An Episomal Expression Vector for Screening Mutant Gene Libraries in Pichia Pastoris

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Plasmid 54 (2005) 80–85 www.elsevier.com/locate/yplas Short communication An episomal expression vector for screening mutant gene libraries in Pichia pastoris Charles C. Lee*, Tina G. Williams, Dominic W.S. Wong, George H. Robertson USDA-ARS-WRRC, 800 Buchanan St., Albany, CA 94710, USA Received 7 October 2004, revised 6 December 2004 Available online 20 January 2005 Communicated by Manuel Espinosa Abstract Screening mutant gene libraries for isolating improved enzyme variants is a powerful technique that benefits from effective and reliable biological expression systems. Pichia pastoris is a very useful organism to express proteins that are inactive in other hosts such as Escherichia coli and Saccharomyces cerevisiae. However, most P. pastoris expression plasmids are designed to integrate into the host chromosome and hence are not as amenable to high-throughput screen- ing projects. We have designed a P. pastoris expression vector, pBGP1, incorporating an autonomous replication sequence that allows the plasmid to exist as an episomal element. This vector contains the a-factor signal sequence to direct secretion of the mutant enzymes. Expression of the genes is driven by the constitutive GAP promoter, thus eliminating the need for timed or cell density-specific inductions. The pBGP1 plasmid was used to screen a xylanase gene library to isolate higher activity mutants. Published by Elsevier Inc. Keywords: Pichia pastoris; Episomal expression vector 1. Introduction formed with libraries of randomly mutated genes encoding the enzyme of interest (Cohen et al., There are many efforts directed at improving 2001). Clones that demonstrate an increased activ- enzymes involved in industrial processes in order ity relative to wild type can be isolated and further to increase cost and energy efficiency. One of the characterized. most promising methods to obtain better enzymes In order to screen a library for increased activ- is to screen microorganisms that have been trans- ity, it is critical to develop an effective expression system. It is desirable to have an expression vector * Corresponding author. Fax: +1 510 559 5940. that will direct secretion of the enzyme into the E-mail address: [email protected] growth media. This allows for the rapid assaying 0147-619X/$ - see front matter. Published by Elsevier Inc. doi:10.1016/j.plasmid.2004.12.001 Short communication / Plasmid 54 (2005) 80–85 81 of the enzyme activity without the need to release contrast, an episome could be isolated by a simple the protein by cell lysis or osmotic shock. Secreted plasmid preparation procedure. enzymes are often also easier to purify because of In this report, we describe the construction of a the relatively low levels of contaminating cellular new P. pastoris expression vector for screening proteins. mutant gene libraries. The plasmid contains both The most common host organisms used for bacterial and P. pastoris autonomous replication screening libraries are the bacterium Escherichia sequences that allow the vector to exist as an coli and the yeast Saccharomyces cerevisiae. E. coli episome. A zeocin-resistance gene permits selection is popular because of its rapid growth and high of the plasmid in P. pastoris. We demonstrate the transformation efficiency. However, many pro- utility of the plasmid by screening a library contain- teins, especially those of eukaryotic origin, ex- ing mutant gene variants of a xylanase enzyme that pressed in E. coli are not active due to improper was not active in either E. coli or S. cerevisiae host. folding and/or lack of necessary post-translational modifications, such as glycosylation and signal 1.1. Strains, growth media, and enzymes sequence processing. S. cerevisiae does have the cellular machinery to modify enzymes post-transl- Escherichia coli bacterial strain JM109 ationally, so this yeast often succeeds where the (Promega, Madison, WI) was cultured in Luria– bacterium fails (Dean, 1999; Strahl-Bolsinger Bertani broth (1% tryptone, 0.5% yeast extract, et al., 1999). Unfortunately, some proteins ex- and 1% sodium chloride) supplemented with pressed in S. cerevisiae are hyperglycosylated, a ampicillin (50 lg/ml) when appropriate. The condition that can also result in loss of activity P. pastoris yeast strain GS115 (Invitrogen, Carls- (Eckart and Bussineau, 1996). bad, CA) was cultured on YPD (1% yeast extract, Another host that has been used successfully 2% peptone, and 2% glucose) supplemented with when both E. coli and S. cerevisiae have failed is zeocin (100 lg/ml) when appropriate. YPDS Pichia pastoris. This methylotrophic yeast has the (YPD containing 1 M sorbitol) was used when plat- capacity to grow to very high densities and can ing yeast that were transformed by electroporation. produce large amounts of protein (Cereghino For solid media, 1.5 and 2% agar were used for the and Cregg, 2000). Although P. pastoris also post- bacterial and yeast media, respectively. translationally modifies expressed enzymes, it does All media components were manufactured by not tend to hyperglycosylate proteins as is the case Becton–Dickinson (Sparks, MD), and all enzymes with S. cerevisiae (Bretthauer and Castellino, were purchased from New England Biolabs 1999). (Beverly, MA) unless otherwise noted. One difficulty with using P. pastoris as a host to screen mutant libraries is that most P. pastoris 1.2. pBGP1 plasmid construction expression vectors are designed to integrate into the host chromosome. These vectors do not con- The first PCR was conducted using PfuTurbo tain an autonomous replication sequence and thus polymerase (Stratagene, La Jolla, CA), pBlue- cannot exist as episomal (i.e., replicative) plasmids. script-KS plasmid template (Stratagene), and the Instead, the vectors must be linearized, trans- primers BS938 and BS2958 to isolate a 2021 bp formed into P. pastoris, and then integrated into fragment containing the ampicillin-resistance gene the yeast chromosome. This feature of such vec- and the bacterial ColE1 origin of DNA replica- tors makes screening of the libraries more labori- tion. The second PCR employed PfuTurbo ous. First, linearized DNA does not transform as polymerase, pGAPZaA vector template (Invitro- efficiently as circular DNA, so there are fewer gen), and the primers GAP1 and GAP2405 to clones from the library that are available for anal- produce a 2405 bp fragment containing the ysis. In addition, when the clone is inserted into glyceraldehyde-3-phosphate dehydrogenase gene the host chromosome, it is much more difficult to (GAP) promoter, the a-factor secretion signal, extract for further analysis and manipulations. In and the zeocin-resistance gene. The products of 82 Short communication / Plasmid 54 (2005) 80–85 both PCRs were digested with SpeI and HindIII G1510A, T1606C, C2114G, add G at 897, add A restriction enzymes and ligated using T4 DNA li- at 1479, add C at 1517, add G at 2106, and remove gase to produce the pBS-GAP vector. extra G at 2099. A third PCR was conducted using PfuTurbo Primer sequences (restriction enzyme site used): polymerase, pYM8 plasmid template (Cregg et al., 1985), and the primers PARS1-FC and BS938: gcgaagcttacgtatgcactgcagctcactgcccgctttcc PARS1-RA to generate a 187 bp fragment con- agt (HindIII); taining the P. pastoris autonomous replication se- BS2958: gcgactagtgcacttttcggggaaatgtgcg (SpeI); quence (PARS1). The product of this PCR and GAP1: gcgactagtagatcttttttgtagaaatgtcttggtgtcctc pBS-GAP vector were digested with PstI and Hin- (SpeI); dIII restriction enzymes and ligated with T4 DNA GAP2405: gcgaagcttagcttgcaaattaaagccttcgagc ligase to produce the pBGP1 episomal expression (HindIII); vector. PARS1-FC: cgactgcagtcgagataagctgggggaacattcg The entire pBGP1 plasmid was sequenced and (PstI); compared to the predicted sequence. Multiple dis- PARS1-RA: ctgggatccaagcttcgacaattaatatttacttatt crepancies were detected in the region that origi- ttggtcaaccc (HindIII). nated from the pGAPZaA expression vector. To investigate this issue, the original pGAPZaA vec- tor provided by Invitrogen was sequenced. It was 1.3. Features of the pBGP1 expression vector discovered that the discrepancies were present in the pGAPZaA vector. Thus, there are errors in The pBGP1 plasmid was designed with several the pGAPZaA vector sequence data file available features to serve as an episomal expression plas- on the Invitrogen web site (www.invitrogen.com). mid (Fig. 1). The P. pastoris autonomous replicat- These errors do not occur in any protein-coding ing sequence (PARS1) permitted the maintenance sequences and do not impact the functionality of of the plasmid without chromosomal integration either the pGAPZaA or the pBGP1 expression in the yeast (Cregg et al., 1985). The bacterial vectors. Corrections that should be incorporated colE1 origin of DNA replication was also included into the pGAPZaA vector sequence file are as fol- to allow the maintenance of the plasmid in E. coli. lows: T1348C, A1493G, G1494A, A1509G, Fig. 1. pBGP1 expression vector. pGAP, GAP promoter; a-factor, secretion signal peptide; MCS, multiple cloning site derived from pGAPZaA plasmid; zeoR, zeocin-resistance gene; PARS1, P. pastoris autonomous replication sequence; colE1, bacterial replication sequence; and ampR, ampicillin-resistance gene. Short communication / Plasmid 54 (2005) 80–85 83 A signal sequence derived from the S. cerevisiae E. coli, we chose to include the ampicillin-resis- a-factor gene was included upstream of the multi- tance gene (ampR) because the ampicillin antibi- ple cloning site (MCS). Genes that are
Recommended publications
  • Gene Therapy Glossary of Terms

    Gene Therapy Glossary of Terms

    GENE THERAPY GLOSSARY OF TERMS A • Phase 3: A phase of research to describe clinical trials • Allele: one of two or more alternative forms of a gene that that gather more information about a drug’s safety and arise by mutation and are found at the same place on a effectiveness by studying different populations and chromosome. different dosages and by using the drug in combination • Adeno-Associated Virus: A single stranded DNA virus that has with other drugs. These studies typically involve more not been found to cause disease in humans. This type of virus participants.7 is the most frequently used in gene therapy.1 • Phase 4: A phase of research to describe clinical trials • Adenovirus: A member of a family of viruses that can cause occurring after FDA has approved a drug for marketing. infections in the respiratory tract, eye, and gastrointestinal They include post market requirement and commitment tract. studies that are required of or agreed to by the study • Adeno-Associated Virus Vector: Adeno viruses used as sponsor. These trials gather additional information about a vehicles for genes, whose core genetic material has been drug’s safety, efficacy, or optimal use.8 removed and replaced by the FVIII- or FIX-gene • Codon: a sequence of three nucleotides in DNA or RNA • Amino Acids: building block of a protein that gives instructions to add a specific amino acid to an • Antibody: a protein produced by immune cells called B-cells elongating protein in response to a foreign molecule; acts by binding to the • CRISPR: a family of DNA sequences that can be cleaved by molecule and often making it inactive or targeting it for specific enzymes, and therefore serve as a guide to cut out destruction and insert genes.
  • Lecture 3 Types, Biology and Salient Features of Vectors in Recombinant

    Lecture 3 Types, Biology and Salient Features of Vectors in Recombinant

    NPTEL – Bio Technology – Genetic Engineering & Applications MODULE 1- LECTURE 3 TYPES, BIOLOGY AND SALIENT FEATURES OF VECTORS IN RECOMBINANT DNA TECHNOLOGY – PLASMID 1-3.1 Introduction: DNA molecule used for carrying an exogenous DNA into a host organism and facilitates stable integration and replication inside the host system is termed as Vector. Molecular cloning involves series of sequential steps which includes restriction digestion of DNA fragments both target DNA and vector, ligation of the target DNA with the vector and introduction into a host organism for multiplication. Then the fragments resulted after digestion with restriction enzymes are ligated to other DNA molecules that serve as vectors. In general, vectors should have following characteristics: • Capable of replicating inside the host. • Have compatible restriction site for insertion of DNA molecule (insert). • Capable of autonomous replication inside the host (ori site). • Smaller in size and able to incorporate larger insert size. • Have a selectable marker for screening of recombinant organism. 1-3.2 Plasmids: • Plasmids are naturally occurring extra chromosomal double-stranded circular DNA molecules which can autonomously replicate inside bacterial cells. Plasmids range in size from about 1.0 kb to over 250 kb. • Plasmids encode only few proteins required for their own replication (replication proteins) and these proteins encoding genes are located very close to the ori. All the other proteins required for replication, e.g. DNA polymerases, DNA ligase, helicase, etc., are provided by the host cell.Thus, only a small region surrounding Joint initiative of IITs and IISc – Funded by MHRD Page 28 of 84 NPTEL – Bio Technology – Genetic Engineering & Applications the ori site is required for replication.
  • Molecular Biology and Applied Genetics

    Molecular Biology and Applied Genetics

    MOLECULAR BIOLOGY AND APPLIED GENETICS FOR Medical Laboratory Technology Students Upgraded Lecture Note Series Mohammed Awole Adem Jimma University MOLECULAR BIOLOGY AND APPLIED GENETICS For Medical Laboratory Technician Students Lecture Note Series Mohammed Awole Adem Upgraded - 2006 In collaboration with The Carter Center (EPHTI) and The Federal Democratic Republic of Ethiopia Ministry of Education and Ministry of Health Jimma University PREFACE The problem faced today in the learning and teaching of Applied Genetics and Molecular Biology for laboratory technologists in universities, colleges andhealth institutions primarily from the unavailability of textbooks that focus on the needs of Ethiopian students. This lecture note has been prepared with the primary aim of alleviating the problems encountered in the teaching of Medical Applied Genetics and Molecular Biology course and in minimizing discrepancies prevailing among the different teaching and training health institutions. It can also be used in teaching any introductory course on medical Applied Genetics and Molecular Biology and as a reference material. This lecture note is specifically designed for medical laboratory technologists, and includes only those areas of molecular cell biology and Applied Genetics relevant to degree-level understanding of modern laboratory technology. Since genetics is prerequisite course to molecular biology, the lecture note starts with Genetics i followed by Molecular Biology. It provides students with molecular background to enable them to understand and critically analyze recent advances in laboratory sciences. Finally, it contains a glossary, which summarizes important terminologies used in the text. Each chapter begins by specific learning objectives and at the end of each chapter review questions are also included.
  • Regulation of Transgene Expression in Genetic Immunization

    Regulation of Transgene Expression in Genetic Immunization

    Brazilian Journal of Medical and Biological Research (1999) 32: 155-162 Regulation of transgene expression 155 ISSN 0100-879X Regulation of transgene expression in genetic immunization J.S. Harms1, 1Department of Animal Health and Biomedical Sciences, University of Wisconsin, S.C. Oliveira2 Madison, WI, USA and G.A. Splitter1 2Departamento de Bioquímica e Imunologia, Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brasil Abstract Correspondence The use of mammalian gene expression vectors has become increas- Key words J.S. Harms ingly important for genetic immunization and gene therapy as well as · DNA vaccine AHABS basic research. Essential for the success of these vectors in genetic · Gene therapy 1655 Linden Drive · immunization is the proper choice of a promoter linked to the antigen Regulation Madison, WI 53706 · Transcription of interest. Many genetic immunization vectors use promoter elements USA · Transgene Fax: +1-608-262-7420 from pathogenic viruses including SV40 and CMV. Lymphokines E-mail: [email protected] produced by the immune response to proteins expressed by these vectors could inhibit further transcription initiation by viral promot- Research supported by the Robert ers. Our objective was to determine the effect of IFN-g on transgene Draper Technology Innovation Fund expression driven by viral SV40 or CMV promoter/enhancer and the (No. 135-0546) of the University mammalian promoter/enhancer for the major histocompatibility com- of Wisconsin, Madison. plex class I (MHC I) gene. We transfected the luciferase gene driven Presented at the International by these three promoters into 14 cell lines of many tissues and several Symposium “The Third Revolution species.
  • RNA Viruses As Tools in Gene Therapy and Vaccine Development

    RNA Viruses As Tools in Gene Therapy and Vaccine Development

    G C A T T A C G G C A T genes Review RNA Viruses as Tools in Gene Therapy and Vaccine Development Kenneth Lundstrom PanTherapeutics, Rte de Lavaux 49, CH1095 Lutry, Switzerland; [email protected]; Tel.: +41-79-776-6351 Received: 31 January 2019; Accepted: 21 February 2019; Published: 1 March 2019 Abstract: RNA viruses have been subjected to substantial engineering efforts to support gene therapy applications and vaccine development. Typically, retroviruses, lentiviruses, alphaviruses, flaviviruses rhabdoviruses, measles viruses, Newcastle disease viruses, and picornaviruses have been employed as expression vectors for treatment of various diseases including different types of cancers, hemophilia, and infectious diseases. Moreover, vaccination with viral vectors has evaluated immunogenicity against infectious agents and protection against challenges with pathogenic organisms. Several preclinical studies in animal models have confirmed both immune responses and protection against lethal challenges. Similarly, administration of RNA viral vectors in animals implanted with tumor xenografts resulted in tumor regression and prolonged survival, and in some cases complete tumor clearance. Based on preclinical results, clinical trials have been conducted to establish the safety of RNA virus delivery. Moreover, stem cell-based lentiviral therapy provided life-long production of factor VIII potentially generating a cure for hemophilia A. Several clinical trials on cancer patients have generated anti-tumor activity, prolonged survival, and
  • Clone the Unclonable – Vectors and Cells to Capture and Express Problematic Dnas

    Clone the Unclonable – Vectors and Cells to Capture and Express Problematic Dnas

    Clone the Unclonable – Vectors and Cells to Capture and Express Problematic DNAs Ron Godiska, Ph.D. May, 2016 Agenda Improve Cloning and Expression of Problematic DNA • What makes DNA difficult to clone or express? • Circular vectors for difficult DNAs • Linear vectors for “impossible” DNAs • Enzyme-free cloning and compatible protein expression vectors • E. coli strains for toxic recombinant proteins or unstable DNA What is Unclonable DNA? Characteristics of Difficult DNA • Toxic coding sequences • Promoters • A-T Rich DNA • Large fragments (>10 kb) • Trace amounts Which types of difficult DNA have you worked with in the lab? Common Vector Traits Cause Cloning Problems Vector driven transcription into the insert – Deleterious expression – Destabilize 2o structure Insert driven transcription out into the vector – False negatives (blue or lethal) – Transcriptional interference pUC19 – Replication interference High copy number – Increased effect of the above issues – Active origin – Many copies/cell Supercoiling – Deletion of secondary structures CloneSmart® Technology “Silencing” DNA Inserts to Improve Cloning • No Transcriptional Interference – Stably maintain “unclonable” DNA • No blue/white screening – No false positives/negatives • Minimal vector size • Variable copy number • Variety of drug selection markers • Very low empty-vector background U.S. Patent 6,709,861 pSMART Vectors Clone Toxic Inserts and Promoters Test DNA Fragments: • RNase coding sequence (350 bp; no promoter) • Phage Lambda PR Promoter (400 bp) pSMART Vectors cDNA Clones are More Stable Deletion Rates: <1% in pSMART HC Kan vs. 32% in pUC % Deleted Clones Insert Size (kb) • Teleost fish cDNA library • Clones were grown in liquid medium, diluted, and regrown • Each final culture was diluted, plated, and grown up into individual colonies • Plasmid DNA was isolated from colonies for each clone and analyzed - Oleksiak M.F., Crawford D.L., 2001.
  • Important Vector Factors for Gene Expression Technical Reference Guide

    Important Vector Factors for Gene Expression Technical Reference Guide

    BioResearch Important Vector Factors for Gene Expression Technical Reference Guide vectors expressing the same luciferase gene in different backbones and expression cassettes and obtained highly discriminative expres- sion levels. In this guideline, we show the most important aspects to be considered when choosing an expression vector and their impact on your experimental results. 1. Promoter Strength Introduction Is your promoter appropriate for the cell type that you are working with? Our Scientific Support Team is commonly asked: “Why don’t I get the Table 1 describes the promoter strengths as a relative percent of the same expression level of my gene if I use various vector backbones?” strength of the CMV promoter for various cells for which Lonza has There are many components to a vector that can have an effect on the Optimized Protocols. The CMV promoter activity is set to 100% based level of gene expression. Below you will find the 10 most important on their CAT assay values from the referenced publications. Although factors to consider when looking at vectors. CMV is a strong promoter in many mammalian cells, another promoter The selection of an appropriate expression vector is crucial for efficient may give stronger expression in your cells (e.g., promoter SV40 in gene expression. Just take a look at Figure 1. We tried 10 different BHK-21 cells). n 1600 1400 1200 1000 800 [% of pGL3-CMV at 24 h] 24 at pGL3-CMV [% of 600 400 Relative luciferase-expressio Relative 200 0 Control Program Only pGL3-Control pGL3-CMV pmax Cloning™ pSG5 pcDNA3.1 pFP pIRES-MCS B pcDNA4 HisMax pCMVbeta pCMV-TNT 4 hours 24 hours 48 hours n 2000 1500 1000 500 0 Control Program Only pGL3-Control pGL3-CMV pmax Cloning™ pSG5 pcDNA3.1 pFP pIRES-MCS B pcDNA4 HisMax pCMVbeta pCMV-TNT [% of pGL3-CMV at 24 h] 24 at pGL3-CMV [% of 4 hours 24 hours 48 hours Relative luciferase-expressio Relative Figure 1: Luciferase expression levels depend on vector backbones.
  • Cloning Technologies for Protein Expression and Purification

    Cloning Technologies for Protein Expression and Purification

    Cloning technologies for protein expression and purification James L Hartley Detailed knowledge of the biochemistry and structure of expedite the manipulations that are often required to individual proteins is fundamental to biomedical research. To obtain pure, active recombinant proteins. further our understanding, however, proteins need to be purified in sufficient quantities, usually from recombinant sources. Cloning for protein expression and Although the sequences of genomes are now produced in purification automated factories purified proteins are not, because their The required amount, purity, homogeneity, and activity behavior is much more variable. The construction of plasmids of the protein of interest usually determine the choice of and viruses to overexpress proteins for their purification is often expression context, vector and host. Usually the first tedious. Alternatives to traditional methods that are faster, easier consideration is what host cell to use. Expression in and more flexible are needed and are becoming available. Escherichia coli is fast, inexpensive and scaleable, and minimal post-translational modifications make proteins Addresses Protein Expression Laboratory, Research Technology Program, purified from E. coli relatively homogeneous and highly SAIC-Frederick, Inc., NCI-Frederick, Frederick, Maryland 21702, USA desirable for structural studies. However, in our experi- ence most eukaryotic proteins larger than 30 kDa are Corresponding author: Hartley, James L ([email protected]) unlikely to be properly folded when expressed in E. coli (JL Hartley et al., unpublished). Expression in mamma- Current Opinion in Biotechnology 2006, 17:359–366 lian cells is best for activity and native structure (includ- ing post-translational modifications), but yields are much This review comes from a themed issue on lower and costs are high.
  • Complete Control Retroviral Inducible Mammalian Expression System

    Complete Control Retroviral Inducible Mammalian Expression System

    Complete Control Retroviral Inducible Mammalian Expression System Instruction Manual Catalog #217564 (pFB-ERV), #240028 (pCFB-EGSH) Revision D.0 For Research Use Only. Not for use in diagnostic procedures. 217564-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product. No other warranties of any kind, express or implied, including without limitation, implied warranties of merchantability or fitness for a particular purpose, are provided by Agilent. Agilent shall have no liability for any direct, indirect, consequential, or incidental damages arising out of the use, the results of use, or the inability to use this product. ORDERING INFORMATION AND TECHNICAL SERVICES Email [email protected] World Wide Web www.genomics.agilent.com Telephone Location Telephone United States and Canada 800 227 9770 Austria 01 25125 6800 Benelux 02 404 92 22 Denmark 45 70 13 00 30 Finland 010 802 220 France 0810 446 446 Germany 0800 603 1000 Italy 800 012575 Netherlands 020 547 2600 Spain 901 11 68 90 Sweden 08 506 4 8960 Switzerland 0848 8035 60 UK/Ireland 0845 712 5292 All Other Countries Please visit www.agilent.com/genomics/contactus Complete Control Retroviral Inducible Mammalian Expression System Materials Provided .............................................................................................................................. 1 Storage Conditions .............................................................................................................................. 1 Additional Materials
  • Retroviral Gene Transfer and Expression User Manual Table of Contents I

    Retroviral Gene Transfer and Expression User Manual Table of Contents I

    Takara Bio USA, Inc. Retroviral Gene Transfer and Expression User Manual Cat. Nos. Many (081419) Takara Bio USA, Inc. 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support: [email protected] United States/Canada Asia Pacific Europe Japan Page 1 of 31 800.662.2566 +1.650.919.7300 +33.(0)1.3904.6880 +81.(0)77.565.6999 Retroviral Gene Transfer and Expression User Manual Table of Contents I. Introduction ..................................................................................................................................................................... 3 II. List of Components ....................................................................................................................................................... 10 III. Additional Materials Required .................................................................................................................................. 13 IV. Safety Guidelines for Working with Retroviruses .................................................................................................... 16 V. Plasmid Vector Manipulations ...................................................................................................................................... 17 VI. Working with Retroviral Packaging Cell Lines ........................................................................................................ 18 A. General Cell Culture and Retrovirus Information ....................................................................................................
  • Advances in the Development of Genetically Modified Animals

    Advances in the Development of Genetically Modified Animals

    Advances in the Development of Genetically Modified Animals Louis-Marie Houdebinea, Martín Alfredo Lemab, Moisés Burachikc* aBiologie du Développement et Reproduction, INRA, UMR1198, 78350 Jouy en Josas, France bNational University of Quilmes. Roque Sáenz Peña 352, Bernal B1876BXD, Buenos Aires Province, Argentina cINDEAR (Agrobiotechnology Institute Rosario), Ocampo 210 Bis (Predio CCT), (2000) Rosario, Argentina *E-mail: [email protected] (corresponding author) Abstract A wide range of genetically modified (GM) animal/trait combinations are being developed with a great variety of purposes: to enhance food production or nutritional quality; to improve human or animal health; as sources of products (pharmaceuticals) or tissues (transplantation) for human therapeutic use; to control vectors of human infectious diseases; and to improve animal farming operations, amongst others. This review will focus on developments in three main animal classes: mammals, fish and insects. Several developments of GM mammals and their derived products shall be reviewed as examples of the potential impacts of this technology on farming practices through to human health. Fish, on the other hand, pose a particular problem because of the possible effects of their entry into natural ecosystems as a result of their unintended escape from fish farming operations. Two main objectives drive the development of GM insects, namely pest management and control of vector-borne infectious diseases. These will require the deliberate release of GM insects directly
  • Construction of a High-Expression System in Bacillus Through Transcriptomic Profiling and Promoter Engineering

    Construction of a High-Expression System in Bacillus Through Transcriptomic Profiling and Promoter Engineering

    microorganisms Article Construction of a High-Expression System in Bacillus through Transcriptomic Profiling and Promoter Engineering Cui-Cui Miao 1, Lin-Li Han 1, Yan-Bing Lu 1 and Hong Feng 1,2,* 1 Key Laboratory of Molecular Biology and Biotechnology, College of Life Sciences, Sichuan University, 29, Wangjiang Rd, Chengdu 610064, China; meff[email protected] (C.-C.M.); [email protected] (L.-L.H.); [email protected] (Y.-B.L.) 2 Key Laboratory for Bio-Resources and Eco-Environment of Ministry of Education, Sichuan University, 29 Wangjiang Rd, Chengdu 610064, China * Correspondence: [email protected]; Tel.: +86-28-8547-0226 Received: 24 May 2020; Accepted: 9 July 2020; Published: 12 July 2020 Abstract: Bacillus subtilis is an ideal host for secretion and expression of foreign proteins. The promoter is one of the most important elements to facilitate the high-level production of recombinant protein. To expand the repertoire of strong promoters for biotechnological applications in Bacillus species, 14 highly transcribed genes based on transcriptome profiling of B. pumilus BA06 were selected and evaluated for their promoter strength in B. subtilis. Consequently, a strong promoter P2069 was obtained, which could drive the genes encoding alkaline protease (aprE) and green fluorescent protein (GFP) to express more efficiency by an increase of 3.65-fold and 18.40-fold in comparison with the control promoter (PaprE), respectively. Further, promoter engineering was applied to P2069, leading to a mutation promoter (P2069M) that could increase GFP expression by 3.67-fold over the wild-type promoter (P2069). Moreover, the IPTG-inducible expression systems were constructed using the lac operon based on the strong promoters of P2069 and P2069M, which could work well both in B.