Vol. 9(8), pp. 99-103, September, 2015 DOI: 10.5897/AJBR2015.0837 Article Number: F90783054978 ISSN 1996-0778 African Journal of Biochemistry Research Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJBR Full Length Research Paper Association of single nucleotide polymorphism of Hsp90ab1 gene with thermotolerance and milk yield in Sahiwal cows 1 2 2 2 2 Lalrengpuii Sailo *, I. D. Gupta , Archana Verma , Ramendra Das and M. V. Chaudhari 1AG Division, IVRI, Izzatnagar, India. 2DCB Division, NDRI, Karnal, India. Received 18 April, 2015; Accepted 27 July, 2015 Heat shock proteins play a critical role in the development of thermotolerance and protection from cellular damage associated with heat stresses. The study was undertaken to investigate the association of single nucleotide polymorphisms (SNPs) of Hsp90ab1 gene with thermo-physiological parameters viz, respiration rate (RR), rectal temperature (RT), heat tolerance coefficient (HTC) and total milk yield in Sahiwal cows. The RR and RT were recorded once in different seasons, viz., winter, spring, and summer, at the probable extreme hot hours of the day. Polymorphism of Hsp90ab1 gene, evaluated by comparative sequencing revealed five SNPs, viz., T17871421C, C17871485del, C17872061T, T17872112C and T17872148G. Individuals with CT genotype recorded significantly (P≤0.01) lower RT (°C) than CC genotype in Sahiwal cows. The CT genotype animals also had better production parameter in terms of total milk yield (TMY) (P<0.01). Therefore, our results inferred that CT genotype in Sahiwal cows may be an aid to selection and breeding to enhance thermo-tolerance. Key words: Hsp90ab1, SNPs, respiration rate, rectal temperature, total milk yield, Sahiwal. INTRODUCTION Climate change is likely to be a major threat to the close relationship between metabolic heat generation and viability and sustainability of livestock production systems production level, development in the genetic programs in many regions of the world. Increased in temperature that enhance production traits may increase an animal’s impairs production and reproduction performance, susceptibility to high environmental temperatures (Nardone metabolic, health status and immune response (St-Pierre et al., 2010). One possible approach for reducing the et al., 2003; Rosenzweig et al., 2007). The negative impact of heat stress on cattle productivity is to exploit effects of heat stress will become more apparent in the the genetic variability underlying relative thermotolerance future if climate change continues. Moreover, due to the (Hoffmann, 2010). *Corresponding author. E-mail: [email protected]. Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License 100 Afr. J. Biochem. Res. Cellular tolerance to heat stress is mediated by a family Recording milk production data of proteins named heat shock proteins (HSPs). HSPs play essential roles in the immunity of organisms, Data for total milk yield was obtained from the data sheets of the farm records. Milk production records from the entire lactation particularly in relation to heat-resistance (Song et al., length of all the individuals were utilized. 2006; You et al., 2013). The chaperone, Hsp90 is one of the most abundant proteins in eukaryotic cells, comprising 1–2% of cellular proteins under non-stress conditions Blood collection and DNA extraction (Craven et al., 1996). There are two major cytoplasmic Ten ml blood was collected aseptically from the cows in a sterile Hsp90 isoforms, the inducible (Hsp90α/ Hsp90aa1) and Beckton-Dickinson vacutainer containing 0.5 per cent (10 μl/ml of the constitutive (Hsp90β/ Hsp90ab1), which have arisen blood) anticoagulant ethylene diamine tetraacetic acid (EDTA). by gene duplication (Chen et al., 2006). A fully functional Genomic DNA was extracted using Phenol-chloroform method Hsp90 protein normally associates with other described by Sambrook and Russel (1989) with minor modifica- cochaperones, playing an important role in the folding of tions, and detected by 0.7% agarose gel electrophoresis. The newly synthesized proteins or stabilizing and refolding content of DNA was estimated by Biospec-nano spectrophotometer, and the genome DNA was diluted to a final concentration of 50 ng denatured proteins after stress (Richter and Buchner, /µl, and stored at -20°C for PCR amplification. 2001). Recently novel single nucleotide polymorphisms (SNPs) were identified at different positions of the bovine heat shock protein 90 kDa alpha (cytosolic), class PCR amplification member 1 (Hsp90ab1) in Bos taurus (crossbred) and Bos indicus cattle. High prevalence of this gene in tropical Two sets of forward and reverse gene-specific oligonucleotide cattle (Bos indicus) perform better as compared to primers were designed using DNASTAR software and gene specific temperate breeds or their zebu crossbreds due to higher sequence (ENSBTAT00000001034) available at ensemble genome browser (www.ensembl.org). The working solutions of both forward level of heat tolerance (Charoensook et al., 2012; Deb et and reverse primers were prepared to obtain final concentration of al., 2013; Mcmanus et al., 2014; Sajjanar et al., 2015) 10pmol for each primer. The objective of this study was to identify SNPs in the Final reaction mix (25 µl) comprised of forward primer (0.5 µl), targeted regions of Hsp90ab1 gene in Sahiwal cows and reverse primer (0.5 µl), PCR Master Mix (12.5 µl), water (8.5 µl) and to analyze the association of genetic variants with template DNA (3.0 µl). PCR amplification was performed using Thermal cycler (MJ research and Biorad T100). Each tube, thermo-physiological parameters and milk yield. containing 25 µl PCR reaction cocktail was kept in Thermal Cycler for amplification of target region of bovine Hsp90ab1 gene. PCR conditions involved initial denaturation at 95C for 1 min, followed MATERIALS AND METHODS by 34 cycles with denaturation at 94C for 30 s, primer specific annealing temperature of 59C and 61C for 30 s to specifically Experimental animals amplify target region 1 and 2 respectively, extension at 72oC for 25 s followed by final extension at 72oC for 6 minutes and 30 s. The study was conducted on randomly selected 50 lactating Sahiwal cows maintained at Livestock Research Centre of National Dairy Research Institute (Karnal). The animals were different age Temperature humidity index group, clinically healthy and kept under the same conditions. The experimental design and procedure were carefully planned and approved by the Institutional Animal Ethics Committee. The outdoor temperature and the relative humidity (RH) (%) were recorded daily during the experiment to ascertain Temperature humidity index (THI) value. THI was calculated as per National Research Council (NRC, 1971). THI of winter (49.7), spring (64.65), Recording physiological parameters and summer (86.44) obtained from ICAR-CSSRI, Karnal were the three subclasses of THI considered in association analysis. Respiration rate (RR) of each animal was recorded by visual observation of inward and outward flank movement. Rectal THI = 0.72 (Wb + Db) + 40.6 temperature (RT) was recorded in centigrade with a digital thermometer by keeping the thermometer in contact with rectal Where, Wb is wet bulb temperature and Db is dry bulb temperature mucosa for about 2 min. RR and RT were recorded at 6-8 am, 12- in °C. 02 pm, and 12-02 pm during winter (January), spring (March) and summer (June) respectively. Recording of each of the parameters was done once in each of the three seasons at the probable extreme hours of day. Purification and Sequencing Heat tolerance coefficient (HTC) was calculated by Benezra Coefficient of Heat Adaptability (Benezra, 1954) with the following Amplified PCR products of both sets of primers Table 1 were formula: custom sequenced from both ends, i.e. 5′ and 3′ ends. DNA sequencing results for the respective region of bovine Hsp90ab1 HTC= RR/23 + RT/38.33 gene were visualized and edited using Chromas Lite Software. Each edited sequence was aligned with corresponding reference The denominators 23 and 38.33 in the equation represent the sequence of Bos taurus using ClustalW multiple sequence normal RR and RT (°C) of cattle, respectively, under ideal alignment program to identify single nucleotide polymorphism conditions. (www.ebi.ac.uk/Tools/msa/clustalw2). Sailo et al. 101 Table 1. Sequence of primers, targeted regions and amplicon sizes of bovine Hsp90ab1 gene. Primer set Primer sequence (5’-3’) Targeted regions Amplicon size () F: AGTGAGTATCTTTTGCCCTAATG (23) 1 17871343-17871801 459 R:TCTCCTCTAACCGAATGAAAAA (22) F: GCTGCTGCGCTATCACACG (19) 2 17871892-17872278 387 R: GCCCTCCTTGGTCACAGA (18) 1The number within parenthesis indicates base pairs. 2Targeted region 1 includes part of intron 7, exon 8, and part of intron 9, Targeted region 2 includes part of exon 10, intron 10, and exon 11. Table 2. Genotypic and allelic frequency at each SNP locus of Hsp90ab1 gene in Sahiwal cows. SNPs Genotype Genotypic frequency Allele Allelic frequency TT - T - SNP1 T17871421C (Exon 8) TC - C 1 CC 1(50) CC - C - SNP2 C17871485del (Exon 8) Del 1(50) Del 1 CC 0.34(17) C 0.67 SNP3 CT 0.66(33) T 0.33 C17872061T (Intron 10) TT - SNP4 TT 0.78(39) T 0.89 T17872112C TC 0.22(11) C 0.11 (Intron 10) CC - SNP5 TT - T 0.06 T17872148G TG 0.12(04) G 0.94 (Exon 11) GG 0.88(36) The number within parenthesis indicates number of animals. Statistical analysis T17871421C and deletion (-) at SNP locus C17871485del. These were not considered for Genotypic and allelic frequencies were calculated using POPGENE subsequent analysis. The frequencies of genotypes in the software package (Yeh et al., 1999). The association of SNP genotype with rectal temperature (RT), respiration rate (RR), heat population was in accordance with Hardy-Weinberg tolerance coefficient and total milk yield (TMY) was analyzed using equilibrium (P>0.05). Allele and genotype frequencies are GLM procedure of SAS. The effect of SNP genotype on displayed in Table 2.