DOCSLIB.ORG

Association of Single Nucleotide Polymorphism of Hsp90ab1 Gene with Thermotolerance and Milk Yield in Sahiwal Cows

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Association of Single Nucleotide Polymorphism of Hsp90ab1 Gene with Thermotolerance and Milk Yield in Sahiwal Cows Vol. 9(8), pp. 99-103, September, 2015 DOI: 10.5897/AJBR2015.0837 Article Number: F90783054978 ISSN 1996-0778 African Journal of Biochemistry Research Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJBR Full Length Research Paper Association of single nucleotide polymorphism of Hsp90ab1 gene with thermotolerance and milk yield in Sahiwal cows 1 2 2 2 2 Lalrengpuii Sailo *, I. D. Gupta , Archana Verma , Ramendra Das and M. V. Chaudhari 1AG Division, IVRI, Izzatnagar, India. 2DCB Division, NDRI, Karnal, India. Received 18 April, 2015; Accepted 27 July, 2015 Heat shock proteins play a critical role in the development of thermotolerance and protection from cellular damage associated with heat stresses. The study was undertaken to investigate the association of single nucleotide polymorphisms (SNPs) of Hsp90ab1 gene with thermo-physiological parameters viz, respiration rate (RR), rectal temperature (RT), heat tolerance coefficient (HTC) and total milk yield in Sahiwal cows. The RR and RT were recorded once in different seasons, viz., winter, spring, and summer, at the probable extreme hot hours of the day. Polymorphism of Hsp90ab1 gene, evaluated by comparative sequencing revealed five SNPs, viz., T17871421C, C17871485del, C17872061T, T17872112C and T17872148G. Individuals with CT genotype recorded significantly (P≤0.01) lower RT (°C) than CC genotype in Sahiwal cows. The CT genotype animals also had better production parameter in terms of total milk yield (TMY) (P<0.01). Therefore, our results inferred that CT genotype in Sahiwal cows may be an aid to selection and breeding to enhance thermo-tolerance. Key words: Hsp90ab1, SNPs, respiration rate, rectal temperature, total milk yield, Sahiwal. INTRODUCTION Climate change is likely to be a major threat to the close relationship between metabolic heat generation and viability and sustainability of livestock production systems production level, development in the genetic programs in many regions of the world. Increased in temperature that enhance production traits may increase an animal’s impairs production and reproduction performance, susceptibility to high environmental temperatures (Nardone metabolic, health status and immune response (St-Pierre et al., 2010). One possible approach for reducing the et al., 2003; Rosenzweig et al., 2007). The negative impact of heat stress on cattle productivity is to exploit effects of heat stress will become more apparent in the the genetic variability underlying relative thermotolerance future if climate change continues. Moreover, due to the (Hoffmann, 2010). *Corresponding author. E-mail: [email protected]. Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License 100 Afr. J. Biochem. Res. Cellular tolerance to heat stress is mediated by a family Recording milk production data of proteins named heat shock proteins (HSPs). HSPs play essential roles in the immunity of organisms, Data for total milk yield was obtained from the data sheets of the farm records. Milk production records from the entire lactation particularly in relation to heat-resistance (Song et al., length of all the individuals were utilized. 2006; You et al., 2013). The chaperone, Hsp90 is one of the most abundant proteins in eukaryotic cells, comprising 1–2% of cellular proteins under non-stress conditions Blood collection and DNA extraction (Craven et al., 1996). There are two major cytoplasmic Ten ml blood was collected aseptically from the cows in a sterile Hsp90 isoforms, the inducible (Hsp90α/ Hsp90aa1) and Beckton-Dickinson vacutainer containing 0.5 per cent (10 μl/ml of the constitutive (Hsp90β/ Hsp90ab1), which have arisen blood) anticoagulant ethylene diamine tetraacetic acid (EDTA). by gene duplication (Chen et al., 2006). A fully functional Genomic DNA was extracted using Phenol-chloroform method Hsp90 protein normally associates with other described by Sambrook and Russel (1989) with minor modifica- cochaperones, playing an important role in the folding of tions, and detected by 0.7% agarose gel electrophoresis. The newly synthesized proteins or stabilizing and refolding content of DNA was estimated by Biospec-nano spectrophotometer, and the genome DNA was diluted to a final concentration of 50 ng denatured proteins after stress (Richter and Buchner, /µl, and stored at -20°C for PCR amplification. 2001). Recently novel single nucleotide polymorphisms (SNPs) were identified at different positions of the bovine heat shock protein 90 kDa alpha (cytosolic), class PCR amplification member 1 (Hsp90ab1) in Bos taurus (crossbred) and Bos indicus cattle. High prevalence of this gene in tropical Two sets of forward and reverse gene-specific oligonucleotide cattle (Bos indicus) perform better as compared to primers were designed using DNASTAR software and gene specific temperate breeds or their zebu crossbreds due to higher sequence (ENSBTAT00000001034) available at ensemble genome browser (www.ensembl.org). The working solutions of both forward level of heat tolerance (Charoensook et al., 2012; Deb et and reverse primers were prepared to obtain final concentration of al., 2013; Mcmanus et al., 2014; Sajjanar et al., 2015) 10pmol for each primer. The objective of this study was to identify SNPs in the Final reaction mix (25 µl) comprised of forward primer (0.5 µl), targeted regions of Hsp90ab1 gene in Sahiwal cows and reverse primer (0.5 µl), PCR Master Mix (12.5 µl), water (8.5 µl) and to analyze the association of genetic variants with template DNA (3.0 µl). PCR amplification was performed using Thermal cycler (MJ research and Biorad T100). Each tube, thermo-physiological parameters and milk yield. containing 25 µl PCR reaction cocktail was kept in Thermal Cycler for amplification of target region of bovine Hsp90ab1 gene. PCR conditions involved initial denaturation at 95C for 1 min, followed MATERIALS AND METHODS by 34 cycles with denaturation at 94C for 30 s, primer specific annealing temperature of 59C and 61C for 30 s to specifically Experimental animals amplify target region 1 and 2 respectively, extension at 72oC for 25 s followed by final extension at 72oC for 6 minutes and 30 s. The study was conducted on randomly selected 50 lactating Sahiwal cows maintained at Livestock Research Centre of National Dairy Research Institute (Karnal). The animals were different age Temperature humidity index group, clinically healthy and kept under the same conditions. The experimental design and procedure were carefully planned and approved by the Institutional Animal Ethics Committee. The outdoor temperature and the relative humidity (RH) (%) were recorded daily during the experiment to ascertain Temperature humidity index (THI) value. THI was calculated as per National Research Council (NRC, 1971). THI of winter (49.7), spring (64.65), Recording physiological parameters and summer (86.44) obtained from ICAR-CSSRI, Karnal were the three subclasses of THI considered in association analysis. Respiration rate (RR) of each animal was recorded by visual observation of inward and outward flank movement. Rectal THI = 0.72 (Wb + Db) + 40.6 temperature (RT) was recorded in centigrade with a digital thermometer by keeping the thermometer in contact with rectal Where, Wb is wet bulb temperature and Db is dry bulb temperature mucosa for about 2 min. RR and RT were recorded at 6-8 am, 12- in °C. 02 pm, and 12-02 pm during winter (January), spring (March) and summer (June) respectively. Recording of each of the parameters was done once in each of the three seasons at the probable extreme hours of day. Purification and Sequencing Heat tolerance coefficient (HTC) was calculated by Benezra Coefficient of Heat Adaptability (Benezra, 1954) with the following Amplified PCR products of both sets of primers Table 1 were formula: custom sequenced from both ends, i.e. 5′ and 3′ ends. DNA sequencing results for the respective region of bovine Hsp90ab1 HTC= RR/23 + RT/38.33 gene were visualized and edited using Chromas Lite Software. Each edited sequence was aligned with corresponding reference The denominators 23 and 38.33 in the equation represent the sequence of Bos taurus using ClustalW multiple sequence normal RR and RT (°C) of cattle, respectively, under ideal alignment program to identify single nucleotide polymorphism conditions. (www.ebi.ac.uk/Tools/msa/clustalw2). Sailo et al. 101 Table 1. Sequence of primers, targeted regions and amplicon sizes of bovine Hsp90ab1 gene. Primer set Primer sequence (5’-3’) Targeted regions Amplicon size () F: AGTGAGTATCTTTTGCCCTAATG (23) 1 17871343-17871801 459 R:TCTCCTCTAACCGAATGAAAAA (22) F: GCTGCTGCGCTATCACACG (19) 2 17871892-17872278 387 R: GCCCTCCTTGGTCACAGA (18) 1The number within parenthesis indicates base pairs. 2Targeted region 1 includes part of intron 7, exon 8, and part of intron 9, Targeted region 2 includes part of exon 10, intron 10, and exon 11. Table 2. Genotypic and allelic frequency at each SNP locus of Hsp90ab1 gene in Sahiwal cows. SNPs Genotype Genotypic frequency Allele Allelic frequency TT - T - SNP1 T17871421C (Exon 8) TC - C 1 CC 1(50) CC - C - SNP2 C17871485del (Exon 8) Del 1(50) Del 1 CC 0.34(17) C 0.67 SNP3 CT 0.66(33) T 0.33 C17872061T (Intron 10) TT - SNP4 TT 0.78(39) T 0.89 T17872112C TC 0.22(11) C 0.11 (Intron 10) CC - SNP5 TT - T 0.06 T17872148G TG 0.12(04) G 0.94 (Exon 11) GG 0.88(36) The number within parenthesis indicates number of animals. Statistical analysis T17871421C and deletion (-) at SNP locus C17871485del. These were not considered for Genotypic and allelic frequencies were calculated using POPGENE subsequent analysis. The frequencies of genotypes in the software package (Yeh et al., 1999). The association of SNP genotype with rectal temperature (RT), respiration rate (RR), heat population was in accordance with Hardy-Weinberg tolerance coefficient and total milk yield (TMY) was analyzed using equilibrium (P>0.05). Allele and genotype frequencies are GLM procedure of SAS. The effect of SNP genotype on displayed in Table 2.
Load more

Recommended publications
  • This Is the Accepted Version of the Author's Manuscript. Reis SD, Pinho BR, Oliveira JMA "Modulation of Molecular Chapero
    This is the Accepted Version of the Author’s Manuscript. Reis SD, Pinho BR, Oliveira JMA "Modulation of molecular chaperones in Huntington’s disease and other polyglutamine disorders". Molecular Neurobiology. September 2016 DOI: 10.1007/s12035-016-0120-z Link to Publisher: https://link.springer.com/article/10.1007%2Fs12035-016-0120-z Links to Full Text (RedCube, shared via Springer Nature) – View Only http://rdcu.be/kwjE 1 ! Title page Modulation of molecular chaperones in Huntington’s disease and other polyglutamine disorders Sara D. Reis, Brígida R. Pinho, Jorge M. A. Oliveira* REQUIMTE/LAQV, Department of Drug Sciences, Pharmacology Lab, Faculty of Pharmacy, University of Porto, Porto, Portugal *Corresponding author: Jorge M. Ascenção Oliveira Tel. +351 220428610 Email: [email protected] Acknowledgements This work was supported by Fundação para a Ciência e a Tecnologia (FCT): Strategic award UID/QUI/50006/2013, and by the research grant PTDC/NEU-NMC/0412/2014 (PI: JMAO), co- financed by the European Union (FEDER, QREN, COMPETE) – POCI-01-0145-FEDER- 016577. SDR acknowledges FCT for her PhD Grant (PD/BD/113567/2015). BRP acknowledges FCT for her PostDoc Grant (SFRH/BPD/102259/2014). We thank Ana Isabel Duarte (PhD, U. Coimbra) and Maria Clara Quintas (PhD, U. Porto) for reading and commenting the initial manuscript draft. 2 ! Abstract Polyglutamine expansion mutations in specific proteins underlie the pathogenesis of a group of progressive neurodegenerative disorders, including Huntington’s disease, spinal and bulbar muscular atrophy, dentatorubral-pallidoluysian atrophy, and several spinocerebellar ataxias. The different mutant proteins share ubiquitous expression and abnormal proteostasis, with misfolding and aggregation, but nevertheless evoke distinct patterns of neurodegeneration.
    [Show full text]
  • Mirc11 Disrupts Inflammatory but Not Cytotoxic Responses of NK Cells
    Published OnlineFirst September 12, 2019; DOI: 10.1158/2326-6066.CIR-18-0934 Research Article Cancer Immunology Research Mirc11 Disrupts Inflammatory but Not Cytotoxic Responses of NK Cells Arash Nanbakhsh1, Anupallavi Srinivasamani1, Sandra Holzhauer2, Matthew J. Riese2,3,4, Yongwei Zheng5, Demin Wang4,5, Robert Burns6, Michael H. Reimer7,8, Sridhar Rao7,8, Angela Lemke9,10, Shirng-Wern Tsaih9,10, Michael J. Flister9,10, Shunhua Lao1,11, Richard Dahl12, Monica S. Thakar1,11, and Subramaniam Malarkannan1,3,4,9,11 Abstract Natural killer (NK) cells generate proinflammatory cyto- g–dependent clearance of Listeria monocytogenes or B16F10 kines that are required to contain infections and tumor melanoma in vivo by NK cells. These functional changes growth. However, the posttranscriptional mechanisms that resulted from Mirc11 silencing ubiquitin modifiers A20, regulate NK cell functions are not fully understood. Here, we Cbl-b, and Itch, allowing TRAF6-dependent activation of define the role of the microRNA cluster known as Mirc11 NF-kB and AP-1. Lack of Mirc11 caused increased translation (which includes miRNA-23a, miRNA-24a, and miRNA-27a) of A20, Cbl-b, and Itch proteins, resulting in deubiquityla- in NK cell–mediated proinflammatory responses. Absence tion of scaffolding K63 and addition of degradative K48 of Mirc11 did not alter the development or the antitumor moieties on TRAF6. Collectively, our results describe a func- cytotoxicity of NK cells. However, loss of Mirc11 reduced tion of Mirc11 that regulates generation of proinflammatory generation of proinflammatory factors in vitro and interferon- cytokines from effector lymphocytes. Introduction TRAF2 and TRAF6 promote K63-linked polyubiquitination that is required for subcellular localization of the substrates (20), Natural killer (NK) cells generate proinflammatory factors and and subsequent activation of NF-kB (21) and AP-1 (22).
    [Show full text]
  • Polymorphisms of PRLHR and HSPA12A and Risk of Gastric and Colorectal Cancer in the Chinese Han Population
    Su et al. BMC Gastroenterology (2015) 15:107 DOI 10.1186/s12876-015-0336-9 RESEARCH ARTICLE Open Access Polymorphisms of PRLHR and HSPA12A and risk of gastric and colorectal cancer in the Chinese Han population Qinghua Su1, Yuan Wang2, Jun Zhao1, Cangjian Ma1, Tao Wu1, Tianbo Jin3,4 and Jinkai Xu1* Abstract Background: Gastric and colorectal cancers have a major impact on public health, and are the most common malignant tumors in China. The aim of this research was to study whether polymorphisms of CHCHD3P1-HSP90AB7P, GRID1, HSPA12A, PRLHR, SBF2, POLD3 and C11orf93-C11orf92 genes are associated with the risk of gastric and colorectal cancers in the Chinese Han population. Methods: We genotyped seven single nucleotide polymorphisms (SNPs) from seven genes. We selected 588 patients with gastric cancer and 449 with colorectal cancer, along with 703 healthy controls. All these SNPs were evaluated using the χ2 test and genetic model analysis. Results: The genotype “A/T” of rs12413624 in PRLHR gene was associated with a decreased risk of colorectal cancer in allele model analysis [odds ratio (OR) = 0.81; 95 % confidence interval (CI) = 0.68–0.97; p = 0.018] and log-additive model analysis (OR = 0.81; 95 % CI = 0.66–0.98; p = 0.032). The genotype “A/G” of rs1665650 in HSPA12A gene was associated with a decreased risk of gastric cancer in overdominant model analysis (OR = 0.77; 95 % CI = 0.60–0.99; p =0.038). Conclusions: Our results provide evidence that variants of PRLHR gene are a protective factor in colorectal cancer and variants of HSPA12A gene are a protective factor in gastric cancer in the Chinese Han population.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Senescence Inhibits the Chaperone Response to Thermal Stress
    SUPPLEMENTAL INFORMATION Senescence inhibits the chaperone response to thermal stress Jack Llewellyn1, 2, Venkatesh Mallikarjun1, 2, 3, Ellen Appleton1, 2, Maria Osipova1, 2, Hamish TJ Gilbert1, 2, Stephen M Richardson2, Simon J Hubbard4, 5 and Joe Swift1, 2, 5 (1) Wellcome Centre for Cell-Matrix Research, Oxford Road, Manchester, M13 9PT, UK. (2) Division of Cell Matrix Biology and Regenerative Medicine, School of Biological Sciences, Faculty of Biology, Medicine and Health, Manchester Academic Health Science Centre, University of Manchester, Manchester, M13 9PL, UK. (3) Current address: Department of Biomedical Engineering, University of Virginia, Box 800759, Health System, Charlottesville, VA, 22903, USA. (4) Division of Evolution and Genomic Sciences, School of Biological Sciences, Faculty of Biology, Medicine and Health, Manchester Academic Health Science Centre, University of Manchester, Manchester, M13 9PL, UK. (5) Correspondence to SJH ([email protected]) or JS ([email protected]). Page 1 of 11 Supplemental Information: Llewellyn et al. Chaperone stress response in senescence CONTENTS Supplemental figures S1 – S5 … … … … … … … … 3 Supplemental table S6 … … … … … … … … 10 Supplemental references … … … … … … … … 11 Page 2 of 11 Supplemental Information: Llewellyn et al. Chaperone stress response in senescence SUPPLEMENTAL FIGURES Figure S1. A EP (passage 3) LP (passage 16) 200 µm 200 µm 1.5 3 B Mass spectrometry proteomics (n = 4) C mRNA (n = 4) D 100k EP 1.0 2 p < 0.0001 p < 0.0001 LP p < 0.0001 p < 0.0001 ) 0.5 1 2 p < 0.0001 p < 0.0001 10k 0.0 0 -0.5 -1 Cell area (µm Cell area fold change vs. EP fold change vs.
    [Show full text]
  • Prognostic and Functional Significant of Heat Shock Proteins (Hsps)
    biology Article Prognostic and Functional Significant of Heat Shock Proteins (HSPs) in Breast Cancer Unveiled by Multi-Omics Approaches Miriam Buttacavoli 1,†, Gianluca Di Cara 1,†, Cesare D’Amico 1, Fabiana Geraci 1 , Ida Pucci-Minafra 2, Salvatore Feo 1 and Patrizia Cancemi 1,2,* 1 Department of Biological Chemical and Pharmaceutical Sciences and Technologies (STEBICEF), University of Palermo, 90128 Palermo, Italy; [email protected] (M.B.); [email protected] (G.D.C.); [email protected] (C.D.); [email protected] (F.G.); [email protected] (S.F.) 2 Experimental Center of Onco Biology (COBS), 90145 Palermo, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-091-2389-7330 † These authors contributed equally to this work. Simple Summary: In this study, we investigated the expression pattern and prognostic significance of the heat shock proteins (HSPs) family members in breast cancer (BC) by using several bioinfor- matics tools and proteomics investigations. Our results demonstrated that, collectively, HSPs were deregulated in BC, acting as both oncogene and onco-suppressor genes. In particular, two different HSP-clusters were significantly associated with a poor or good prognosis. Interestingly, the HSPs deregulation impacted gene expression and miRNAs regulation that, in turn, affected important bio- logical pathways involved in cell cycle, DNA replication, and receptors-mediated signaling. Finally, the proteomic identification of several HSPs members and isoforms revealed much more complexity Citation: Buttacavoli, M.; Di Cara, of HSPs roles in BC and showed that their expression is quite variable among patients. In conclusion, G.; D’Amico, C.; Geraci, F.; we elaborated two panels of HSPs that could be further explored as potential biomarkers for BC Pucci-Minafra, I.; Feo, S.; Cancemi, P.
    [Show full text]
  • Characterization of the Dual Functional Effects of Heat Shock Proteins (Hsps
    Zhang et al. Genome Medicine (2020) 12:101 https://doi.org/10.1186/s13073-020-00795-6 RESEARCH Open Access Characterization of the dual functional effects of heat shock proteins (HSPs) in cancer hallmarks to aid development of HSP inhibitors Zhao Zhang1†, Ji Jing2†, Youqiong Ye1, Zhiao Chen1, Ying Jing1, Shengli Li1, Wei Hong1, Hang Ruan1, Yaoming Liu1, Qingsong Hu3, Jun Wang4, Wenbo Li1, Chunru Lin3, Lixia Diao5*, Yubin Zhou2* and Leng Han1* Abstract Background: Heat shock proteins (HSPs), a representative family of chaperone genes, play crucial roles in malignant progression and are pursued as attractive anti-cancer therapeutic targets. Despite tremendous efforts to develop anti-cancer drugs based on HSPs, no HSP inhibitors have thus far reached the milestone of FDA approval. There remains an unmet need to further understand the functional roles of HSPs in cancer. Methods: We constructed the network for HSPs across ~ 10,000 tumor samples from The Cancer Genome Atlas (TCGA) and ~ 10,000 normal samples from Genotype-Tissue Expression (GTEx), and compared the network disruption between tumor and normal samples. We then examined the associations between HSPs and cancer hallmarks and validated these associations from multiple independent high-throughput functional screens, including Project Achilles and DRIVE. Finally, we experimentally characterized the dual function effects of HSPs in tumor proliferation and metastasis. Results: We comprehensively analyzed the HSP expression landscape across multiple human cancers and revealed a global disruption of the co-expression network for HSPs. Through analyzing HSP expression alteration and its association with tumor proliferation and metastasis, we revealed dual functional effects of HSPs, in that they can simultaneously influence proliferation and metastasis in opposite directions.
    [Show full text]
  • Deficiency of Heat Shock Protein A12A Promotes Browning of White Adipose Tissues in Mice
    BBA - Molecular Basis of Disease 1865 (2019) 1451–1459 Contents lists available at ScienceDirect BBA - Molecular Basis of Disease journal homepage: www.elsevier.com/locate/bbadis Deficiency of heat shock protein A12A promotes browning of white adipose tissues in mice T Hao Chenga, Tao Qia, Xiaojin Zhangb, Qiuyue Konga, Xinxu Mina, Qian Maoa, Xiaofei Caoa, ⁎ Li Liub,c, Zhengnian Dinga, a Department of Anaesthesiology, First Affiliated Hospital with Nanjing Medical University, Nanjing 210029, China b Jiangsu Provincial Key Laboratory of Geriatrics, Department of Geriatrics, First Affiliated Hospital with Nanjing Medical University, Nanjing 210029, China c Key Laboratory of Targeted Intervention of Cardiovascular Disease, Collaborative Innovation Center for Cardiovascular Disease Translational Medicine, Nanjing Medical University, Nanjing 210029, China ARTICLE INFO ABSTRACT Keywords: Browning of white adipose tissues (WAT) is critical for a variety of physiological and pathophysiological events. Adipose tissue Given the limited understanding in molecular control of WAT browning, further research is needed. Heat shock Heat shock protein A12A (HSPA12A) protein A12A (HSPA12A) is a new member of multigene Hsp70 family. This study investigated the effect of Adipocyte HSPA12A on the browning of WAT. WAT Browning in mice was induced by cold exposure for 5 days. We Browning observed that nuclear HSPA12A content was increased in WAT after cold exposure, while deficiency of HSPA12A Macrophage − − (Hspa12a / ) promoted the cold-induced browning of WAT in mice compared to wild type (WT) littermates. − − Accordingly, Hspa12a / mice showed attenuation of body temperature drop and increase of thermogenic gene expression compared to WT mice after cold exposure. However, in vitro experiments demonstrated that HSPA12A deficiency in primary white adipocytes did not affect their browning and thermogenic gene expres- sion.
    [Show full text]
  • Two Hsp70 Family Members Expressed in Atherosclerotic Lesions
    Two Hsp70 family members expressed in atherosclerotic lesions Zhihua Han, Quynh A. Truong, Shirley Park, and Jan L. Breslow* Laboratory of Biochemical Genetics and Metabolism, The Rockefeller University, 1230 York Avenue, New York, NY 10021 Contributed by Jan L. Breslow, December 16, 2002 Gene expression profiling was carried out comparing Con A elicited chromosomes 10, 14, and 19 (10). The responsible genes at these peritoneal macrophages from C57BL͞6 and FVB͞N wild-type and loci are not currently known. apolipoprotein (apo)E knockout mice. An EST, W20829, was ex- Because macrophages play such a fundamental role in the pressed at higher levels in C57BL͞6 compared with FVB͞N mice. initiation and progression of atherosclerotic lesions, differen- W20829 mapped to an atherosclerosis susceptibility locus on chro- tially expressed genes were sought between elicited peritoneal mosome 19 revealed in an intercross between atherosclerosis- macrophages from C57BL͞6 and FVB͞N wild-type and apoE susceptible C57BL͞6 and atherosclerosis-resistant FVB͞N apoE knockout mice. In the course of this analysis, one of the genes knockout mice. A combination of database search and Northern overexpressed in C57BL͞6 macrophages corresponded to an -analysis confirmed that W20829 corresponded to 3؅-UTR of a EST that maps to the chromosome 19 atherosclerosis suscepti hitherto predicted gene, named HspA12A. Blasting the National bility locus. This gene, HspA12A, and another closely related Center for Biotechnology Information database revealed a closely mammalian homologue that maps to a different region of the related homologue, HspA12B. HspA12A and -B have very close genome, HspA12B, were found to be distant members of the human homologues. TaqMan analysis confirmed the increased Hsp70 family.
    [Show full text]
  • Brief Communication Increased Systemic HSP70B Levels in Spinal
    medRxiv preprint doi: https://doi.org/10.1101/2020.11.20.20235325; this version posted November 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Brief Communication Increased Systemic HSP70B Levels in Spinal Muscular Atrophy Infants Eric J. Eichelberger1, Christiano R. R. Alves1, Ren Zhang1, Marco Petrillo2, Patrick Cullen2, Wildon Farwell2, Jessica A Hurt2, John F. Staropoli2,3, Kathryn J. Swoboda1* 1 Department of Neurology, Center for Genomic Medicine, Massachusetts General Hospital, Boston, MA 2 Biogen, Cambridge, MA 3 Current Affiliation: Vertex Pharmaceuticals, Boston, MA * Correspondence should be addressed to Kathryn J. Swoboda ([email protected]) Center for Genomic Medicine, Massachusetts General Hospital Simches Research Building, 185 Cambridge Street, Boston, MA 02114, US Office: 617-726-5732 / Fax: 617-724-9620 / Cell 617-312-8318 ORCIDs Eric J. Eichelberger: 0000-0003-3418-6141, Christiano R. R. Alves: 0000-0002-2646-9689 Ren Zhang: 0000-0002-8437-3562 Marco Petrillo: 0000-0003-2526-6166 Kathryn J. Swoboda: 0000-0002-4593-6342 Running Head: Spinal Muscular Atrophy and HSP70B Levels Keywords: Neuromuscular; Genetic Diseases; Biomarkers; Neurofilaments; Neurology. Author Contributions: EJE, CRRA, and KJS conceived and designed the study. EJE, RZ, JAH, PC and JFS carried out RNAseq experiments and analysis. MP and WF performed and analyzed neurofilaments experiments. EJE and CRRA carried out other experiments. KJS provided laboratory support and supervised the experiments. EJE and CRRA performed data analysis and drafted the manuscript.
    [Show full text]
  • Genetics and Molecular Biology, 44, 1, E20190410 (2021) Copyright © Sociedade Brasileira De Genética
    Genetics and Molecular Biology, 44, 1, e20190410 (2021) Copyright © Sociedade Brasileira de Genética. DOI: https://doi.org/10.1590/1678-4685-GMB-2019-0410 Research Article Human and Medical Genetics Integrated analysis of label-free quantitative proteomics and bioinformatics reveal insights into signaling pathways in male breast cancer Talita Helen Bombardelli Gomig1*, Amanda Moletta Gontarski1*, Iglenir João Cavalli1, Ricardo Lehtonen Rodrigues de Souza1 , Aline Castro Rodrigues Lucena2, Michel Batista2,3, Kelly Cavalcanti Machado3, Fabricio Klerynton Marchini2,3, Fabio Albuquerque Marchi4, Rubens Silveira Lima5, Cícero de Andrade Urban5, Rafael Diogo Marchi6, Luciane Regina Cavalli6,7and Enilze Maria de Souza Fonseca Ribeiro1 1Universidade Federal do Paraná, Departamento de Genética, Programa de Pós-graduação em Genética, Curitiba, PR, Brazil. 2Instituto Carlos Chagas, Laboratório de Genômica Funcional, Curitiba, PR, Brazil. 3Fundação Oswaldo Cruz (Fiocruz), Plataforma de Espectrometria de Massas, Curitiba, PR, Brazil. 4Hospital A.C. Camargo Cancer Center, Centro de Pesquisa Internacional, São Paulo, SP, Brazil. 5Hospital Nossa Senhora das Graças, Centro de Doenças da Mama, Curitiba, PR, Brazil. 6Instituto de Pesquisa Pelé Pequeno Príncipe, Curitiba, PR, Brazil. 7Georgetown University, Lombardi Comprehensive Cancer Center, Washington, USA. * These authors contributed equally to this study. Abstract Male breast cancer (MBC) is a rare malignancy that accounts for about 1.8% of all breast cancer cases. In contrast to the high number of
    [Show full text]
  • Skeletal Muscle Heat Shock Protein 70: Diverse Functions and Therapeutic Potential for Wasting Disorders
    PERSPECTIVE ARTICLE published: 11 November 2013 doi: 10.3389/fphys.2013.00330 Skeletal muscle heat shock protein 70: diverse functions and therapeutic potential for wasting disorders Sarah M. Senf* Department of Physical Therapy, University of Florida, Gainesville, FL, USA Edited by: The stress-inducible 70-kDa heat shock protein (HSP70) is a highly conserved protein Lucas Guimarães-Ferreira, Federal with diverse intracellular and extracellular functions. In skeletal muscle, HSP70 is rapidly University of Espirito Santo, Brazil induced in response to both non-damaging and damaging stress stimuli including exercise Reviewed by: and acute muscle injuries. This upregulation of HSP70 contributes to the maintenance Gordon Lynch, The University of Melbourne, Australia of muscle fiber integrity and facilitates muscle regeneration and recovery. Conversely, Ruben Mestril, Loyola University HSP70 expression is decreased during muscle inactivity and aging, and evidence supports Chicago, USA the loss of HSP70 as a key mechanism which may drive muscle atrophy, contractile *Correspondence: dysfunction and reduced regenerative capacity associated with these conditions. To Sarah M. Senf, Department of date, the therapeutic benefit of HSP70 upregulation in skeletal muscle has been Physical Therapy, University of Florida, 1225 Center Drive, HPNP established in rodent models of muscle injury, muscle atrophy, modified muscle use, Building Rm. 1142, Gainesville, aging, and muscular dystrophy, which highlights HSP70 as a key therapeutic target for FL 32610, USA the treatment of various conditions which negatively affect skeletal muscle mass and e-mail: smsenf@ufl.edu function. This article will review these important findings and provide perspective on the unanswered questions related to HSP70 and skeletal muscle plasticity which require further investigation.
    [Show full text]