Glucocorticoid Receptor Signaling Activates TEAD4 to Promote Breast

Published OnlineFirst July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012

Cancer Molecular Cell Biology Research

Glucocorticoid Receptor Signaling Activates TEAD4 to Promote Breast Cancer Progression Lingli He1,2, Liang Yuan3,Yang Sun1,2, Pingyang Wang1,2, Hailin Zhang4, Xue Feng1,2, Zuoyun Wang1,2, Wenxiang Zhang1,2, Chuanyu Yang4,Yi Arial Zeng1,2,Yun Zhao1,2,3, Ceshi Chen4,5,6, and Lei Zhang1,2,3

Abstract

The Hippo pathway plays a critical role in cell growth and to the TEAD4 promoter to boost its own expression. Func- tumorigenesis. The activity of TEA domain transcription factor tionally, the activation of TEAD4 by GC promoted breast 4 (TEAD4) determines the output of Hippo signaling; how- cancer stem cells maintenance, cell survival, metastasis, and ever, the regulation and function of TEAD4 has not been chemoresistance both in vitro and in vivo. Pharmacologic explored extensively. Here, we identiﬁed glucocorticoids (GC) inhibition of TEAD4 inhibited GC-induced breast cancer as novel activators of TEAD4. GC treatment facilitated gluco- chemoresistance. In conclusion, our study reveals a novel corticoid receptor (GR)-dependent nuclear accumulation and regulation and functional role of TEAD4 in breast cancer and transcriptional activation of TEAD4. TEAD4 positively corre- proposes a potential new strategy for breast cancer therapy. lated with GR expression in human breast cancer, and high expression of TEAD4 predicted poor survival of patients with Signiﬁcance: This study provides new insight into the role breast cancer. Mechanistically, GC activation promoted GR of glucocorticoid signaling in breast cancer, with potential for interaction with TEAD4, forming a complex that was recruited clinical translation.

Introduction MST-LATS kinase cascade phosphorylates YAP/TAZ and restricts theirlocalizationinthecytoplasm, whereas unphosphorylated The Hippo signaling pathway, originally discovered in YAP/TAZ translocate into nucleus and binds with TEADs to Drosophila melanogaster and highly conserved in mammals, activate TEADs transcriptional activity (4, 5). Activated TEADs plays key roles in cell proliferation, cell fate determination, stimulates the expression of genes involved in cell proliferation organ size control, and tumor suppression (1–3). The Hippo and metastasis (CYR61, CTGF, BIRC5, ANKRD1, vimentin, and pathway mainly contains upstream kinase complex, transcrip- N-cadherin) and then promote tumorigenesis and progres- tional cofactor Yes associated-protein (YAP) and its paralog sion (2, 6). Regulators, such as energy/osmotic stress (7, 8), WW domain containing transcription regulator 1 (TAZ), and cell contact/mechanical force (9, 10) and hormones (11) trigger TEA domain transcription factors (TEAD1-4). Upstream core Hippo pathway by controlling YAP/TAZ activity, whereas YAP/TAZ require TEADs binding to regulate target genes (12). Thus,itisofimportancetounderstand the regulation and 1State Key Laboratory of Cell Biology, CAS Center for Excellence in Molecular function of TEADs. Cell Science, University of Chinese Academy of Sciences, Shanghai, People's TEADs have been reported to be phosphorylated by protein 2 Republic of China. Shanghai Institute of Biochemistry and Cell Biology, Chinese kinase A and protein kinase C, which impairs TEADs DNA binding Academy of Sciences, University of Chinese Academy of Sciences, Shanghai, ability (13, 14). TEAD4 is also palmitoylated to enhance its People's Republic of China. 3School of Life Science and Technology, Shanghai Tech University, Shanghai, People's Republic of China. 4Key Laboratory of association with YAP/TAZ and transcriptional activity (15). Animal Models and Human Disease Mechanisms of Chinese Academy of RBM4-facilitated alternative splicing of TEAD4 generates a Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy TEAD4-shorter form to suppress cancer cell proliferation and of Sciences, Kunming, People's Republic of China. 5Institute of Stem Cell and migration (16). In addition, It has been studied that p38 regulates Reproductive Biology, Chinese Academy of Sciences, Beijing, People's Republic TEADs nuclear–cytoplasmic shuttling in response to osmotic 6 of China. KIZ-CUHK Joint Laboratory of Bioresources and Molecular Research in stress (8). Moreover, TEAD4 nuclear localization is critical Common Diseases, Kunming Institute of Zoology, Chinese Academy of Sciences, ﬁ Kunming, People's Republic of China. for establishing the trophectoderm-speci c transcriptional program and segregating trophectoderm from the inner cell mass Note: Supplementary data for this article are available at Cancer Research (17). More importantly, TEAD4 nuclear localization positively Online (http://cancerres.aacrjournals.org/). autoregulates its own transcription and increases its protein Corresponding Authors: Lei Zhang, Chinese Academy of Sciences, Shanghai level in the trophectoderm lineage, and the high TEAD4 con- 200031, China. Phone/Fax: 86-021-4592-1336; E-mail: [email protected]; centration facilitates its nuclear localization as a positive feed- and Ceshi Chen, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China. E-mail: [email protected] back response (17). Recently, it has been reported that the glucocorticoid receptor (GR) binds to the promoter of Cancer Res 2019;79:4399–411 TEAD4 to regulate TEAD4 transcription during adipogen- doi: 10.1158/0008-5472.CAN-19-0012 esis (18). The activity of TEADs is also regulated by its cofactors. 2019 American Association for Cancer Research. Besides the most well-known coactivators YAP/TAZ, some other

www.aacrjournals.org 4399

He et al.

Hippo-independent cofactors have been also identified as TEAD1/2/3/4, TEAD4-N, TEAD4-C and YAP were cloned to TEADs-binding partners, such as the vestigial-like protein fam- vectorpcDNA3.1.GR,GR-DBD,GR-DDBD and GR-2C2A were ily (19), C-terminal binding protein 2 (20), transcription factor cloned to vector pGEX-4T1-GST, and TEAD4 was cloned to 4(21),Kruppel-like€ factor 5 (KLF5; ref. 22) and activator pET28a-His-Sumo for protein purification in E. coli.Allcon- protein-1 (23). Together with their cofactors, TEADs bind to structs for short hairpin RNA (shRNA) were constructed in a the conserved MCAT motif to regulate transcriptional activity modified pLKO.1 vector. The shRNA target sequences as involved in cancer initiation and progression (24, 25). followings. Glucocorticoids (GC), as a kind of steroid hormones, func- YAP-1: GACATCTTCTGGTCAGAGA; tion through GR and play important roles in various biological TEAD4-1: GAGACAGAGTATGCTCGCTAT; processes, such as cell growth, metabolism, immune and TEAD4-2: CCTTTCTCTCAGCAAACCTAT; inflammatory reactions (26, 27). Because of its antiproliferative GR-1: TGGATAAGACCATGAGTATTG; and proapoptotic roles, GCs have been used in various diseases GR-2: CACAGGCTTCAGGTATCTTAT. therapies, such as acute lymphoblastic leukemia and multiple Scramble DNA duplex was also designed as a control: myeloma (27). Nevertheless, GCs treatment has side effect TTCTCCGAACGTGTCACGT. for the emergence of GC-induced apoptosis resistance (28). It has been shown that GCs promote cancer cells survival and Cell culture protect cells from chemotherapy-induced apoptosis (29, 30). HEK293T cells, MDA-MB-231, MDA-MB-453, and BT-549 For example, dexamethasone treatment inhibits paclitaxel- were cultured in DMEM (Invitrogen) supplemented with 10% induced apoptosis especially in breast cancer (11, 31, 32). FBS and antibiotics at 37 Cwith5%CO2 in a humidified Consistently, high expression of GC-related GR correlates with incubator (Thermo Fisher Scientific), NIH/3T3 cells were cul- poor survival and poor prognosis in patients with breast tured in DMEM with 10% NCS and antibiotics. MCF10A cells cancer (11, 33). However, the molecular mechanism and the were maintained in DMEM/F12 medium (Sigma D6421) con- key mediators that respond to GC-GR signaling and induce cell taining 5% horse serum (Sigma H1270), 10 mg/mL insulin growth, remain unclear. (Sigma I6634), 20 ng/mL hEGF (Sigma E4269), 100 ng/mL Breast cancer is the most common malignancy in women. In cholera toxin (Sigma C8052), 0.5 mg/mL hydrocortisone (Sig- clinical diagnosis, breast cancers are divided into four subtypes ma H4001), and antibiotics. Cells were obtained from Shang- based on the expression of the markers: estrogen receptor (ER), hai Life Academy of Sciences cell library (Shanghai, China) in progesterone receptor (PR), and HER2. Among the different June 2016, then the short tandem repeat analysis was per- subtypes, patients with triple-negative breast cancer (TNBC), formed to authenticate the cell lines. Multiple aliquots were characterized by ER/HER2/PR negative, have the highest frequen- frozen within 10 days when the cells were purchased and cy of lymph node metastasis and poorest prognosis (34). TNBC thawed. For experimental use, aliquots were resuscitated and has a relatively good response to chemotherapy, however, che- cultured for about 20 passages (every 2 days for 6 weeks) before moresistance is an alarming issue following treatment (34). The being discarded. All cell lines were ensured to be negative for Hippo signaling pathway has been linked to breast cancer pro- Mycoplasma contamination. gression. The high expression of YAP and TAZ contribute to breast cancer cell survival and metastasis dependent on TEAD4 interac- Small interference RNAs tion (35, 36). Besides, TEAD4 also acts as an oncogene in breast Duplexes of siRNA targeting TEAD4, GR, YAP, TAZ and cancer (22). negative control were synthesized by Genepharma (Shanghai, In this study, we identify GCs as new regulators of TEAD4 in China). The siRNA target sequences in human are as followings: breast cancer. GCs promote TEAD4 transcriptional levels, nuclear GR-1: AAGTCAAGTTGTCATCTCC; accumulation and TEAD4 transcriptional activity. These actions of YAP-1: CCCAGTTAAATGTTCACCAAT; fi GCs depend on GRs. Speci cally, GC-activated GR is recruited to TAZ: CAGCCAAATCTCGTGATGAA. the promoter of TEAD4 and forms a complex with TEAD4 to The siRNA target sequences in mouse: regulate TEAD4 transcription and auto-activation. The activity of YAP-1: GAAGCGCTGAGTTCCGAAAT; TEAD4 positively correlates with GR expression in clinical breast TAZ-1: CAGCCGAATCTCGCAATGAAT; cancer samples. Furthermore, high expression of TEAD4 and GR TAZ-2: CCATGAGCACAGATATGAGAT; predicts poor survival in patients with breast cancer. GC-GR For negative control: UUCUCCGAACGUGUCACGU. induced TEAD4 activity is involved in breast cancer cells survival, metastasis and chemoresistance in vitro and in vivo. Pharmaco- DNA preparation for TEAD4 promoter luciferase reporter logical inhibition of TEAD4 transcriptional activity by niflumic The downstream sequence of TEAD4 gene containing TEAD4 acid inhibited GC-induced breast cancer drug resistance. Our data and GR-binding site was amplified by PCR. Target DNA was identify a new GC–GR–TEAD4 axis and a novel mechanism of detected by agarose gel and purified by Gel Extraction Kit TEAD4 regulation in breast cancer, suggesting a new strategy for (Tiangen). The primers used for PCR were as followings: breast cancer therapy. TEAD4-F: CGAGGTGCCGGTGGC; TEAD4-R: CTCTCCACTGG- CGGGACG. Materials and Methods Reagents and plasmids Chromatin immunoprecipitation The compounds and drugs were shown in Supplementary Protocol of chromatin immunoprecipitation (ChIP) assay Table S1. TEAD4, TEAD4-VP16, GR, and GR-2C2A were was previous described in detail (20). Chromatin was immu- cloned to the pLEX-HA vector for stable expression in cells. noprecipitated with 2 mgantibodyofGR(SC-8992,Cell

4400 Cancer Res; 79(17) September 1, 2019 Cancer Research

GC-Activated TEAD4 Contributes to Breast Cancer Progression

Signaling Technology), normal rabbit IgG (sc-2027, Santa Cruz nificant at , P < 0.05; , P < 0.01; , P < 0.001; , P < 0.0001. ns Biotechnology), TEAD4 (58310, Abcam) or normal mouse IgG means no significance. All data were presented as mean SD. (sc-2025, Santa Cruz Biotechnology). The immunoprecipitated DNA was collected with QIAQIUCK PCR Purification Kit (250). Purified DNA was performed with ChIP-PCR. The primers used Results were shown in Supplementary Table S1. Glucocorticoids upregulate TEAD4 transcriptional levels in breast cancer cells Mammosphere formation assay To study the regulation of GCs on Hippo signaling, MDA-MB-231 cells were cultured with MammoCult Human we treated breast cancer cells MDA-MB-231 with 1 mmol/L Medium Kit (05620, STEMCELL Technologies) supplemented dexamethasone for different time. Consistent with earlier find- with 4 mg/mL heparin (07980, STEMCELL Technologies) in 6-well ings (11), the total YAP protein levels were increased and ultralow attachment plates (3,471, Corning), 3 105 cells per phosphorylated YAP protein levels were decreased at 8 and well for 10 days. Fresh complete medium was added into each 12 hours. Surprisingly, the protein level of TEAD4 were also well every 3 days. After culture, sphere number was counted. upregulated dramatically with the increase of treatment time (Fig. 1A). The expression of TEAD4 and YAP were monitored Immunohistochemistry after dexamethasone treatment (Fig. 1B). However, TEAD4 and Tissues were embedded in paraffin before cutting into 5-mm YAP were not concurrently activated, and TEAD4 was activated sections. IHC signals were developed using monoclonal antibo- soon after dexamethasone treatment, as well as Hippo target dies against human TAZ (1:200, 4883), GR (1:200, 12041), and genes CYR61 and ANKRD1. TEAD1 and TEAD2 showed no cleaved caspase-3 (1:200, 9661), which were purchased from Cell significant change, and TEAD3 expression was also upregulated Signaling Technology. TEAD4 (1:100, sc-101184) and YAP but in a time-independent manner (Supplementary Fig. S1A). (1:200, sc-15407) were purchased from Santa Cruz Biotechnol- To confirm the upregulation of TEAD4 was triggered by GCs but ogy. Ki67 (PA5-19462) was a product of Thermo Fisher Scientific. not only dexamethasone, 1 mg/mL hydrocortisone was used in MDA-MB-231 cells. Consistently, hydrocortisone also activated Xenograft tumor formation and lung seeding assay TEAD4 in a time-dependent manner (Supplementary Fig. S1B). Six-week-old healthy female nude mice (BALB/cA-nu/nu) Regardless the change in YAP/TAZ expression, TEAD4 was also were obtained from the Shanghai Experimental Animal Center activated in BT-549 and MDA-MB-453 cells (Fig. 1C), implying and maintained in pathogen-free conditions. One million that the GC-related regulation of TEAD4 is a general phenom- MDA-MB-231 cells in 100 mL of PBS was injected into the mam- enon in breast cancer cells. In addition, we found that TEAD4 mary fat pad of female nude mice for xenograft tumor formation also responded to GCs in NIH/3T3 cells, a mouse embryo or injected into tail vein for metastatic analysis of lung. Tumor fibroblast (MEF) cell line (Supplementary Fig. S1C). Consistent growth at the injection site was monitored by caliper measure- with their protein results, TEAD4 and target genes mRNA levels ments 2 times a week and tumor volume was calculated using were also increased after GCs treatment in MDA-MB-231 the formula: Tumor volume (mm3) ¼ 0.52 D d2, where D (Fig. 1D) and BT-549 cells (Fig. 1E), whereas the mRNA levels and d is the longest and the shortest diameters, respectively. Mice of YAP did not change (Fig. 1D and E). The lowest dose that were killed after 4 weeks and tumor weight were then weighted. TEAD4 responded to dexamethasone was 0.01 mmol/L (Sup- For lung seeding assay, Lung of nude mice were analyzed after plementary Fig. S1D), and the GLIZ was a GR-regulated gene as 40 days of tail vein injection. All animals were used in accordance positive control (Supplementary Fig. S1E). Again, the mRNAs with the guidelines of the Institutional Animal Care and Use of TEAD1/2/3 did not show a consistent change (Supplemen- Committee of the Institute of Biochemistry and Cell Biology. tary Fig. S1F).

Human breast cancer sample collection Glucocorticoids promote TEAD4 nuclear accumulation All the human breast cancer samples were collected from Because localization of TEAD is a critical determinant of Hippo Yunnan Cancer Hospital and The First Affiliated Hospital of signaling output (8), we then investigated the regulation of TEAD4 Kunming Medical University, with patient written informed con- localization by GCs. TEAD4 was mainly located in cytoplasm in a sent and the approval from the Institute Research Ethics Com- normal control culture conditions in MDA-MB-231 (Fig. 1F), mittee. The patient studies were conducted according to Interna- MCF10A (Supplementary Fig. S2A), and NIH/3T3 cells (Supple- tional Ethical Guidelines for Biomedical Research Involving mentary Fig. S2B), and GC treatment induced obvious TEAD4 Human Subjects (CIOMS) ethical guidelines. nuclear accumulation (Fig. 1F and Supplementary Fig. S1A and S1B). Nuclear and cytoplasmic fraction extraction also confirmed Statistical analysis TEAD4 nuclear accumulation in MDA-MB-231 cells (Fig. 1G), Statistical parameters including the definitions and exact values MDA-MB-453 cells (Fig. 1H), MCF10A cells (Supplementary of n, statistical test and statistical significance are reported in the Fig. S2C) and NIH/3T3 cells (Supplementary Fig. S2D). Interest- figures and figure legends. Comparisons between groups were ingly, the regulation was specific to TEAD4 rather than any other analyzed using an unpaired Student t test in less than three TEADs. TEAD1/2/3 were always located in the nucleus with or groups and one-way ANOVA followed by Tukey multiple compar- without GC treatment (Supplementary Fig. S2E and S2F). 3 SD ison test in more than two groups by GraphPad Prism. SPSS 13.0 luciferase reporter was used to evaluate TEAD4 transcriptional (SPSS, inc.) was used to analyze the Pearson correlation between GR activity (5). GC upregulated the reporter activity both in MDA- and TEAD4. Survival curves were calculated according to the MB-231 cells (Fig. 1I) and MDA-MB-453 cells (Fig. 1J), and Kaplan–Meier method, and survival analysis was performed knockdown of TEAD4 almost blocked the GC-induced reporter using the log-rank test. Differences are considered statistically sig- activity (Supplementary Fig. S2G). Taken together, GCs regulate

www.aacrjournals.org Cancer Res; 79(17) September 1, 2019 4401

He et al.

Figure 1. Glucocorticoids upregulate TEAD4 transcriptional level and promote TEAD4 nuclear accumulation in breast cancer cells. A, Western blotting analysis of the protein levels of Hippo components with indicated antibodies. MDA-MB-231 cells were treated with dexamethasone (Dex) 1 mmol/L for 0, 1, 4, 8, or 12 hours. B, Quantification of YAP and TEAD4 protein levels. The protein levels were quantized by ImageJ. C, Protein levels of Hippo signaling components. MDA-MB-453 and BT-549 cells were treated with 1 mmol/L dexamethasone for 0, 4, or 12 hours. D and E, Quantitative PCR with reverse transcription (qRT–PCR) analysis of Hippo components mRNA levels. MDA-MB-231 and BT-549 cells were treated with 1 mmol/L dexamethasone for 4 or 12 hours. Two biological repeats per group. F, Representative confocal immunofluorescence images (left) of TEAD4 in MDA-MB-231 cells treated with 1 mmol/L dexamethasone or 1 mg/mL hydrocortisone (HC) for 12 hours. Ethanol (Etha) was used as a control. TEAD4 and DAPI were stained. Quantification of TEAD4 nuclear localization (N) and cytoplasmic localization (C) is provided (right). Scale bar, 10 mm. G and H, Nuclear and cytoplasmic fraction analysis of TEAD4 expression. MDA-MB-231 or MDA-MB-453 cells were treated as in F. Subcellular fractionation was performed with NE-PERTM nuclear and cytoplasmic extraction reagent (Thermo Fisher Scientific) according to the instructions of the manufacturer. Both fractions were analyzed by Western blotting with indicated antibodies. I and J, 3 SD luciferase reporter activity analysis of TEAD4 transcriptional activity. MDA-MB-231 and MDA-MB-453 cells were transfected with vector of 3 SD luciferase reporter, and 24 hours later, cells were treated with ethanol, 1 mmol/L dexamethasone, or 1 mg/mL hydrocortisone for 12 hours. The relative luciferase activities were determined by calculating the ratio of firefly luciferase activities over Renilla luciferase activities. Data were normalized to ethanol. Three biological repeats per group. Data in D–F, I, and J represent the mean SD. One-way ANOVA was used to compare the difference between groups. , P < 0.05; , P < 0.01; , P < 0.001; P < 0.0001; ns, no statistical significance. Significance was relative to control of each group.

TEAD4 not only by promoting its expression, but also nuclear the role of GR in regulating TEAD4, we interfered GR expression accumulation and transcriptional activity in breast cancer cells. by siRNA in MDA-MB-231 cells. Knockdown of GR totally blocked the nuclear upregulation of TEAD4 triggered by dexa- GC–GR axis regulates TEAD4 independent of YAP/TAZ methasone or hydrocortisone at both protein (Fig. 2A) and GCs regulates the expression of target genes by binding to mRNA levels (Fig. 2B). Although GR mainly located in nucleus GR and activating its transcriptional activity (37). To investigate in the absence of ligand treatment, which could be explained

4402 Cancer Res; 79(17) September 1, 2019 Cancer Research

GC-Activated TEAD4 Contributes to Breast Cancer Progression

Figure 2. The GC–GR axis regulates TEAD4 independent of YAP/TAZ. A and B, Analysis of TEAD4 subcellular localization and mRNA level in MDA-MB-231 cells transfected with indicated siRNA for 36 hours and treated with 1 mmol/L dexamethasone (Dex) or 1 mg/mL hydrocortisone (HC) for 12 hours. siNC was used as negative control. Nuclear and cytoplasmic extraction was analyzed by Western blotting (A), and mRNA level was analyzed by qRT–PCR (B). C and D, Analysis of TEAD4 subcellular localization and mRNA level in MDA-MB-231 cells treated with 1 mmol/L dexamethasone or 1 mg/mL hydrocortisone alone or in combination with RU486 1 mmol/L for 12 hours. Representative blots (C) and relative mRNA level (D) are shown. E, Analysis of transcriptional activity of TEAD4 by 3 SD luciferase reporter. MDA-MB-231 cells were transfected with 3 SD luciferase reporter and siRNA. After 24 hours, cells were treated with 1 mmol/L dexamethasone or 1 mg/mL hydrocortisone alone or in combination with RU486 1 mmol/L for 12 hours. Data were normalized to ethanol (Etha). F, Analysis of protein levels with indicated antibodies in YAP/TAZ deletion cells. MDA-MB-231 cells stably expressing shYAP were transfected with siTAZ for 36 hours and treated with 1 mmol/L dexamethasone or 1 mg/mL hydrocortisone for 12 hours. G, Analysis of mRNA levels with indicated RT-PCR primers in YAP/TAZ knockdown cells. MDA-MB-231 cells were transfected with siTAZ and siYAP for 36 hours and treated with 1 mmol/L dexamethasone or 1 mg/mL hydrocortisone for 12 hours. H, MDA-MB-231 were treated with verteporfin (VP) combined with 1 mmol/L dexamethasone or 1 mg/mL hydrocortisone for 12 hours. Data in B, D, E, and G represent the mean SD from two biological repeats. One-way ANOVA was used to compare the difference between groups. , P < 0.05; , P < 0.001; , P < 0.0001; ns, no statistical significance. Significance was relative to control of each group.

that besides ligand, the nuclear localization of GR also appears GR totally blocked the TEAD4 cytoplasmic-nuclear shuttling to be dependent in large part on nuclear retention mediated and at the same time decreased TEAD4 protein levels (Supple- through the binding of the receptors to DNA (38). The protein mentary Fig. S3B and S3C) in NIH/3T3 cells. The activation of levels of GR in the nucleus were reduced as a negative feedback TEAD4 induced by GCs was also completely blocked by cotreat- by GCs treatment (39). Knockdown of GR also blocked the ment with RU486 (GR antagonist) compared with only GCs mRNA level up-regulation of GLIZ (Supplementary Fig. S3A). treatment in MDA-MB-231 cells (Fig. 2C and D). Furthermore, These results were conﬁrmed in NIH/3T3 cells. Knockdown of GR silencing inhibited TEAD4 transcriptional activity

www.aacrjournals.org Cancer Res; 79(17) September 1, 2019 4403

He et al.

Figure 3. GR, forming a novel complex with TEAD4, is required for TEAD4 transcriptional activation. A, Schematic diagram of TEAD4 promoter region with conserved TEAD4 and GR-binding sites. B, ChIP analysis showed the binding of GR to the TEAD4 promoter. MDA-MB-231 cells were treated with 1 mmol/L dexamethasone (Dex) for 12 hours. Protein-bound chromatin was immunoprecipitated with the GR antibody, and IgG was used as a control. The immunoprecipitated DNA was analyzed by quantitative PCR using primers of TEAD4-binding sequence, and TEAD4-NC was used as a negative control. C, Luciferase reporter driven by wild- type or mutant TEAD4 promoter (as shown in A) was transfected in the presence or absence of dexamethasone or dexamethasone/RU486. D, Luciferase reporter analysis of the TEAD4 transcriptional activity with or without GR expression. Luciferase activity from TEAD4 promoter in MDA-MB-231 cells was measured following treatment with 1 mmol/L dexamethasone for 12 hours on the background of siGR transfection. E, ChIP analysis of the binding of TEAD4 to the TEAD4 promoter. MDA-MB-231 cells were treated with 1 mmol/L dexamethasone. (Continued on the following page.)

4404 Cancer Res; 79(17) September 1, 2019 Cancer Research

GC-Activated TEAD4 Contributes to Breast Cancer Progression

stimulated by GCs treatment in MDA-MB-231 cells (Fig. 2E) (Supplementary Fig. S4B). These data suggest that TEAD4 is a and MDA-MB-453 cells (Supplementary Fig. S3D). Thus, our direct target of GR in response to GCs. results indicate a critical role of GR in GC-induced TEAD4 nuclear accumulation and transactivation. GR–TEAD4 complex is required for TEAD4 transcriptional TEAD4 exerts its function mainly by binding with activation YAP/TAZ (5, 40). Because the GC–GR axis also activates YAP in TEAD4 positively autoregulates its own transcription by bind- breast cancer cells (11), we then examined whether there was a ing to the promoter of itself in the trophectoderm lineage, and correlation between YAP and TEAD4 in GC-dependent regula- high TEAD4 concentration facilitates its nuclear localization. Silencing of YAP/TAZ was incapable of blocking the tion (17). Interestingly, the DNA regions where TEAD4 binding up-regulation of TEAD4 induced by GCs treatment at both overlaps with the GR-binding regions in the promoter of protein and mRNA levels in MDA-MB-231 cells (Fig. 2F and TEAD4. We speculated that TEAD4 may bind with GR to G) and NIH/3T cells (Supplementary Fig. S3E). Moreover, we regulate its own transcription in response to GCs. We first also disrupted TEAD4 and YAP/TAZ binding by verteporfin detected the binding of TEAD4 to its own promoter by ChIP (VP) treatment, and there was no obvious influence on GC- assay in GC-treated MDA-MB-231 cells. Our results showed regulated TEAD4 expression (Fig. 2H). To further exclude the that TEAD4 bound to its own promoter region (Fig. 3E) and effect of YAP to TEAD4, we tested whether YAP influence the overexpression of wild type TEAD4 or TEAD4 active form TEAD4 protein stability. Overexpression of YAP or knockdown (TEAD4-VP16; ref. 43) upregulated TEAD4 promoter luciferase of YAP/TAZ did not change TEAD4 protein stability followed by activity (Supplementary Fig. S4C), which indicated an auto- cyclohexane treatment (Supplementary Fig. S3F and S3G). regulation of TEAD4 upon GCs treatment. These results indicate that YAP/TAZ are not responsible for We next examined the physical association between GR and GC-triggered TEAD4 activation. Altogether, our data demon- TEAD4. TEAD4 contains an N-terminal TEA domain responsible strate that the GC–GR axis regulates TEAD4 independent of for DNA binding, and a C-terminal YAP-binding domain respon- YAP/TAZ. sible for YAP/TAZ binding. GR generates two main isoforms: GR- a and GR-b. The longer isoform GR-a contains three distinct TEAD4 is a direct target of GR in response to GCs domains: transaction domain in the N-terminal, ligand-binding The previous reported regulation of TEAD4 contains phos- domain (LBD) in the C-terminal and DNA binding domain phorylation (13, 14), palmitoylation (15), nucleocytoplasmic (DBD) in the middle region responsible for specific DNA shuttling (8), and nuclear transport in the inner blastomere sequence recognition and binding (44). The schematic diagram (17). Our data showed that the GC–GR axis regulates TEAD4 at of TEAD4 and GR main domains were shown in Fig. 3F. GST pull- the transcriptional levels (Fig. 2B–D). As GR regulates genes down assay showed that GST-tagged GR pulled down TEAD4, and mainly by binding to their promoters (26), and GR regulates the interaction was mediated by N-terminal TEA domain but not TEAD4 transcription during adipogenesis (18). We hypothesized the C-terminal YAP-binding domain (Fig. 3G). Because the TEA that TEAD4 is also a direct target of GR during breast tumorigen- domain of TEADs proteins were conserved, GR could also pull- esis. There are three repeated CATTCC sequences in TEAD4 down TEAD1/2/3 (Supplementary Fig. S4D). GR full-length and promoter region that matched with the reported GR-binding DBD bind to TEAD4 but not the truncation form GR-DDBD sites (41, 42). The schematic diagram of TEAD4 promoter was (Fig. 3H), suggesting a specific interaction between the DNA shown in Fig. 3A. We then performed ChIP assay to detect the binding domains of TEAD4 and GR. Purified protein–protein binding of GR on TEAD4 promoter in GC-treated MDA-MB-231 pull-down assay also confirmed the direct interaction of GR-DBD cells and MBA-MB-453 cells. Our results confirmed that GR and TEAD4 (Supplementary Fig. S4E). Although YAP did not bind bound to the promoter region of TEAD4 (Fig. 3B and Supple- to GR in pull-down analysis (Supplementary Fig. S4F). Biotin- mentary Fig. S4A). A region without the CATTCC sequences serves labeled DNA from TEAD4 promoter region could pull down both as a negative control (Fig. 3B). The wild-type and core base pair TEAD4 and GR-DBD protein (Supplementary Fig. S4G). More- mutant of TEAD4 promoter luciferase reporters were both gen- over, adding DNase in the pull-down system decreased the erated (Fig. 3A). TEAD4 promoter luciferase activity was increased interaction of TEAD4 and GR (Fig. 3I), indicating that the inter- after GCs treatment, and decreased after RU486 cotreatment with action between TEAD4 and GR was enhanced by DNA again. GCs (Fig. 3C). In contrast, GCs failed to activate the mutant form ChIP–reChIP further proved that TEAD4 and GR genetically of TEAD4 promoter luciferase reporter (Fig. 3C). Knockdown of interacted on TEAD4 and CYR61/CTGF promoter (Fig. 3J). GR completely blocked the upregulation of TEAD4 promoter We then asked whether TEAD4–GR interaction is required luciferase activity triggered by GCs (Fig. 3D). Still, knockdown for GC-induced TEAD4 transcriptional activation. We made of YAP/TAZ had no effect to the TEAD4 transcriptional activity GR-2C2A mutant (C463A and C473A) that was unable to bind

(Continued.) F, Schematic diagram of main domains and sites of TEAD4 and GR. G, GST pull-down assay to detect the interaction of TEAD4 and GR. Purified GST-tagged GR recombinant proteins were incubated with cell lysates overexpressing Flag-tagged TEAD4, TEAD4-N, or TEAD4-C. GST protein was used as a negative control. H, GST pull-down assay to detect the main domain of GR mediating the interaction of TEAD4 and GR. Purified GST-tagged GR full-length and truncated recombinant proteins were incubated with cell lysates overexpressing Flag-tagged TEAD4. I, GST pull-down assay to determine the interaction of TEAD4 and GR with or without DNase. Digestion of DNA was detected by agarose gel. J, Two-step ChIP-PCR analysis of the TEAD4 binding to the TEAD4/CYR61/CTGF promoters with or without siGR transfection. MDA-MB-231 cells were treated with dexamethasone. K, Luciferase reporter analysis of TEAD4–GR complex to enhance TEAD4 transcription. Luciferase reporter driven by TEAD4 promoter was transfected with GR or GR-2C2A overexpression, then MDA-MB-231 cells were treated with ethanol (Etha) or dexamethasone. L, ChIP analysis of the binding of TEAD4 to the TEAD4/CYR61/CTGF promoter with or without siGR transfection. MDA-MB-231 cells were treated with 1 mmol/L dexamethasone. Data in B–E and J–L represent the mean SD from three biological repeats. One-way ANOVA was used to compare the difference between groups. , P < 0.05; , P < 0.001; , P < 0.0001; ns, no statistical significance. Significance was relative to control of each group.

www.aacrjournals.org Cancer Res; 79(17) September 1, 2019 4405

He et al.

Figure 4. The activity of TEAD4 positively correlates with GR expression in human breast cancer. A, Representative IHC images of GR and TEAD4 staining in the human TNBC samples; scale bar, 100/25 mm. B, Pearson correlation analysis of the expression correlation of GR and TEAD4 in 30 TNBC samples. C, Percentage statistic of TEAD4 and GR nuclear expression in the human TNBC samples. D, TEAD4 mRNA expression in breast cancer and normal tissue. The data were obtained from The Cancer Genome Atlas database. E, Kaplan–Meier survival analysis of TEAD4 mRNA levels with 3,951 samples of 35 datasets from Kaplan–Meier Plotter website using the log-rank test. Survival curve was calculated according to the Kaplan–Meier method. F and G, MTT analysis of cell proliferation. MDA-MB-231 cells stably expressed shLuc, shTEAD4, or shGR and the MTT assay was done daily for 6 days. Five biological repeats per group. H, Transwell analysis of cell migration. MDA-MB-231 cells stably expressed shLuc, shTEAD4, or shGR and were serum starved. The representative pictures of migrated cells are shown; scale bar, 500 mm. I, Tumorsphere formation assay was conducted with shLuc, shTEAD4, or shGR in 3 105 MDA-MB-231 cells. Representative images are shown. Scale bars, 400 mm, based on randomly selected 5 fields. J, Xenograft assay of tumor growth. MDA-MB-231 cells were stably expressed shLuc, shTEAD4, or shGR, and were implanted subcutaneously in nude mice. The average sizes of xenograft tumors were measured twice a week. Each group contained eight biological replicates of four mice. K, Weights of the tumors in G removed after 24 days. L, Representative images of removed tumors and the ratios of metastatic mice are shown; scale bar, 1 cm. Data in F–K represent the mean SD. One-way ANOVA was used to compare the difference between groups. , P < 0.01; , P < 0.00; , P < 0.0001; ns, no statistical significance. Significance was relative to control of each group.

4406 Cancer Res; 79(17) September 1, 2019 Cancer Research

GC-Activated TEAD4 Contributes to Breast Cancer Progression

with TEAD4 (Supplementary Fig. S4H) but did not influence its of TEAD4 inhibited GC-induced metastasis (Fig. 5E). In line with ability of DNA binding (Supplementary Fig. S4I). Overexpression this, the GCs treatment increased the expression of Ki67 in a of GR-2C2A mutant lost the ability of enhancing the GC-induced TEAD4-dependent manner in xenograft tumors (Fig. 5F). Over- TEAD4 promoter luciferase activity compared with GR-WT expression of TEAD4-mNLS (nuclear localization signal mutant) (Fig. 3K). Notably, knockdown of GR completely abolished blocked the function of GC in promoting proliferation (Supple- GC-induced auto-binding of TEAD4 to its own promoter and mentary Fig. S6A and S6B). In addition, TEAD4-VP16 overexpres- also blocked TEAD4's binding to the promoter of CYR61 and sion completely mimicked the function of GCs in promoting CTGF (Fig. 3L). Taken together, these results suggest that GC- TEAD4 promoter luciferase activity (Supplementary Fig. S6C) and activated GR facilitates TEAD4 transcription by co-binding with cell migration (Supplementary Fig. S6D). To further dissect the TEAD4 to the TEAD4 promoter, which further promotes function of TEAD4 in promoting tumor progression, wound- TEAD4–GR transactivation. healing assay was performed. Knockdown of TEAD4 resulted in suppression of GC-induced cell migration (Supplementary The activity of TEAD4 positively correlates with GR expression Fig. S6E). GR knockdown also blocked the GC-induced upregula- in clinical breast cancer tion of CYR61, ANKRD1 and vimentin (Supplementary Fig. S6F), To investigate whether the expression of TEAD4 correlates with as well as promotion of cell proliferation (Supplementary Fig. GR, we performed IHC staining of TEAD4 and GR in human S6G) and cell migration (Supplementary Fig. S6H). Because of the TNBC samples. There were 9 GR-positive and 9 TEAD4-positive importance of CSCs trait, we tested whether GC triggered CSCs samples in 30 total samples, and 8 of these GR or TEAD4 positive feature depends on TEAD4 and GR. Knocking down TEAD4, as samples were GR and TEAD4 double positive (Supplementary well as GR blocked GC treatment induced CSCs marker Slug, Table S2). The results showed that TEAD4 expression positively Nanog, and Oct4 expression (Fig. 5G, Supplementary Fig. S6I), correlated with the expression of GR (Fig. 4A and B). We also and blocked GC treatment induced tumorsphere formation þ checked their correlation in Her2-positive (Her2 ) and ERa- (Fig. 5H). Lung seeding assay assessing tumor migration ability þ positive (ER ) human breast cancer samples, and found that no in vivo showed that knockdown of TEAD4 or GR blocked GC- expression of TEAD4 was detected (Supplementary Fig. S5A and induced increase of the ratio of lung in the whole-body weight S5B), which was consistent with the previous study (22). As (Fig. 5I) and the number of metastatic tumors (Fig. 5J and K). TEAD4 and GR function mainly in the nucleus, we examined the Besides the contribution of TEAD4 and GR, it is noticeable percentage of TEAD4 and GR nuclear localization in human that YAP also contributed to the growth promotion function of TNBC samples, respectively. The results showed that almost all GCs (Supplementary Fig. S6J). It may be a synergistic result of of GR and TEAD4 had nuclear expression (Fig. 4C). These results TEAD4/YAP, and the function of YAP/TEAD4 still depends on the suggest that the activity of TEAD4 positively correlates with GR in transcriptional activity of TEAD4. Moreover, TEAD4 activated human breast cancer samples. form TEAD4-VP16 overexpression satisfied metastasis phenotype High expression of GR contributes to breast cancer progression (Fig. 5L–N). Thus, several lines of evidence indicate that and poor survival of patients (33, 45). Consistently, TEAD4 had GR-TEAD4 is essential for GCs induced CSCs feature, cell survival, higher expression in breast tumor compared with normal tissue and metastasis in vitro and in vivo. (Fig. 4D). We analyzed 3951 samples from 35 datasets and found high TEAD4 mRNA levels were associated with poor survival of GR–TEAD4 pathway is involved in GC-induced patients with breast cancer (Fig. 4E). To further investigate the role chemoresistance of TEAD4 and GR in breast cancer, we made shTEAD4 and shGR Breast cancer is sensitive to cytotoxic compounds like taxanes, stable cell lines in MDA-MB-231 cells (Supplementary Fig. S5C and GCs promote breast cancer cell drug resistance during cancer and S5D). Knockdown of TEAD4 or GR, respectively, inhibited therapy (33, 46). We then assessed whether TEAD4 was involved MDA-MB-231 cell proliferation (Fig. 4F–G) and migration in GC-induced chemoresistance. We monitored proliferation in (Fig. 4H). TEAD4 re-expression based on knockdown rescued the cells treated with vehicle, paclitaxel, or paclitaxel combined with proliferation inhibition induced by TEAD4 knocking down (Sup- dexamethasone. Dexamethasone treatment inhibited the cleaved plementary Fig. S5E and S5F). More importantly, knockdown of PARP and cleaved caspase-8 expressions and protected the cells TEAD4 or GR repressed cancer stem cells (CSC) trait, which is from apoptosis caused by paclitaxel treatment, but lost its func- considered a major driver for cell proliferation, migration, and tion in TEAD4 knockdown cells (Fig. 6A and B), suggesting that chemo-resistance (Fig. 4I). Subcutaneous xenotransplant in nude TEAD4 mediates GC-induced chemoresistance. To further gain mice was performed to study the function of TEAD4 and GR in insight into the role of TEAD4 in GC-triggered chemoresistance, vivo. The results showed shTEAD4 or shGR significantly repressed we inhibited TEAD-dependent transcriptional activity using niflu- tumor growth (Fig. 4J–L) and metastasis (Fig. 4L). mic acid (NA), a nonsteroidal anti-inflammatory drug (47). Paclitaxel treatment promoted the expression of apoptosis marker GR–TEAD4 mediates GC-triggered CSCs trait, as well as cell cleaved PARP and inhibited cell growth (Fig. 6C and D). Co- survival and metastasis in vitro and in vivo treatment paclitaxel with dexamethasone inhibited the function GCs treatment promotes cancer cell growth and anti- of paclitaxel (Fig. 6C and D). NA cotreatment abolished dexa- apoptosis (11, 30). We then investigated the role of TEAD4 methasone-induced expression changes of ANKRD1 and cleaved in GC-induced tumor growth. Knockdown of TEAD4 blocked PARP (Fig. 6C), also repressed dexamethasone-induced cell pro- GC-induced upregulation of proliferation-related genes BIRC5/ liferation (Fig. 6D). NA lost its function in TEAD4 knockdown ANKRD1 and EMT-related genes N-cadherin/vimentin (Fig. 5A), cells (Fig. 6E). These results indicate that transcriptional activity of which consequently suppressed the GC-induced cell proliferation TEAD4 is required for GC-induced chemoresistance in breast (Fig. 5B) and tumor growth (Fig. 5C–E). GCs treatment also cancer cells. To investigate whether NA works in vivo, we intra- promoted metastasis from primary solid tumors, and knockdown peritoneally injected different combined drugs after cells were

www.aacrjournals.org Cancer Res; 79(17) September 1, 2019 4407

He et al.

Figure 5. GR-TEAD4 mediates GC-triggered CSCs trait, as well as cell survival and metastasis in vitro and in vivo. A, Protein levels of GC-induced genes with shLuc or shTEAD4 transfection. MDA-MB-231 cells were treated with 1 mmol/L dexamethasone (Dex) for 12 hours with shLuc or shTEAD4 expression. B, MTT analysis of GC-triggered cell proliferation. MDA-MB-231 cells stably expressing shLuc or shTEAD4 were treated with ethanol (Etha), 1 mmol/L dexamethasone, or 1 mg/mL hydrocortisone (HC) when seeding cells. Five biological replicates per group. C, Xenograft analysis of GC-promoted tumor growth. MDA-MB-231 cells stably expressing shLuc or shTEAD4 were pretreated with ethanol or 1 mmol/L dexamethasone for 24 hours and were implanted subcutaneously in nude mice. The average sizes of xenograft tumors were measured twice a week. Each group contained eight biological replicates of four mice. D and E, Weights and pictures of the tumors in C removed after 22 days are shown; scale bar, 1 cm. F, Statistics of Ki67-positive cells in E. G, Protein level of GC-induced CSCs marker. H, Tumorsphere formation assay was conducted with shLuc, shTEAD4, or shGR in 3 105 MDA-MB-231 cells with or without GC treatment. Representative images are shown. Scale bars, 400 mm, based on randomly selected 5 ﬁelds. I, Lung seeding assay of tumor metastasis in vivo.(Continued on the following page.)

4408 Cancer Res; 79(17) September 1, 2019 Cancer Research

GC-Activated TEAD4 Contributes to Breast Cancer Progression

Figure 6. TEAD4 activation is involved in GC-induced chemoresistance. A, Knockdown of TEAD4 blocked GC-induced expression of apoptosis marker. MDA-MB-231 cells were treated with control, 0.1 mmol/L paclitaxel (PX), or 1 mmol/L dexamethasone as labeled with shLuc or shTEAD4 transfection. B, Inhibition of TEAD4 activity blocked GC-induced chemoresistance. MDA-MB-231 cells were treated as in A. Cell viability was detected after 4 days. Five repeats for each group. C and D, MDA-MB-231 cells were treated with DMSO, 100 mmol/L NA, or 1 mmol/L paclitaxel combined with ethanol or 1 mmol/L dexamethasone and then analyzed for protein levels (C) and cell survival (D). E, MDA-MB-231 cells were treated with DMSO or 100 mmol/L NA combined with 1 mmol/L paclitaxel and 1 mmol/L dexamethasone treatment with or without shTEAD4 expression and then analyzed for cell survival. F, Xenograft assay analysis of the function of TEAD4 transcriptional activity in GC-induced drug resistance. One million MDA-MB-231 cells were implanted subcutaneously in nude mice, and paclitaxel combined with dexamethasone or NA was intraperitoneally injected into the nude mice when the tumor volume was up to 50 mm3. The average sizes of xenograft tumors were measured twice a week. The tumor growth curves are shown. Each group contained six biological replicates. G and H, Tumor weight (G) and images of tumors in H removed after 33 days are shown; scale bar, 1 cm. I, IHC analysis of Ki67 and cleaved caspase-3 expression in tumor of G. Representative images are shown; scale bar, 20 mm. Data in B and D–G represent the mean SD. One-way ANOVA was used to compare the difference between groups. , P < 0.01; , P < 0.001; , P < 0.0001. Signiﬁcance was relative to control of each group. ns, no statistical signiﬁcance.

(Continued.) The ratio of lung in whole body weight is shown. One million cells stably expressing shLuc, shTEAD4, or shGR were pretreated as in C and injected into nude mice via tail vein. Mice were sacrificed after 40 days. More than five mice per group. J, Representative images of lung are shown. Scale bar, 1 cm. K, Statistical graph of tumor numbers in lung. L–N, The function of TEAD4 activation in tumor metastasis in vivo. One million MDA-MB-231 cells stably expressing control or TEAD-VP16 were injected into nude mice via tail vein, and the mice were analyzed as in I–K. Data in B–D, F, H, I, K, L, and N represent the mean SD. Unpaired t tests and one-way ANOVA were used to compare the difference between groups. , P < 0.05; , P < 0.01; P < 0.0001; ns, no statistical significance. Significance was relative to control of each group.

www.aacrjournals.org Cancer Res; 79(17) September 1, 2019 4409

He et al.

subcutaneously transplanted into nude mice. Paclitaxel treatment nous TEAD4-FL was mainly located in nucleus, and endogenous dramatically repressed tumor growth as shown by reduced tumor TEAD4-S was mainly located in cytoplasm by extraction of nuclear volume (Fig. 6F), decreased tumor weight and metastasis (Fig. 6G and cytoplasmic fraction. GCs trigger nuclear TEAD4-FL accumu- and H), reduced Ki67 expression and elevated cleaved caspase-3 lation, but cytoplasmic TEAD4-S does not show obvious change expression (Fig. 6I) compared with control group. Coinjection of in MDA-MB-231 and MDA-MB-453 cells. The increased ratio of dexamethasone with paclitaxel inhibited the tumor suppression TEAD4-FL/TEAD4-S suggests that GCs could also regulate TEAD4 function of paclitaxel, whereas NA treatment reversed Dex- alternative splicing and help TEAD4 produce more nuclear induced tumor chemoresistance (Fig. 6F–I). Our data suggest TEAD4-FL to promote tumor progression. that activity of TEAD4 is responsible for GC-induced chemore- TNBC is the most aggressive breast cancer subtype. Our work sistance in vitro and in vivo. demonstrated the oncogenic role and positive correlation of TEAD4 and GR in breast cancer. The GC–GR–TEAD4 axis was involved in the tumor initiation, progression, and drug resistance Discussion in breast cancer especially in TNBC. Our findings illustrated a new The Hippo signaling pathway plays critical roles in many molecular mechanism in TNBC regulation, and shed insights in biological processes. Although much has been learned about the developing new breast cancer therapy. regulation and function of the cofactors YAP/TAZ, less is known about the transcription factors TEADs. In this report, we provided Disclosure of Potential Conflicts of Interest evidence that GC–GR positively regulated TEAD4. YAP/TAZ dele- No potential conflicts of interest were disclosed. tion was not able to block the transcription regulation of TEAD4 induced by GCs, and overexpression of YAP was not able to Authors' Contributions stabilize TEAD4. Besides, GR directly interacted with TEAD4 Conception and design: L. He, Z. Wang, C. Chen, L. Zhang independent of YAP. These results revealed a YAP/TAZ- Development of methodology: L. He, Y. Sun, Z. Wang Acquisition of data (provided animals, acquired and managed patients, independent regulation of TEAD4 by GC–GR signaling. Even provided facilities, etc.): L. He though, YAP still contributes to the function of GCs. GC- Analysis and interpretation of data (e.g., statistical analysis, biostatistics, activated YAP–TEAD4 may bind with each other and play their computational analysis): L. He, P. Wang, H. Zhang function synergistically in breast cancer. Writing, review, and/or revision of the manuscript: L. He, Z. Wang, Y.A. Zeng, Several genes have been identified as TEAD4 cofactors and Y. Zhao, C. Chen, L. Zhang involved in the function of TEAD4. We previously reported that Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): L. He, Y. Sun, H. Zhang, X. Feng, Z. Wang, KLF5 forms a complex with TEAD4 and promotes breast cancer W. Zhang, C. Yang, Y.A. Zeng, C. Chen progression (22), and GCs also induces KLF5 through GR, and Study supervision: C. Chen, L. Zhang KLF5 partially mediated the GC-induced docetaxel and cisplatin Other (cultured the cells, cared the animals and purified the proteins): resistance in TNBC (32). In this study, we demonstrated that GR L. Yuan binds to TEAD4 to promote TEAD4 transcription and is involved in tumor growth and drug resistance. It is plausible that GC- Acknowledgments stimulated GR form a ternary complex with TEAD4-KLF5 and play We thank Xiaorui Zhang and Liping Kuai for the animal care. We acknowl- its function through TEAD4-KLF5. Interestingly, it is reported that edge Gaoxiang Ge, Zhenfei Li, and Lijian Hui for providing reagents and helpful comments. This work was supported by National Key Research and Develop- GC-liganded GR regulates target gene expression through binding ment Program of China (2017YFA0103601 to L. Zhang), National Natural to GC response elements, or tethering to other transcription Science Foundation of China (No. 31530043 and 31625017 to L. Zhang; factors such as AP1 or TEAD (41, 42). These cues also suggest U1602221, 81830087, and 31771516 to C. Chen), "Strategic Priority Research that GR may be involved in the regulation of Hippo signaling. Program" of Chinese Academy of Sciences (XDB19000000 to L. Zhang and Recently, several alternative splicing events were reporter to XDA16010405 to C. Chen), "Shanghai Leading Talents Program" (to L. Zhang), modulate Hippo signaling activity. RBM4-facilitated TEAD4 alter- Science and Technology Commission of Shanghai Municipality (19ZR1466300 to Z. Wang), and Youth Innovation Promotion Association of the Chinese native splicing produces a truncated isoform: TEAD4 shorter Academy of Sciences (to Z. Wang). isoform (TEAD4-S; ref. 16). TEAD4-S lacks an N-terminal DNA binding domain whereas maintains C-terminal YAP-binding The costs of publication of this article were defrayed in part by the payment of domain. Exogenous TEAD4-S is located in both nucleus and page charges. This article must therefore be hereby marked advertisement in cytoplasm, whereas TEAD4-FL is mainly located in nucleus. accordance with 18 U.S.C. Section 1734 solely to indicate this fact. TEAD4-FL functions as a tumor promoter, whereas TEAD4-S as a tumor suppressor (16). Our data demonstrated that GCs trigger Received January 2, 2019; revised April 24, 2019; accepted July 1, 2019; TEAD4-FL nuclear accumulation in breast cancer cells. Endoge- published first July 9, 2019.

References 1. Wu S, Huang J, Dong J, Pan D. Hippo encodes a Ste-20 family protein 5. Zhang L, Ren F, Zhang Q, Chen Y, Wang B, Jiang J. The TEAD/TEF family of kinase that restricts cell proliferation and promotes apoptosis in conjunc- transcription factor Scalloped mediates Hippo signaling in organ size tion with salvador and warts. Cell 2003;114:445–56. control. Dev Cell 2008;14:377–87. 2. Yin MX, Zhang L. Hippo signaling in epithelial stem cells. Acta Biochim 6.ZhouY,HuangT,ChengAS,YuJ,KangW,ToKF.TheTEADfamily Biophys Sin 2015;47:39–45. and its oncogenic role in promoting tumorigenesis. Int J Mol Sci 3. Yu FX, Zhao B, Guan KL. Hippo pathway in organ size control, tissue 2016;17. doi: 10.3390/ijms17010138. homeostasis, and cancer. Cell 2015;163:811–28. 7. Wang W, Xiao ZD, Li X, Aziz KE, Gan B, Johnson RL, et al. AMPK modulates 4. Hao Y, Chun A, Cheung K, Rashidi B, Yang X. Tumor suppressor LATS1 is a Hippo pathway activity to regulate energy homeostasis. Nat Cell Biol 2015; negative regulator of oncogene YAP. J Biol Chem 2008;283:5496–509. 17:490–9.

4410 Cancer Res; 79(17) September 1, 2019 Cancer Research

GC-Activated TEAD4 Contributes to Breast Cancer Progression

8. Lin KC, Moroishi T, Meng Z, Jeong HS, Plouffe SW, Sekido Y, et al. 28. Kofler R, Schmidt S, Kofler A, Ausserlechner MJ. Resistance to glucocorti- Regulation of Hippo pathway transcription factor TEAD by p38 MAPK- coid-induced apoptosis in lymphoblastic leukemia. J Endocrinol 2003; induced cytoplasmic translocation. Nat Cell Biol 2017;19:996–1002. 178:19–27. 9. Zhao B, Wei X, Li W, Udan RS, Yang Q, Kim J, et al. Inactivation of YAP 29. Moran TJ, Gray S, Mikosz CA, Conzen SD. The glucocorticoid receptor oncoprotein by the Hippo pathway is involved in cell contact inhibition mediates a survival signal in human mammary epithelial cells. Cancer Res and tissue growth control. Genes Dev 2007;21:2747–61. 2000;60:867–72. 10. Gao J, He L, Shi Y, Cai M, Xu H, Jiang J, et al. Cell contact and pressure 30. Zhang C, Beckermann B, Kallifatidis G, Liu Z, Rittgen W, Edler L, et al. control of YAP localization and clustering revealed by super-resolution Corticosteroids induce chemotherapy resistance in the majority of tumour imaging. Nanoscale 2017;9:16993–7003. cells from bone, brain, breast, cervix, melanoma and neuroblastoma. Int J 11. Sorrentino G, Ruggeri N, Zannini A, Ingallina E, Bertolio R, Marotta C, et al. Oncol 2006;29:1295–301. Glucocorticoid receptor signalling activates YAP in breast cancer. 31. Skor MN, Wonder EL, Kocherginsky M, Goyal A, Hall BA, Cai Y, et al. Nat Commun 2017;8:14073. Glucocorticoid receptor antagonism as a novel therapy for triple-negative 12. Chen L, Chan SW, Zhang X, Walsh M, Lim CJ, Hong W, et al. Structural basis breast cancer. Clin Cancer Res 2013;19:6163–72. of YAP recognition by TEAD4 in the hippo pathway. Genes Dev 2010;24: 32. Li Z, Dong J, Zou T, Du C, Li S, Chen C, et al. Dexamethasone induces 290–300. docetaxel and cisplatin resistance partially through up-regulating 13. Gupta MP, Kogut P, Gupta M. Protein kinase-A dependent phosphoryla- Kruppel-like factor 5 in triple-negative breast cancer. Oncotarget tion of transcription enhancer factor-1 represses its DNA-binding activity 2017;8:11555–65. but enhances its gene activation ability. Nucleic Acids Res 2000;28: 33. Chen Z, Lan X, Wu D, Sunkel B, Ye Z, Huang J, et al. Ligand-dependent 3168–77. genomic function of glucocorticoid receptor in triple-negative breast 14. Jiang SW, Dong M, Trujillo MA, Miller LJ, Eberhardt NL. DNA binding of cancer. Nat Commun 2015;6:8323. TEA/ATTS domain factors is regulated by protein kinase C phosphorylation 34. Jamdade VS, Sethi N, Mundhe NA, Kumar P, Lahkar M, Sinha N. Thera- in human choriocarcinoma cells. J Biol Chem 2001;276:23464–70. peutic targets of triple-negative breast cancer: a review. Br J Pharmacol 15. Noland CL, Gierke S, Schnier PD, Murray J, Sandoval WN, Sagolla M, et al. 2015;172:4228–37. Palmitoylation of TEAD transcription factors is required for their stability 35. Lamar JM, Stern P, Liu H, Schindler JW, Jiang ZG, Hynes RO. The Hippo and function in Hippo pathway signaling. Structure 2016;24:179–86. pathway target, YAP, promotes metastasis through its TEAD-interaction 16. Qi Y, Yu J, Han W, Fan X, Qian H, Wei H, et al. A splicing isoform of TEAD4 domain. PNAS 2012;109:E2441–50. attenuates the Hippo-YAP signalling to inhibit tumour proliferation. 36. Shi P, Feng J, Chen C. Hippo pathway in mammary gland development and Nat Commun 2016;7:ncomms11840. breast cancer. Acta Biochim Biophys Sin 2015;47:53–9. 17. Home P, Saha B, Ray S, Dutta D, Gunewardena S, Yoo B, et al. Altered 37. Biddie SC, Conway-Campbell BL, Lightman SL. Dynamic regulation of subcellular localization of transcription factor TEAD4 regulates first mam- glucocorticoid signalling in health and disease. Rheumatology 2012;51: malian cell lineage commitment. PNAS 2012;109:7362–7. 403–12. 18. Park B, Chang S, Lee GJ, Kang B, Kim JK, Park H. Wnt3a disrupts GR- 38. Hache RJ, Tse R, Reich T, Savory JG, Lefebvre YA. Nucleocytoplasmic TEAD4-PPARgamma2 positive circuits and cytoskeletal rearrangement in a trafficking of steroid-free glucocorticoid receptor. J Biol Chem 1999;274: beta-catenin-dependent manner during early adipogenesis. Cell Death Dis 1432–9. 2019;10:16. 39. Kadmiel M, Cidlowski JA. Glucocorticoid receptor signaling in health and 19. Jiao S, Wang H, Shi Z, Dong A, Zhang W, Song X, et al. A peptide mimicking disease. Trends Pharmacol Sci 2013;34:518–30. VGLL4 function acts as a YAP antagonist therapy against gastric cancer. 40. Zhao B, Ye X, Yu J, Li L, Li W, Li S, et al. TEAD mediates YAP-dependent gene Cancer Cell 2014;25:166–80. induction and growth control. Genes Dev 2008;22:1962–71. 20. Zhang W, Xu J, Li J, Guo T, Jiang D, Feng X, et al. The TEA domain family 41. Biddie SC, John S, Sabo PJ, Thurman RE, Johnson TA, Schiltz RL, et al. transcription factor TEAD4 represses murine adipogenesis by recruiting Transcription factor AP1 potentiates chromatin accessibility and glucocor- cofactors VGLL4 and CtBP2 into a transcriptional complex. J Biol Chem ticoid receptor binding. Mol Cell 2011;43:145–55. 2018;293:17119–34. 42.StarickSR,Ibn-SalemJ,JurkM,HernandezC,LoveMI,Chung 21. Jiao S, Li C, Hao Q, Miao H, Zhang L, Li L, et al. VGLL4 targets a TCF4- HR, et al. ChIP-exo signal associated with DNA-binding motifs TEAD4 complex to coregulate Wnt and Hippo signalling in colorectal provides insight into the genomic binding of the glucocorticoid cancer. Nat Commun 2017;8:14058. receptor and cooperating transcription factors. Genome Res 2015; 22. Wang C, Nie Z, Zhou Z, Zhang H, Liu R, Wu J, et al. The interplay between 25:825–35. TEAD4 and KLF5 promotes breast cancer partially through inhibiting the 43. Nishioka N, Inoue K, Adachi K, Kiyonari H, Ota M, Ralston A, et al. The transcription of p27Kip1. Oncotarget 2015;6:17685–97. Hippo signaling pathway components Lats and Yap pattern Tead4 activity 23. Zanconato F, Forcato M, Battilana G, Azzolin L, Quaranta E, Bodega B, et al. to distinguish mouse trophectoderm from inner cell mass. Dev Cell 2009; Genome-wide association between YAP/TAZ/TEAD and AP-1 at enhancers 16:398–410. drives oncogenic growth. Nat Cell Biol 2015;17:1218–27. 44. Gruver-Yates AL, Cidlowski JA. Tissue-specific actions of glucocorticoids on 24. Anbanandam A, Albarado DC, Nguyen CT, Halder G, Gao X, apoptosis: a double-edged sword. Cells 2013;2:202–23. Veeraraghavan S. Insights into transcription enhancer factor 1 (TEF-1) 45. Pan D, Kocherginsky M, Conzen SD. Activation of the glucocorticoid activity from the solution structure of the TEA domain. PNAS 2006;103: receptor is associated with poor prognosis in estrogen receptor-negative 17225–30. breast cancer. Cancer Res 2011;71:6360–70. 25. Shi Z, He F, Chen M, Hua L, Wang W, Jiao S, et al. DNA-binding mechanism 46. Herr I, Pfitzenmaier J. Glucocorticoid use in prostate cancer and other solid of the Hippo pathway transcription factor TEAD4. Oncogene 2017;36: tumours: implications for effectiveness of cytotoxic treatment and metas- 4362–9. tases. Lancet Oncol 2006;7:425–30. 26. Buttgereit F, Scheffold A. Rapid glucocorticoid effects on immune cells. 47.PobbatiAV,HanX,HungAW,WeiguangS,HudaN,ChenGY, Steroids 2002;67:529–34. et al. Targeting the central pocket in human transcription factor 27. Smith LK, Cidlowski JA. Glucocorticoid-induced apoptosis of healthy and TEAD as a potential cancer therapeutic strategy. Structure 2015;23: malignant lymphocytes. Prog Brain Res 2010;182:1–30. 2076–86.

www.aacrjournals.org Cancer Res; 79(17) September 1, 2019 4411

Glucocorticoid Receptor Signaling Activates TEAD4 to Promote Breast Cancer Progression

Lingli He, Liang Yuan, Yang Sun, et al.

Cancer Res 2019;79:4399-4411. Published OnlineFirst July 9, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-19-0012

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2019/07/09/0008-5472.CAN-19-0012.DC1

Cited articles This article cites 46 articles, 15 of which you can access for free at: http://cancerres.aacrjournals.org/content/79/17/4399.full#ref-list-1

Citing articles This article has been cited by 1 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/79/17/4399.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/79/17/4399. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.