGGCCGGCGGAAGATCATCCTGTCAGACGAGGGCAAGATGTACGGCCGAAAT GAGTTGATTGCACGCTATATTAAACTGAGGACGGGGAAGACTCGGACGAGAAAACAGGTGTCCAGCCACA TACAGGTTCTAGCTCGGAAGAAGGTGCGGGAGTACCAGGTTGGCATCAAGGCCATGAACCTGGACCAGGT CTCCAAGGACAAAGCCCTTCAGAGCATGGCGTCCATGTCCTCTGCCCAGATCGTCTCTGCCAGTGTCCTG CAGAACAAGTTCAGCCCACCTTCCCCTCTGCCCCAGGCCGTCTTCTCCACTTCCTCGCGGTTCTGGAGCA GCCCCCCTCTCCTGGGACAGCAGCCTGGACCCTCTCAGGACATCAAGCCCTTTGCACAGCCAGCCTACCC CATCCAGCCGCCCCTGCCGCCGACGCTCAGCAGTTATGAGCCCCTGGCCCCGCTCCCCTCAGCTGCTGCC TCTGTGCCTGTGTGGCAGGACCGTACCATTGCCTCCTCCCGGCTGCGGCTCCTGGAGTATTCAGCCTTCA TGGAGGTGCAGCGAGACCCTGACACGTACAGCAAACACCTGTTTGTGCACATCGGCCAGACGAACCCCGC CTTCTCAGACCCACCCCTGGAGGCAGTAGATGTGCGCCAGATCTATGACAAATTCCCCGAGAAAAAGGGA GGATTGAAGGAGCTCTATGAGAAGGGGCCCCCTAATGCCTTCTTCCTTGTCAAGTTCTGGGCCGACCTCA
    [Show full text]
  • Down-Regulation of Stem Cell Genes, Including Those in a 200-Kb Gene Cluster at 12P13.31, Is Associated with in Vivo Differentiation of Human Male Germ Cell Tumors
    Research Article Down-Regulation of Stem Cell Genes, Including Those in a 200-kb Gene Cluster at 12p13.31, Is Associated with In vivo Differentiation of Human Male Germ Cell Tumors James E. Korkola,1 Jane Houldsworth,1,2 Rajendrakumar S.V. Chadalavada,1 Adam B. Olshen,3 Debbie Dobrzynski,2 Victor E. Reuter,4 George J. Bosl,2 and R.S.K. Chaganti1,2 1Cell Biology Program and Departments of 2Medicine, 3Epidemiology and Biostatistics, and 4Pathology, Memorial Sloan-Kettering Cancer Center, New York, New York Abstract on the degree and type of differentiation (i.e., seminomas, which Adult male germ cell tumors (GCTs) comprise distinct groups: resemble undifferentiated primitive germ cells, and nonseminomas, seminomas and nonseminomas, which include pluripotent which show varying degrees of embryonic and extraembryonic embryonal carcinomas as well as other histologic subtypes patterns of differentiation; refs. 2, 3). Nonseminomatous GCTs are exhibiting various stages of differentiation. Almost all GCTs further subdivided into embryonal carcinomas, which show early show 12p gain, but the target genes have not been clearly zygotic or embryonal-like differentiation, yolk sac tumors and defined. To identify 12p target genes, we examined Affymetrix choriocarcinomas, which exhibit extraembryonal forms of differ- (Santa Clara, CA) U133A+B microarray (f83% coverage of 12p entiation, and teratomas, which show somatic differentiation along genes) expression profiles of 17 seminomas, 84 nonseminoma multiple lineages (3). Both seminomas and embryonal carcinoma GCTs, and 5 normal testis samples. Seventy-three genes on 12p are known to express stem cell markers, such as POU5F1 (4) and were significantly overexpressed, including GLUT3 and REA NANOG (5).
    [Show full text]
  • Machine-Learning and Chemicogenomics Approach Defi Nes and Predicts Cross-Talk of Hippo and MAPK Pathways
    Published OnlineFirst November 18, 2020; DOI: 10.1158/2159-8290.CD-20-0706 RESEARCH ARTICLE Machine -Learning and Chemicogenomics Approach Defi nes and Predicts Cross-Talk of Hippo and MAPK Pathways Trang H. Pham 1 , Thijs J. Hagenbeek 1 , Ho-June Lee 1 , Jason Li 2 , Christopher M. Rose 3 , Eva Lin 1 , Mamie Yu 1 , Scott E. Martin1 , Robert Piskol 2 , Jennifer A. Lacap 4 , Deepak Sampath 4 , Victoria C. Pham 3 , Zora Modrusan 5 , Jennie R. Lill3 , Christiaan Klijn 2 , Shiva Malek 1 , Matthew T. Chang 2 , and Anwesha Dey 1 ABSTRACT Hippo pathway dysregulation occurs in multiple cancers through genetic and non- genetic alterations, resulting in translocation of YAP to the nucleus and activation of the TEAD family of transcription factors. Unlike other oncogenic pathways such as RAS, defi ning tumors that are Hippo pathway–dependent is far more complex due to the lack of hotspot genetic alterations. Here, we developed a machine-learning framework to identify a robust, cancer type–agnostic gene expression signature to quantitate Hippo pathway activity and cross-talk as well as predict YAP/TEAD dependency across cancers. Further, through chemical genetic interaction screens and multiomics analyses, we discover a direct interaction between MAPK signaling and TEAD stability such that knockdown of YAP combined with MEK inhibition results in robust inhibition of tumor cell growth in Hippo dysregulated tumors. This multifaceted approach underscores how computational models combined with experimental studies can inform precision medicine approaches including predictive diagnostics and combination strategies. SIGNIFICANCE: An integrated chemicogenomics strategy was developed to identify a lineage- independent signature for the Hippo pathway in cancers.
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Glioblastoma Stem Cells Induce Quiescence in Surrounding Neural Stem Cells Via Notch Signalling
    bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 29, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Glioblastoma stem cells induce quiescence in surrounding neural stem cells via Notch signalling. Katerina Lawlor1, Maria Angeles Marques-Torrejon2, Gopuraja Dharmalingham3, Yasmine El-Azhar1, Michael D. Schneider1, Steven M. Pollard2§ and Tristan A. Rodríguez1§ 1National Heart and Lung Institute, Imperial College London, Hammersmith Hospital Campus, Du Cane Road, London W12 0NN, United Kingdom. 2 MRC Centre for Regenerative Medicine & Edinburgh Cancer Research UK Centre, University of Edinburgh, Edinburgh, UK. 3MRC London Institute of Medical Sciences, Institute of Clinical Sciences, Imperial College London, UK §Authors for correspondence: [email protected] and [email protected] Running title: Glioblastoma stem cell competition Keyword: Neural stem cells, quiescence, glioblastoma, Notch, cell competition 1 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 29, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Abstract 2 There is increasing evidence suggesting that adult neural stem cells (NSCs) are a cell of 3 origin of glioblastoma, the most aggressive form of malignant glioma. The earliest stages of 4 hyperplasia are not easy to explore, but likely involve a cross-talk between normal and 5 transformed NSCs. How normal cells respond to this cross-talk and if they expand or are 6 outcompeted is poorly understood.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Figure S1. Representative Report Generated by the Ion Torrent System Server for Each of the KCC71 Panel Analysis and Pcafusion Analysis
    Figure S1. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. A Figure S1. Continued. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. B Figure S2. Comparative analysis of the variant frequency found by the KCC71 panel and calculated from publicly available cBioPortal datasets. For each of the 71 genes in the KCC71 panel, the frequency of variants was calculated as the variant number found in the examined cases. Datasets marked with different colors and sample numbers of prostate cancer are presented in the upper right. *Significantly high in the present study. Figure S3. Seven subnetworks extracted from each of seven public prostate cancer gene networks in TCNG (Table SVI). Blue dots represent genes that include initial seed genes (parent nodes), and parent‑child and child‑grandchild genes in the network. Graphical representation of node‑to‑node associations and subnetwork structures that differed among and were unique to each of the seven subnetworks. TCNG, The Cancer Network Galaxy. Figure S4. REVIGO tree map showing the predicted biological processes of prostate cancer in the Japanese. Each rectangle represents a biological function in terms of a Gene Ontology (GO) term, with the size adjusted to represent the P‑value of the GO term in the underlying GO term database.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Tead2 Expression Levels Control the Subcellular Distribution Of
    ß 2014. Published by The Company of Biologists Ltd | Journal of Cell Science (2014) 127, 1523–1536 doi:10.1242/jcs.139865 RESEARCH ARTICLE Tead2 expression levels control the subcellular distribution of Yap and Taz, zyxin expression and epithelial–mesenchymal transition Maren Diepenbruck1,*, Lorenz Waldmeier1,*, Robert Ivanek1, Philipp Berninger2, Phil Arnold2, Erik van Nimwegen2 and Gerhard Christofori1,` ABSTRACT tumor, but also results in the acquisition of stem-cell-like traits, which has implications for cancer therapy and might also be The cellular changes during an epithelial–mesenchymal transition important for colonization at distant organs (Chaffer and Weinberg, (EMT) largely rely on global changes in gene expression 2011; Magee et al., 2012; Polyak and Weinberg, 2009; Scheel and orchestrated by transcription factors. Tead transcription factors Weinberg, 2012). Among the many genes and signaling pathways and their transcriptional co-activators Yap and Taz have been active during EMT, transcription factors are the master coordinators previously implicated in promoting an EMT; however, their direct of the EMT program (Acloque et al., 2009; Moreno-Bueno et al., transcriptional target genes and their functional role during EMT 2008; Nieto, 2011). have remained elusive. We have uncovered a previously The Hippo tumor suppressor signaling pathway plays a critical unanticipated role of the transcription factor Tead2 during EMT. role in restricting organ size by antagonizing the oncogenic During EMT in mammary gland epithelial cells and breast cancer transcriptional co-activators Yap and Taz (Hong and Guan, 2012; cells, levels of Tead2 increase in the nucleus of cells, thereby Zhao et al., 2011). A complex network of cell adhesion and signaling directing a predominant nuclear localization of its co-factors molecules, including the tumor suppressor neurofibromin-2/ Yap and Taz via the formation of Tead2–Yap–Taz complexes.
    [Show full text]
  • Bioinformatics Studies Provide Insight Into Possible Target and Mechanisms of Action of Nobiletin Against Cancer Stem Cells
    DOI:10.31557/APJCP.2020.21.3.611 Bioinformatics Studies Provide Insight into Possible Target and Mechanisms of Action of Nobiletin against Cancer Stem Cells RESEARCH ARTICLE Editorial Process: Submission:05/08/2019 Acceptance:03/06/2020 Bioinformatics Studies Provide Insight into Possible Target and Mechanisms of Action of Nobiletin against Cancer Stem Cells Adam Hermawan1*, Herwandhani Putri2 Abstract Objective: Nobiletin treatment on MDA-MB 231 cells reduces the expression of CXC chemokine receptor type 4 (CXCR4), which is highly expressed in cancer stem cell populations in tumor patients. However, the mechanisms of nobiletin in cancer stem cells (CSCs) remain elusive. This study was aimed to explore the potential target and mechanisms of nobiletin in cancer stem cells using bioinformatics approaches. Methods: Gene expression profiles by public COMPARE predicting the sensitivity of tumor cells to nobiletin. Functional annotations on gene lists are carried out with The Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.8, and WEB-based GEne SeT Analysis Toolkit (WebGestalt). The protein-protein interaction (PPI) network was analyzed by STRING-DB and visualized by Cytoscape. Results: Microarray analyses reveal many genes involved in protein binding, transcriptional and translational activity. Pathway enrichment analysis revealed breast cancer regulation of estrogen signaling and Wnt/ß-catenin by nobiletin. Moreover, three hub genes, i.e. ESR1, NCOA3, and RPS6KB1 and one significant module were filtered out and selected from the PPI network. Conclusion: Nobiletin might serve as a lead compound for the development of CSCs-targeted drugs by targeting estrogen and Wnt/ß-catenin signaling. Further studies are needed to explore the full therapeutic potential of nobiletin in cancer stem cells.
    [Show full text]
  • Full Text (PDF)
    Published OnlineFirst May 1, 2014; DOI: 10.1158/0008-5472.CAN-13-3147 Cancer Tumor and Stem Cell Biology Research Loss of the Polycomb Mark from Bivalent Promoters Leads to Activation of Cancer-Promoting Genes in Colorectal Tumors Maria A. Hahn1, Arthur X. Li2, Xiwei Wu3, Richard Yang1, David A. Drew4, Daniel W. Rosenberg4, and Gerd P. Pfeifer1 Abstract In colon tumors, the transcription of many genes becomes deregulated by poorly defined epigenetic mechanisms that have been studied mainly in established cell lines. In this study, we used frozen human colon tissues to analyze patterns of histone modification and DNA cytosine methylation in cancer and matched normal mucosa specimens. DNA methylation is strongly targeted to bivalent H3K4me3- and H3K27me3-associated promoters, which lose both histone marks and acquire DNA methylation. However, we found that loss of the Polycomb mark H3K27me3 from bivalent promoters was accompanied often by activation of genes associated with cancer progression, including numerous stem cell regulators, oncogenes, and proliferation-associated genes. Indeed, we found many of these same genes were also activated in patients with ulcerative colitis where chronic inflammation predisposes them to colon cancer. Based on our findings, we propose that a loss of Polycomb repression at bivalent genes combined with an ensuing selection for tumor-driving events plays a major role in cancer progression. Cancer Res; 74(13); 3617–29. Ó2014 AACR. Introduction cells (21, 22). The acquisition of the more permanent silencing Tumorigenesis is a complex process that is driven by a mark, 5mC, at the promoters of Polycomb target genes does number of genetic and epigenetic alterations, which often not fundamentally change their expression levels although result in aberrant gene expression (1–3).
    [Show full text]