DOCSLIB.ORG

The New Antitumor Drug ABTL0812 Inhibits the Akt/Mtorc1 Axis By

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The New Antitumor Drug ABTL0812 Inhibits the Akt/Mtorc1 Axis By Published OnlineFirst December 15, 2015; DOI: 10.1158/1078-0432.CCR-15-1808 Cancer Therapy: Preclinical Clinical Cancer Research The New Antitumor Drug ABTL0812 Inhibits the Akt/mTORC1 Axis by Upregulating Tribbles-3 Pseudokinase Tatiana Erazo1, Mar Lorente2,3, Anna Lopez-Plana 4, Pau Munoz-Guardiola~ 1,5, Patricia Fernandez-Nogueira 4, Jose A. García-Martínez5, Paloma Bragado4, Gemma Fuster4, María Salazar2, Jordi Espadaler5, Javier Hernandez-Losa 6, Jose Ramon Bayascas7, Marc Cortal5, Laura Vidal8, Pedro Gascon 4,8, Mariana Gomez-Ferreria 5, Jose Alfon 5, Guillermo Velasco2,3, Carles Domenech 5, and Jose M. Lizcano1 Abstract Purpose: ABTL0812 is a novel first-in-class, small molecule tion of Tribbles-3 pseudokinase (TRIB3) gene expression. Upre- which showed antiproliferative effect on tumor cells in pheno- gulated TRIB3 binds cellular Akt, preventing its activation by typic assays. Here we describe the mechanism of action of this upstream kinases, resulting in Akt inhibition and suppression of antitumor drug, which is currently in clinical development. the Akt/mTORC1 axis. Pharmacologic inhibition of PPARa/g or Experimental Design: We investigated the effect of ABTL0812 TRIB3 silencing prevented ABTL0812-induced cell death. on cancer cell death, proliferation, and modulation of intracel- ABTL0812 treatment induced Akt inhibition in cancer cells, tumor lular signaling pathways, using human lung (A549) and pancre- xenografts, and peripheral blood mononuclear cells from patients atic (MiaPaCa-2) cancer cells and tumor xenografts. To identify enrolled in phase I/Ib first-in-human clinical trial. cellular targets, we performed in silico high-throughput screening Conclusions: ABTL0812 has a unique and novel mechanism of comparing ABTL0812 chemical structure against ChEMBL15 action, that defines a new and drugable cellular route that links database. PPARs to Akt/mTORC1 axis, where TRIB3 pseudokinase plays a Results: ABTL0812 inhibited Akt/mTORC1 axis, resulting in central role. Activation of this route (PPARa/g-TRIB3-Akt- impaired cancer cell proliferation and autophagy-mediated cell mTORC1) leads to autophagy-mediated cancer cell death. Given death. In silico screening led us to identify PPARs, PPARa and the low toxicity and high tolerability of ABTL0812, our results PPARg as the cellular targets of ABTL0812. We showed that support further development of ABTL0812 as a promising anti- ABTL0812 activates both PPAR receptors, resulting in upregula- cancer therapy. Clin Cancer Res; 1–12. Ó2015 AACR. Introduction The PI3K/AKT/mTORC1 (mTOR complex-1) signaling path- 1 Protein Kinases and Signal Transduction Laboratory, Institut de Neu- way drives signals from ligand-stimulated receptor tyrosine rociencies and Departament de Bioquímica i Biologia Molecular, Uni- versitat Autonoma de Barcelona, Bellaterra, Barcelona, Spain. kinases (RTK) to proteins that control cell metabolism, growth, 2Department of Biochemistry and Molecular Biology, Faculty of size, survival, and angiogenesis (1). In response to growth or Biology, Universidad Complutense, Madrid, Spain. 3Instituto de survival factors, phosphorylated RTKs activate PI3K, which gen- Investigacion Sanitaria del Hospital Clínico San Carlos (IdISSC), erates the phosphatidylinositol 3,4,5-trisphosphate (PIP3) sec- Madrid, Spain. 4Area of Molecular and Translational Oncology, IDIBAPS, Fundacio Clínic, Universitat de Barcelona, Barcelona, Spain. ond messenger and allows the recruitment of protein kinase Akt to 5Ability Pharmaceuticals, SL, Edifici Eureka, Campus UAB, Bellaterra, the cellular membrane. Akt binds PIP3 through its PH domain, 6 Barcelona, Catalonia, Spain. Pathology Department, Hospital Uni- resulting in a conformational change that enables its activation versitari Vall d'Hebron, Barcelona, Spain. 7Institut de Neurociencies and Department of Biochemistry and Molecular Biology, Universitat through phosphorylation of two critical residues: Thr308 at the Autonoma de Barcelona, Barcelona, Spain. 8Medical Oncology T-loop of the kinase domain by the phosphoinositide-dependent Department, Novel Therapeutics Unit, Hospital Clínic Barcelona. kinase-1 (PDK1), and Ser473 at the C-terminal hydrophobic Barcelona, Catalonia, Spain. motif by mTOR complex-2 (mTORC2; refs. 2, 3). Active Akt Note: Supplementary data for this article are available at Clinical Cancer phosphorylates a plethora of substrates that regulate cell survival Research Online (http://clincancerres.aacrjournals.org/). and metabolism, and also cell growth through subsequent acti- Corresponding Author: Jose M. Lizcano, Institut de Neurociencies and Departa- vation of mTORC1. Akt phosphorylation of PRAS40 and TSC2 ment de Bioquímica i Biologia Molecular, Facultat de Medicina, Universitat leads to activation of mTORC1, which promotes protein trans- Autonoma de Barcelona, Bellaterra, Barcelona 08193, Spain. Phone: 34 935- lation and synthesis by phosphorylating ribosomal S6-Kinase 813-076; Fax: 34 935-811-573; E-mail: [email protected] (S6K) and the elongation factor 4EBP-1 (4). doi: 10.1158/1078-0432.CCR-15-1808 Human cancer is very often associated with activation of the Ó2015 American Association for Cancer Research. PI3K/Akt/mTORC1 pathway, mainly due to overexpression or www.aacrjournals.org OF1 Downloaded from clincancerres.aacrjournals.org on September 30, 2021. © 2015 American Association for Cancer Research. Published OnlineFirst December 15, 2015; DOI: 10.1158/1078-0432.CCR-15-1808 Erazo et al. plementary Table S1. Akt was immunoprecipitated following the Translational Relevance protocol previously described (11). Hyperactivation of the Akt/mTORC1 axis is commonly observed in many human cancers and blocking this pathway Transmission electron microscopy is an important anticancer strategy. Inhibition of Akt is a valid Cells treated with ABTL0812 or vehicle (ethanol) were pro- target for anticancer therapy and several AKT inhibitors are cessed as described before (12). Pellets were embedded in Epo- under clinical development. We present ABTL0812, a first-in- nate-12TM resin (Ted Pella). Ultrathin (70-nm thick) sections class small molecule with a unique mechanism of action. In were contrasted with uranyl-acetate and lead citrate solutions, and cells and tumor xenografts models, ABTL0812 induces upre- visualized in transmission electron microscope (Jeol JEM-1400) gulation of TRIB3 pseudokinase. TRIB3 binds Akt, preventing equipped with a CCD- GATAN-ES1000W Erlangshen camera. its activation by upstream kinases and resulting in an effective inhibition of the Akt/mTORC1 axis and in autophagy-medi- Xenograft models fi ated cancer cell death. ABTL0812 is currently in phase I/Ib rst- For A549 model, athymic female nude mice (n ¼ 5 per group) in-human clinical trial in patients with advance solid tumors. were injected subcutaneously with 5  106 cells in each flank. Preliminary results show that ABTL0812 also induces Akt When tumors reached 80 to 100 mm3, mice were randomly inhibition in humans. These evidences, together with a very distributed into treatment groups and administered the corre- low toxicity and high tolerability, support further develop- sponding treatments. ABTL0812 was administered by oral gavage ment of ABTL0812. at 120 mg/kg every day. Docetaxel was administered by intraper- itoneal route at 15 mg/kg once a week. MiaPaCa-2 cells were injected in athymic male mice (n ¼ 5 per group) with 10  106 cells in one flank. When tumors reached 80 to 160 mm3, mice activating mutations of RTKs and PI3K, to deletions/mutations of were randomly distributed and treated with vehicle or ABTL0812 the PIP3 phosphatase PTEN and to amplification of Akt (3, 5). 120 mg/kg by oral gavage five times per week. Tumor volumes 2 These types of tumors are hypersensitive to inhibition of each of were measured as (length  width )/2, twice a week. All proce- the components of the PI3K/Akt/mTORC1 axis, and therefore dures involving animal were performed with the approval of the major efforts have been taken to develop inhibitors of this Hospital Clinic Animal Experimentation Committee, according signaling pathway (6). Akt acts as a central node of this pathway, to Spanish official regulations. and hyperactivated Akt is a common feature observed in human solid tumors (3, 5). Therefore, Akt has been proposed as an Pharmacokinetics of ABTL0812 in mice and rats interesting target in cancer therapy. Two classes of Akt inhibitors ABTL0812 was orally (gavage, 100 mg/kg) and intravenously are now in clinical development: ATP-competitive inhibitors (10 mg/kg) administered to male CD-1 mice. ABTL0812 was (such as GSK690693) which target active Akt, and allosteric quantified in plasma by validated LC/MS-MS methods and phar- inhibitors (such as MK-2206 and perifosine, currently in phase macokinetic parameters were calculated with WinNonlin II and phase III clinical trials, respectively) that by binding the PH software. domain of Akt prevent its activation by upstream kinases (3, 7). Here we present ABTL0812, a first-in-class molecule with anti- Clinical trial and isolation of PBMC from patients tumor activity which is currently in phase I/Ib clinical trials in ABTL0812 is currently in clinical evaluation in a phase I/Ib trial patients with advanced solid tumors. We provide evidences show- in patients with advanced solid tumors. This study was approved ing that ABTL0812 inhibits Akt phosphorylation by upregulating by the local Ethics Committee of the Hospital Clinic Barcelona the expression of TRIB3,a pseudokinase that binds and inhibits Akt, and the
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • TRIB2 Functions As Novel Oncogene in Colorectal Cancer by Blocking
    Hou et al. Molecular Cancer (2018) 17:172 https://doi.org/10.1186/s12943-018-0922-x RESEARCH Open Access TRIB2 functions as novel oncogene in colorectal cancer by blocking cellular senescence through AP4/p21 signaling Zhenlin Hou1, Kaixuan Guo1, Xuling Sun1, Fuqing Hu1, Qianzhi Chen1, Xuelai Luo1, Guihua Wang1, Junbo Hu1 and Li Sun2* Abstract Background: Cellular senescence is a state of irreversible cell growth arrest and senescence cells permanently lose proliferation potential. Induction of cellular senescence might be a novel therapy for cancer cells. TRIB2 has been reported to participate in regulating proliferation and drug resistance of various cancer cells. However, the role of TRIB2 in cellular senescence of colorectal cancer (CRC) and its molecular mechanism remains unclear. Methods: The expression of TRIB2 in colorectal cancer tissues and adjacent tissues was detected by immunohistochemistry and RT-PCR. The growth, cell cycle distribution and cellular senescence of colorectal cancer cells were evaluated by Cell Counting Kit-8 (CCK8) assay, flow cytometry detection and senescence- associated β-galactosidase staining, respectively. Western blot, RT-PCR and luciferase assay were performed to determine how TRIB2 regulates p21. Immunoprecipitation (IP) and chromatin-immunoprecipitation (ChIP) were used to investigate the molecular mechanisms. Results: We found that TRIB2 expression was elevated in CRC tissues compared to normal adjacent tissues and high TRIB2 expression indicated poor prognosis of CRC patients. Functionally, depletion of TRIB2 inhibited cancer cells proliferation, induced cell cycle arrest and promoted cellular senescence, whereas overexpression of TRIB2 accelerated cell growth, cell cycle progression and blocked cellular senescence. Further studies showed that TRIB2 physically interacted with AP4 and inhibited p21 expression through enhancing transcription activities of AP4.
    [Show full text]
  • Characterization of TRIB2-Mediated Resistance to Pharmacological Inhibition of MEK
    VANESSA MENDES HENRIQUES Characterization of TRIB2-mediated resistance to pharmacological inhibition of MEK Oncobiology Master Thesis Faro, 2017 VANESSA MENDES HENRIQUES Characterization of TRIB2-mediated resistance to pharmacological inhibition of MEK Supervisors: Dr. Wolfgang Link Dr. Bibiana Ferreira Oncobiology Master Thesis Faro, 2017 Título: “Characterization of TRIB2-mediated resistance to pharmacological inhibition of MEK” Declaração de autoria do trabalho Declaro ser a autora deste trabalho, que é original e inédito. Autores e trabalhos consultados estão devidamente citados no texto e constam da listagem de referências incluída. Copyright Vanessa Mendes Henriques _____________________________ A Universidade do Algarve tem o direito, perpétuo e sem limites geográficos, de arquivar e publicitar este trabalho através de exemplares impressos reproduzidos em papel ou de forma digital, ou por qualquer outro meio conhecido ou que venha a ser inventado, de o divulgar através de repositórios científicos e de admitir a sua cópia e distribuição com objetivos educacionais ou de investigação, não comerciais, desde que seja dado crédito ao autor e editor. i Acknowledgements First, I would like to thank the greatest opportunity given by professor doctor Wolfgang Link to accepting me into his team, contributing to my scientific and personal progress. Thank You for all Your knowledge and help across the year. A special thanks to Bibiana Ferreira who stayed by me all year and trained me. Thank You for all you taught me, thank you for all your patience and time and all the support. Thank you for all the great times that You provided me. It was an amazing experience to learn and work with You, which made me grow as a scientist and also as a person.
    [Show full text]
  • Genome-Wide Sirna Screen for Mediators of NF-Κb Activation
    Genome-wide siRNA screen for mediators SEE COMMENTARY of NF-κB activation Benjamin E. Gewurza, Fadi Towficb,c,1, Jessica C. Marb,d,1, Nicholas P. Shinnersa,1, Kaoru Takasakia, Bo Zhaoa, Ellen D. Cahir-McFarlanda, John Quackenbushe, Ramnik J. Xavierb,c, and Elliott Kieffa,2 aDepartment of Medicine and Microbiology and Molecular Genetics, Channing Laboratory, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; bCenter for Computational and Integrative Biology, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114; cProgram in Medical and Population Genetics, The Broad Institute of Massachusetts Institute of Technology and Harvard, Cambridge, MA 02142; dDepartment of Biostatistics, Harvard School of Public Health, Boston, MA 02115; and eDepartment of Biostatistics and Computational Biology and Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, MA 02115 Contributed by Elliott Kieff, December 16, 2011 (sent for review October 2, 2011) Although canonical NFκB is frequently critical for cell proliferation, (RIPK1). TRADD engages TNFR-associated factor 2 (TRAF2), survival, or differentiation, NFκB hyperactivation can cause malig- which recruits the ubiquitin (Ub) E2 ligase UBC5 and the E3 nant, inflammatory, or autoimmune disorders. Despite intensive ligases cIAP1 and cIAP2. CIAP1/2 polyubiquitinate RIPK1 and study, mammalian NFκB pathway loss-of-function RNAi analyses TRAF2, which recruit and activate the K63-Ub binding proteins have been limited to specific protein classes. We therefore under- TAB1, TAB2, and TAB3, as well as their associated kinase took a human genome-wide siRNA screen for novel NFκB activa- MAP3K7 (TAK1). TAK1 in turn phosphorylates IKKβ activa- tion pathway components. Using an Epstein Barr virus latent tion loop serines to promote IKK activity (4).
    [Show full text]
  • TRIB3 Stabilizes High TWIST1 Expression to Promote Rapid APL Progression and ATRA Resistance
    Author Manuscript Published OnlineFirst on June 24, 2019; DOI: 10.1158/1078-0432.CCR-19-0510 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. TRIB3 Stabilizes High TWIST1 Expression to Promote Rapid APL Progression and ATRA Resistance Jian Lin1, 3, Wu Zhang1, 3, *, Li-Ting Niu1, Yong-Mei Zhu1, Xiang-Qin Weng1, Yan Sheng1, Jiang Zhu1 and Jie Xu1, 2, * 1State Key Laboratory for Medical Genomics, Shanghai Institute of Hematology, National Research Center for Translational Medicine, Rui-Jin Hospital, Shanghai Jiao-Tong University School of Medicine and School of Life Sciences and Biotechnology, Shanghai Jiao-Tong University, 197 Ruijin Er Road, Shanghai 200025, China. 2Translational Medicine Ward, Department of Hematology, Rui-Jin Hospital, Shanghai 200025, China. 3These authors contributed equally to this work. *Correspondence: Jie Xu, State Key Laboratory for Medical Genomics and Shanghai Institute of Hematology Rui-Jin Hospital, affiliated to Shanghai Jiao-Tong University School of Medicine, Shanghai, 200025, China. E-mail: [email protected]; and Wu Zhang, State Key Laboratory for Medical Genomics and Shanghai Institute of Hematology Rui-Jin Hospital, affiliated to Shanghai Jiao-Tong University School of Medicine, Shanghai, 200025, China. E-mail: [email protected]; Running title: TRIB3 stabilizes TWIST1 to promote APL progression Key words: Acute promyelocytic leukemia; TWIST1; TRIB3; Early death; ATRA-resistance Conflict of interest statement: The authors declare no potential conflicts of interest. 1 Downloaded from clincancerres.aacrjournals.org on October 1, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on June 24, 2019; DOI: 10.1158/1078-0432.CCR-19-0510 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • The New Antitumor Drug ABTL0812 Inhibits the Akt/Mtorc1 Axis By
    Published OnlineFirst December 15, 2015; DOI: 10.1158/1078-0432.CCR-15-1808 Cancer Therapy: Preclinical Clinical Cancer Research The New Antitumor Drug ABTL0812 Inhibits the Akt/mTORC1 Axis by Upregulating Tribbles-3 Pseudokinase Tatiana Erazo1, Mar Lorente2,3, Anna Lopez-Plana 4, Pau Munoz-Guardiola~ 1,5, Patricia Fernandez-Nogueira 4, Jose A. García-Martínez5, Paloma Bragado4, Gemma Fuster4, María Salazar2, Jordi Espadaler5, Javier Hernandez-Losa 6, Jose Ramon Bayascas7, Marc Cortal5, Laura Vidal8, Pedro Gascon 4,8, Mariana Gomez-Ferreria 5, Jose Alfon 5, Guillermo Velasco2,3, Carles Domenech 5, and Jose M. Lizcano1 Abstract Purpose: ABTL0812 is a novel first-in-class, small molecule tion of Tribbles-3 pseudokinase (TRIB3) gene expression. Upre- which showed antiproliferative effect on tumor cells in pheno- gulated TRIB3 binds cellular Akt, preventing its activation by typic assays. Here we describe the mechanism of action of this upstream kinases, resulting in Akt inhibition and suppression of antitumor drug, which is currently in clinical development. the Akt/mTORC1 axis. Pharmacologic inhibition of PPARa/g or Experimental Design: We investigated the effect of ABTL0812 TRIB3 silencing prevented ABTL0812-induced cell death. on cancer cell death, proliferation, and modulation of intracel- ABTL0812 treatment induced Akt inhibition in cancer cells, tumor lular signaling pathways, using human lung (A549) and pancre- xenografts, and peripheral blood mononuclear cells from patients atic (MiaPaCa-2) cancer cells and tumor xenografts. To identify enrolled in phase I/Ib first-in-human clinical trial. cellular targets, we performed in silico high-throughput screening Conclusions: ABTL0812 has a unique and novel mechanism of comparing ABTL0812 chemical structure against ChEMBL15 action, that defines a new and drugable cellular route that links database.
    [Show full text]
  • Mirc11 Disrupts Inflammatory but Not Cytotoxic Responses of NK Cells
    Published OnlineFirst September 12, 2019; DOI: 10.1158/2326-6066.CIR-18-0934 Research Article Cancer Immunology Research Mirc11 Disrupts Inflammatory but Not Cytotoxic Responses of NK Cells Arash Nanbakhsh1, Anupallavi Srinivasamani1, Sandra Holzhauer2, Matthew J. Riese2,3,4, Yongwei Zheng5, Demin Wang4,5, Robert Burns6, Michael H. Reimer7,8, Sridhar Rao7,8, Angela Lemke9,10, Shirng-Wern Tsaih9,10, Michael J. Flister9,10, Shunhua Lao1,11, Richard Dahl12, Monica S. Thakar1,11, and Subramaniam Malarkannan1,3,4,9,11 Abstract Natural killer (NK) cells generate proinflammatory cyto- g–dependent clearance of Listeria monocytogenes or B16F10 kines that are required to contain infections and tumor melanoma in vivo by NK cells. These functional changes growth. However, the posttranscriptional mechanisms that resulted from Mirc11 silencing ubiquitin modifiers A20, regulate NK cell functions are not fully understood. Here, we Cbl-b, and Itch, allowing TRAF6-dependent activation of define the role of the microRNA cluster known as Mirc11 NF-kB and AP-1. Lack of Mirc11 caused increased translation (which includes miRNA-23a, miRNA-24a, and miRNA-27a) of A20, Cbl-b, and Itch proteins, resulting in deubiquityla- in NK cell–mediated proinflammatory responses. Absence tion of scaffolding K63 and addition of degradative K48 of Mirc11 did not alter the development or the antitumor moieties on TRAF6. Collectively, our results describe a func- cytotoxicity of NK cells. However, loss of Mirc11 reduced tion of Mirc11 that regulates generation of proinflammatory generation of proinflammatory factors in vitro and interferon- cytokines from effector lymphocytes. Introduction TRAF2 and TRAF6 promote K63-linked polyubiquitination that is required for subcellular localization of the substrates (20), Natural killer (NK) cells generate proinflammatory factors and and subsequent activation of NF-kB (21) and AP-1 (22).
    [Show full text]
  • Mondoa Drives Muscle Lipid Accumulation and Insulin Resistance
    MondoA drives muscle lipid accumulation and insulin resistance Byungyong Ahn, … , Kyoung Jae Won, Daniel P. Kelly JCI Insight. 2019. https://doi.org/10.1172/jci.insight.129119. Research In-Press Preview Metabolism Muscle biology Obesity-related insulin resistance is associated with intramyocellular lipid accumulation in skeletal muscle. We hypothesized that in contrast to current dogma, this linkage is related to an upstream mechanism that coordinately regulates both processes. We demonstrate that the muscle-enriched transcription factor MondoA is glucose/fructose responsive in human skeletal myotubes and directs the transcription of genes in cellular metabolic pathways involved in diversion of energy substrate from a catabolic fate into nutrient storage pathways including fatty acid desaturation and elongation, triacylglyeride (TAG) biosynthesis, glycogen storage, and hexosamine biosynthesis. MondoA also reduces myocyte glucose uptake by suppressing insulin signaling. Mice with muscle-specific MondoA deficiency were partially protected from insulin resistance and muscle TAG accumulation in the context of diet-induced obesity. These results identify MondoA as a nutrient-regulated transcription factor that under normal physiological conditions serves a dynamic checkpoint function to prevent excess energy substrate flux into muscle catabolic pathways when myocyte nutrient balance is positive. However, in conditions of chronic caloric excess, this mechanism becomes persistently activated leading to progressive myocyte lipid storage and insulin resistance. Find the latest version: https://jci.me/129119/pdf Revised manuscript JCI Insight 129119-INS-RG-RV-3 MondoA Drives Muscle Lipid Accumulation and Insulin Resistance Byungyong Ahn1, Shibiao Wan2, Natasha Jaiswal2, Rick B. Vega3, Donald E. Ayer4, Paul M. Titchenell2, Xianlin Han5, Kyoung Jae Won2, Daniel P.
    [Show full text]
  • High Throughput Kinase Inhibitor Screens Reveal TRB3 and MAPK-ERK/Tgfβ Pathways As Fundamental Notch Regulators in Breast Cancer
    High throughput kinase inhibitor screens reveal TRB3 and MAPK-ERK/TGFβ pathways as fundamental Notch regulators in breast cancer Julia Izrailita,b, Hal K. Bermana,c, Alessandro Dattid,e, Jeffrey L. Wranad, and Michael Reedijka,b,f,1 aCampbell Family Institute for Breast Cancer Research, Ontario Cancer Institute, Toronto, ON, Canada M5G 2M9; bDepartment of Medical Biophysics, University of Toronto, Ontario Cancer Institute, Princess Margaret Hospital, Toronto, ON, Canada M5G 2M9; cDepartment of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, ON, Canada M5S 1A8; dCenter for Systems Biology, Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, ON, Canada M5G 1X5; eDepartment of Experimental Medicine and Biochemical Sciences, University of Perugia, 06100 Perugia, Italy; and fDepartment of Surgical Oncology, Princess Margaret Hospital, University Health Network, Toronto, ON, Canada M5G 2M9 Edited by Tak W. Mak, The Campbell Family Institute for Breast Cancer Research, Ontario Cancer Institute at Princess Margaret Hospital, University Health Network, Toronto, ON, Canada, and approved December 12, 2012 (received for review August 20, 2012) Expression of the Notch ligand Jagged 1 (JAG1) and Notch acti- TGFβ signaling pathways. These findings are consistent with vation promote poor-prognosis in breast cancer. We used high a previously reported association between TRB3 expression and throughput screens to identify elements responsible for Notch acti- poor overall survival in breast cancer (16) and establishes TRB3 vation in this context. Chemical kinase inhibitor and kinase-specific as a potential therapeutic target in this malignancy. small interfering RNA libraries were screened in a breast cancer cell line engineered to report Notch. Pathway analyses revealed MAPK- Results ERK signaling to be the predominant JAG1/Notch regulator and this MAPK Regulates Notch in Breast Cancer.
    [Show full text]
  • UPR-Mediated TRIB3 Expression Correlates with Reduced AKT Phosphorylation and Inability of Interleukin 6 to Overcome Palmitate-Induced Apoptosis in Rinm5f Cells
    183 UPR-mediated TRIB3 expression correlates with reduced AKT phosphorylation and inability of interleukin 6 to overcome palmitate-induced apoptosis in RINm5F cells Jose´ Edgar Nicoletti-Carvalho*, Tatiane C Arau´jo Nogueira*, Renata Gorja˜o1, Carla Rodrigues Bromati, Tatiana S Yamanaka, Antonio Carlos Boschero2, Licio Augusto Velloso3, Rui Curi, Gabriel Forato Anheˆ4 and Silvana Bordin Department of Physiology and Biophysics, Institute of Biomedical Sciences, University of Sao Paulo, Prof. Lineu Prestes Ave #1524. ICB 1- Room 125, 05508-900 Sao Paulo, SP, Brazil 1Institute of Physical Activity Sciences and Sports, Cruzeiro do Sul University, Sao Paulo, SP, 03342-000, Brazil Departments of 2Physiology and Biophysics, Institute of Biology, 13083-862, 3Internal Medicine, Faculty of Medical Sciences and 4Pharmacology, Faculty of Medical Sciences, State University of Campinas, Campinas, SP, 13083-887, Brazil (Correspondence should be addressed to S Bordin; Email: [email protected]) *(J E Nicoletti-Carvalho and T C Arau´jo Nogueira contributed equally to this work) Abstract Unfolded protein response (UPR)-mediated pancreatic b-cell that IL6 is unable to overcome PA-stimulated UPR, as assessed by death has been described as a common mechanism by which activating transcription factor 4 (ATF4) and C/EBP homologous palmitate (PA) and pro-inflammatory cytokines contribute to the protein (CHOP) expression, X-box binding protein-1 gene development of diabetes. There are evidences that interleukin 6 mRNA splicing, and pancreatic eukaryotic initiation factor-2a (IL6) has a protective action against b-cell death induced kinase phosphorylation, whereas no significant induction of by pro-inflammatory cytokines; the effects of IL6 on PA-induced UPR by pro-inflammatory cytokines was detected.
    [Show full text]
  • TRIB3 Is Implicated in Glucotoxicity- and Oestrogen Receptor-Stress-Induced B-Cell Apoptosis
    407 TRIB3 is implicated in glucotoxicity- and oestrogen receptor-stress-induced b-cell apoptosis Bo Qian1,2, Haiyan Wang3, Xiuli Men2, Wenjian Zhang2, Hanqing Cai2, Shiqing Xu2, Yaping Xu2, Liya Ye2, Claes B Wollheim3 and Jinning Lou2 1Graduate School of Peking Union Medical College, Beijing 100730, People’s Republic of China 2Institute of Clinical Medical Sciences, China–Japan Friendship Hospital, Beijing 100029, People’s Republic of China 3Department of Cell Physiology and Metabolism, University Medical Center, 1 rue Michel-Servet, CH-1211 Geneva 4, Switzerland (Correspondence should be addressed to J Lou; Email: [email protected]) Abstract We found that TRIB3, an endogenous inhibitor of Akt confirmed that the DJm of mitochondria was decreased, (PKB), is expressed in pancreatic b-cells. The TRIB3 caspase-3 activity was up-regulated and reactive oxygen expression is significantly increased in islets isolated from species content was increased in TRIB3 overexpressing b cells hyperglycemic Goto–Kakizaki rats compared with normal in high glucose condition. Most interestingly, the oestrogen glycemic controls. In vitro high glucose treatment also resulted receptor (ER) stress inducer, thapsigargin, mimicked the high in increased TRIB3 expression in rat INS1 cells. To glucose effects on up-regulation of TRIB3 and generation of investigate the role of TRIB3 in the regulation of b-cell apoptosis in cultured INS1 cells. These effects were function, we established an INS1 stable cell line allowing specifically prevented by siRNA knock down of TRIB3. inducible expression of TRIB3. We demonstrated that We therefore conclude that TRIB3 is implicated in overexpression of TRIB3 mimicked the glucotoxic effects glucotoxicity- and ER stress-induced b-cell failure.
    [Show full text]
  • Surface EGFR Expression
    UC San Diego UC San Diego Electronic Theses and Dissertations Title The Role of BMP4 and Oxygen in Trophoblast Lineage Specification and Differentiation Permalink https://escholarship.org/uc/item/0269k42k Author Wakeland, Anna Kearny Publication Date 2015 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO The Role of BMP4 and Oxygen in Trophoblast Lineage Specification and Differentiation A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Anna Kearny Wakeland Committee in Charge: Professor Mana M. Parast, Chair Professor Sylvia Evans Professor Robert Oshima Professor Frank Powell Professor Shunichi Shimasaki 2015 Signature Page The Dissertation of Anna Kearny Wakeland is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Chair University of California, San Diego 2015 iii DEDICATION Dedication In recognition of their unwavering love and support, I dedicate my dissertation to my best friend and love of my life, Israel Castillo, and to my loving family; my mother, Adelia Kearny, my father, John Wakeland, and my brother, Stephen Wakeland. They all have stood by me every step of the way throughout my graduate studies, and have always been there to listen to me and provide encouragement, humor, empathy, guidance and love. iv TABLE OF CONTENTS Table of Contents Signature Page .........................................................................................................
    [Show full text]