Mirc11 Disrupts Inflammatory but Not Cytotoxic Responses of NK Cells

Home , BATF (gene), CBX1, COA3, EYA1, FAM71E1, HSPA12A

Published OnlineFirst September 12, 2019; DOI: 10.1158/2326-6066.CIR-18-0934

Research Article Cancer Immunology Research Mirc11 Disrupts Inﬂammatory but Not Cytotoxic Responses of NK Cells Arash Nanbakhsh1, Anupallavi Srinivasamani1, Sandra Holzhauer2, Matthew J. Riese2,3,4, Yongwei Zheng5, Demin Wang4,5, Robert Burns6, Michael H. Reimer7,8, Sridhar Rao7,8, Angela Lemke9,10, Shirng-Wern Tsaih9,10, Michael J. Flister9,10, Shunhua Lao1,11, Richard Dahl12, Monica S. Thakar1,11, and Subramaniam Malarkannan1,3,4,9,11

Abstract

Natural killer (NK) cells generate proinflammatory cyto- g–dependent clearance of Listeria monocytogenes or B16F10 kines that are required to contain infections and tumor melanoma in vivo by NK cells. These functional changes growth. However, the posttranscriptional mechanisms that resulted from Mirc11 silencing ubiquitin modifiers A20, regulate NK cell functions are not fully understood. Here, we Cbl-b, and Itch, allowing TRAF6-dependent activation of define the role of the microRNA cluster known as Mirc11 NF-kB and AP-1. Lack of Mirc11 caused increased translation (which includes miRNA-23a, miRNA-24a, and miRNA-27a) of A20, Cbl-b, and Itch proteins, resulting in deubiquityla- in NK cell–mediated proinflammatory responses. Absence tion of scaffolding K63 and addition of degradative K48 of Mirc11 did not alter the development or the antitumor moieties on TRAF6. Collectively, our results describe a func- cytotoxicity of NK cells. However, loss of Mirc11 reduced tion of Mirc11 that regulates generation of proinflammatory generation of proinflammatory factors in vitro and interferon- cytokines from effector lymphocytes.

Introduction TRAF2 and TRAF6 promote K63-linked polyubiquitination that is required for subcellular localization of the substrates (20), Natural killer (NK) cells generate proinflammatory factors and and subsequent activation of NF-kB (21) and AP-1 (22). Regu- mediate antitumor cytotoxicity (1, 2). Upon recognizing target lation of these signaling events is obligatory to prevent pathologic cells, activation receptors initiate unique signaling cascades in NK inflammation (23). One established mechanism is mediated cells (3). Adaptor proteins DAP10 (4), DAP12 (5), and CD3z (6) by lipids (SHIP and PTEN) and protein phosphatases (CD45, recruit key signaling proteins including Syk (7), Fyn (8), PI(3)- SHP1, and SHP2) that are recruited to inhibitory Ly49/KIR p110d/p85a (9–11), Grb2 (12), PLC-g2 (13, 14), ADAP (15, 16), receptors (24, 25). Carma1 (17), Bcl10 (18), and TAK1 (19). E3 ligases including In addition, ubiquitin regulators such as A20, Itch, Cbl-b, and Cyld synthesize and add polyubiquitin chains to lysine (K) 48 of 1Laboratory of Molecular Immunology and Immunotherapy, Blood Research ubiquitin molecules leading to the proteasomal degradation of Institute, BloodCenter of Wisconsin, Milwaukee, Wisconsin. 2Laboratory of substrates (26–29). Ubiquitin regulators can alter the activation Lymphocyte Signaling, Blood Research Institute, BloodCenter of Wisconsin, threshold of NF-kB and AP-1 by targeting multiple signaling Milwaukee, Wisconsin. 3Department of Medicine, Medical College of Wisconsin, proteins including TRAF6 (30). However, the regulatory role of 4 Milwaukee, Wisconsin. Department of Microbiology and Immunology, Medical small noncoding microRNAs (miRNA), which degrade mRNAs in 5 College of Wisconsin, Milwaukee, Wisconsin. Laboratory of B Cell Biology, other cell types, is unknown in NK cells. The Mirc11 (micro RNA Blood Research Institute, BloodCenter of Wisconsin, Milwaukee, Wisconsin. 6Bioinformatics Core, Blood Research Institute, BloodCenter of Wisconsin, cluster 11, also known as miRNA-23a) locus encodes three Milwaukee, Wisconsin. 7Laboratory of Stem Cell Biology, Blood Research miRNAs, miR-23a, miR-27a, and miR-24-2, from a single primary Institute, BloodCenter of Wisconsin, Milwaukee, Wisconsin. 8Department of Cell mRNA transcript (31). The Mirc11 cluster is highly conserved in Biology, Medical College of Wisconsin, Milwaukee, Wisconsin. 9Genome mouse and human genomes. Mirc22 (micro RNA cluster 22, Sciences and Precision Medicine Center, Medical College of Wisconsin, Milwau- also known as miRNA-23b) is a paralog of Mirc11 and encodes 10 kee, Wisconsin. Department of Physiology, Medical College of Wisconsin, miR-23b, miR-27b, and miR-24-1 (31). Despite study of Mirc11 in Milwaukee, Wisconsin. 11Department of Pediatrics, Medical College of Wisconsin, Milwaukee, Wisconsin. 12Indiana University School of Medicine, South Bend, lymphocyte biology (32, 33), little functional or mechanistic Indiana. insight exists regarding its effect on NK cell development and function. Note: Supplementary data for this article are available at Cancer Immunology fi fl Research Online (http://cancerimmunolres.aacrjournals.org/). Here we de ne Mirc11 as an obligatory regulator of in ammatory responses in NK cells. A lack of the Mirc11 cluster did not Corresponding Author: Subramaniam Malarkannan, Blood Research Institute, affect the development of NK cells. Ex vivo and in vitro antitumor 8727 Watertown Plank Road, Milwaukee, WI 53226. Phone: 414-937-3812; cytotoxicity of NK cells from Mirc11 / mice was mostly intact. Fax: 414-937-6811; E-mail: [email protected] However, in vitro stimulation of NK cells from Mirc11 / mice Cancer Immunol Res 2019;7:1647–62 with mitogenic antibodies revealed defective production of doi: 10.1158/2326-6066.CIR-18-0934 inflammatory cytokines. NK cell–produced IFNg-dependent 2019 American Association for Cancer Research. in vivo clearance of Listeria monocytogenes and B16F10 melanoma

www.aacrjournals.org 1647

Nanbakhsh et al.

was defective in Mirc11 / mice. Transcriptome-wide analyses of release (MR) by lysing the cells with hydrochloric acid and NK cells after either anti-NKG2D–mediated in vitro stimulation or spontaneous release (SR) of the radioactivity in the media with in vivo Listeria challenge indicated a global defect in NF-kB and AP- target cells alone. Specific lysis: 100 [(experimental counts per 1–mediated gene transcription in the absence of Mirc11. We show minutes (CPM) SR (average CPM)/(MR (average CPM) SR that members of Mirc11 targeted and silenced the transcripts (average CPM)] ¼ % specific lysis. encoding A20, Itch, and Cbl-b, thereby reducing the TRAF6- fi mediated activation and nuclear translocation of NF-kB and Quanti cation of cytokines and chemokines AP-1 complexes. Our findings provide insight into microRNA- IL2-cultured NK cells were activated with plate-bound mito- mediated regulation of lymphocyte functions and identify targets genic antibodies (2.5 mg/mL) against NKG2D (A10), CD137 for containing pathologic inflammation. (17B5), or Ly49D (4E5) for 18 hours. Culture supernatants were analyzed in a Bioplex assay (Bio-Rad). As positive controls, IL2- cultured NK cells were stimulated with 1 ng/mL of IL12 (R&D Materials and Methods Systems) and 10 ng/mL of IL18 (MBL), and the supernatants were Mice and cell lines analyzed. Intracellular IFNg was quantified as previously C57BL/6 mice (wild type, WT) were obtained from The Jackson described (36). Cytokine encoding transcripts were quantified as Laboratory. Mirc11 / mice were backcrossed with C57BL/6 mice described earlier (15). for at least 10 generations (34). Spleens from Cyld / and Itch / mice were a gift from Dr. V.K. Poojary at Baylor Research Institute, Cytoplasmic and nuclear extracts 6 Dallas, TX. Spleens from Tnfaip3 / mice were a gift from Dr. D. IL2-cultured NK cells (3 10 ) were stimulated with anti- Starczynowski at Cincinnati Children Hospital, Cincinnati, OH. All NKG2D mAb (2.5 mg/mL) for 40 minutes. Cells were suspended mice were maintained in pathogen-free conditions at the Biomed- in 100 mL cold buffer A (10 mmol/L HEPES pH 7.9, 10 mmol/L ical Resource Center-Medical College of Wisconsin. All animal and KCl, 0.2 mmol/L EDTA, 1 mmol/L DTT, 3 mg/mL aprotinin, human peripheral blood mononuclear cell (PBMC) usage was 2 mg/mL Pepstatin, and 1 mg/mL leupeptin). After incubation on approved by the Institutional Animal Care and Use Committee ice for 15 minutes, Nonidet P-40 was added to a final concen- (IACUC; AUA1512) and Institutional Review Board (IRB). EL4, tration of 0.5%. The mixtures were vortexed for 10 seconds and RMA, RMA/S, and YAC-1 cell lines were purchased from ATCC. spun at 16,000 g for 30 seconds. The supernatants were Generation of H60-expressing EL4 stable cell lines has been collected as the cytoplasmic extracts. The pellets were washed described (35). When needed, frozen aliquots of these cell lines with buffer A once and resuspended in 50 mL buffer B (20 mmol/L were thawed and used for a period of 3 weeks. Reauthentication of HEPES pH 7.9, 400 mmol/L NaCl, 2 mmol/L EDTA, 1 mmol/L RMA and RMA/S was performed through analysis of levels of MHC DTT, 3 mg/mL aprotinin, 2 mg/mL Pepstatin, and 1 mg/mL class I (H2-Kb and H2-Db). Expression of H60 was used to authen- leupeptin), followed by incubation on ice for 15 minutes. The ticate EL4-H60 and the parental EL4 cell lines. YAC-1 background mixtures were spun at 16,000 g for 5 minutes, and the super- was verified through lack of H-2b and the presence of H-2a.Allcell natants were collected as the nuclear extracts. lines are tested every 3 months for and are negative for Mycoplasma. Immunoblotting Antibodies and flow cytometry Whole-cell lysate (15–20 mg) or nuclear extracts (10 mg) were Antibodies for NK1.1 (PK136), CD3e (17A2, 145-2C11), resolved using 10% SDS-PAGE gels, transferred to polyvinylidene NKG2D (A10), CD137 (17b5), CD137L (TKS-1), and anti- difluoride (PVDF) membranes, and probed with indicated anti- human IFNg (MG1.2) were from e-Bioscience. Anti-Ly49D bodies. Antibodies for b-actin (ACTBD11B7), TRAF6 (H-274), and (4E5) and RIP1 were from BD Pharmingen. Antibody for NCR1 TRAF2 (F-2) were from Santa Cruz Biotechnology. K63-linkage (MAB2225) was from R&D Systems. Antibodies for CD45.1 Specific Polyubiquitin (D7A11), K48-linkage Specific Polyubiqui- (A20) and CD45.2 (#104) were from BioLegend. Single-cell tin (D9D5), A20 (#4625), Cbl-b (D3C12), Cyld (#4495), and Itch suspensions were stained in 1% FBS–PBS. Flow cytometry anal- (D8Q6D) were from Cell Signaling Technologies. Signals were yses were performed in LSR-II or MACSQuant and analyzed with detected using SuperSignal West Pico Chemiluminescent Substrate FACSDiva (BD) or FlowJo. (Thermo Scientific). The band intensities of phospho-protein were normalized against the respective total protein. NK cell preparation NK cells were purified as described (15). Nylon wool- Immunoprecipitation nonadherent cells were cultured with 1,000 U/mL of IL2 (NCI- Unstimulated or plate-bound anti-NKG2D (2.5 mg/mL)–acti- BRB-Preclinical Repository) or 100 ng/mL of IL15 (PeproTech vated NK cells were lysed using IP lysis buffer containing Tris (pH Inc.). The purity of the NK cultures was checked by flow cytometry, 7.5, 20 mmol/L), NaCl (150 mmol/L), EDTA (1 mmol/L), EGTA þ and preparations with more than 95% of CD3e NK1.1 cells (1 mmol/L), Triton X100 (1%), sodium pyrophosphate (2.5 were used. mmol/L), beta-glycerophosphate (1 mmol/L), sodium orthova- nadate (1 mmol/L), leupeptin (1 mg/mL), and phenylmethylsul- Cytotoxicity fonyl fluoride (PMSF; 1 mmol/L). The lysate was centrifuged at NK cells were used as effectors in 51Chromium (Cr)-release 12,000 g for 10 minutes to remove debris. For immunopre- assays. Target cells were labeled with 50 mCi 51Cr (PerkinElmer) in cipitation, 300 to 500 mg of the lysate was incubated for 1 hour FBS for 1 hour at 37C, washed, plated in 96-well U-bottom plates with 2 mg of the indicated antibody at 4C. Protein G Plus agarose in serial dilutions with effector cells at corresponding ratios, and (20 mL; Santa Cruz Biotechnology) was added and incubated incubated at 37C for 4 hours. Supernatants were used to measure overnight at 4C. Following centrifugation, the supernatant was the radioactivity in a 1470 Automatic Gamma Counter (Perki- aspirated, and the beads were washed with the IP lysis buffer. SDS- nElmer). The specific lysis was calculated relative to maximum sample buffer (6X, reducing, BP-111R, Boston BioProducts)

1648 Cancer Immunol Res; 7(10) October 2019 Cancer Immunology Research

Role of Mirc11 in NK Cell–Mediated Anticancer Responses

þ diluted to 1 concentration with the IP lysis buffer was added to Total RNA was extracted from splenic CD3e NK1.1 NK cells the bead pellet and denatured at 95C for 10 minutes. The using TRIzol before and after challenging with 2 104 CFU of L. samples were electrophoresed using 10% SDS-PAGE gel. monocytogenes (n ¼ 3/group), followed by library preparation using TruSeq RNA (Illumina Inc.). Individual libraries were Electrophoretic mobility shift assay sequenced on either NextSeq500 or an Illumina HiSeq2500. The IL2-cultured NK cells (3 106) were stimulated with anti- RSEM program function "rsem-prepare-reference" (v1.3.0) was NKG2D (2.5 mg/mL) for 40 minutes and then prepared for used to extract the transcript sequences from the mouse genome nuclear extracts. Nuclear extracts were incubated with 32P- (Build GRCm38; ref. 37) and to generate Bowtie2 indices (Bow- labeled NF-kB or AP-1 probe (NF-kB probe: 50-AGTTGAGGG- tie2 v2.2.8; ref. 38). Bioconductor package DESeq2 version 0 0 GACTTTCCCAGGC-3 ; AP-1 probe: 5 -CGCTTGATGACT- 1.12.4 (39) to compute Log2 fold changes and false discovery CAGCCGGAA-3; Santa Cruz Biotechnology) for 15 minutes at rate (FDR)–adjusted P values. Statistical significance was deter- room temperature, resolved on a 4% polyacrylamide gel at 4C, mined at an FDR threshold of 0.05. Data were analyzed for and exposed to X-ray film. pathway enrichment using Ingenuity Pathway Analysis (IPA; Qiagen). We interrogated a B-cell regulatory network (http:// fi Quanti cation of Mirc11 califano.c2b2.columbia.edu/networks/) with the gene-expression – miRNAs were extracted using TRIzol (Invitrogen). DNase I profiles among stimulated NK cells to identify the regulon of each treated total RNA (8 ng) was subjected to qRT-PCR analysis using gene of interest. This network analysis was carried out using the TaqMan miR Reverse Transcription Kit (Applied Biosystems). R Bioconductor package DeMAND (https://bioconductor.org/ fi fi miR-23a, miR-24-2, and miR-27a were quanti ed by using speci c packages/release/bioc/html/DeMAND.html). primers. Expression of mature miRNAs was evaluated using comparative Threshold Cycle (Ct) method (2- DCt). Transcript B16F10 infusions fi quanti cations were normalized with small nucleolar RNA 202. B16F10 cells (2 105,or106) were injected into mice through the retro-orbital or tail vein. Seven or 14 days later, the recipient Target prediction and luciferase reporter assay mice were euthanized, 10 mL PBS was used for a right ventricular Miranda (www.microrna.org/microrna/home.do) and Target- flush, and the lungs were excised. Each set of lungs was photo- Scan (www.targetscan.org) were used to identify potential targets graphed, and the lung nodules were counted in a blinded manner. for miR-23a, miR-24-2,andmiR-27a. To validate that A20, Cblb, Lungs were fixed in 10% (v/v) neutral buffered formalin for 24 to Itch,andCyld are the targets of Mirc11, sequences of these genes 72 hours. Tissue blocks were cut at 4 mm and mounted on poly-L- were cloned into the psiCHECK vector in HEK293T cells. lysine coated slides. Sections were deparaffinized with xylene, HEK293T cells were then cotransfected with the luciferase rehydrated, and stained with hematoxylin and eosin. Stained reporter constructs with 10 nmol/L of pre-miR-23a, pre-miR- slides were scanned using a Hamamatsu Slide scanner and viewed 24-2, pre-miR-27a, or control microRNA. Transfection was done using NDPiView software. using Lipofectamine 2000 (Invitrogen) in OPTIMEM (Invitro- gen) medium. After 48 hours, the cells were harvested, and the Statistical analysis luciferase signals were measured. Statistical analyses were performed using paired, two-sample Lentiviral vectors equal or unequal variance. Student t test was used depending on fi Lenti-miR vectors (System Biosciences) were used to produce the type of data. P values of 0.05 were considered signi cant. mature miRNA-23a, miRNA-24-2, and miRNA-27a from CMV Normal distribution of sample variance was assumed on the basis promoter with GFP reporter to monitor miRNA expression. of earlier studies. Transduced human NK cells (105) were cocultured with K562 5 (10 ) for 4 hours, and intracellular IFNg expression was quanti- Results fied by flow cytometry. Lack of Mirc11 does not alter NK cell development L. monocytogenes infection Mirc11 consists of miR-23a, miR-27a, and miR-24-2 (Supple- L. monocytogenes was grown to stationary phase, aliquoted, mentary Fig. S1A) and acts as a switch in regulating the lineage titered, and stored at 80C. Before injection, bacteria were thawed commitment of hematopoietic stem and progenitor cells (HSPC; on ice, grown to early exponential phase in brain–heart infusion refs. 40, 41). A lack of Mirc11 did not alter the percentages of þ broth, and diluted in PBS. The LD50 of L. monocytogenes strain CD3e NK1.1 NK cells in the bone marrow (BM) and other 10403S is 2 105 CFU in C57BL/6 mice. For infections, a dose peripheral organs (spleen, liver, lung, and blood; Supplementary 4 4 of 10 or 2 10 was suspended in 200 mL of PBS and injected Fig. S1B). Expression of NK cell maturation markers CD51 (av) retro-orbitally into 8- to 12-week-old mice. Mice were moni- and CD49b was unaffected by Mirc11 deficiency. A decrease in toreddailyandweresacrificed 48 or 72 hours later. Splenocytes expression of CD51 (42) and CD27, an increase in integrin were used for flow cytometry and RNA sequencing (RNA-seq). CD11b (aMb2), and eventually, loss of CD27 define functional Livers were used for CFU calculation. maturation, which were comparable between Mirc11-deficient and WT mice of the two genotypes (Supplementary Fig. S1C and RNA-seq S1D). NK cells defined by the stochastic acquisition of distinct The raw sequence data have been deposited in the Gene Ly49 receptors such as Ly49C/I, Ly49H, Ly49A, Ly49D, and Expression Omnibus (GEO) at the National Center for Biotech- Ly49G2 (42) were similar (Supplementary Fig. S1C and S1E). nology Information (NCBI) under the accession number Terminally mature NK cells, as defined by KLRG1expression (43), GSE136015 and are publicly accessible at: https://www.ncbi. were unaltered in Mirc11 / relative to WT mice. Thus, lack of nlm.nih.gov/geo/query/acc.cgi?acc=GSE136015. Mirc11 did not affect the development and maturation of NK cells.

www.aacrjournals.org Cancer Immunol Res; 7(10) October 2019 1649

Nanbakhsh et al.

Effect of Mirc11 on NK cell–mediated cytotoxicity Touseanunbiasedapproachtoidentifytargetgenes Next, we evaluated the cytotoxic potential of na€ve NK cells regulated by the Mirc11, we performed transcriptome-wide against B16F10 tumor cells that express CD155 (induced-self), a RNA-seq analyses of purified IL2-cultured splenic NK cells ligand for DNAM-1; parental EL4 thymoma cells (self); EL4 cells activated with plate-bound anti-NKG2D. Total mRNA was stably transfected with H60 (EL4H60), a ligand for NKG2D isolated, transcribed, and sequenced. Unsupervised analyses (induced-self); RMA cells (self); RMA/S cells that lack the normal of transcriptional profiles of nonstimulated and anti-NKG2D– expression of MHC class I H-2b (missing-self); and YAC1 cells that activated NK cells using principal component analyses (PCA) areofH-2a strain background(allo).Na€veNKcellswere onlyable to revealed that stimulated WT NK cells possessed a transcriptome mediate detectable cytotoxicity against missing-self and allo targets, distinct from Mirc11 / NK cells (Supplementary Fig. S3A). We with a statistically significant difference between WT and Mirc11 / used statistical filtering (P < 0.05 Mann–Whitney, Benjamini– mice being reached only for missing-self (Supplementary Fig. S2A). Hochberg correction of stimulated vs. unstimulated) to identify IL2 plays a role in the clearance of B16F10 cells in vivo (44). genes that corresponded to different conditions based on the Purified splenic NK cells expanded with IL2 and tested their similarity of available transcripts. Among the unstimulated – – cytotoxic potentials on day 7. NK cells from Mirc11 / and WT controls, a set of 255 genes was distinctly expressed in NK mice were similarly cytotoxic to B16F10 cells and other targets cells from the WT that were low or not expressed in the (Supplementary Fig. S2B). The reduction in cytotoxicity of IL15- Mirc11 / NK cells (Fig. 1D). Following anti-NKG2D– cultured NK cells from Mirc11 / or WT mice was only significant mediated activation, WT NK cells differentially expressed for missing-self or allo targets (Supplementary Fig. S2C). Thus, 1,074 transcripts compared with the unstimulated, of which Mirc11 does not regulate the cytotoxic potentials of NK cells, 240 overlapped between WT and Mirc11 / mice. A total of consistent with the role of IL2, which is known to bypass the 834 genes were expressed only in WT NK cells following anti- requirement of WASp-dependent actin polymerization in NK NKG2D–mediated activation, which was low or absent in the cells (45). Mirc11 / NK cells. Indeed, comparison of the differentially In a transplant rejection model, host WT or Mirc11 / (H-2b) expressed transcripts revealed attenuation of the expression of mice were challenged with donor-derived splenocytes from proinflammatory cytokines, chemokines, and cytotoxic gran- b tm1Unc b / C57BL/6 (H-2 ; "self"), b2M /J (H-2 ; but negative for ule-associated factors in the Mirc11 NK cells (Fig. 1E and F). cell-surface H2-Kb and H2-Db; "missing-self") and BALB/c (H- Collectively, this shows that Mirc11 plays a role in positively 2d; "nonself") mice. Donor splenocytes were labeled and injected. regulating production of proinflammatory factors. The number of remaining donor splenocytes after 18 hours represented a surrogate marker for NK cell–mediated killing. Loss Mirc11 is obligatory for NK cell–mediated in vivo clearance of of Mirc11 significantly impaired the ability of NK cells to clear L. monocytogenes "missing-self" but not "nonself" targets (Supplementary To evaluate the role of Mirc11 in the IFNg-dependent clearance Fig. S2D), suggesting that NK cells partially rely on Mirc11 for of L. monocytogenes infection, we systemically infected mice with 4 regulation of cell-mediated cytotoxicity. live L. monocytogenes (2 10 , 0.5 LD50) and tested for expression of individual members of Mirc11 in purified splenic NK cells Mirc11 is essential for proinflammatory responses of NK cells after 48 hours. Significant changes in the expression were To address whether the lack of Mirc11 affects the production observed for the miR-27a transcript, followed by the miR-24-2 of inflammatory cytokines, IL2- or IL15-cultured NK cells were and the miR-23a, suggesting a regulatory function of these tran- cocultured with tumor targets (Fig. 1A and B). A lack of Mirc11 scripts during Listeria infection (Fig. 2A). Compared with WT significantly impaired the ability of NK cells to produce IFNg. mice, the number of bacteria in the livers of Mirc11 / mice was Although culturing NK cells from Mirc11 / mice with IL2 higher after 48 hours (Fig. 2B). We also observed a significant þ helped to overcome the defect in antitumor cytotoxicity, it did reduction in the percentages of IFNg-positive CD3e NK1.1 NK not rescue IFNg production (Fig. 1A). This indicates that Mirc11 cells from Mirc11 / compared with WT mice (Fig. 2C) during L. regulates the cytotoxicity and cytokine production via distinct monocytogenes infection. mechanisms. To ensure that the impairment in cytokine production To determine the specific signaling pathways affected by the observed in Mirc11 NK cells was intrinsic, we generated mixed absence of Mirc11, we stimulated NK cells with plate-bound BM chimeras. Equal numbers of BM-derived cells from WT þ þ antibodies. IL2-cultured NK cells were activated with anti- (CD45.1 ;B6.SJL)andMirc11 / (CD45.2 ;C57BL/6)mice / / NKG2D (DAP10 and DAP12), anti-NCR1 (Fc eRIg and CD3z), weretransferredintoRag2 gc mice. Six weeks later, mice anti-CD137 (Lck-Fyn and TRAF2), anti-CD244 (SAP-Fyn), or were challenged with L. monocytogenes (2 104). After anti-Ly49H (DAP10 and DAP12). Culture supernatants were 48 hours, spleens were analyzed for the percentage of IFNg- þ analyzed for IFNg,TNFa, GM-CSF, CCL3 (MIP1a), CCL4 positive CD3e NK1.1 NK cells. Whereas the percentage of NK (MIP1b), and CCL5 (RANTES). Generation of these cytokines cells did not differ, indicating comparable survival rates of NK and chemokines was significantly impaired in NK cells from cells between the two genotypes (Fig. 2D), IFNg production Mirc11 / mice compared with WT (Fig. 1C). IL12 and IL18 can was significantly reduced in NK cells from Mirc11 / compared also induce NK cells to produce cytokines (46), and analyses with that from WT mice (Fig. 2E). of their supernatants revealed that the production of IFNg, To further assess transcriptomic changes, WT and Mirc11 / GM-CSF, CCL3, CCL4, and CCL5 was comparable between mice were again challenged with L. monocytogenes. After 48 hours, þ Mirc11 / and WT mice. Thus, the function of Mirc11 is splenic CD3e NK1.1 NK cells were sorted, and total mRNA for required downstream of activation receptor–mediated signal- each group (unchallenged or challenged) was sequenced. Unsu- ing, and that lack of the Mirc11 complex did not render NK cells pervised analyses of transcriptomic profiles using PCA revealed globally hyporesponsive. that the transcriptome of NK cells from the WT mice was distinct

1650 Cancer Immunol Res; 7(10) October 2019 Cancer Immunology Research

Role of Mirc11 in NK Cell–Mediated Anticancer Responses

A C WT Mirc11−/− D F WT Anti-NKG2D mAb −/− Mirc11−/− 120 −/− WT Mirc11 15 80 IFNγ WT vs. Mirc11

s llecKN * 20 10 *** + ***

γ 10

NFI% 5 Anti-NKG2D Unstim Anti-NKG2D 834 Unstim ** ** 0 400 α 0 TNF Ifng H60 RMA EL4 Csf2 YAC-1 RMA/S EL4 200 240 Tnfa IL2-cultured NK cells + Areg 0 255 Tnni3 Lif GM-CSF Nonstimulated Tnfrsf13b WT vs. Mirc11−/− Ccl3 B E Ccl5 Gzmb *** Ccl3 Gzma

s 20 llecKN Prf1 *** ** Gzme Gzmd 15 + Gzmg γ Gzmf NFI% * *** Ifng Gzmf Gzmc 10 Csf2 Gzmm adjusted P Prf1 10 Tnfa 5 Gzmg Il23a

−Log Gzmd Gzmb Il2 Ccl5 Il7 Il2 Gzmm 0 Lif Il18 Il18 −4 −3 −2 −1 0123

Log2 fold change

Figure 1. Lack of Mirc11 reduces NK cell–mediated cytokine production in vitro. A and B, Intracellular IFNg is measured in IL2- or IL15-cultured NK cells from WT (n ¼ 3) and Mirc11/ (n ¼ 3) mice after coculture with indicated targets (effector:target ¼ 1:1). C, Quantitative analyses of cytokines and chemokines produced by WT (*, n ¼ 6) or Mirc11/ (*, n ¼ 6) NK cells following activation with indicated antibodies and IL12 and IL18. D, Venn diagram depicting differentially expressed genes (FDR < 0.05) in NK cells following anti-NKG2D activation (Mirc11 / , n ¼ 3; WT, n ¼ 3). E, Volcano plot depicting alterations in the transcriptome of NK cells (n ¼ 3, 3). We plotted all the genes with–Log10 (P values) greater than 80 at the Y-axis equal to 80. F, Heat map derived from RNA-seq of IL2-cultured NK cells stimulated with anti-NKG2D (n ¼ 3, 3). Bar graphs represent the mean with the standard deviations obtained using unpaired t test (, P < 0.05; , < 0.01; , <0.001). from that from Mirc11 / mice (Supplementary Fig. S3A). Ccl7), cytotoxic granule–associated factors (Gzmc, Gzmb, Pfr1, Statistical analyses revealed the differentially expressed genes in Gzmf, Gzma), and interleukins (Il10, Il17a, Il27, Il6, Il12a, Il15, the WT and Mirc11 / mice. NK cells derived from WT and Il22, Il22b, Il18, Il23a, Il7, Il2, Il4) were reduced by more than Mirc11 / mice challenged with L. monocytogenes showed dif- 50% in NK cells from the Mirc11 / mice relative to WT ferential expression of 6,519 and 7,537 genes, respectively. NK (Fig.2H).Thus,Mirc11 plays a role in positively regulating cells from the spleen of the nonchallenged WT and Mirc11 / the production of proinflammatory factors. mice had differential expression of 3,433 and 4,184 genes, respectively. In NK cells derived from nonchallenged mice, a set Mirc11 is required for NK cell–mediated in vivo clearance of of 740 genes were differentially expressed in WT compared with B16F10 those of Mirc11 / mice with a difference in the expression of To evaluate the role of the Mirc11 in regulating antitumor 2-fold or more change in either direction (Fig. 2F). Following L. response in vivo, we used a B16F10 melanoma-based pulmonary monocytogenes challenge, NK cells from WT mice expressed pseudometastasis model (47), where the host mice depend on NK 5,302 transcripts, of which 1,217 were expressed by Mirc11 / cell–mediated IFNg production for tumor clearance (48). Mice mice. After normalizing quantities of NK cell transcripts from were challenged intravenously, the lungs were harvested when Mirc11 / to WT quantities, we plotted all genes using Volcano indicated, and the number of nodules counted. Gross analyses plots to determine overall change in the transcriptomic profile and hematoxylin and eosin staining (Fig. 2I) and quantitation (Fig. 2G). Analyses of a select panel of transcripts encoding (Fig. 2J) indicated significantly more pseudometastases in the proinflammatory factors using heat maps of normalized lungs of Mirc11 / mice compared with WT mice. Expression of expression values (Log2) revealed the inability of NK cells from Mirc11 increased following tumor challenge compared with that Mirc11 / mice to transcribe many of these genes (Fig. 2H). of nonchallenged mice (Fig. 2K). This suggests that an increase in Transcripts that encode many proinflammatory cytokines (Ifng, Mirc11 expression correlates with an augmented ability of NK Lif, Tnfa, csf2), chemokines (Ccl22, Ccl19, Ccl17, Ccl8, Ccl12, cells to mediate clearance of B16F10 tumors.

www.aacrjournals.org Cancer Immunol Res; 7(10) October 2019 1651

Nanbakhsh et al.

A None D 100 F Listeria-challenged H −/− Listeria ns −/− WT Mirc11

* sllecKN% WT vs. Mirc11 10 75 None None 50 Listeria Listeria 5 5302 ** 25 Ifng ** Lif 0 1217 Tnfa Fold expression Fold 0 Areg

)1.54DC( TW 740 −/− Csf2 23a 27a Tnfrsf13b 24-2 Tnni3 miRNA Nonchallenged Mirc11 (CD45.2) WT vs. Mirc11−/− Ccl22 B G Ccl19 106 * Ccl17 Ccl8 5 Ccl12 10 E Ccl7 Ccl5 104 15 Ccl3

sllecKN *** 150 Gzmc 103 10 Gzmb Gzmb 2 Prf1 of listeria/liver 10 Gzmm γ

NFI% Gzmf 101 5 100 Gzma C 8 Gzmc Il10 )%(sll ** 0 adjusted P Ccl5 Il17a 10

TW Lif

−/− Tnfa Il27 6 .54DC Il6 Ifng

ec 50

−Log Il12a Prf1 Il15 Mirc11 (CD45.2)

( KN+ 4 Il22 Csf2 Il22b Il18

γ Gzmf 2 WT Il23a −/− Areg Il7 IFN Mirc11 0 Il18 Ccl3 Il2 0 Il4 −/− −4−3−2−1 0 1 2 3 4 5 6 7

WT Log2 fold change Mirc11 -1 2.0

I J K None B16-F10 400 *** 400 *** 10 8 ** WT 300 300 6 ** 200 200 4 −/− 100 100 ** Fold expression Fold 2 Number of nodules Mirc11 0 0 0 −/− −/− WT WT 23a 24-2 27a Mirc11 Mirc11 miRNA

Figure 2. Mirc11 is obligatory for NK cell–produced IFNg-dependent in vivo clearance of L. monocytogenes and B16F10. A, Relative expression of members of Mirc11 in NK cells from WT mice (n ¼ 3) following L. monocytogenes infection. B, Quantification of bacterial burden in the liver (n ¼ 9, 9). Bacterial burden from individual mice is shown. C, Percentage of WT (n ¼ 9) and Mirc11 / (n ¼ 9) splenic NK cells producing IFNg after infection with L. þ monocytogenes. D and E, NK cells isolated from spleens of mixed BM chimeras 1 (n ¼ 5). Total NK cell number (D) and percentage of IFNg NK cells (E). F, Venn diagram depicting the number of differentially expressed genes (FDR < 0.05) in fresh NK cells (n ¼ 3, 3, 3, 3) after L. monocytogenes infection. G, Volcano plot depicting alterations in the transcriptomic profiles of NK cells. Genes with –Log10 (P values) greater than 80 at the Y-axis are plotted. H, RNA-seq heat map analyses of freshly isolated NK cells from mice infected with L. monocytogenes (n ¼ 3, 3). I, Pulmonary pseudometastases in lungs of mice after intravenous injection of B16F10 cells (n ¼ 4, 4). Left, freshly isolated, representative lungs. Middle, hematoxylin and eosin–stained lung sections. Right, magnified regions (100 ). J, Quantification of lung nodules. WT (n ¼ 6) and Mirc11/ (n ¼ 8) mice were injected intravenously with either 2 105 (left) or 106 (right) B16F10 cells, and lungs were harvested at 14 or 7 days, respectively. Double-blinded counting was used. K, Relative expression of members of Mirc11 in NK cells isolated from lungs of B16F10-challenged WT mice (n ¼ 3). The data presented are a compilation of three independent experiments showing the mean with standard error. Data were analyzed using an unpaired t test (, P < 0.05; , < 0.01; , < 0.001). Mann–Whitney U test was used for statistical analyses of BM chimerism.

1652 Cancer Immunol Res; 7(10) October 2019 Cancer Immunology Research

Role of Mirc11 in NK Cell–Mediated Anticancer Responses

Identification of Mirc11 targets in NK cells Mirc11 / NK cells (Supplementary Fig. S4A and S4B). Likewise, We next identified the mRNA targets of Mirc11 by using RNA- gene network analysis using the IPA software tool revealed that seq data to determine the differentially targeted transcripts using the NF-kB(P < 10 42) and AP-1 (P < 10 13) pathways were Fisher exact test to compare splenic NK cells that were derived enriched among the differentially expressed gene sets in NK cells from the nonchallenged and L. monocytogenes–challenged WT and derived from the L. monocytogenes–challenged mice (Fig. 4). A Mirc11 / mice. Potential targets of miR-23a, miR-27a, and miR- total of 280 differentially expressed genes were identified with 64 24-2 were identified based on the presence of the unique "seed" upregulated and 216 downregulated that are transcriptionally sequences present in the 30 untranslated region (UTR) of the regulated by NF-kB. A total of 320 differentially expressed genes transcripts (Fig. 3A). We identified a set of targets based on "the were identified, with 132 upregulated and 188 downregulated aggregate probability of conserved targeting" (PCT; ref. 49). In that are the target genes of AP-1. Hierarchical clustering revealed silico predictions that matched the 30 UTR of the transcripts and distinct gene groups either upregulated or downregulated as their orthologs based on the UCSC whole-genome alignments presented in heat maps (Fig. 4A and B). Functional classification identified a total of 6,606 genes that could be targeted by Mirc11 and Fisher exact test further identified enriched transcripts that (Fig. 3A). Among these, 5,972 were present in the RNA-seq data encode proinflammatory cytokines, chemokines, and other tran- obtained from splenic NK cells following L. monocytogenes infec- scription factors. Thus, the reduced response of Mirc11 / NK tion (Fig. 3B). Only a fraction of the genes (617) were differen- cells is most likely due to disruption of the activation of NF-kB tially expressed between WT and the Mirc11 / mice under and AP-1. nonchallenged condition (Fig. 3C). However, following Listeria To validate these in silico findings, we determined the functional challenge, 2,073 of these transcripts were differentially expressed status of both NF-kB and AP-1 in NK cells from Mirc11 / mice. between the NK cells derived from WT and the Mirc11 / mice NK cells from the WT and Mirc11 / mice were stimulated with (Fig. 3D). Lack of miR-24-2 was associated with the most differ- plate-bound anti-NKG2D, prepared nuclear lysates, and quanti- entially expressed genes (1,169), followed by miR-23a (1,145) fied the binding of NF-kB and AP-1 to chromosomal DNA using and miR-27a (394). Many of these genes can be targeted by one or electrophoretic mobility shift assay (EMSA). We found that both more of the three miRNAs. NF-kB and AP-1 pathways are activated in WT NK cells but are Analyses of the identities of the targets revealed clusters of genes reduced in Mirc11 / NK cells (Fig. 5A). that control apoptosis and cell survival, metabolic regulators, Next, we compared the gene-expression profiles from both the transcriptional activators of cytokines and chemokines, and sig- RNA-seq libraries made from NK cells activated with anti-NKG2D naling proteins (Fig. 3E–G). The first group was transcripts encod- and NK cells from L. monocytogenes–infected mice to identify shared ing transcriptional activators (Stat1, Ctnnb1p1, Zfp799, Zfp113, and common targets. NK cells from L. monocytogenes–challenged Zfp397, Zfp329, IRF4, Pparg) or repressors (ATF3, Runx2, Hic2) mice (WT vs. Mirc11 / mice) contained the 6,073 genes that were that may control production of inflammatory cytokines and differentially expressed compared with 628 genes that were differ- chemokines. Alterations in the amount of ATF3, IRF4, and Runx2 entially expressed in NK cells that were stimulated in vitro with anti- transcripts may suggest mechanisms. We found the amounts of NKG2D (WT vs. Mirc11 / mice). There were 446 genes that were ATF3 transcripts reduced in NK cells from Mirc11 / mice com- shared between the two RNA-seq libraries, of which many were pared with those from WT. ATF3 interacts with the cis-regulatory known to be transcriptionally regulated by NF-kB, AP-1, or both element and represses transcription of the Ifng gene (50). There- (Fig. 5B). These shared groups of genes included proinflammatory fore, a reduction in ATF3 does not provide an explanation of the cytokines and chemokines. Expression of most of the target genes in reduction in IFNg or other inflammatory cytokine production that NK cells from Mirc11 / mice was significantly reduced, indicating we observe in Mirc11 / mice. After L. monocytogenes infection, we that Mirc11 functions as a central repressor of one or more negative observed an increase in IRF4-encoding transcripts in the NK cells regulators of NF-kB and AP-1 activation pathways (Fig. 5C). Also, from WT but not Mirc11 / mice. Mirc11 has a broader transcrip- we evaluated the gene set enrichment for NF-kB and TNFa response tional influence, since genes that were not encoding cytokines and pathways. Analysis of NK cells stimulated either in vitro with anti- chemokines were also altered. NKG2D or derived from L. monocytogenes–infected mice revealed that these pathways were significantly impaired in NK cells lacking Mirc11 is a positive regulator of NF-kB– and AP-1–mediated Mirc11 (FDR-adjusted P < 0.05) that was stimulated either in vitro gene transcription with anti-NKG2D or derived from L. monocytogenes–infected mice Transcriptional induction of proinflammatory factors is pri- (Fig. 5D). Overall, transcriptome-wide RNA-seq analyses revealed marily mediated by NF-kB (p50/Rel-A) and AP-1 (c-Fos/c-Jun; that the primary target genes of the Mirc11 involved transcriptional ref. 51). Analyses of the activation status of Jnk1/2 that is regulation by NF-kB and AP-1. NK cells from WT mice infected with upstream of NF-kB and AP-1 revealed a reduction in their phos- L. monocytogenes exhibited a proinflammatory gene set similar to phorylation following anti-NKG2D–mediated activation (Sup- that of human chronic inflammatory bowel disease; however, NK plementary Fig. S3B). Similar reductions were seen in the phos- cells from Mirc11 / mice lacked this profile (Supplementary phorylation of Erk1/2 but not of p38. To define the effect of Fig. S5). Mirc11 on NF-kB and AP-1 activation, we performed in silico regulatory network genome-wide analyses using Detecting Mech- A20, Cbl-b, and Itch are direct targets of Mirc11 in mice and anism of Action by Network Dysregulation (DeMAND; ref. 52) humans and a precompiled Bayesian network based on the gene- We tested whether the deubiquitinating enzymes and E3 expression profiles of 254 B-cell lymphoma cell preparations on ligases with membrane proximal functions were principal U95av2 arrays. Following stimulation with anti-NKG2D, the targets of Mirc11. We analyzed two deubiquitinating enzymes DeMAND analysis revealed that the Rel-A (p65, P < 10 7) and (A20 and Cyld) and two E3 ligases (Cbl-b and Itch) with Jun (P < 10 8) networks were altered between the WT and established roles in NF-kB and AP-1 signaling (53) in

www.aacrjournals.org Cancer Immunol Res; 7(10) October 2019 1653

Nanbakhsh et al.

A EGWT Mirc11−/− WT Mirc11−/− − L.m.− L.m. −L.m. − L.m. Cnst Nrp2 Unc5b Mbd4 Zcchc24 Trappc4 Total target input Stat6 Ppm1k Smad5 miRNA-23a miRNA-27a Als2 Pde10a Trip10 Hspa12a Ggta1 Lrch1 Kcnk6 2,236 308 412 Il17ra Fam160b2 Tnfsf10 183 Ska3 987 193 Map7d1 Celf1 Atf3 Jak1 Ctnnbip1 2,287 Lmnb1 Birc5 H2afx targets targets Itpk1 miRNA-24-2 Stat1 Pmaip1 Plch1 Ms4a4c Esyt2 B Fas Kdm4c Tgfb2 Total targets present Fam126b miRNA-23a miRNA-23a miRNA-27a Zfp488 Mdk Tnfaip3 Rpl12 Apaf1 Nme7 2,008 290 377 Bax Sema4g Mtss1 Lrrc39 171 Rbm44 Nr2c2 902 179 Ptpre Zfp799 Runx2 Zfp113 Bbc3 Rnf170 2,045 Fbxl17 2610008E11Rik Tmem241 Gpalpp1 miRNA-24-2 targets Zfp397 F Lmbr1 Csnk1e Clcn3 C Tcirg1 Ogt Smad3 1700025G04Rik Nonchallenged Bmp2 Rictor Foxo1 Tnks miRNA-23a miRNA-27a Slco5a1 miRNA-24-2 Slc30a10 Serpini1 Adcyap1r1 Nsd1 Zfp329 Cbfa2t2 190 31 32 Smad5 Rps6kl1 Epha4 Hic2 13 Ccl9 108 24 Ldb2 Irf4 Saysd1 Bmpr1a Bbc3 219 Ret Chl1 targets targets Pmaip1 Slc35d2 Trem1 miRNA-24-2 Pparg Plec Il10 Hdgfrp3 Cxcr2 Macf1 D Lsm6 Coa3 miRNA-27a Srm Cbx1 Odc1 Listeria-challenged Polr1e Lifr Naa40 Runx2 miRNA-23a miRNA-27a Gna14 Bbc3 Hmox1 Wars2 Pml 640 110 140 Bax H2-T24 Cblb Klf6 66 Fxw7 Ncl 329 78 Tlr4 Mcm2 Lrpprc Tpst1 Spp1 696 Mrpl35 Reep1 Rprd1a Nrgn miRNA-24-2 Ttyh1 Gatsl2 Runx1 Nrp2 Ranbp17 Nsrp1

Figure 3. Qualitative alterations in potential target transcripts of Mirc11. A, Venn diagram depicting the number of total target input modulated by miR-23a, miR-27a, and miR-24-2 and the overlapping targets. B, Venn diagram depicting the number of total target genes expressed in NK cells and modulated by miR-23a, miR-27a, and miR-24-2 and the overlapping targets. C and D, Venn diagram depicting the number of total target genes in NK cells freshly isolated or following L. monocytogenes infection. E–G, Hierarchical clustering of all potential target genes of Mirc11 in NK cells from L. monocytogenes–challenged mice. TargetScan 7.1–based in silico analyses was used to identify mRNAs present in the total genome-wide RNA-seq analyses of NK cells from mice that were unchallenged or challenged with L. monocytogenes.

1654 Cancer Immunol Res; 7(10) October 2019 Cancer Immunology Research

Role of Mirc11 in NK Cell–Mediated Anticancer Responses

A NF-κB targets B AP-1 targets WT Mirc11−/− WT Mirc11−/− − L.m.− L.m. −L.m. − L.m. Rras Eya1 Senp1 Bcl2 Cd83 Ube2h Map3k8 Bbc3 Nfkbie Stx17 Il15ra Vegfc Icam1 Habp4 Fth1 Eomes Cxcr4 Pogk Fabp5 Pld1 Aldh1b1 Hif3a Ccr2 Nfkb1 Tbc1d8 Trp53 Ccr7 Itgb1 Nfkb2 Cxcl16 Jun Tnfaip2 B4galt1 Tnip1 Bcl3 Socs3 C3 Terf2ip Tnfsf9 Map3k14 Scly Nfkbia Brd2 Casp7 Fas Tlr2 Rftn1 Il12b Socs1 Cx3cl1 Il1b Lta Sod3 Cebpb Col18a1 Vim Mmp9 Col1a2 Lif Birc2 Gnl1 Tnfaip8 Il15 Myc Ifng Zc3h10 Figure 4. Cd40 Dmbt1 Casp8 Rel Cyld Mirc11 targets NF- B– and AP-1– k Tfec Tmod2 Nfkbiz Casp4 Nudt1 mediated gene transcriptions. C1ra Cxcl12 Birc5 Traf2 Mmp3 Hierarchical clustering of NF-kB(A) −2−10 Ncf2 Ptx3 Hivep1 Nos2 or AP-1 (B) target genes that are Plk1 Csf3 Traf1 Prok2 differentially expressed between Ccl22 Plk3 NK cells derived from WT and Bcl3 Saa3 Ier3 Abcb1a Mmp13 Mirc11/ mice using an unpaired Tlr2 Timp1 Hdgf Relb Cxcl2 Timp1 t test following L. monocytogenes Irf1 Il10 Tgfb1 Gadd45b Plk2 infection. Gene sets were identiﬁed Cd86 Gdf15 Itpr1 Nup62 Lrrc49 using IPA informatics software Fcgr1 Cd274 Ahr Sod2 Tnni3 1 through classiﬁcation into gene Ptgs2 Cd80 Mmp7 ontology (GO) categories with an Il1bSerpina3n Crkl

2 Atp2a2 Mmp9 FDR of 0.01% based on biological Wfdc17 Ptges Plk3 F3 Tnfaip1 process and molecular function Lcn2 Serpine1 Ier3 categories with a minimum of 2-fold Nampt Hdgf Il12b Fpr2 Ccl2 Mapk13 change restriction. RNA-seq data Gla Tgfb1 Rsad2 Il17a Il6 from WT (n ¼ 3, 3) and Mirc11 / Tnf Il6 Ccl12 Itpr1 Tubb3 (n ¼ 3, 3) are compared and shown. Batf Daxx Ccl7 Ahr Plk2 Irf7 Mmp3 Egr1 Clec4e Psmb9 Cxcl1 Ccnd2 Rtn4rl1 Plau Cx3cl1 Hmox1 Mmp13 Fam71e1 Odc1 Col18a1 Isg15 Cxcl2 Slc24a2 Atf3 Birc2 Tgm2 Nos2 Rabgap1l E2f7 Ifng Tnfrsf4 Il1rn Fam214a Pask Rel Birc3 Il1a Kif5a Ccnb2 Casp4 Il2 Tap2 Ido1 Ccnb1 Traf2 Znrd1as Tap1 Gbp2 Cebpb Hivep1 Rassf1 Hspb1 Il22 Lif Traf1 Jrk Il27 Rnf19b Myc Abcb1a Pusl1 Ncoa7 Ccl17 Casp8 Relb Vegfc AppMadcam1 Nfkbiz Gadd45b Plec Cxcl10 Lgals7 Birc5 Nup62 Soat2 Cxcl9 Has2 Plk1 Sod2 Plekhh3 Cfb Cxcl5 Cckar Socs1

ex vivo–purified splenic NK cells 48 hours after L. monocytogenes proteins, but expression of all four was higher in NK cells from infection. NK cells from noninfected WT mice contained all Mirc11 / mice (Fig. 6B). four proteins (Fig. 6A). Upon L. monocytogenes infection, splenic To identify the mechanistic link between Mirc11 and these E3 NK cells from WT mice reduced expression of Cbl-b, Cyld, and ligases, we analyzed the 30 UTR sequences of A20, Cbl-b, Cyld, and Itch, whereas expression of A20 remained undetectable. NK Itch. Using TargetScan, we found that the 30 UTR of all four E3 cells from Mirc11 / mice had more A20, Cbl-b, Cyld, and Itch ligases contained predicted binding sites for one or more mem- regardless of the infection status. We validated these results in bers of Mirc11 (Fig. 6C). To identify which miRNA targeted IL2-cultured splenic NK cells activated with plate-bound anti- Tnfaip3 (A20), we cloned their putative interacting sequences NKG2D. NK cells from WT and deficient mice expressed all four from 30 UTR regions downstream of the firefly luciferase reporter

www.aacrjournals.org Cancer Immunol Res; 7(10) October 2019 1655

Nanbakhsh et al.

A −/− −/− C

Anti- WT Mirc11 WT Mirc11 3 NKG2D −−+−+ + − + −−+−+ + − + NF-κB target genes mAb AP-1 target genes AP1 2 Tmem200a ) FC 2 2 NF-κB Itgam Sidt1 Itgam 1 Pde7a Pecam1 Dusp3 Ccnd2 Plk3 Nfe2l1 Gadd45a Jun Slc7a5 Atf4 Mapk6 Ly9 0 Hmox1 Cerk Irf4 Stk40 Prf1 Myc Anxa Hbegf Birc3 Tnfa Prdx5

vs. WT, listeria challenged (log −1 Ell2 Csf2 Odc1 −/− Ifng Nfkbia Ler3 Bhlhe40 Trib3 Hook2 Micr11 Spp1 Clec4e −2 Gzmf Tubb6 Atf3 Epas1 Rgs16 Tnfrsf8 Bcl2a1d Cd83 Cdkn1a Cd69 Ztbt32 Il2ra −3 −1 01 −/− Micr11 vs. WT, Anti-NKG2D mAb (log2) FC B Listeria- D challenged NK cells, Anti-NKG2D mAb stim. NK Listeria-challenged NK −/− 2 10 WT vs. Mirc11 5 0 −2 0 RLM −4 −5 −6 −10 0.0 0.0 −0.1 6,073 −0.2

−0.3 NF- κ B pathway ES −0.4 −0.5 −0.6 446 0 5,000 10,000 15,000 0 5,000 10,000 15,000

628 2.5 0.0 10 Anti-NKG2D- −2.5 0 stimulated −5.0 −10 NK cells −20 0.0 0.0 WT vs. Mirc11−/− −0.1 −0.2 −0.2 −0.3 TNF α pathway

ES RLM −0.4 −0.4 −0.6 0 5,000 10,000 15,000 0 5,000 10,000 15,000

Figure 5. Mirc11 targets NF-kB– and AP-1–mediated gene transcriptions. A, Nuclear translocation of NF-kB and AP-1 in NK cells following activation with anti-NKG2D (n ¼ 3, 3). Data presented are a representative of three independent experiments. B, Venn diagram of the number of differentially expressed (FDR < 0.05) and shared transcripts from gene expression proﬁles of NK cells from in vivo L. monocytogenes–challenged mice (n ¼ 3, 3) and in vitro anti-NKG2D–activated (n ¼ 3, 3) cultures. C, Differentially expressed known target transcripts of NF-kB and AP-1 in the absence of Mirc11 that are shared between NK cells from in vivo L. monocytogenes–challenged mice (n ¼ 3, 3) and in NK cells that were activated in vitro with anti-NKG2D (n ¼ 3, 3). D, GSEA was used to show and compare the set of gene targets that are regulated downstream of NF-kB and TNFa in NK cells that were anti-NKG2D activated (n ¼ 3, 3) or NK cells derived from L. monocytogenes–challenged WT (n ¼ 3) and Mirc11/ (n ¼ 3) mice. The data presented are a compilation of three independent experiments.

1656 Cancer Immunol Res; 7(10) October 2019 Cancer Immunology Research

Role of Mirc11 in NK Cell–Mediated Anticancer Responses

A WT Mirc11−/− B C Tnfaip3 Cyld (2) Anti -NKG2D mAb 5′ ATTTTCATTGTTAATGTGAA 3′ 5′TGCATCTTCCTGCACTGAGTTG 3′ −/− ||||||| ||| |||||| WT Mirc11 3′ CUUUAGGGACCGUUACACUA 5′ 3′GACAAGGACGACUUGACUCGGU 5′

kDa None Listeria None Listeria kDa 0′ 5′ 20′ 0′ 5′ 20′ Cblb (1) Cyld (3) 82 A20 82 A20 5′CTTGAACTTTGAATCTGTGAA 3′ 5′GTGCTCTTAACTGCTGAGCTA3′ ||||||| |||||| | 125 Cbl-b 125 Cbl-b 3′CGCCUUGAAUCGGUGACACUU 5′ 3′ACAAGGACGACUUGACUCGGU5′ Cblb (2) Itch (1) 108 Cyld 108 Cyld 5’CAGAGCTCTTCATAATGTGAA 3’ 5′TGTAAACTTGGACTGTGAC3′ ||||||| ||||||| 105 Itch 105 Itch 3′CUUUAGGGACCGUUACACUA 5′ 3’CCUUGAAUCGGUGACACUU 5’ Actin Cyld (1) Itch (2) 45 Actin 42 5’TGGTTTCTGAAATGACTGAGCGA 3’ 5′GACCTAGAAATATTATGTGAA3′ ||||||| |||||| 3’ GACAAGGACGACUUGACUCGGU 5′ 3′CUUUAGGGACCGUUACACUA5′ D Tnafaip3 Cblb (1) Cblb (2) Cyld (1) E 80 1.4 (miR23a-3p) (miR-27a-3p ) (miR-23a-3p) (miR-24-2-3p)

60 Pri-

* *

* miR23a

y 0.7 40

i v

i Pri-

t 20 c

a 0 miR24-2

human NK cells e +

s Cyld (2) Cyld (3) Itch (1) Itch (2) 0 a

r 80 Pri- e

f (miR-24-2-3p) (miR-24-2-3p) (miR-27a-3p ) (miR-23a-3p )

i 1.4

CD56 c

− miR27a

u 60

L *

0.7 * Pri- * CD3 ε 40 +

γ miR23 0 20 cluster

% IFN 0 CM miR-24-2 CM miR-24-2 ec ec V miR-23a miR-27a miR-23a miR-27a V - miR - miR E- E- P Control vector Experimental vector P

Figure 6. Mirc11 targets members of E3 ligases in NK cells from mice and humans. A, Expression of E3 ligases A20, Cbl-b, Itch, and Cyld in freshly isolated NK cells from WT (n ¼ 2) and Mirc11/ (n ¼ 2) mice following L. monocytogenes infection. B, Expression of A20, Cbl-b, Itch, and Cyld E3 ligases in IL15-cultured NK cells following anti-NKG2D activation (n ¼ 3, 3). C, Predicted interactions between the 30 UTR of transcripts encoding A20, Cbl-b, Itch, and Cyld containing target sequences and members of Mirc11. D, Dual luciferase assay measuring activity of miR-23a, miR-24-2, miR-27a, or control mimetics (CM) as a ratio of Renilla to ﬁreﬂy luciferase on the 30 UTR of select target genes in HEK293T cells 2 days after transfection. Data are normalized to control 30 UTR plus no miRNA condition. Transfection was done in triplicates, and the average with standard deviation is shown. E, Forced expression of the members of the Mirc11 cluster in human NK cells enhances IFNg production. IFNg production by primary human NK cells transduced with pre-miR lentiviral vectors for human miR-23a, miR-24-2, or miR-27a þ þ or CM. Forty-eight hours following transduction, NK cells were cocultured with K562 cells, and the percentage of intracellular IFNg CD3e CD56 NK cells was enumerated. NK cells from a total of 4 normal healthy individuals were used. The data presented are a compilation of three independent experiments showing the mean with standard error obtained using an unpaired t test (, P < 0.01; , < 0.001).

gene in a pMIR-Report vector. We identiﬁed and cloned one, two, these could block the translation of luciferase. miR-24-1, the three, and two 30 UTR regions of Tnfaip3, Cblb, Cyld, and Itch, paralog of miR-24-2, contains an identical sequence (54). The respectively (Fig. 6C). These sequences or control mimetics were 30 UTR of Itch contained two seed matches between 2,882–2,900 cotransduced with vectors expressing miRNA23a, miRNA24-2, and 4,649–4,669 nts that were targeted by miR-27a-3p and miR- and miRNA27a into HEK293T cells. After 48 hours, cells were 23a-3p, respectively. Incorporation of the target sequences in the lysed, and the luciferase activity was measured. 30UTR of luciferase indicated that the miR-27a-3p could reduce The 30 UTR of Cblb contained two seed matches between 3,216– the translation of luciferase but not the miR-23a-3p. Thus, miR- 3,236 and 5,879–5,901 nts targeted by miR-27a-3p and miR-23a- NA23a signiﬁcantly reduced the luciferase activity of vector that 3p, respectively. Although the proximal sequence for miR-27a-3p contained the 30 UTR of Tnfaip3. Similarly, miRNA27a reduced contained 13 noncontiguous nucleotides (out of 21) that were luciferase activity of vectors containing 30 UTR sequences of either complementary, it was unable to block the translation of lucif- Cblb or Itch (Fig. 6D). With three different 30 UTR sequences of erase. However, the distal sequence that was targeted by miR-23a- Cyld, we did not observe any reduction of luciferase activity, 3p with a 7mer seed match was functional as indicated by the indicating that Mirc11 members may not target Cyld (Fig. 6D). reduction in luciferase activity. The 30 UTR of Cyld contained three Thus, Mirc11 controls the activity of A20, Cbl-b, and Itch in NK sequences between 3,842–3,864, 4,031–4,051, and 5,979–6,000 cells by binding to the 30 UTR of their respective transcripts and nts, all of which were targeted by miR-24-2-3p. However, none of regulating their translation.

www.aacrjournals.org Cancer Immunol Res; 7(10) October 2019 1657

Nanbakhsh et al.

We investigated whether this regulatory mechanism was active Incubation of NK cells from WT but not Mirc11 / mice with þ in human NK cells. We purified CD3e CD56 NK cells from K63R significantly reduced the production of IFNg, TNFa, GM- human peripheral blood mononuclear cells (PBMC) and trans- CSF, CCL4, and CCL5 (Fig. 7E). Addition of K48R to NK cells from duced them with lentiviral pLenti-TetCMV vectors encoding indi- neither WT nor Mirc11 / mice augmented the production of vidual pre-miRs or all three pre-miRs that encode the members of these cytokines. Thus, Mirc11 temporally targets and silences the Mirc11. NK cells were activated with plate-bound anti-NKG2D these E3 ligases during the active phase of receptor-mediated (1D11, 5 mg/mL) for 24 hours, and the percentage of IFNg- stimulation, which enabled optimal NK cell–mediated produc- positive cells was quantified by flow cytometry. Transduction of tion of proinflammatory factors. þ pre-miR23a or pre-miR-27a increased the percentage of IFNg NK cells compared with that of empty vector (Fig. 6E). Out of 4 individual PBMCs transduced with pre-miR24-2, only one Discussion þ showed an augmentation of percentage of IFNg NK cells. These Production of inflammatory cytokines is a component of an results indicate that Mirc11 suppresses the translation of specific immune response. However, an acute or a chronic inflammation deubiquitinating enzymes or E3 ligases to allow maximum is destructive; therefore, regulation of genes that encode inflam- threshold of activation. matory factors is essential. In this study, we define Mirc11 as a positive regulator of inflammatory cytokine production. We Mirc11 augments K63 polyubiquitination of TRAF6 demonstrate that one function of Mirc11 is to target and silence To establish the roles of A20, Cbl-b, Cyld, and Itch as suppres- translation of A20, Cbl-b, Cyld, and Itch. Lack of Mirc11 led to sors of NK cell activation, we used their respective gene knockout increased translation of A20, Cbl-b, Cyld, and Itch, which resulted mice. The total number of splenic NK cells or the expression of in increased deubiquitylation of K63 and augmented K48 ubi- KLRG1 between the knockout mice to their respective WT controls quitylation of TRAF6. Degradation of TRAF6 dampened the was comparable (Supplementary Fig. S6A and S6B). Splenic NK activation and nuclear translocation of NF-kB and AP-1 com- fl fl cells from Tnfaip3 / RosaCre-ER mice were cultured with IL15 for plexes and therefore the transcription of proinflammatory genes. 7 days, and on day 4, tamoxifen was added to the culture to induce These findings provide insights into an immune regulatory func- the deletion of A20-encoding alleles. Splenic NK cells from mice tion of miRNAs. lacking Cblb, Cyld, and Itch were also prepared by culturing with Lack of Mirc11 only moderately impaired the cytotoxic poten- IL15. Although NK cells from three of the knockout models tials of na€ve or IL15-cultured NK cells against EL4H60, RMA/S, mediated comparable cytotoxicity against EL4H60, RMA/S, and B16F10, and YAC1 targets. Culturing NK cells from Mirc11 / YAC1 compared with WT controls (Supplementary Fig. S6C), NK mice with IL2 rescued the impairment in their cytotoxicity. cells without Cbl-b exhibited increased killing. Next, we stimu- Analyses of the in vivo clearance of donor-derived splenocytes lated the IL15-cultured NK cells with plate-bound anti-NKG2D for that expressed either reduced MHC class I or a mismatched 18 hours, and the supernatants were analyzed for IFNg, GM-CSF, MHC class I revealed that the lack of Mirc11 impaired only the CCL3, CCL4, and CCL5 (Supplementary Fig. S7). The absence of clearance of splenocytes representing "missing-self" and not Tnfaip3, Cblb, Cyld,orItch significantly increased the generation of "nonself." Earlier studies have shown that one of the members these cytokines and chemokines, thus corroborating data from the of Mirc11, miR-27a, targets transcripts encoding perforin and Mirc11 / mice, suggesting that this regulatory mechanism pri- granzyme B, and the absence of miR-27a augmented the cyto- marily affects the production of proinflammatory factors. toxic potential of human NK cells (58). Our transcriptomic profiling of NK cells from either in vitro anti-NKG2D– A lack of Mirc11 reduces K63 and increases K48 stimulated or from L. monocytogenes–challenged mice revealed polyubiquitination of TRAF6 reductions in the expression of perforin, and granzymes B, A, C, K63-polyubiquitination of TRAF6 recruits TAB2 and TAB3, and F in NK cells from Mirc11 / mice.However,weobserved which activate TAK1 (55) to ultimately activate NF-kB (56). We neither reduction nor augmentation of NK cell–mediated examined TRAF6 ubiquitination in NK cells following anti- cytotoxicity in coculture experiments using the EL4H60 in which NKG2D mAb–mediated activation by immunoprecipitation NK cells are activated through NKG2D. from NK cell lysates and probed for K63 and K48 ubiquitination. The moderate reduction in cytotoxicity and impairment in We observed a ladder of high molecular mass of K63-polyubi- cytokine production can be due to distinct regulation by Mirc11. quitinated TRAF6 in WT (Fig. 7A, lanes 1 and 2) but not Mirc11 / First, irrespective of the reductions in the transcripts encoding NK cells (Fig. 7A, lanes 3 and 4). However, TRAF6 did not contain cytotoxic proteins, lack of Mirc11 did not affect the overall ability any K48 polyubiquitination in WT NK cells (Fig. 7B, lanes 1 and of NK cells to lyse tumor cells. We found a 4-fold augmented 2) but was abundant in Mirc11 / NK cells (Fig. 7B, lanes 3 and expression of another miR, Let-7a, in Mirc11-deficient NK cells. 4). K63 ubiquitination of RIP1 was augmented in WT NK cells but Members of the Let-7 family negatively regulate effector functions not in Mirc11 / NK cells (Fig. 7C). We verified TRAF2 modifi- of CTLs (59), and forced expression of Let-7 targeted, degraded, cation after activation and did not observe any change in K63 and reduced the transcripts encoding effector molecules, includ- ubiquitination (Fig. 7D, lanes 1–4), suggesting TRAF6 is the ing granzyme B. We predict that a similar mechanism occurs with primary target of A20-, Cyld-, Cbl-b–, and Itch-mediated sup- Let-7 family members in Mirc11-deficient NK cells, although the pression of cytokine production. reduction in cytokine production occurs due to changes in gene To confirm these findings, we incubated IL15-cultured NK cells transcription regulated by NF-kB and AP-1. NK cell–derived IFNg with mutant K63 or mutant K48 ubiquitin proteins that cannot augments both activating (ICAM1) and inhibitory (MHC class I) form polyubiquitin chains with other ubiquitin molecules (57). ligands on target cells (60). Also, one of the mechanisms that We coincubated NK cells with either K63R or K48R ubiquitins, NK cells utilize to recognize target cells via "missing-self" mech- activated with anti-NKG2D, and quantified the amount of IFNg. anism is to use LFA-1 to interact with ICAM1 on target cells (61).

1658 Cancer Immunol Res; 7(10) October 2019 Cancer Immunology Research

Role of Mirc11 in NK Cell–Mediated Anticancer Responses

A Anti -NKG2D mAb BDAnti -NKG2D mAb C Anti -NKG2D mAb Anti -NKG2D mAb −/− WT Mirc11−/− WT Mirc11−/− WT Mirc11 WT Mirc11−/− 0′ 15′ 0′ 15′ 0′ 15′ 0′ 15′ 0′ 15′ 0′ 15′ 0′ 15′ 0′ 15′

IP-TRAF6 IP-TRAF6 IP-RIP1 IP-TRAF2 IB-K63 IB-K48 IB-K63 IB-K63

TRAF6 TRAF6 RIP1 TRAF2

E IFNγ GM-CSF CCL3 CCL4 CCL5 6 150 ** 300 200 *** 150 ** *** ** 100 100 3 150 100 ** *** 50 ** 50 *** ng/mL ** 0 0 0 0 0

WT WT + rMutant K48 WT + rMutant K63 Mirc11−/− Mirc11−/− + rMutant K48 Mirc11−/− + rMutant K63

Figure 7. Lack of Mirc11 reduces K63 and increases K48 polyubiquitination of TRAF6. A, IL15-cultured NK cells (n ¼ 2, 2) were activated with anti-NKG2D, TRAF6 was immunoprecipitated, and the extent of K63 polyubiquitination was analyzed. B, Immunoprecipitated TRAF6 was analyzed for the extent of K48 polyubiquitination (n ¼ 2, 2). C, IL15-cultured NK cells were activated with anti-NKG2D for 15 minutes, RIP1 was immunoprecipitated, and the extent of K63 polyubiquitination was analyzed (n ¼ 2, 2). D, IL15-cultured NK cells were activated with anti-NKG2D for 15 minutes, TRAF2 was immunoprecipitated, and the extent of K63 polyubiquitination is shown (n ¼ 2, 2). E, IL15-cultured NK cells were activated with anti-NKG2D in the presence of either recombinant mutant K63 or mutant K48 ubiquitin proteins. Eighteen hours following activation, supernatants were analyzed for the production of indicated cytokines (n ¼ 3, 3). The data are a compilation of three independent experiments plotting the mean, with the error bars representing the standard error of the mean analyzing the results using an unpaired t test (, P < 0.01; , <0.001).

Thus, a reduction in the production of IFNg by the NK cells from members or the full of Mirc11 elevated the production of Mirc11 / mice could affect the lysis of splenocytes from b-2 IFNg (32). microglobulin knockout mice. Splenocytes from BALB/c mice It is possible that a lack of Mirc11-mediated regulation of express allo MHC class I and H60, Rae-1, and MULT1 that are the other immune cells, such as dendritic cells, could cause the ligands of the NKG2D receptor (62–64). This could explain why defect in NK cell–mediated cytokine production. Therefore, to recognition and in vivo clearance of BALB/c-derived splenocytes is differentiate the cell-intrinsic and -extrinsic effects of Mirc11, þ not impaired in Mirc11 / mice. we generated BM chimeras of WT (CD45.1 ;B6.SJL)and / þ / / The defects in IFNg production could not be rescued by Mirc11 (CD45.2 ; C57BL/6) mice in Rag2 gc mice. culturing na€ve Mirc11 / NK cells with either IL2 or IL15. To Evaluation of the NK cells ex vivo revealed the Mirc11-sufficient further validate these in vitro findings and to define the role of the host did not rescue the defect in the production of IFNg, Mirc11 in vivo, we used L. monocytogenes, whose clearance depends implying a cell-intrinsic role of Mirc11 in NK cells. The absence on IFNg produced by NK cells early during infection (65). The of Mirc11 reduced overall NK cell activation (5,302 vs. 740 absence of Mirc11 impaired the clearance of L. monocytogenes and differentially expressed transcripts with 1,217 shared tran- reduced the number of NK cells that produced IFNg. This indi- scripts) following L. monocytogenes challenge. Utilization of a cated that the impairment in cytokine production is due to pulmonary pseudometastasis model further confirmed the alteration in the posttranscriptional mechanism that is regulated relationship between Mirc11 and production of IFNg,which by the Mirc11. Activation of IL2-cultured NK cells from Mirc11 / is obligatory for the clearance of B16F10. mice with plate-bound anti-NKG2D demonstrated a defect in the NF-kB/Rel and AP-1 families of transcription factors play a role inflammatory responses. This positive correlation of Mirc11 and in the transcription of genes encoding inflammatory factors (66). the generation of inflammatory response is corroborated in T cells Transcriptomic signature of NK cells that lack Mirc11 predicted by showing that the enforced overexpression of the individual defects in the activation of NF-kB/Rel, AP-1, or both. A decrease in

www.aacrjournals.org Cancer Immunol Res; 7(10) October 2019 1659

Nanbakhsh et al.

the nuclear translocations of the NF-kB/Rel and AP-1 in NK cells define the role of the Mirc11 in inflammatory autoimmune lacking Mirc11 corroborates the reduction in transcription of diseases and malignancies. genes that are positively regulated by these transcription factors. Reduction in the transcripts encoding Myc, Irf4, Jun, Disclosure of Potential Conflicts of Interest Nfkbia, Cd69, Il2ra, Atf3, and Cd83 in NK cells from Mirc11 / D. Wang is an adjunct professor at Fujian Normal University. No potential mice demonstrates a failure of NF-kB/Rel-mediated transcription- conflicts of interest were disclosed by the other authors. al regulation. Similarly, a reduction in the transcript amounts of Atf4, Ccnd2, Dusp3, Nfe2l1, Stk40, and Ztbt32 that are targets of Authors' Contributions AP-1 confirmed a reduction in its transcriptional activity. These Conception and design: A. Nanbakhsh, D. Wang, S. Rao, S. Malarkannan Development of methodology: A. Nanbakhsh, Y. Zheng, M.H. Reimer findings demonstrate that the Mirc11 is an active repressor of Acquisition of data (provided animals, acquired and managed patients, signaling pathways that inhibit the activation and nuclear trans- provided facilities, etc.): A. Nanbakhsh, S. Holzhauer, M.J. Riese, Y. Zheng, location of NF-kB/Rel and AP-1. M.H. Reimer, A. Lemke, R. Dahl, M.S. Thakar Members of the Mirc11 miR-23a, miR-24-2,andmiR-27a have Analysis and interpretation of data (e.g., statistical analysis, biostatistics, the potential to silence the translation of hundreds of mRNAs computational analysis): A. Nanbakhsh, R. Burns, S.-W. Tsaih, M.J. Flister, by targeting unique "seed" sequences present in their 30 UTR. S. Malarkannan Writing, review, and/or revision of the manuscript: A. Nanbakhsh, D. Wang, The total genome-wide RNA-seq data along with additional R. Burns, M.H. Reimer, S. Rao, M.J. Flister, R. Dahl, M.S. Thakar, S. Malarkannan biochemical analyses indicate that the transcripts encoding Administrative, technical, or material support (i.e., reporting or organizing A20, Cyld, Cbl-b, and Itch are targets of the Mirc11.Thus,the data, constructing databases): S.-W. Tsaih, S. Lao ability of the Mirc11 to target the transcripts encoding A20, Study supervision: A. Nanbakhsh, D. Wang, S. Malarkannan Cyld, Cbl-b, and Itch provides a mechanistic explanation for Other (performed experiments): A. Srinivasamani the reduction in the production of proinflammatory factors. Earlier work indicating a high expression of miRNA-23a in Acknowledgments human primary macrophages and its ability to target A20 to The authors thank Lucia Sammarco and her Lulu's Lemonade Stand for inspiration, motivation, and support. This work was supported in part by NIH repress NF-kBactivationandtherebyareductioninIL6and R01 AI102893 (S. Malarkannan) and NCI R01 CA179363 (S. Malarkannan and TNFa corroborates our current findings in murine NK cells (67). M.S. Thakar), Alex's Lemonade Stand Foundation (S. Malarkannan), HRHM The posttranslational repression of both deubiquitinases and Program of MACC Fund/Children's Hospital of Wisconsin (S. Malarkannan), E3 ligases by Mirc11 is a mechanism to dampen the activation Nicholas Family Foundation (S. Malarkannan), Gardetto Family (S. Malarkan- of inflammatory responses. nan), MCW-Cancer Center-Large Seed Grant (S. Malarkannan and M.S. Thakar), Insummary,wehaveidentified a posttranslational regula- MACC Fund/Children's Hospital of Wisconsin (M.S. Thakar and S. Malarkan- fl nan), Ann's Hope Melanoma Foundation (S. Malarkannan and M.S. Thakar), tory mechanism of in ammatory responses by microRNAs. The and Advancing Healthier Wisconsin (S. Malarkannan and M.H. Reimer). clinical relevance of our findings is highlighted by the evolu- tionarily conserved expression of Mirc11 in human cells, The costs of publication of this article were defrayed in part by the payment of including NK cells. Indeed, we have also found that the trans- page charges. This article must therefore be hereby marked advertisement in duction of pri-miRNAs, an RNA hairpin with mature miRNA, accordance with 18 U.S.C. Section 1734 solely to indicate this fact. encoding either the individual or all three members of the Mirc11 was able to increase the production of IFNg in purified Received January 24, 2019; revised April 14, 2019; accepted August 12, 2019; þ CD3e CD56 human NK cells. Future work is warranted to published first September 12, 2019.

References 1. Yokoyama WM, Plougastel BF. Immune functions encoded by the natural 10. Tassi I, Cella M, Gilfillan S, Turnbull I, Diacovo TG, Penninger JM, et al. killer gene complex. Nat Rev Immunol 2003;3:304–16. p110gamma and p110delta phosphoinositide 3-kinase signaling path- 2. Eberl G, Di Santo JP, Vivier E. The brave new world of innate lymphoid ways synergize to control development and functions of murine NK cells. cells. Nat Immunol 2015;16:1–5. Immunity 2007;27:214–27. 3. Bryceson YT, Long EO. Line of attack: NK cell specificity and integration of 11. Awasthi A, Samarakoon A, Dai X, Wen R, Wang D, Malarkannan S. Deletion signals. Curr Opin Immunol 2008;20:344–52. of PI3K-p85alpha gene impairs lineage commitment, terminal matura- 4. Bauer S, Groh V, Wu J, Steinle A, Phillips JH, Lanier LL, et al. Activation of tion, cytokine generation and cytotoxicity of NK cells. Genes Immun 2008; NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. 9:522–35. Science 1999;285:727–9. 12. Giurisato E, Cella M, Takai T, Kurosaki T, Feng Y, Longmore GD, et al. 5. Lanier LL, Corliss B, Wu J, Phillips JH. Association of DAP12 with activating Phosphatidylinositol 3-kinase activation is required to form the NKG2D CD94/NKG2C NK cell receptors. Immunity 1998;8:693–701. immunological synapse. Mol Cell Biol 2007;27:8583–99. 6. Westgaard IH, Berg SF, Vaage JT, Wang LL, Yokoyama WM, Dissen E, et al. 13. Tassi I, Presti R, Kim S, Yokoyama WM, Gilfillan S, Colonna M. Phospho- Rat NKp46 activates natural killer cell cytotoxicity and is associated with lipase C-gamma 2 is a critical signaling mediator for murine NK cell FcepsilonRIgamma and CD3zeta. J Leukoc Biol 2004;76:1200–6. activating receptors. J Immunol 2005;175:749–54. 7. Billadeau DD, Upshaw JL, Schoon RA, Dick CJ, Leibson PJ. NKG2D-DAP10 14. Regunathan J, Chen Y, Kutlesa S, Dai X, Bai L, Wen R, et al. Differential and triggers human NK cell-mediated killing via a Syk-independent regulatory nonredundant roles of phospholipase Cgamma2 and phospholipase pathway. Nat Immunol 2003;4:557–64. Cgamma1 in the terminal maturation of NK cells. J Immunol 2006; 8. Dong Z, Davidson D, Perez-Quintero LA, Kurosaki T, Swat W, Veillette A. 177:5365–76. The adaptor SAP controls NK cell activation by regulating the enzymes Vav- 15. Rajasekaran K, Kumar P, Schuldt KM, Peterson EJ, Vanhaesebroeck B, Dixit 1 and SHIP-1 and by enhancing conjugates with target cells. Immunity V, et al. Signaling by Fyn-ADAP via the Carma1-Bcl-10-MAP3K7 signalo- 2012;36:974–85. some exclusively regulates inflammatory cytokine production in NK cells. 9. Guo H, Samarakoon A, Vanhaesebroeck B, Malarkannan S. The p110 delta Nat Immunol 2013;14:1127–36. of PI3K plays a critical role in NK cell terminal maturation and cytokine/ 16. Gerbec ZJ, Thakar MS, Malarkannan S. The Fyn-ADAP axis: cytotoxicity chemokine generation. J Exp Med 2008;205:2419–35. versus cytokine production in killer cells. Front Immunol 2015;6:472.

1660 Cancer Immunol Res; 7(10) October 2019 Cancer Immunology Research

Role of Mirc11 in NK Cell–Mediated Anticancer Responses

17. Gross O, Grupp C, Steinberg C, Zimmermann S, Strasser D, Hanness- 38. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. chlager N, et al. Multiple ITAM-coupled NK-cell receptors engage the Nat Methods 2012;9:357–9. Bcl10/Malt1 complex via Carma1 for NF-kappaB and MAPK activa- 39. Love MI, Huber W, Anders S. Moderated estimation of fold change tion to selectively control cytokine production. Blood 2008;112: and dispersion for RNA-seq data with DESeq2. Genome Biol 2014; 2421–8. 15:550. 18. Malarkannan S, Regunathan J, Chu H, Kutlesa S, Chen Y, Zeng H, et al. 40. Kondo M. Lymphoid and myeloid lineage commitment in multipotent Bcl10 plays a divergent role in NK cell-mediated cytotoxicity and cytokine hematopoietic progenitors. Immunol Rev 2010;238:37–46. generation. J Immunol 2007;179:3752–62. 41. Kurkewich JL, Hansen J, Klopfenstein N, Zhang H, Wood C, Boucher A, 19. Rajasekaran K, Chu H, Kumar P, Xiao Y, Tinguely M, Samarakoon A, et al. et al. The miR-23a27a24-2 microRNA cluster buffers transcription and Transforming growth factor-{beta}-activated kinase 1 regulates natural signaling pathways during hematopoiesis. PLoS Genet 2017;13: killer cell-mediated cytotoxicity and cytokine production. J Biol Chem e1006887. 2011;286:31213–24. 42. Kim S, Iizuka K, Kang HS, Dokun A, French AR, Greco S, et al. In vivo 20. Malynn BA, Ma A. Ubiquitin makes its mark on immune regulation. developmental stages in murine natural killer cell maturation. Immunity 2010;33:843–52. Nat Immunol 2002;3:523–8. 21. Kwon HJ, Choi GE, Ryu S, Kwon SJ, Kim SC, Booth C, et al. Stepwise 43. Robbins SH, Nguyen KB, Takahashi N, Mikayama T, Biron CA, Brossay L. phosphorylation of p65 promotes NF-kappaB activation and NK cell Cutting edge: inhibitory functions of the killer cell lectin-like receptor G1 responses during target cell recognition. Nat Commun 2016;7:11686. molecule during the activation of mouse NK cells. J Immunol 2002;168: 22. Nausch N, Florin L, Hartenstein B, Angel P, Schorpp-Kistner M, Cerwenka 2585–9. A. Cutting edge: the AP-1 subunit JunB determines NK cell-mediated target 44. Guan H, Nagarkatti PS, Nagarkatti M. Blockade of hyaluronan inhi- cell killing by regulation of the NKG2D-ligand RAE-1epsilon. J Immunol bits IL-2-induced vascular leak syndrome and maintains effectiveness 2006;176:7–11. of IL-2 treatment for metastatic melanoma. J Immunol 2007;179: 23. Rajasekaran K, Riese MJ, Rao S, Wang L, Thakar MS, Sentman CL, et al. 3715–23. Signaling in effector lymphocytes: insights toward safer immunotherapy. 45. Orange JS, Roy-Ghanta S, Mace EM, Maru S, Rak GD, Sanborn KB, et al. IL-2 Front Immunol 2016;7:176. induces a WAVE2-dependent pathway for actin reorganization that 24. HuntingtonND,XuY,NuttSL,TarlintonDM.ArequirementforCD45 enables WASp-independent human NK cell function. J Clin Invest distinguishes Ly49D-mediated cytokine and chemokine production 2011;121:1535–48. from killing in primary natural killer cells. J Exp Med 2005;201: 46. Takeda K, Tsutsui H, Yoshimoto T, Adachi O, Yoshida N, Kishimoto T, et al. 1421–33. Defective NK cell activity and Th1 response in IL-18-deficient mice. 25. Kim S, Poursine-Laurent J, Truscott SM, Lybarger L, Song YJ, Yang L, et al. Immunity 1998;8:383–90. Licensing of natural killer cells by host major histocompatibility complex 47. Fidler IJ, Gersten DM, Budmen MB. Characterization in vivo and in vitro of class I molecules. Nature 2005;436:709–13. tumor cells selected for resistance to syngeneic lymphocyte-mediated 26. Duwel M, Welteke V, Oeckinghaus A, Baens M, Kloo B, Ferch U, et al. A20 cytotoxicity. Cancer Res 1976;36(9 pt.1):3160–5. negatively regulates T cell receptor signaling to NF-kappaB by cleaving 48. Takeda K, Nakayama M, Sakaki M, Hayakawa Y, Imawari M, Ogasawara K, Malt1 ubiquitin chains. J Immunol 2009;182:7718–28. et al. IFN-gamma production by lung NK cells is critical for the natural 27. Shembade N, Harhaj NS, Parvatiyar K, Copeland NG, Jenkins NA, Matesic resistance to pulmonary metastasis of B16 melanoma in mice. J Leukoc LE, et al. The E3 ligase Itch negatively regulates inflammatory signaling Biol 2011;90:777–85. pathways by controlling the function of the ubiquitin-editing enzyme A20. 49. Friedman RC, Farh KK, Burge CB, Bartel DP. Most mammalian mRNAs are Nat Immunol 2008;9:254–62. conserved targets of microRNAs. Genome Res 2009;19:92–105. 28. Fang D, Liu YC. Proteolysis-independent regulation of PI3K by Cbl-b- 50. Rosenberger CM, Clark AE, Treuting PM, Johnson CD, Aderem A. mediated ubiquitination in T cells. Nat Immunol 2001;2:870–5. ATF3 regulates MCMV infection in mice by modulating IFN-gamma 29. Reiley WW, Jin W, Lee AJ, Wright A, Wu X, Tewalt EF, et al. Deubiqui- expression in natural killer cells. Proc Natl Acad Sci U S A 2008;105: tinating enzyme CYLD negatively regulates the ubiquitin-dependent 2544–9. kinase Tak1 and prevents abnormal T cell responses. J Exp Med 2007; 51. Hayden MS, Ghosh S. NF-kappaB, the first quarter-century: remarkable 204:1475–85. progress and outstanding questions. Genes Dev 2012;26:203–34. 30. Guven-Maiorov E, Keskin O, Gursoy A, Nussinov R. A structural view of 52. Woo JH, Shimoni Y, Yang WS, Subramaniam P, Iyer A, Nicoletti P, et al. negative regulation of the toll-like receptor-mediated inflammatory path- Elucidating compound mechanism of action by network perturbation way. Biophys J 2015;109:1214–26. analysis. Cell 2015;162:441–51. 31. Chhabra R, Dubey R, Saini N. Cooperative and individualistic functions of 53. Chen ZJ. Ubiquitination in signaling to and activation of IKK. the microRNAs in the miR-23a27a24-2 cluster and its implication in Immunol Rev 2012;246:95–106. human diseases. Mol Cancer 2010;9:232. 54. Bang C, Fiedler J, Thum T. Cardiovascular importance of the microRNA-23/ 32. Cho S, Wu CJ, Yasuda T, Cruz LO, Khan AA, Lin LL, et al. miR-23 27/24 family. Microcirculation 2012;19:208–14. approximately 27 approximately 24 clusters control effector T cell differ- 55. Ohtake F, Saeki Y, Ishido S, Kanno J, Tanaka K. The K48-K63 entiation and function. J Exp Med 2016;213:235–49. branched ubiquitin chain regulates NF-kappaB signaling. Mol Cell 33. Pua HH, Steiner DF, Patel S, Gonzalez JR, Ortiz-Carpena JF, Kageyama R, 2016;64:251–66. et al. MicroRNAs 24 and 27 suppress allergic inflammation and target a 56. Wang C, Deng L, Hong M, Akkaraju GR, Inoue J, Chen ZJ. TAK1 is a network of regulators of T helper 2 cell-associated cytokine production. ubiquitin-dependent kinase of MKK and IKK. Nature 2001;412:346–51. Immunity 2016;44:821–32. 57. Xu M, Skaug B, Zeng W, Chen ZJ. A ubiquitin replacement strategy in 34. Kurkewich JL, Bikorimana E, Nguyen T, Klopfenstein N, Zhang H, human cells reveals distinct mechanisms of IKK activation by TNFalpha Hallas WM, et al. The mirn23a microRNA cluster antagonizes B cell and IL-1beta. Mol Cell 2009;36:302–14. development. J Leukoc Biol 2016;100:665–77. 58. Kim TD, Lee SU, Yun S, Sun HN, Lee SH, Kim JW, et al. Human microRNA- 35. Regunathan J, Chen Y, Wang D, Malarkannan S. NKG2D receptor- 27a targets Prf1 and GzmB expression to regulate NK-cell cytotoxicity. mediated NK cell function is regulated by inhibitory Ly49 receptors. Blood Blood 2011;118:5476–86. 2005;105:233–40. 59. Wells AC, Daniels KA, Angelou CC, Fagerberg E, Burnside AS, Markstein M, 36. Abel AM, Tiwari AA, Gerbec ZJ, Siebert JR, Yang C, Schloemer NJ, et al. IQ et al. Modulation of let-7 miRNAs controls the differentiation of effector domain-containing GTPase-activating protein 1 regulates cytoskeletal CD8 T cells. Elife 2017;6:e26398. reorganization and facilitates NKG2D-mediated mechanistic target of 60. Aquino-Lopez A, Senyukov VV, Vlasic Z, Kleinerman ES, Lee DA. Interferon rapamycin complex 1 activation and cytokine gene translation in natural gamma induces changes in natural killer (NK) cell ligand expression and killer cells. Front Immunol 2018;9:1168. alters NK cell-mediated lysis of pediatric cancer cell lines. Front Immunol 37. Li B, Dewey CN. RSEM: accurate transcript quantification from RNA-Seq 2017;8:391. data with or without a reference genome. BMC Bioinformatics 2011;12: 61. Barber DF, Faure M, Long EO. LFA-1 contributes an early signal for NK cell 323. cytotoxicity. J Immunol 2004;173:3653–9.

www.aacrjournals.org Cancer Immunol Res; 7(10) October 2019 1661

Nanbakhsh et al.

62. Malarkannan S, Shih PP, Eden PA, Horng T, Zuberi AR, Christianson G, 65. Dunn PL, North RJ. Early gamma interferon production by natural killer et al. The molecular and functional characterization of a dominant minor cells is important in defense against murine listeriosis. Infect Immun 1991; H antigen, H60. J Immunol 1998;161:3501–9. 59:2892–900. 63. Malarkannan S, Horng T, Eden P, Gonzalez F, Shih P, Brouwenstijn N, et al. 66. Rothschild DE, McDaniel DK, Ringel-Scaia VM, Allen IC. Modulating Differences that matter: major cytotoxic T cell-stimulating minor histo- inﬂammation through the negative regulation of NF-kappaB signaling. compatibility antigens. Immunity 2000;13:333–44. J Leukoc Biol 2018 Feb 1 [Epub ahead of print]. 64. Samarakoon A, Chu H, Malarkannan S. Murine NKG2D ligands: "double, 67. Peng P, Li Z, Liu X. Reduced expression of miR-23a suppresses A20 in TLR- double toil and trouble". Mol Immunol 2009;46:1011–9. stimulated macrophages. Inﬂammation 2015;38:1787–93.

1662 Cancer Immunol Res; 7(10) October 2019 Cancer Immunology Research

Mirc11 Disrupts Inflammatory but Not Cytotoxic Responses of NK Cells

Arash Nanbakhsh, Anupallavi Srinivasamani, Sandra Holzhauer, et al.

Cancer Immunol Res 2019;7:1647-1662. Published OnlineFirst September 12, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/2326-6066.CIR-18-0934

Supplementary Access the most recent supplemental material at: Material http://cancerimmunolres.aacrjournals.org/content/suppl/2021/03/17/2326-6066.CIR-18-0934.DC1

Cited articles This article cites 66 articles, 24 of which you can access for free at: http://cancerimmunolres.aacrjournals.org/content/7/10/1647.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://cancerimmunolres.aacrjournals.org/content/7/10/1647.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department Subscriptions at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerimmunolres.aacrjournals.org/content/7/10/1647. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.