Retrovirus Vectors Designed for Efficient Transduction of Cytotoxic Or

Home , Expression vector, Recombinase

Gene Therapy (1999) 6, 1670–1678  1999 Stockton Press All rights reserved 0969-7128/99 $15.00 http://www.stockton-press.co.uk/gt Retrovirus vectors designed for efﬁcient transduction of cytotoxic or cytostatic genes

MUi1, M Takada1, T Arai1,2, K Matsumoto1, K Yamada3, T Nakahata3, T Nishiwaki4, Y Furukawa4, T Tokino4, Y Nakamura4 and H Iba1 1Department of Gene Regulation 3Department of Clinical Oncology and 4Laboratory of Molecular Medicine, Institute of Medical Science, University of Tokyo, Tokyo; and 2Tsukuba Research Laboratories, Eisai Co, Ltd, Tsukuba, Japan

It is difﬁcult to establish stable packaging cell lines produc- rying LacZ or p53 as the exogenous gene was introduced ing retrovirus vectors for the expression of anti-oncogenes into a previously constructed prepackaging cell lines PtG- with cytotoxic or cytostatic potential, because these genes S2, in which the expression of VSV-G is also designed to would also affect the growth of the packaging cell lines. To be initiated by the introduction of Cre recombinase, while overcome this problem, we designed a transcriptional unit the gag-pol gene is expressed continuously. After the intro- pBabeLPL for vector RNA production, in which the tran- duction of Cre recombinase by an adenovirus vector, LacZ- scription of the exogenous genes is completely suppressed or p53-expressing VSV-G-pseudotyped retrovirus vectors by the presence of a preceding insertion containing the with the designed structure were produced at high virus puromycin resistance gene (puro) and a poly(A) addition titers. The p53 virus was shown to be able to transduce signal. This insertion is ﬂanked by a tandem pair of loxP, p53 into the entire population of several human cancer cell and is designed to be excised after the introduction of Cre lines and to induce their growth arrest at the G1 phase, recombinase, when transcription of the exogenous gene indicating that this vector-producing system will be advan- will be started from the 5Ј-LTR. The transcriptional unit car- tageous for human gene therapy.

Keywords: retrovirus vector; Cre-loxP; p53; cell cycle arrest; VSV-G-pseudotypes

Introduction Establishment of stable packaging cell lines for such retrovirus vectors is difficult, because the growth-sup- Retrovirus vectors based on murine leukemia virus pressing activity of these genes would cause problems (MLV) have been used as powerful gene delivery systems 1–3 in isolation of stable packaging cellular clones and their in basic research and human gene therapy. The intro- propagation in large-scale culture. Furthermore, the duced genes are stably integrated into the target cell gen- propagation step may potentially result in the accumu- ome and have the potential for long-term expression. lation of cellular populations carrying loss-of-function Recently, retrovirus vectors pseudotyped with the G pro- mutants of the tumor suppressor genes because of their tein of vesicular stomatitis virus (VSV-G) have been con- growth advantage. Such difficulties would lower the structed and shown to be advantageous in that they have quality and safety of the vectors, as discussed previously a much broader host range, often yielding higher trans- for an amphotropic retrovirus vector encoding p53.12 duction efficiency, than conventional amphotropic retrovirus vectors and that virus stocks can be concentrated To overcome these problems, we have designed a tran- by ultracentrifugation to give a very high titer scriptional unit for vector RNA production, pBabeLPL, in (approximately 1 × 109 IU/ml).4–7 Efficient production which the expression of the cytotoxic genes is completely systems for these vectors have recently been developed silenced during cloning and propagation of the packag- by us8 and by other groups,9–11 making use of the Cre- ing cell lines. When this transcriptional unit was intro- loxP-mediated recombination system and inducible duced into a prepackaging cell line PtG-S2, which we had 8 promoters, respectively. previously developed, the expression of both the Retrovirus vectors that can efficiently transduce anti- exogenous gene in the vector and the VSV-G gene was oncogenes or tumor suppressor genes with cytotoxic or induced in an all-or-nothing manner upon the introduc- cytostatic potential could be useful for gene therapy of tion of Cre recombinase in an adenovirus vector.13,14 We human cancer. Such vectors might be produced by transi- show here that pBabeLPL in combination with PtG-S2 ent transfection of the vector DNA into packaging cell functioned as designed and was able to produce high lines, but these systems are not suitable for the reproduc- titer virus stocks of VSV-G-pseudotyped retrovirus vec- ible preparation of certified vectors on a large scale. tor encoding p53. The virus stock transmitted the p53 gene into the entire population of several human tumor cell lines in a single transduction and induced cell cycle Correspondence: H Iba, Department of Gene Regulation, Institute of arrest of these cultures. Medical Science, University of Tokyo, 4–6–1 Shirokanedai, Minato-ku, Tokyo 108–8639, Japan Received 12 April 1999; accepted 8 June 1999 Retrovirus vectors for cytotoxic genes MUiet al 1671

Figure 1 (a) Schematic presentation of the system designed for the production of VSV-G-pseudotyped retrovirus vectors encoding cytotoxic or cytostatic genes. The transcriptional unit pBabeLPL-X contains both the puro gene and a poly(A) addition signal flanked with loxP sequences which are tandemly located. Before the introduction of Cre recombinase, the puro gene is transcribed from the vector 5Ј-LTR, while the X gene is completely silent because the RNA transcript terminates before its coding sequence. Arrows indicate the predicted transcript in each cell type. Cre recombinase excises the puro gene and poly(A) addition signal by site-specific recombination between the two loxP sequences, producing a proviral structure carrying the X gene with a loxP. This enzyme also excises the other insert carrying the neo gene, an mRNA-destabilizing signal and a poly(A) addition signal in the transcriptional unit, pCALNdLG and induces the transcription of the VSV-G gene, which initiates VSV-G-pseudotyped vector production. MoLTR, MoMLV long terminal repeat; ␺, packaging signal of retrovirus vector; puro, puromycin resistance gene; pA, polyadenylation signal; X gene, an arbitary gene; CAG, CAG promoter; neo, neomycin resistance gene; VSV-G, VSV-G-coding sequence; MoMLV gag-pol, MoMLV gag and pol genes; bsr, blasticidin resistance gene. (b, c) Predicted structural changes in pBabeLPL-lacZ (b) or pBabeLPL-p53 (c) before and after the introduction of Cre recombinase. The predicted lengths of the restriction fragments used for the chromosomal analysis are shown. K, KpnI sites; X, XbaI sites. Retrovirus vectors for cytotoxic genes MUiet al 1672 Results mixed populations of these transfectants of PtG-S2 produced 2 × 104 IU/ml of LacZ-expressing retrovirus vec- Design of retrovirus vectors for the expression of tors around 5 to 7 days after the introduction of Cre cytotoxic or cytostatic genes recombinase (Figure 2a). The induction kinetics of the To overcome the difficulties in generating packaging cell vectors were slightly delayed compared with those of lines which produce retrovirus vectors expressing cyto- PtG-S2 harboring pMFGnlslacZ (PtG-S2 lacZ1) and the toxic or cytostatic genes, we first designed a transcrip- highest titer was about 1/50 of that of PtG-S2 lacZ1. The tional unit pBabeLPL-X (Figure 1a) for vector RNA pro- slight delay in the induction kinetics might be partially duction. While it has a usual MLV-based proviral DNA explained by the fact that two independent Cre-loxP structure, the exogenous gene X is preceded by an inser- recombination events are required for the virus tion carrying the puromycin resistance gene (puro) and a production in PtG-S2 harboring pBabeLPL-lacZ. poly(A) addition signal flanked by a tandem pair of loxP In order to improve the production of retrovirus sequences. The RNA transcript driven by the 5Ј-LTR would be expected to encode only the puro gene and to be terminated by the poly(A) addition signal present just before the X gene. Therefore, the X gene should not be transcribed from the 5Ј-LTR or from any other promoters, even when pBabeLPL-X is introduced into cells. In cells harboring pBabeLPL-X, the introduction of Cre recombinase will induce excision of the insertion (both the puro gene and the poly(A) addition signal) through loxP-specific recombination and the transcription of the X gene from the 5Ј-LTR will be initiated. As the virus-producing cell system, we used the prepackaging cell line PtG-S2, which we had previously developed.8 PtG-S2 constitutively expresses the gag and pol genes of MoMLV and also contains a Cre recombinase-inducible transcriptional unit, pCALNdLG, for the VSV-G gene (Figure 1a). Neither RCR nor adenovirus vector was detected in pseudotyped virus stocks of 1 × 107 IU produced from PtG-S2.8 After the introduction of an adenovirus vector encoding Cre recombinase, PtG- S2 harboring pBabeLPL-X would be expected to begin transcription of both full-length vector RNA driven by the 5Ј-LTR and VSV-G mRNA driven by a CAG promoter.15 Thereafter, virus vector carrying the X gene will be packaged and produced from the packaging cell line just generated from the prepackaging cell line. To develop this vector-producing system, we first used nlslacZ, the ␤-galactosidase gene with a nuclear localiz- ation signal, as a control gene (hereafter abbreviated as LacZ) and basic conditions for virus production, as well as the characteristics of the viral structure, were examined in PtG-S2 harboring pBabeLPL-lacZ (Figure 1b). Using the conditions and procedures established for these cells, we further applied this system to a represen- tative tumor suppressor gene p53, with cytostatic and cytotoxic potential, by generating PtG-S2 harboring pBa- beLPL-p53 (Figure 1c).

Isolation of prepackaging cell lines from which LacZ virus production can be induced pBabeLPL-lacZ (Figure 1b) was transfected into PtG-S2 by lipofection and stable transformants were selected with puromycin. When mixed populations of puromycin- resistant clones were collected and grown, no LacZ- Figure 2 Time-course of VSV-G-pseudotyped retrovirus production after transduction with AxCANCre at an MOI of 10. (a) Induction kinetics of expressing cells were detectable in the entire culture, virus carrying LacZ from cellular clones of PtG-S2 harboring pBabeLPL- indicating that the LacZ gene is initially silent, as lacZ; A48 (closed circles), B19 (open triangles) or from the parental mixed designed. When a subculture of the mixed populations population (closed squares). (b) Induction kinetics of virus carrying p53 was infected with the adenovirus vector AxCANCre13,14 from cellular clones of PtG-S2 harboring pBabeLPL-p53; C1 (open at an MOI of 10, cells expressing LacZ became detectable triangles), C58 (closed circles), C72 (closed squares) and D18 (open within 3 days. From a parallel subculture, culture fluids squares). None of these cultures produced retrovirus vectors in the absence of Cre recombinase. Results from A48 ((a); open circles) and C58 ((b); were recovered every day and virus production was open circles) that were kept without the introduction of AxCANCre are determined by titrating the LacZ-expressing retrovirus shown. Cells were kept at 37°C until 2 days after the transduction and vectors with rat fibroblast 3Y1 cells as the indicator. The were shifted to 32°C thereafter. Retrovirus vectors for cytotoxic genes MUiet al 1673 vectors, we isolated 182 clones of stable transformants of Proviral DNA analysis confirmed virus production as pBabeLPL-lacZ after selection with puromycin. None of designed the clones expressed LacZ or produced LacZ-expressing To test whether the loxP-specific recombination occurred retrovirus vectors before the introduction of Cre recombi- in pBabeLPL as designed, proviral DNA in PtG-S2 chro- nase, as observed above. A subculture of each clone was mosome was analyzed by Southern blotting using a LacZ infected with AxCANCre at an MOI of 10 and the induction of LacZ expression in the culture was examined 6 days later. Twenty clones showing high level induction as monitored by X-gal staining were selected, and shown to produce LacZ with titers more than 2 × 104 IU/ml on day 6. Among them, two clones (A48 and B19) produced high titer retrovirus vectors (A48; 4 × 105 IU/ml) with similar kinetics of virus induction to mixed populations (Figure 2a). After high levels of vector production (6 or 7 days after adenovirus infection), the virus titer declined gradually possibly due to the cytotoxic effects of VSV-G protein. Experiments using different MOIs of AxCANCre indicated that an MOI of 10 reproducibly gave the highest titers, and this condition was employed thereafter. Since the structural analysis of PtG-S2 harboring pBab- eLPL-lacZ and of 3Y1 transduced with the stocks of the LacZ virus indicated that DNA recombination and virus production proceeded precisely as designed (see below), we next applied this system for p53 virus production.

Isolation of prepackaging cell lines from which p53 virus production can be induced To produce p53-expressing retrovirus vectors, we constructed pBabeLPL-p53 (Figure 1c), transfected it into PtG-S2, and isolated 168 clones of stable transformants by puromycin selection. Parallel cultures of these clones were infected with AxCANCre at an MOI of 10, and culture ﬂuids were collected 6 and 8 days after the introduction of Cre recombinase. The titers of the virus stocks were determined by transduction on to 3Y1 and counting of p53-producing cellular clones after immunocytochemical staining. Twelve cellular clones that produced virus stocks with higher titers than 1 × 104 IU/ml were selected; none produced p53-expressing retrovirus vectors before the introduction of Cre recombinase. We further selected four clones (C1, C58, C72 and D18) on the basis of reproducibility in virus induction and high virus-producing activity (C58; 4 × 104 IU/ml), though the induction kinetics of the vectors were variable among them (Figure 2b). These virus stocks could easily be concentrated by ultracentrifugation to 1 × 108 IU/ml.

Figure 3 Proviral DNA analysis by Southern blotting. (a) Chromosomal DNA was prepared from A48 before (−) or 5 days after (+) the introduction of Cre recombinase. As a control, chromosomal DNA of PtG-S2 lacZ1 (lacZ1), known to harbor four copies of proviral DNA per diploid, was also prepared. DNA samples were digested with KpnI, separated on 1.0% agarose gel, analyzed by Southern blotting using the LacZ probe shown in Figure 1b (10 ␮g per lane) and visualized by autoradiography. (b) Chromosomal DNA was prepared from C1, C58, C72, D18 and the parental PtG-S2 before (−) and 4 days after (+) the introduction of Cre recombinase, doubly digested with XbaI and KpnI and analyzed by Southern blotting using the p53 probe shown in Figure 1c, top panel (10 ␮g per lane). The same sets of chromosomal DNA were designed with KpnI and analyzed by Southern blotting using the gag probe shown in Figure 1c, bottom panel. (c) Autoradiogram of Southern blotting of KpnI digests of chromosomal DNA isolated from 3Y1(−) or virus-transduced 3Y1(+) (10 ␮g per lane). The genomic DNA was hybridized to the LacZ probe (left panel) or the p53 probe (right panel). Retrovirus vectors for cytotoxic genes MUiet al 1674 probe before or 5 days after the introduction of vectors with the designed structure were integrated into AxCANCre (Figure 3a). A single 5.9-kb band was the target cells. detected in the KpnI digests before the introduction of Cre recombinase, but the density of the band was drasti- Transduction of the p53 virus into several cell lines and cally reduced and a new 4.8-kb band appeared instead its biological effects after the introduction. This change in the size of the LacZ To test the biological activity of the p53-carrying virus fragment is consistent with the expected structural prepared here, a pair of growing cultures of either 3Y1 change accompanying Cre recombinase-mediated recom- (rat fibroblast) or U2-OS (originated from human bination between the two loxP sequences in pBabeLPL- osteosarcoma) was prepared and transduced with the lacZ, as illustrated in Figure 1b. By comparing the density p53 virus at an MOI of 10. In both cell lines, the entire of chromosomal DNA with that of control chromosomal populations of the transduced culture were shown to DNA from PtG-S2 lacZ18 harboring four copies of express p53 protein at high levels within 65 h as judged MFGnlslacZ per diploid, A48 was shown to contain a sin- by immunocytochemical staining using anti-p53 (human) gle copy of pBabeLPL-lacZ in the diploid cell before the antiserum (Figure 4 right panels) and no cells were introduction of Cre recombinase. After the introduction, unstained. The cell numbers of transduced cultures were the copy number increased to two to three copies per dip- much lower than those of cultures left untransduced, loid, as shown in Figure 3a. This result would indicate indicating that cell growth was strongly inhibited in the that the LacZ virus has propagated in the packaging cell transduced cultures. It was also clear that all the cells lines by 5 days after the introduction of Cre recombinase, transduced with the p53 virus exhibited a much flatter because VSV-G-pseudotyped virus was previously morphology than the untransduced cells (Figure 4, left shown to be fully infectious to VSV-G-expressing cells panels). Endogenous p53 expression in 3Y1 was not such as PtG-S2 into which Cre recombinase had been detectable because the antiserum is non-crossreactive to introduced.8 rat p53, while low level expression of endogenous p53 We next analyzed chromosomal DNA of C1, C58, C72 was detected in untransduced U2-OS. and D18 by Southern blotting to examine the structural When the amounts of human p53 protein in these cells changes in pBabeLPL-p53. Chromosomal DNA was iso- were analyzed by Western blotting using the same anti- lated before or 4 days after the introduction of p53 (human) antiserum, strong induction of p53 protein AxCANCre. The samples were doubly digested with was confirmed. The analysis of parallel cultures trans- KpnI and XbaI and analyzed with a p53 probe, or digested duced with p53 virus at an MOI of 1 indicated that the with KpnI and analyzed with a gag probe (Figure 1c). The p53 expression levels increased in a dose-dependent size changes observed by the p53 probe (2.5 kb to 3.4 kb) manner and further that the p53 expression level induced or by the gag probe (4.6 kb to 3.5 kb) are consistent with by UV irradiation was roughly equivalent to that induced the idea that Cre recombinase had excised the insertion by retrovirus transduction at an MOI of 1 (Figure 5). between the two loxP sequences by site-specific recombi- To assess the effects of p53 virus on cell growth more precisely, these two cell lines as well as PtG-S2, the par- nation. A comparison of the densities of the bands indi- ental prepackaging cell line originated from the human cates that the copy numbers were drastically increased fibrosarcoma cell line, HT1080, were transduced with this by the introduction of Cre recombinase in all the clones virus at an MOI of 10 and analyzed by flow cytometry (Figure 3b). In C1, we additionally detected an unexpec- after propidium iodide staining. All three cell lines trans- ted 3.3-kb band with either the p53 or gag probe before duced with p53 virus showed a marked decrease in the the introduction of Cre recombinase (Figure 3b, top and bottom panels), and found that it disappeared after the introduction. This result suggests that the C1 chromosome contains one copy of pBabeLPL-p53 which has an altered structure from that in the original plasmid and we eliminated this clone from further analysis. By chromosomal analysis of clone A48, or C58, we also showed that in pCALNdLG the loxP-specific recombination was almost completed by 4 days after the introduction of Cre recombinase (data not shown), as has also been shown for the parental strain PtG-S2. These chromosomal changes are consistent with the kinetics of LacZ virus or p53 virus production; the virus production was highest from 4 days after the introduction of Cre recombinase. To examine the integrated structures of transduced retrovirus vectors, LacZ virus or p53 virus was transduced into 3Y1 at an MOI of 10 or 3, respectively. Chromosomal DNA was isolated before or 3 days after the transduction, digested with KpnI, and analyzed by Southern blotting using LacZ or p53 probe. A single 4.8- Figure 4 Transduction of p53 vector into the entire cellular population. kb band was detected in the LacZ virus-transduced cells p53 vector was transduced into 3Y1 or U2-OS at an MOI of 10. Cells were fixed before and 3 days after the transduction and observed under a and a 3.5-kb band was detected in the p53 virus-trans- Normarski’s differential interference microscope after immunocytochem- duced cells (Figure 3c). These bands were not detected ical staining using monoclonal anti-p53 (human) IgG. The bar indi- before the virus transduction. Therefore only retrovirus cates 100 ␮m. Retrovirus vectors for cytotoxic genes MUiet al 1675 Discussion

We have presented here a unique system for the production of retrovirus vectors carrying cytotoxic or cytostatic genes. pBabeLPL can be employed as an inducible transcriptional unit for the vector RNA encoding an exogenous gene in an all-or-nothing manner using the Cre-loxP recombination system. We can select prepackaging cell lines without any production of vector RNA bear- ing the exogenous gene during the selection and sub- Figure 5 p53 expression in cells before and 3 days after the transduction of p53 virus at an MOI of 1 or 10. The parallel culture of logarithmically sequent passaging procedures. Even before the growing U2-OS was UV-irradiated using a 254-nm germicidal lamp at introduction of Cre recombinase, a part of the vector the dose of 20 J/m2 14 h before preparation. Cell lysates were prepared RNA with the puromycin resistance gene is transcribed under denaturing conditions, separated by SDS-PAGE (15 ␮g per lane) from the 5Ј-LTR of pBabeLPL and terminated by the SV and detected by Western blotting using murine monoclonal anti-p53 40 poly(A) addition signal. In the culture medium of PtG- (human) IgG. S2 derivatives such as A48, B19, C1, C58, C72 and D18, however, we have never detected any vector particles transmitting puro resistancy to 3Y1 (our unpublished result) either before or after the introduction of Cre Table 1 Effects of p53 virus or control MFGnlslacZ on the cell cycle distribution recombinase. While the Cre-loxP recombination system was used here for the induction of the cytotoxic exogen- Cell line Virus Cell cycle distribution (%) ous genes, it has also been used in the context of retrovirus-mediated gene transfer for the generation of self- 16,17 G0-G1 S G2-M deleting vectors, for the removal of proviral marker genes,18–20 and for the exchange of the exogenous genes 21 3Y1 LacZ 27.73 45.67 26.60 in a packaging cell line. p53 50.26 30.06 19.68 In our system, induction of both the X gene in pBab- U2-OS LacZ 36.82 43.47 19.71 eLPL-X and the VSV-G gene in pCALNdLG is mediated p53 59.64 19.70 20.66 through Cre-loxP recombination. While site-specific PtG-S2 LacZ 31.01 24.66 44.33 recombination by Cre recombinase has been reported to p53 59.08 9.63 31.29 be quite rare if the two loxP sequences are distantly located in the same chromosome or located in different chromosome,22 it is theoretically possible for the site-specific recombination to occur between the loxP sequences in pBabeLPL-X and pCALNdLG. However, we did not proportion of cells in S phase and a significant increase detect any of the bands that would be expected from such in the proportion of cells in G1 phase (Figure 6, Table 1), recombinations (Figure 3b), even in an autoradiogram of when compared with control cultures transduced with the same gel exposed for 10 times longer (our unpub- LacZ virus at an MOI of 10, as well as untransduced cul- lished results). Such recombinations would generate a tures (data not shown). These results indicate the structure, 5Ј-LTR-loxP-VSV-G-poly(A) addition signal, expression of p53 results in the G1 arrest of these cell which could be further converted to produce packageable lines at the G1-S transition. and transmissible transcripts after a single non-homolo-

Figure 6 Cell cycle analysis of 3Y1, U2-OS and PtG-S2 transduced with either p53 virus or control MFGnlslacZ at an MOI of 10. Cells were harvested 60 h after the transduction with p53 virus or control MFGnlslacZ, stained with propidium iodide and analyzed by flow cytometry. Retrovirus vectors for cytotoxic genes MUiet al 1676 gous recombination. We have carefully checked whether VSV-G gene (Indiana serotype) that is silent before the such particles that can transmit the VSV-G gene were introduction of Cre recombinase), 3Y1 (rat fibroblast) and present in our virus stocks, but we were not able to detect U2-OS (human osteosarcoma) were maintained in Dul- such particles at all in 5 × 106 IU of the vectors. Therefore, becco’s modified Eagle’s medium (DMEM) (high glucose) such recombination was negligible, at least at 5–6 days supplemented with 10% fetal calf serum and kept at after the introduction of Cre recombinase. The proviral 37°C. PtG-S2 and its derivatives were grown in the pres- DNA analysis further confirmed that only DNA forms ence of 4 ␮g of blasticidin S (Funakoshi, Tokyo, Japan) with the designed structure were transmittable to the and 1 mg of G418 (Gibco-BRL) per milliliter. Drug selec- transductants. tion for the transfected PtG-S2 was performed with 2 ␮g Using this retrovirus production system, we have suc- of puromycin (Sigma, St Louis, MO, USA) per ml. ceeded in generating stable packaging cell lines which can produce high-titer p53-expressing VSV-G-pseudo- DNA transfection and cloning of the transfectants typed retrovirus vector. When this vector was transduced PtG-S2 was seeded at 2 × 106 cells/100-mm diameter into 3Y1, U2-OS and PtG-S2 at an MOI of 10, exogenous dish, kept for 1 day and transfected with either pBab- p53 expression was induced in all the cells at quite high eLPL-lacZ or pBabeLPL-p53 (4 ␮g) by the use of Lipofec- levels and essentially none of the cells in the entire cul- tamine Plus Reagent (Gibco-BRL). Two days after the ture escaped transduction. Therefore this system should transfection, the cultures were split at several ratios, and permit us to examine the effect of introducing cytotoxic puromycin (final concentration, 2 ␮g/ml) was added to genes into an entire cellular population without any prior the medium 3 or 4 days after the transfection to select selection. Since the transduction of the p53-carrying virus stable transfectants. Puromycin-resistant colonies were into the parental prepackaging cell line, PtG-S2, induced picked up with cloning cylinders and propagated. cell cycle arrest (Figure 6, Table 1), a stable cell line which constitutively expresses p53 should not be established. Adenovirus vector infection for pseudotyped retrovirus Due to its widespread alterations in malignant cells production and its central position in both proliferation arrest and PtG-S2 and its derivatives were kept at 37°C, seeded at apoptosis induction, p53 has been the most investigated 7.5 × 105 cells per 100-mm diameter dish, kept for 1 day gene for cancer gene therapy.23–28 In most experiments, and infected with AxCANCre at a multiplicity of infec- gene transfer efficiencies have been below 100%,29 so the tion (MOI) of 10. G418 and puromycin were removed antitumoral effect of p53 relies strongly on ‘by-stander from the culture medium just before the AxCANCre killing’ effects.24,27,30,31 In contrast by using the VSV-G- infection. From two days after the adenovirus infection, pseudotyped retrovirus vectors developed here, it should the cultures were kept at 32°C to obtain a slightly more be possible to transduce exogenous genes into the entire stable production of VSV-G-pseudotypes. The medium population of monolayer cultures originated from human was changed every day and at each medium change, cell lines (Figure 4a), even if the exogenous genes are retrovirus vector stocks were recovered. cytostatic or cytotoxic, like p53. Southern blot analysis Total chromosomal DNA was prepared using standard Materials and methods techniques from PtG-S2, 3Y1 and their derivatives. The digested DNA was separated on 1.0% agarose gel and Plasmid construction transferred to a nylon membrane (Hybond N+; Amer- The 1.0-kb SaII–ClaI fragment (carrying an internal pro- sham, Buckinghamshire, UK) by the capillary transfer moter and the puro gene) of pBabe puro32 (a kind gift method. The 3.1-kb LacZ probe was isolated from from Dr H Land, Imperial Cancer Research Fund) was pMFGnlslacZ by BamHI digestion. The 1.8-kb p53 probe deleted and replaced with the linker oligonucleotides (5Ј was isolated from pCMV-NEO-BAM-p53 by BamHI TCGACGCAGATCTCACGTGATTTAAATAT 3Ј and 5Ј digestion. The 0.7-kb gag probe was isolated from pBabe CGATATTTAAATCACGTGAGATCTGCG 3Ј) to gener- by SpeI and BamHI digestion. The probes were labeled ate pBabe. The 1.1-kb HindIII–BamHI fragment carrying with 32P-␣-CTP by using the RTS RadPrime DNA Labe- the puro gene and SV 40 poly(A) addition signal was ling System (Gibco-BRL), hybridized and detected by excised from pPUR (Gibco-BRL, Rockville, MD, USA) autoradiography. and ligated into the 2.5-kb HindIII–BamHI fragment of pBS246 (Gibco-BRL) that is flanked with loxP sequences Protein analysis at both ends. The 1.2-kb loxP-puro-SV 40 poly(A)-loxP For Western blot analysis, cellular lysates were prepared fragment was excised from the generated plasmid by under denaturing conditions and separated by sodium digesting with both EcoRI and ScaI, blunt-ended with dodecyl sulfate-10% polyacrylamide gel electrophoresis. Klenow fragment, and inserted into the unique SnaBI site The gels were transferred on to polyvinylidene difluoride of pBabe to generate pBabeLPL. The BamHI fragment membrane (Immobilon; Millipore, Bedford, MA, USA) encoding the entire nlslacZ or p53 was excised from with a semi-dry electroblotter. Filters were immunoblot- pMFGnlslacZ33 or pCMV-NEO-BAM-p5323 and inserted ted first with monoclonal anti-p53 (human) IgG (Pab into the unique BgIII site of pBabeLPL to generate pBab- 1801; Santa Cruz, Santa Cruz, CA, USA) that is non-cross- eLPL-lacZ and pBabeLPL-p53, respectively. reactive to either mouse or rat p53 and then with anti- mouse IgG horseradish peroxidase-linked whole anti- Cell lines body (Amersham). Protein bands were detected with an The prepackaging cell line PtG-S28 (a derivative of ECL kit (Amersham). For immunocytochemical staining, human fibrosarcoma cell line HT1080, which carries the cells were fixed with PBS containing 2% paraformal- gag and pol genes from Moloney MLV (MoMLV) and a dehyde and 0.1% Triton X-100 at 4°C for 15 min and Retrovirus vectors for cytotoxic genes MUiet al 1677 reacted with monoclonal anti-p53 (human) IgG (DO-1; 8 Arai T et al. A new system for stringent, high-titer vesicular Santa Cruz), which is non-crossreactive to either mouse stomatitis virus G protein-pseudotyped retrovirus vector induc- or rat p53. p53-producing cells were visualized using tion by introduction of Cre recombinase into stable prepackag- biotinylated anti-mouse IgG and a Vectastain ABC kit ing cell lines. J Virol 1998; 72: 1115–1121. (Vector, Burlingame, CA, USA). 9 Yang Y et al. Inducible, high-level production of infectious murine leukemia retroviral vector particles pseudotyped with vesicular stomatitis virus G envelope protein. Hum Gene Ther Retrovirus transduction and titration 1995; 6: 1203–1213. For the titration of VSV-G-pseudotyped retrovirus vec- 10 Chen ST et al. Generation of packaging cell lines for pseudo- tors, the indicator cell line 3Y1 was plated at 7.5 × 102– typed retroviral vectors of the G protein of vesicular stomatitis 1.5 × 103 cells per well in 96-well plates and kept for 1 virus by using a modified tetracycline inducible system. Proc day before transduction. For transduction, cells were Natl Acad Sci USA 1996; 93: 10057–10062. incubated with serial dilutions of virus supernatants in 11 Ory DS, Neugeboren BA, Mulligan RC. A stable human-derived the presence of 8 ␮g/ml polybrene (Sigma) and kept for packaging cell line for production of high titer a further 3 days. For X-gal staining transduced 3Y1 was retrovirus/vesicular stomatitis virus G pseudotypes. Proc Natl fixed with 1.25% glutaraldehyde and stained with 5 mm Acad Sci USA 1996; 93: 11400–11406. 12 Estreicher A, Iggo R, Roth JA. Retrovirus-mediated p53 gene K4[Fe(CN)6], 5 mm K3[Fe(CN)6], 2 mm MgCl2 and ␤ therapy. Nature Med 1996; 2: 1163. 1 mg/ml X-gal (5-bromo-4-chloro-3-indolyl- -d-galacto- 13 Kanegae Y et al. Efficient gene activation in mammalian cells by pyranoside) (Wako, Osaka, Japan) for more than 4 h. The using recombinant adenovirus expressing site-specific Cre numbers of cellular clones with blue-stained nuclei were recombinase. Nucleic Acids Res 1995; 23: 3816–3821. counted. Expression of p53 (human) protein was evalu- 14 Kanegae Y et al. Efficient gene activation system on mammalian ated by immunocytochemical staining using monoclonal cell chromosomes using recombinant adenovirus producing Cre anti-p53 (human) IgG (DO-1; Santa Cruz) and visualized recombinase. Gene 1996; 181: 207–212. as described above. The numbers of cellular clones with 15 Niwa H, Yamamura K, Miyazaki J. Efficient selection for high- brown-stained nuclei were counted. expression transfectants with a novel eukaryotic vector. Gene 1991; 108: 193–200. Cell cycle analysis 16 Choulika A, Guyot V, Nicolas JF. Transfer of single gene-containing long terminal repeats into the genome of mammalian Cells were trypsinized, fixed with 90% ethanol and resus- cells by a retroviral vector carrying the cre gene and the loxP pended in PBS solution containing 2 mg/ml of Rnase A ␮ site. J Virol 1996; 70: 1792–1798. (Sigma) and 50 g/ml of propidium iodide (Sigma). The 17 Russ AP, Friedel C, Grez M, von Melchner H. Self-deleting stained cells were analyzed in a fluorescence-activated retrovirus vectors for gene therapy. J Virol 1996; 70: 4927–4932. cell sorter (FACScan; Becton Dickinson, Franklin Lakes, 18 Bergemann J et al. Excision of specific DNA sequences from inte- NJ, USA). The percentages of cells in various cell cycle grated retroviral vectors via site-specific recombination. Nucleic phases were determined by using the CellQuest and Acids Res 1995; 23: 4451–4456. ModFit program. 19 Fernex C, Dubreuil P, Mannoni P, Bagnis C. Cre/loxP-mediated excision of a neomycin resistance expression unit from an integrated retroviral vector increases long terminal repeat-driven Acknowledgements transcription in human hematopoietic cells. J Virol 1997; 71: 7533–7540. We thank Yuriko Yoshikawa for assistance in preparing 20 Wildner O et al. Generation of a conditionally neor-containing the manuscript. This work was supported in part by retroviral producer cell line: effects of neor on retroviral titer grants and endowments from Eisai Co, Ltd, and by a and transgene expression. Gene Therapy 1998; 5: 684–691. Grant-in-Aid for Scientific Research on Priority Areas 21 Vanin EF et al. Development of high-titer retroviral producer from the Ministry of Education, Science and Culture, cell lines by using Cre-mediated recombination. J Virol 1997; 71: Japan. 7820–7826. 22 van Deursen J, Fornerdo M, van Rees B, Grosveld G. Cre- mediated site- specific translocation between nonhomologous References mouse chromosomes. Proc Natl Acad Sci USA 1995; 92: 7376– 7380. 1 Miller AD. Human gene therapy comes of age. Nature 1992; 357: 23 Baker SJ et al. Suppression of human colorectal carcinoma cell 455–460. growth by wild-type p53. Science 1990; 249: 912–915. 2 Mulligan RC. The basic science of gene therapy. Science 1993; 24 Cai DW et al. Stable expression of the wild-type p53 gene in 260: 926–932. human lung cancer cells after retrovirus-mediated gene transfer. 3 Vile R, Russell SJ. Gene transfer technologies for the gene ther- Hum Gene Ther 1993; 4: 617–624. apy of cancer. Gene Therapy 1994; 1: 88–98. et al 4 Burns JC et al. Vesicular stomatitis virus G glycoprotein pseudo- 25 Fujiwara T . A retroviral wild-type p53 expression vector typed retroviral vectors: concentration to very high titer and penetrates human lung cancer spheroids and inhibits growth by efficient gene transfer into mammalian and nonmammalian inducing apoptosis. Cancer Res 1993; 53: 4129–4133. cells. Proc Natl Acad Sci USA 1993; 90: 8033–8037. 26 Fujiwara T et al. Therapeutic effect of a retroviral wild-type p53 5 Yee JK et al. A general method for the generation of high-titer, expression vector in an orthotopic lung cancer model. J Natl pantropic retroviral vectors: highly efficient infection of primary Cancer Inst 1994; 86: 1458–1462. hepatocytes. Proc Natl Acad Sci USA 1994; 91: 9564–9568. 27 Xu M et al. Parenteral gene therapy with p53 inhibits human 6 Matsubara T et al. Pantropic retroviral vectors integrate and breast tumors in vivo through a bystander mechanism without express in cells of the malaria mosquito, Anopheles gambiae. Proc evidence of toxicity. Hum Gene Ther 1997; 8: 177–185. Natl Acad Sci USA 1996; 93: 6181–6185. 28 Favrot M, Coll JL, Louis N, Negoescu A. Cell death and cancer: 7 Sharma S, Cantwell M, Kipps TJ, Friedmann T. Efficient infec- replacement of apoptotic genes and inactivation of death sup- tion of a human T cell line and of human primary peripheral pressor genes in therapy. Gene Therapy 1998; 5: 728–739. blood leukocytes with a pseudotyped retrovirus vector. Proc 29 Polyak K et al. Genetic determinants of p53-induced apoptosis Natl Acad Sci USA 1996; 93: 11842–11847. and growth arrest. Genes Dev 1996; 10: 1945–1952. Retrovirus vectors for cytotoxic genes MUiet al 1678 30 Freeman SM et al. The ‘bystander effect’: tumor regression when high titre retroviral vectors with multiple drug selection mark- a fraction of the tumor mass is genetically modified. Cancer Res ers and a complementary helper-free packaging cell line. Nucleic 1993; 53: 5274–5283. Acids Res 1990; 18: 3587–3596. 31 Mesnil M et al. Bystander killing of cancer cells by herpes sim- 33 Dranoff G et al. Vaccination with irradiated tumor cells engine- plex virus thymidine kinase gene is mediated by connexins. Proc ered to secrete murine granulocyte–macrophage colony-stimul- Natl Acad Sci USA 1996; 93: 1831–1835. ating factor stimulates potent, specific, and long-lasting anti- 32 Morgenstern JP, Land H. Advanced mammalian gene transfer: tumor immunity. Proc Natl Acad Sci USA 1993; 90: 3539–3543.