The Homeobox Gene Six3 Is a Potential Regulator of Anterior

Developmental Biology 248, 265–280 (2002) doi:10.1006/dbio.2002.0732

View metadata, citation and similar papers at core.ac.uk brought to you by CORE The Homeobox Gene Six3 Is a Potential Regulatorprovided by Elsevier - Publisher Connector of Anterior Segment Formation in the Chick Eye

Yi-Wen Hsieh,* Xiang-Mei Zhang,* Eddie Lin,* Guillermo Oliver,† and Xian-Jie Yang*,1 *Jules Stein Eye Institute, Molecular Biology Institute, Department of Ophthalmology, University of California, Los Angeles, California 90095; and †Department of Genetics, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105

The anterior segment of the vertebrate eye consists of highly organized and specialized ocular tissues critical for normal vision. The periocular mesenchyme, originating from the neural crest, contributes extensively to the anterior segment. During chick eye morphogenesis, the homeobox gene Six3 is expressed in a subset of periocular mesenchymal cells and in differentiating anterior segment tissues. Retrovirus-mediated misexpression of Six3 causes eye anterior segment malformation, including corneal protrusion and opaciﬁcation, ciliary body and iris hypoplasia, and trabecular meshwork dysgenesis. Histological and molecular marker analyses demonstrate that Six3 misexpression disrupts the integrity of the corneal endothelium and the expression of extracellular matrix components critical for corneal transparency. Six3 misexpression also leads to a reduction of the periocular mesenchymal cell population expressing Lmx1b, Pitx2, and Pax6, transcription factors critical for eye anterior segment morphogenesis. Moreover, elevated levels of Six3 attenuate proliferation of periocular mesenchymal cells in vitro and differentiating anterior segment tissues in vivo. These results suggest that, in addition to its function in eye primordium determination, Six3 plays a role in regulating the development of the vertebrate eye anterior segment. © 2002 Elsevier Science (USA) Key Words: eye; development; anterior segment; mesenchyme; Six3; misexpression; chick.

INTRODUCTION distinct embryonic tissue origins. The lens and the corneal epithelium arise from embryonic ectoderm, whereas the The anterior segment of the vertebrate eye consists of endothelium and stroma of the cornea, the muscles of the several ocular tissues, including the lens, the cornea, the ciliary body, the stroma of the iris, and the trabecular iris, the ciliary body, and the trabecular meshwork. Proper meshwork located at the junction between the cornea and spatial organization, differentiation, and maintenance of iris contain cells derived from the periocular mesenchyme the anterior segment tissues are critical for normal visual (Grainger, 1992; Graw, 1996). Fate-mapping studies in chick function. The lack or loss of transparency of the lens and/or and mouse have shown that cranial neural crest cells the cornea can cause visual impairment and lead to blind- contribute extensively to the periocular mesenchyme ness. Defects and malformation of the ciliary body, which (Johnston et al., 1979; Trainor and Tam, 1995). During produces the aqueous humor, and of the trabecular mesh- anterior segment morphogenesis, periocular mesenchymal work, which allows passage of the aqueous humor through cells migrate toward the margin of the optic cup and the Schlemm’s canal into the venous system, can result in between the lens and the corneal epithelium to differentiate abnormal intraocular pressure, which can then damage the into various ocular tissues. Classical transplantation ex- optic nerve and retina, as has been found in certain types of periments show that differentiation of the cornea and glaucoma (Shields, 1998). development of the anterior chamber involve inductive Formation of the anterior segment entails complex mor- signals from the lens (Coulombre and Coulombre, 1964; phogenetic events involving cells derived from several Genis-Galvez, 1966; Genis-Galvez et al., 1967). Recent studies using transgenic mice also demonstrate that forma- 1 To whom correspondence should be addressed. Fax: (310) 794- tion of the corneal endothelium is required for normal 2144. E-mail: [email protected]. development of the anterior segment (Reneker et al., 2000;

FIG. 1. Expression patterns of chick Six3 mRNA as detected by in situ hybridization. Tissue sections of stage 14 head (A–C), stage 24 eye (D, E), E6 eye and retina (F, G), and E10 (H) and E16 (I) retinae hybridized with antisense probes are shown. Arrowheads (E, F) point to Six3-positive cells immediately adjacent to the pigmented epithelium. Scale bars, 50 ␮m. Abbreviations: cm, ciliary margin; di, diencephalon; ect, ectoderm; gcl, ganglion cell layer; hb, hindbrain; inl, inner nuclear layer; le, lens; np, nasal placode; onl, outer nuclear layer; pe, pigmented epithelium; pc, prechordal plate; ret, retina; vz, ventricular zone.

Kidson et al., 1999). Thus, inductive tissue interactions al., 2001; Alward, 2000). These disease conditions are play important roles in the proper formation of various characterized by anterior segment defects involving the anterior segment tissues. cornea, the iris, and the trabecular meshwork, and all show Increasing evidence supports that transcription factors a high probability of early onset glaucoma (Craig and expressed in the eye primordium and/or in the periocular Mackey, 1999). Moreover, these diseases are autosomal mesenchyme are critical for the patterning and differentia- dominant, suggesting haploinsufficiency as a cause for the tion of ocular tissues in the anterior segment. For example, disorders (Craig and Mackey, 1999). The paired homeodo- the forkhead/winged-helix transcription factor Mf1, the main transcription factor Pax6 is expressed in the neural bicoid class homeobox protein Pitx2, and the LIM home- tube-derived retina, as well as in the surface ectoderm odomain protein Lmx1b are all expressed in the periocular destined to become the corneal epithelium and the lens mesenchyme surrounding the developing optic cup, and (Grindley et al., 1995). Either an increase or decrease of loss-of-function mutations in each of these three genes Pax6 gene expression levels in the murine eye leads to result in anterior segment malformation in mouse (Kidson anterior segment defects (Hill et al., 1991; Schedl et al., et al., 1999; Hong et al., 1999; Pressman et al., 2000; Lu et 1996). In humans, PAX6 mutations result in the autosomal al., 1999). Mutations in the human FKHL7/FOXC1 gene (a dominant disorder aniridia, characterized by iris hypoplasia homologue of the murine mf1 gene), the PITX2 gene, and and progressive anterior segment dysgenesis leading to the LMX1B gene cause the Axenfeld–Rieger anomaly, the cataracts, corneal opacification, and glaucoma (reviewed by Riegers and iridogoniodysgenesis syndrome, and the nail– Glaser et al., 1995). patella syndrome, respectively (Semina et al., 1996; Gage The Six family of genes encode homeobox transcription and Camper, 1997; Kulak et al., 1998; Nishimura et al., factors that were initially identified based on their homol- 1998; Mears et al., 1998; Vollrath et al., 1998; McIntosh et ogy with the Drosophila sine oculis gene, which when al., 1998; Dreyer et al., 1998; Smith et al., 2000; Saleem et mutated causes malformation of the entire fly visual sys-

FIG. 2. Expression of chick Six3 protein and RNA in the eye anterior segment. Immunocytochemical staining of Six3 protein (B, D–G) and Pax6 protein (A, C) is shown. Arrowheads point to tissues expressing either both proteins (black) or Six3 protein only (green). The anti-Six3 antibodies used in (E) and (F) have been preincubated with the Six3 virus-infected and the RCAS virus-infected DF1 cells, respectively. (H) Results of RT-PCR ampliﬁcation of Six3, Six6, Pax6, Pax2, and G3PDH (control) using E6 and E12 corneal cDNAs, E6 retina, and pigmented epithelium cDNAs (r/p), or corneal RNAs without reverse transcription. Red asterisks (*) indicate the expected positions of ampliﬁed products. Scale bars, 100 ␮m. Abbreviations: cor, cornea; le, lens; ir, iris; tbm, trabecular meshwork.

tem (Cheyette et al., 1994; Oliver et al., 1995). The verte- duces the expression of retinal-specific genes (Toy et al., brate Six3 and Six6 (Optx2) genes are closely related struc- 1998). In humans, mutations in the SIX3 gene have been turally and share similar but nonidentical expression linked to the holoprosencephaly syndrome (HPE2), which domains in the anterior brain and the eye primordium display a spectrum of anterior midline defects ranging from (Oliver et al., 1995; Toy et al., 1998; Toy and Sundin, 1999; hypotelorism to cyclopia (Wallis et al., 1999; Pasquier et al., Jean et al., 1999). Misexpression of Six3 results in ectopic 2000; Wallis and Muenke, 2000), whereas mutations in the formation of the lens vesicle at the position of the otic SIX6 gene have been associated with bilateral anophthal- vesicle (Oliver et al., 1996), ectopic formation of the retina mia and pituitary anomalies (Gallardo et al., 1999). These at the mid/hindbrain junction (Loosli et al., 1999; Lagutin data suggest that both Six3 and Six6 play important roles in et al., 2001), or enlargement of the forebrain and defects in vertebrate eye primordium determination as well as in the optic stalk (Kobayashi et al., 1998). Similarly, misex- neural retinal fate specification. In addition, other Six genes pression of Six6 leads to an expanded retinal territory at the may also play roles in eye morphogenesis, as disruption of mid/hindbrain junction and increased eye size (Bernier et the Six5 gene is sufficient to cause cataract formation in the al., 2000; Zuber et al., 1999). In addition, overexpression of lens (Sarkar et al., 2000). Six6 in the retinal pigmented epithelial cell cultures in- In this paper, we describe the expression patterns of Six3

in multiple ocular tissues during the critical period of according to the manufacturer’s instructions (Boehringer Mann- anterior segment formation. We show that misexpression of heim). In situ hybridization was performed as previously described Six3 during chick eye development causes morphological (Riddle et al., 1993; Yang and Cepko, 1996; Zhang and Yang, 2001). defects of the anterior segment and reduction of expression Chick Lmx1b cDNA (Riddle et al., 1995; Kania et al., 2000) was domains of several transcription factors critical for anterior kindly provided by Dr. Randy L. Johnson (MD Anderson Cancer Center, Houston). Chick Pitx2 cDNA (Logan et al., 1998) was a gift segment development. Moreover, we provide evidence that from Dr. Cliff Tabin (Harvard Medical School, Boston). A partial elevated levels of Six3 influence cell proliferation of peri- chick Six3 cDNA clone (461 bp) was generated by RT-PCR using ocular mesenchyme and differentiating anterior segment chick E4 eye cDNAs and degenerate oligonucleotide primers 5Ј- tissues. These results support a regulatory role for Six3 in GARAGRYTIGGIMGITTYYTITGG and 5Ј-TGYCTTCTRTTYT- normal morphogenesis and differentiation of the eye ante- TRAACCARTT, which corresponded to protein sequences ER- rior segment as well as in disease conditions involving LGRFLW and RRNKFWN, respectively. The identity of the chick congenital eye anomalies and glaucoma. Six3 clone was confirmed by DNA sequencing. A cDNA clone (572 bp) of the chick Kera gene encoding the keratocan protein core (Pellegata et al., 2000) was generated by RT-PCR using randomly MATERIALS AND METHODS primed chick E4 head cDNAs and primers 5Ј-ATGAGCT- GGATCCTGAGC and 5Ј-ACAGCTGCAGTGTGTTAG, which Chick Embryos corresponded to amino acid sequences NELDPEHW and ANT- LQLF, respectively, and then sequenced to confirm its identity. For White Leghorn chicken eggs were purchased from Spafas, Inc. control or Six3 virus-infected embryos, a minimum of three em- Embryos were incubated at 38°C in a rotating humidified incuba- bryos were sectioned and analyzed by in situ hybridization. tor. Developmental stages were determined according to Ham- burger and Hamilton (1951). Histological Staining Embryos were fixed in 4% paraformaldehyde in PBS overnight Viral Stock Production and Injections and embedded in paraffin following standard procedures. Then, The replication-competent avian retroviral vector RCAS(A) 7-␮m sections were dewaxed and stained with hematoxylin and (Hughes et al., 1987) was used to construct the different viruses eosin by using standard procedures. expressing wild type and mutant Six3 cDNAs. The RCAS(A).Six3 viral construct was generated by cloning a 1179-bp cDNA fragment Mesenchymal Cell Cultures containing the coding region of the murine Six3 cDNA (from ϩ179 NcoI site, to ϩ1357 DraI site; Oliver et al., 1995) into the RCAS(A) Embryonic day 4 (E4, stage 22–24) eyes with surrounding mes- vector. The RCAS(A).Six3V-E viral construct encoding the full- enchymal tissues were dissected and incubated with trypsin for 5 length murine Six3 cDNA with a missense mutation was generated min at room temperature. The surface ectoderm and eyeballs were by PCR using primers containing a single base change at the second removed, and the remaining cells were collected and further position of codon 190 (GTG to GAG, i.e., V190E), based on dissociated by trypsin incubation (Altshuler and Cepko, 1992). sequence information of a Drosophila sine oculis mutation (V to D) Single-cell suspensions were plated on 10 ␮g/ml poly-D-lysine- at the same Valine residue (S. L. Zipursky and F. Pignoni, unpub- coated six-well dishes at a density of 650 cells/mm2. Cells were lished observations). The RCAS(A).⌬S viral construct was created infected with either 1 ␮l of control RCAS virus or different Six3 by first deleting the sequence between the Bgl II (ϩ199) and the viruses at 1–2 ϫ 108 cfu/ml and incubated at 37°C for 48 h in XhoI(ϩ692) of the murine Six3 cDNA and religating the filled-in medium containing 42.8% DMEM, 50% F12, 5% fetal calf serum, ends, and then by replacing the starting codon with the Flag epitope 1% chick serum, 10 mM Hepes, pH 7.0, and penicillin/ tag. The sequences of the two mutant Six3 viral constructs streptomycin. BrdU was added to culture media to a final concen- (Six3.V-E and Six3.⌬S) were confirmed by DNA sequencing. Viral tration of 20 ␮M for 9 h before cells were fixed and processed for stocks with 1–2 ϫ 108 cfu/ml titers were prepared by transfecting antibody staining. chick embryonic fibroblast cells (CEFs) with the viral DNA constructs. Culture media were collected and concentrated by centrifugation as described (Morgan and Fekete, 1996). Immunocytochemistry and Quantification Concentrated viral stocks were mixed with 1/10 volume of Cryosections of 16- to 20-␮m thickness and monolayer cells 0.25% fast green dye (Morgan and Fekete, 1996) before injection. used for antibody staining were fixed with 4% paraformaldelhyde For stage 10 infection, the viral inoculum was injected into the in PBS. Sections or cells were incubated with primary antibodies anterior neural tube until an overflow of viral solution from the and visualized by using either biotinylated secondary antibodies ␮ anterior neural pore occurred (0.2–0.4 l). For stage 17 infection, and the Vectastain ABC Elite Kit (Vector Laboratories) or Texas the viral inoculum was injected into multiple sites (10–15) within Red-conjugated (Jackson ImmunoResearch Laboratories) or Alexa the mesenchymal tissues surrounding the right optic cup. Eggs 488-conjugated (Molecular Probes) secondary antibodies with were sealed with tape and further incubated in a stationary position costaining of cell nuclei by 4Ј-6Ј-Diamidino-2Ј-phenylindode at 38°C for designated periods until embryos were harvested. (DAPI). Horseradish peroxidase staining using 3Ј,3Ј-Diamino- benzidine (DAB) as chromogen was visualized by using Nomarski In Situ Hybridization microscopy, whereas fluorescent signals were imaged by conven- tional fluorescent microscopy. For section immunostaining experi- In situ hybridization was performed by using 14- to 20-␮M-thick ments, a minimum of three control or Six3 virus-infected eyes was cryosections. Digoxigenin-labeled RNA probes were synthesized analyzed.

The rabbit polyclonal antibody against the Six3 protein was brane following SDS–PAGE. The anti-Six3 polyclonal antibodies raised by using the peptide antigen RLQHQAIGPSGMRSLAEPGC (Lagutin et al., 2001) and HRP-conjugated secondary antibodies located near the C-terminal of the murine Six3 protein (Lagutin et (Amersham) were used in ECL assays (Amersham) to detect Six3 al., 2001). To evaluate the specificity of the anti-Six3 antibody, the protein signals. serum was diluted and preincubated three times with avian DF1 cells infected with either the Six3 virus or the RCAS virus, and the TUNEL Assays supernatants were then used to stain eye sections (Figs. 2E and 2F). The anti-Pax6 (Ericson et al., 1997), anti-type IX collagen (2C2; Cryosections of 20-␮m thickness were used in TUNEL assays Irwin et al., 1985; Fitch et al., 1988), anti-keratan sulfate (I22; (Gavrieli et al., 1992) with fluorescein-conjugated nucleotides Funderbergh et al., 1982, 1986), anti-muscle cell specific antigen (Boehringer Mannheim) according to the manufacturer’s instruc- (13F4; Rong et al., 1987; Barrio-Asensio et al., 1999), and the tions. Apoptotic signals and cell nuclei stained by DAPI were anti-viral GAG protein (3C2; Stoker and Bissell, 1987) monoclonal visualized by using epifluorescent microscopy. antibodies were obtained from the Developmental Studies Hybrid- oma Bank (DSHB, Iowa City). The polyclonal antibodies p27 against the viral GAG protein were purchased from SPAFAS. The RESULTS anti-BrdU antibody containing nuclease was obtained from Amer- sham. Expression of Six3 in Chick Ocular Tissues For in vivo labeling with BrdU, embryos infected by viruses at stage 10 were windowed and 1 ml of PBS containing 100 ␮g BrdU As an initial step to elucidate the potential roles of Six3 was dripped on top of each embryo. The eggs were then returned to in chick eye morphogenesis, a partial chick Six3 cDNA incubation for an additional 3 or 6 h. Embryos were fixed with 4% generated by RT-PCR was used in in situ hybridization paraformaldehyde and cryosections were stained for BrdU incorpo- analyses. Chick Six3 expression was first detected by ration by using a protocol previously described for paraffin embed- whole-mount in situ hybridization at stage 5 in the anterior ded tissues (Belecky-Adams et al., 1996). neural plate (data not shown; Bovolenta et al., 1998). At Percentages of BrdU marker-positive mesenchymal cells among stage 14, in addition to the ventral forebrain and the total cells were determined by calculating the ratio of the prechordal plate, Six3 mRNA was detected in the neural fluorescent-labeled cells and the total DAPI-stained nuclei in a tube-derived optic cup and in the ectoderm-derived nasal given dissociated cell sample. Cells were costained for the anti- placode, lens vesicle, and presumptive corneal epithelium viral P27 antibody to determine infection rates. For a given virus, 7–10 independent samples were quantified. The Student’s t test (Figs. 1A–1C). After the onset of neuronal differentiation, was used for statistical analyses. P values Ͻ0.02 were considered the stage 24 (embryonic day 4, E4) retina showed high levels statistically significant. of Six3 message, while the expression of Six3 in the pigmented epithelium, the lens, and the adjacent surface ectoderm declined (Fig. 1D). The expression of Six3 in the RT-PCR Analyses retina persisted throughout neurogenesis and remained in Total RNAs of E6 cornea, E12 cornea, as well as E6 retina and all three cellular layers at E16 when production of all retinal pigmented epithelium were isolated following the manufacturer’s cell types was complete (Figs. 1D–1I). Interestingly, Six3- instructions by using RNAzol B (Tel-Test, Inc., Friendswood, TX). positive signals were also detected in mesenchymal cells Random hexamers and an MMLV reverse transcriptase (Life Tech- located immediately adjacent to the pigmented epithelium nologies, Rockville, MD) were used to synthesize single-strand (Figs. 1E and 1F). cDNAs. For RT-PCRs, products were amplified using 35 cycles at The expression patterns of Six3 protein were character- (95°C, 45 s; 52°C, 45 s; 72°C, 45 s). Equal volumes of PCR products ized by immunohistochemistry using Six3-specific antibod- were loaded and separated by agarose gel electrophoresis. The Six3 PCR product was sequenced to confirm the identity. The PCR ies. We first examined whether Six3 and Pax6 proteins were primers used for each gene are: Six3, 5Ј-GCAAGCTGCAGGCCA- colocalized. In addition to its expression in the developing TGT and 5Ј-CATACATCACATTCCGAG; Six6 (Optx2), 5Ј-AA- retina (data not shown), the chick Six3 protein was detected CGAGTCGGTGCTGAGA and 5Ј-TGCTGCTGTAGCCTGTTC; in the corneal epithelium and lens epithelium at E6.5 and Pax6, 5Ј-CAGCTTCACCATGGCCAA and 5Ј-TTACAGCGTAG- E12 (Figs. 2B and 2D), coinciding with the expression of the GGCACAG; Pax2, 5Ј-ATAGTGGAGCTGGCTCACCA and 5Ј- Pax6 protein in these tissues (Figs. 2A and 2C). However, by AATCTCCCAAGCGAACATGGT; and G3PDH, 5Ј-CAGTG- E12, Six3 but not Pax6 protein is present in the corneal Ј AGAAAGTCGGAGT and 5 -CAGCACCTCTGCCATCTC. endothelium and the limbal region (Figs. 2C and 2D). After E16 and at hatching (H1), Six3 protein persisted in multiple Western Blot Analysis anterior segment tissues, including the lens epithelium, the corneal endothelium, the iris, and the trabecular meshwork Chick embryonic fibroblast (CEF) cells infected with different (Figs. 2F and 2G). Preincubation of the anti-Six3 antibodies Six3 viruses were cultured for 48 h. Cell extracts were prepared by with Six3-expressing cells abolished the Six3-staining sig- incubating cells on ice in 50 mM Tris–HCl, pH 8.0, 250 mM NaCl, 0.5% NP40 for 15 min, followed by centrifuging cell lysates in a nals (Figs. 2E and 2F), indicating that the antibodies specifi- microfuge for 5 min at the highest speed and collecting the cally recognized the Six3 protein as an antigen. To further supernatants. E6 retinal and spinal cord extracts were similarly confirm the expression of chick Six3 in the developing prepared by directly lysing tissues in the lysis buffer followed by cornea, RT-PCR using E6 and E12 corneal cDNAs was centrifugation. Proteins were transferred to nitrocellulose mem- performed. The amplification results showed that Six3

FIG. 3. Viral-mediated expression of Six3 protein variants. (A) A schematic illustration shows the Six3 cDNA variants inserted into the RCAS(A) viral vector. The Six and the homeodomains are shown as gray and black boxes, respectively. The arrowhead indicates the position of the V190E mutation within the Six domain. The deleted region in Six3.⌬S is indicated with a line, and the arrow points to the N-terminal Flag epitope. (B) Western blot analyses using anti-Six3 antibodies show viral mediated expression of wild type and mutant Six3 proteins. The protein extracts used are derived from E6 chick retina (Ret), E6 chick spinal cord (SC), CEF cells (CEF), and RCAS.Six3 (Six3), RCAS.Six3.V-E (V-E), and RCAS.Six3.⌬S(⌬S) virus-infected CEF cells. (C) Immunocytochemical staining of CEF cells infected with different Six3 viruses demonstrates the expression and subcellular localization of the three Six3 variants. FIG. 4. Anterior segment malformation caused by Six3 virus infection. (A, B) Frontal and ventral views, respectively, of E12 eyes infected by the Six3 virus and the control RCAS virus (asterisks) at stage 10. Arrowhead points to the protruding cornea of the Six3 virus-infected eye. (C, D) Frontal views of the corneas of the Six3 virus (D) and control RCAS virus (C)-infected eyes at E16. (E, F) Frontal views of the pupil in Six3 virus (F)- and control RCAS virus (E)-infected E16 eyes upon removal of the cornea. The two-headed arrows indicate pupil diameters. Scale bars, in (A, B), 5 mm; in (C–F), 250 ␮m.

FIG. 5. Disruption of anterior segment morphology by Six3 misexepression. H&E staining demonstrates anterior segment tissue defects caused by Six3 virus infection (B, D, F, H, I, K) compared with control RCAS virus infection (A, C, E, G, J) at stage 10. In the E12 sections (A–D) shown, arrows point to the eyelid; arrowheads indicate the termination points of the differentiated sclera and the peripheral retina. Among the E16 sections (E–K) displayed, (H) and (I) show partial views of Six3 virus-infected cornea, with arrowheads (H) pointing to the vacuoles in the corneal endothelium. Scale bars, in (A, B, E, F), 500 ␮m; in (C, D, J, K), 100 ␮m; in (G–I), 50 ␮m. Abbreviations: cb, ciliary body; cor, cornea; endo, corneal endothelium; epi, corneal epithelium; str, corneal stroma; ir, iris; le, lens; ret, retina; scl, sclera; tbm, trabecular meshwork. transcripts were indeed expressed in the cornea at these S. L. Zipursky, unpublished observations), we constructed stages, whereas Six6 (Optx2) was only detected in the retina the Six3.V-E mutant cDNA encoding a single amino acid and pigmented epithelium as expected but not in the cornea residue change (Valine190 to Glutamic acid, i.e., V190E) (Fig. 2H). at a highly conserved position within the Six domain. The RNA and protein expression patterns of Six3 to- The Six3.⌬S mutant contained partial deletions of the gether suggest that Six3 may be involved in the develop- N-terminal portion and the Six domain as well as the Flag ment of both neural tube- and mesenchyme-derived ocular epitope tag. By Western blot analyses, the chick E6 retinal tissues, especially during the morphogenesis and differen- extract, but not the spinal cord extract, contained two tiation of the anterior segment of the eye. major proteins recognized by the anti-Six3 antibodies, with the upper band corresponding to 34 kDa as predicted for the Retrovirus-Mediated Misexpression of Wild Type full-length endogenous chick Six3 protein (Fig. 3B). Chick and Mutant Six3 Proteins embryonic ﬁbroblast (CEF) cells infected by the wild type To examine the potential role of Six3 during development Six3 and Six3.V-E viruses produced murine Six3 variants of the anterior segment tissues, we constructed replication with the expected molecular weight of 36 kDa, whereas competent avian retroviruses expressing variants of the CEF cells infected by the Six3.⌬S virus expressed a 26-kDa murine Six3 protein (Fig. 3A). In addition to a virus express- protein corresponding to the truncated Six3 protein (Fig. ing the wild type Six3, two viruses producing mutant Six3 3B). Furthermore, anti-Six3 immunocytochemical staining proteins were also constructed. Based on molecular genetic showed that all three virus-encoded murine Six3 variants studies of Drosophila sine oculis mutations (F. Pignoni and were localized to the nuclei of infected CEF cells (Fig. 3C).

TABLE 1 Summary of Viral-Mediated Six3 Misexpression on Eye Morphogenesis

Injection Virus Harvest No. of survivors No. with phenotypes % with abnormalities

Stage 10 RCAS(A) E12 48 0 E16 4 1 1.6 E18 8 0 Six3 E12 31 24 E16 3 2 78.0 E18 7 6 Six3.V-E E12 26 2 7.7 Six3.⌬S E12 26 12 46.1 Stage 17 RCAS(A) E16 13 0 0 Six3 E16 8 6 75.0

Note. Viruses were injected at stage 10 into the neural tube or at stage 17 into the periocular mesenchyme and further incubated at 38°C until harvesting. Ocular abnormalities, primarily corneal protrusion, were scored by comparing the external appearance of Six3 viruses infected eyes with RCAS(A) control virus infected eyes at a given stage. Percentages of abnormality represent embryos harvested between E12 and E18.

Morphological Defects Caused by Six3 of the Six3 virus-infected eyes showed increased thickness Misexpression despite the presence of the three cellular layers, i.e., the corneal epithelium, the stroma, and the corneal endothe- High-titer viruses were used to infect the developing lium (Figs. 5E and 5F). In Six3 virus-infected eyes, the optic primordium at stage 10 (E2) in order to misexpress corneal stromal cells (keratocytes) appeared to be distrib- wild type and mutant Six3 proteins. By E12, infection with uted more sparsely. However, quantifications using thin wild type Six3 virus resulted in abnormal eye morphology, sections showed no changes of stromal cell number per unit including corneal protrusion, eyelid hypoplasia, and, at low length of cornea (data not shown), suggesting that the frequency, microphthalmia (Figs. 4A and 4B). By E16, Six3 corneal stroma was not properly condensed (Figs. 5G–5I). In virus-infected eyes displayed corneal opacification and iris addition, the structural integrity of the corneal endothe- hypoplasia (Figs. 4C–4F). In comparison to control RCAS lium appeared compromised, as indicated by the presence of virus-infected embryos, which rarely showed eye abnormal- vacuole-like gaps (Figs. 5G and 5H). The limbal region of ity (1 of 60 embryos, or 1.6%), 78% of wild type Six3 the anterior segment, including the trabecular meshwork, virus-infected embryos displayed anterior segment anoma- also exhibited an abnormal morphology (Figs. 5J and 5K). lies represented by cornea protrusion (Table 1). Only 7.7% Moreover, Six3 virus-infected eyes displayed underdevel- of the embryos infected with the Six3.V-E virus and 46% of oped ciliary bodies and shortened irises, i.e., ciliary body the embryos infected with the Six3.⌬S virus showed ante- and iris hypoplasia (Figs. 5J and 5K). These histological rior segment anomalies. Moreover, the eye phenotypes results demonstrated that anterior segment tissue types caused by Six3 mutant viruses were less severe compared containing mesenchyme components were affected by with those caused by the wild type Six3 virus infection. misexpression of Six3. These results indicate that viral-mediated misexpression of wild type Six3 affected anterior segment development. Furthermore, the deleted portions of the Six3 protein were Defective Corneal Differentiation Due to Six3 involved in causing viral-induced morphogenetic defects, Misexpression whereas the conserved Valine190 in the Six domain was The transparency of the cornea is largely dependent on critical for Six3 activity. the composition and proper organization of extracellular Histological staining of tissue sections revealed malfor- matrix proteins in the corneal stroma. To determine pos- mation of multiple anterior segment tissues due to misex- sible effects of misexpressing Six3 on corneal differentia- pression of the wild type Six3 protein. At E12, some Six3 tion, we examined the distribution of two corneal extracel- virus-infected embryos exhibited microphthalmic eyes lular matrix components, type IX collagen and keratan compared with the control RCAS virus-infected or nonin- sulfate proteoglycans (KSPGs). During normal corneal dif- fected embryos (Figs. 5A and 5B). However, the laminar ferentiation, collagen IX crosslinks other types of collagen organization of the Six3 virus-infected neural retina ap- into highly ordered fibrils, and the proteolytic processing of peared similar to that of the control RCAS virus-infected collagen IX may play a role in mesenchymal cell invasion of retina (data not shown). Six3 virus-infected eyes also the corneal stroma (Fitch et al., 1998; Linsenmayer et al., showed retarded sclera and eyelid development in contrast 1998). Immunocytochemical analyses demonstrated that to control eyes at E12 (Figs. 5C and 5D). By E16, the cornea Six3 misexpression caused elevated collagen IX levels (2C2

© 2002 Elsevier Science (USA). All rights reserved. Effects of Six3 Misexpression on Eye Anterior Segment Morphogenesis 273 monoclonal antibody; Fitch et al., 1998) in tissues lining remained in the residual Pax6-positive iris stromal cells. the E12 anterior chamber, i.e., the corneal endothelium and Furthermore, a muscle-specific marker (monoclonal anti- the iris (Figs. 6A–6D). Keratocan is a major type of KSPG body 13F4) (Rong et al., 1987; Barrio-Asensio et al., 1999) present in the developing and adult cornea and is implicated also revealed abnormal iris muscle organization in Six3 in corneal stroma differentiation and transparency (Rada et virus-infected eyes compared with the control virus- al., 1993; Dunlevy et al., 1998; Liu et al., 1998; Pellegata et infected eye (Figs. 7G and 7H). Thus, Six3 misexpression al., 2000). In situ hybridization using a chick Keratocan altered the size of expression territories of key transcription (Kera) cDNA encoding the protein core of Keratocan de- factors in the periocular mesenchyme and their derivatives tected an increased expression of Kera transcripts in Six3 during the critical period of anterior segment formation. virus-infected cornea and limbal regions (Figs. 6E and 6F). Consistently, immunocytochemical staining using the I22 Effects of Misexpressing Six3 on Mesenchymal and monoclonal antibody, which recognized the keratan sulfate Anterior Segment Cell Proliferation groups on different types of KSPGs, also revealed an increased presence of Keratan sulfate antigens in the Six3 The ocular phenotypes caused by Six3 misexpression virus-infected cornea (Figs. 6G and 6H) (Funderburgh et al., appeared to be associated with a reduction of the periocular 1982, 1986). Taken together, these results suggest that mesenchymal cells that give rise to perspective anterior overexpression of wild type Six3 disrupted corneal differen- segment tissues. This effect potentially might be due to the tiation as reflected by altered expression of extracellular influence of misexpressed Six3 on the specification or matrix molecules. migration of neural crest cells originating from dience- phalic and mesencephalic regions of the virally infected neural tube at stage 10. Alternatively, Six3 misexpression Effects of Six3 Misexpression on Molecular might affect the proliferation and/or apoptotic death of the Markers of the Periocular Mesenchyme periocular mesenchymal cells. To begin distinguishing Since misexpressing Six3 affected the morphogenesis of these possibilities, we targeted viral infection directly to mesenchyme-derived anterior segment tissues, we next the periocular mesenchyme surrounding the optic cup at examined whether the expression of other transcription stage 17. Infection by the control RCAS virus did not give factors known to play roles in anterior segment develop- rise to any ocular abnormalities, whereas infection by the ment was influenced by Six3. In situ hybridization detected Six3 virus at stage 17 caused a similar percentage (75%) of the expression of Lmx1b and Pitx2 mRNAs in regions anterior segment anomalies among injected embryos (Table surrounding the chick optic cup at stage 18 (E3; data not 1). Since stage 17 periocular injection did not perturb the shown). Between E4 and E6, overlapping domains of the specification and initial migration of the head neural crest mesenchyme surrounding the eye expressed both Lmx1b cells (data not shown), this result supported the notion that and Pitx2 mRNAs (Figs. 7A and 7C). In Six3 virus-infected effects of Six3 misexpression were, at least in part, due to eyes, the size of expression territories of Lmx1b and Pitx2 local perturbation of the periocular mesenchyme. near the ciliary margin was significantly reduced by E6.5 To determine whether Six3 misexpression caused ante- compared with controls; however, similar intensities of rior segment malformation by influencing cell prolifera- hybridization signals for Lmx1b and Pitx2 were observed tion, incorporation of the DNA synthesis precursor BrdU in (Figs. 7A–7D). To further evaluate whether Six3 virus vitro and in vivo was examined. At stage 23 (E4) when the infection decreased transcription of Lmx1b and/or Pitx2, first wave of mesenchymal cells begun migrating between RNAs from primary periocular mesenchymal cell cultures the corneal epithelium and the lens, periocular mesenchy- (see below) infected with either the RCAS control virus or mal cells near the ciliary margin of the eye expressed Six3 the Six3 virus were assayed by semiquantitative RT-PCRs. mRNA (Fig. 8A). By stage 25 (E5), both the newly formed No difference in the levels of Lmx1b and Pitx2 transcripts corneal endothelium and the periocular mesenchymal cells was detected when equal amounts of input RNAs were used were highly proliferative as indicated by extensive BrdU (data not shown), suggesting that Six3 misexpression did incorporation in vivo (Fig. 8B). To examine whether Six3 not affect the levels of Pitx2 and Lmx1b transcription on a viral infection affected cell proliferation during this time per cell basis, but more likely affected the numbers of window, periocular mesenchymal cells were cultured as a periocular mesenchymal cells in the limbal region. monolayer in vitro at E4 and infected with various viruses During differentiation of the anterior segment, the cor- for 48 h. Quantification of BrdU incorporation showed that neal epithelium and a subset of iris stromal cells expressed Six3 virus infection caused a statistically significant de- the homeo and paired domain transcription factor Pax6 (Fig. crease in BrdU-positive cells from 47.6% found in the 7E). Immunocytochemical staining showed that the expres- control RCAS virus-infected cultures to 40.0% (Fig. 8C). sion of Pax6 protein in the corneal epithelium at E12 was However, infection by the Six3.V-E virus did not result in a not altered by Six3 virus infection (Figs. 7E and 7F). In significant change of BrdU incorporation by this assay contrast, the number of Pax6-positive cells within the iris (44.5%) (Fig. 8C). Consistent with the in vitro proliferation stroma was markedly reduced in Six3 virus-infected eyes assay, immunofluorescent microscopy revealed that at E6 (Figs. 7E and 7F), even though the similar staining intensity Six3 virus-infected limbal region contained significantly

FIG. 6. Effects of Six3 misexpression on corneal differentiation. Immunocytochemical staining (A–D, G, H) and in situ hybridization (E, F) of E12 eyes infected with the Six3 virus (B, D, F, H) and control RCAS virus (A, C, E, G) at stage 10 show altered expression patterns of type IX collagen (2C2 antibody; A–D), keratan sulfate (I22 antibody; G, H), and keratocan mRNA (kera antisense probe; E, F) in the cornea and iris. Arrowheads (A) point to corneal endothelium. Arrows (F) indicate in situ hybridization signals detected in corneal endothelium and in cells lining the anterior chamber. Scale bars, 100 ␮m. Abbreviations: cor, cornea; ir, iris; le, lens. FIG. 7. Altered expression patterns of periocular mesenchyme and anterior segment markers due to Six3 misexpression. (A–D) In situ hybridization signals of Lmx1b (A, B) and Pitx2 (C, D) in the limbal region of E 6.5 eyes infected by Six3 (B, D) and RCAS (A, C) viruses at stage 10. (E–H) Immunocytochemical staining of Pax6 (E, F) and muscle marker 13F4 (G, H) in E12 anterior segments infected by Six3 (F, H) and RCAS (E, G) viruses at stage 10. Anti-viral protein immunostaining (3C2) of adjacent sections reveals extensive infection by the control RCAS virus and the Six3 virus of the regions analyzed (data not shown). Scale bars, 100 ␮m. Abbreviations: cor, cornea; epi, cornea epithelium; le, lens; lim, presumptive limbus; ret, retina. © 2002 Elsevier Science (USA). All rights reserved. Effects of Six3 Misexpression on Eye Anterior Segment Morphogenesis 275

FIG. 8. Effects of Six3 misexpression on cell proliferation. (A) In situ hybridization of Six3 in the anterior segment at stage 23 (E4). (B) Anti-BrdU immunostaining of eye anterior segment (3 h in vivo labeling) at stage 25 (E5). (C) Quantiﬁcation of BrdU incorporation in periocular mesenchymal cells in vitro. Percentages of BrdU-positive cells among total cells are shown (average Ϯ standard error). All cells were infected as indicated by coimmunostaining using anti-viral GAG antibody (P27) (data not shown); RCAS virus (R, n ϭ 7), Six3 virus (Six3, n ϭ 7; *, P ϭ 0.015), Six3.V-E virus (V-E, n ϭ 10). (D–G) Anti-BrdU immunostaining compares in vivo BrdU incorporation after infection by Six3 virus (E, G) and RCAS virus (D, F) at stage 10. (D, E) Infected limbal regions at E6 after3hoflabeling. (F, G) Infected irises at E16 after6hoflabeling. (H–K) DAPI staining of corresponding ﬁelds (D–G), respectively. Extensively viral infection of the same sections was detected by costaining with anti-viral GAG antibody (P27) (data not shown). Scale bars, 100 ␮m. Abbreviations: epi, corneal epithelium; ir, iris; le, lens; pe, pigmented epithelium; lim, presumptive limbus; ret, retina. FIG. 9. Effects of viral infection on cell death. TUNEL staining of E12 eyes infected at stage 10 by RCAS virus (A, C, same section) or Six3 virus (B, D, same section) are shown. Arrowheads point to detected apoptotic cells. Staining with the anti-viral GAG antibody 3C2 (C, D) demonstrates extensive infection of anterior segments by both RCAS and Six3 viruses. Scale bars, 100 ␮m. Abbreviations: cb, ciliary body; cor, cornea; ir, iris; le, lens.

© 2002 Elsevier Science (USA). All rights reserved. 276 Hsieh et al. less BrdU-labeled cells in vivo (Figs. 8D, 8E, 8H, and 8I). eye primordium determination and retinal neurogenesis, Furthermore, during the period of iris growth and differen- current data suggest that Six3 rather than Six6 may be tiation (E12 to E16), the Six3 virus-infected iris showed a required for anterior segment morphogenesis. reduced number of BrdU-labeled cells in vivo compared with control-virus infected iris (Figs. 8F, 8G, 8J, and 8K). Requirements of Conserved Structural Motifs for Together, these data showed that overexpression of the wild Six3 Activity type Six3 protein reduced proliferation of periocular mesenchymal cells and their derivatives in vivo and in vitro. The murine Six3 protein shares 86.4% over all amino To rule out possible effects of Six3 misexpression on acid sequence homology and identical Six and homeodo- apoptotic cell death during anterior segment morphogen- mains with the chick Six3 protein (Kobayashi et al., 1998; esis, we performed TUNEL assay. At E12, few TUNEL- Kawakami et al., 1996; Oliver et al., 1995; Bovolenta et al., positive cells were detected in anterior segment tissues 1996). The results of viral-mediated misexpression in vivo infected by the RCAS virus. Similar extents of cell death indicate that wild type murine Six3 protein effectively were observed in Six3 virus-infected anterior segment, influences development of the chick anterior segment. The despite the presence of defective tissue morphology (Fig. 9). Six3.⌬S mutant shows reduced effectiveness in perturbing Therefore, the anterior segment defects caused by Six3 eye development, indicating that one or both of the deleted misexpression were unlikely due to altered patterns of regions are required for the full activity of Six3 protein in apoptosis in the anterior portion of the eye at this stage. causing anterior segment anomalies. The single missense mutation (Six3.V190E), which nearly abolishes the anterior eye phenotypes, is within the Six domain but outside of the DISCUSSION deleted regions in Six3.⌬S, demonstrating that the replace- ment of the Valine190 residue by the charged Glutamic acid In this paper, we provide evidence that the homeobox severely disrupted the activity of Six3. This is consistent gene Six3 is expressed in the periocular mesenchyme and with the fact that this Valine residue is absolutely con- its derivatives, and that altering expression levels of Six3 served in all Six family proteins in vertebrate species leads to a range of defects in the anterior segment of the eye. (Kawakami et al., 2000). A Valine residue is also present in Thus, our results reveal a potential regulatory role of Six3 in the same position in the Drosophila sine oculis gene prod- the morphogenesis of the vertebrate eye beyond the initial uct; a similar missense mutation (Valine to Aspartic acid) in stage of eye primordium determination. So disrupts the activity of the endogenous wild type So protein when misexpressed during neurogenesis (F. Pignoni and S. L. Zipursky, personal communication). Our results Expression of Six3 in the Periocular Mesenchyme are also consistent with a previous study in zebrafish and in Anterior Segment Tissues demonstrating that deletion of the N-terminal half of the Formation of the periocular mesenchyme becomes appar- Six domain reduces the activity of the zebrafish Six3, ent at stage 18 (E3) in chick, as several genes, including whereas deletion of the C-terminal half of the Six domain Lmx1b and Pitx2, begin to express in overlapping zones completely abolishes the ability of Six3 to cause head surrounding the optic cup (data not shown; Pressman et al., defects in an overexpression assay (Kobayashi et al., 1998). 2000; Lu et al., 1999). Transcriptional activation of these The molecular and genetic interactions between Six3 and genes within this region suggests that the optic cup pro- other genes involved in anterior segment development are vides inductive signals that positively regulate expression not well understood. In Drosophila, So protein forms com- of these regulatory genes. In contrast to the broad periocular plexes and synergizes with the eyes absent gene product via expression zone of Pitx2 and Lmx1b, Six3 transcripts are the Six domain to induce ectopic compound eye formation expressed in only a subset of periocular mesenchymal cells. (Pignoni et al., 1997). The vertebrate Eya genes are ex- This distinct pattern of Six3 expression in early periocular pressed in the periocular mesenchyme and anterior seg- tissues suggests that regulatory mechanism(s) controlling ment tissues (Xu et al., 1997; Mishima and Tomarev, 1998), Six3 expression in this region are distinct from mechanisms and mutations in human EYA1 lead to congenital cataracts controlling the expression of other transcription factors also and anterior segment anomalies (Azuma et al., 2000). How- present in the periocular mesenchyme. ever, a physical interaction of the vertebrate Six3 protein Despite the high homology between Six3 and Six6 as well with Eya proteins has not been confirmed (Ohto et al., as their similar expression domains in the anterior embryo 1999). In chick, misexpression of Six3 does not appear to (Oliver et al., 1995; Toy et al., 1998; Jean et al., 1999; alter the expression pattern of Eya2 in the periocular Bovolenta et al., 1998), the expression patterns of these two mesenchyme (X.-M.Z. and X.-J.Y., unpublished data). Re- genes in the periocular mesenchyme and the anterior seg- cent evidence indicates that Six3 and Six6 (Optx2) may act ment are different. Our analyses show that Six3 is expressed as transcription repressors during retina and brain forma- in the presumptive trabecular meshwork, the cornea, and tion (Zuber et al., 1999; Kobayashi et al., 2001). Like other the iris, whereas Six6 is absent from these tissues. There- homeobox transcription factors (Muhr et al., 2001), the Six fore, although both Six3 and Six6 are likely to function in domain of the Six3 protein contains two eh-1-related motifs

© 2002 Elsevier Science (USA). All rights reserved. Effects of Six3 Misexpression on Eye Anterior Segment Morphogenesis 277 responsible for interaction with the transcription corepres- Potential Roles for Six3 in Congenital Anterior sor Groucho (Kobayashi et al., 2001; Zhu et al., 2002). Segment Anomalies and Glaucoma Interestingly, the single point mutation encoded by The eye phenotypes caused by Six3 misexpression in Six3.V-E is located outside of the two eh-1-related motifs. chick overlap with anterior segment defects observed in Thus, the Six domain may mediate molecular interactions animal models carrying mutations in Lmx1b, Pitx2, Mf1/ with multiple proteins. Since the normal expression do- FHLK7, and Eya1 genes (Pressman et al., 2000; Lu et al., mains of Six3 only partially overlap with that of Pax6, 1999; Kidson et al., 1999; Xu et al., 1999). Human muta- Lmx1b, Pitx2, and Eya2 in periocular mesenchyme and in tions in these genes are associated with disease syndromes anterior segment, and since Six3 misexpression primarily characterized by congenital anterior segment anomalies affected the territories where these genes were expressed and early onset glaucoma. Consistent with our results rather than their levels of expression, Six3 is unlikely to demonstrating that Six3 is expressed in multiple developing directly regulate transcription of these genes in the anterior ocular tissues and that anterior segment morphogenesis is segment. sensitive to the expression levels of Six3, human patients carrying SIX3 mutations and showing mild holoprosencephaly also display microphthalmia and coloboma (Wallis Cellular Mechanisms Underlying Morphological et al., 1999; Wallis and Muenke, 2000). Therefore, the SIX3 Defects Caused by Six3 Misexpression gene is likely to play a role in normal eye development and SIX3 mutations may underlie human anterior segment Increasing evidence indicates that anterior segment mor- anomalies, such as aniridia, corneal opacification, and con- phogenesis is sensitive to the expression levels of a number genital glaucoma. of transcription factors, including Lmx1b, Pitx2, Mf1/ FHKL7/FOXC1, and Pax6 (Pressman et al., 2000; Kidson et al., 1999; Lu et al., 1999; reviewed by Craig and Mackey, ACKNOWLEDGMENTS 1999; and Alward, 2000; Nishimura et al., 2001; Hill et al., 1991; Schedl et al., 1996). However, the molecular and We thank Drs. Randy L. Johnson, Cliff Tabin, and Peter Gruss for cellular mechanisms by which these transcription factors providing cDNAs, and Francesca Pignoni and Larry Zipursky for regulate periocular mesenchyme patterning and differentia- communicating unpublished data and for discussion. We also tion remain largely unknown. Most of the anterior segment thank Kristin Schmidt for her excellent technical support. This tissues disrupted by Six3 misexpression, including the work was supported in part by grants from the Research to Prevent presumptive trabecular meshwork, the corneal endothe- Blindness Foundation, the March of Dimes Birth Defect Founda- tion, the Karl Kirchgessner Foundation, and the NIH (EY12270) (to lium, the stroma of the ciliary body, and the stroma of the X.-J.Y.), and by grants from NIH (EY12162 and GM58462) and the iris, express Six3 endogenously. Therefore, the abnormali- American Lebanese Syrian Associated Charities (ALSAC) (to G.O.). ties in these ocular tissues caused by Six3 virus infection are likely due to overexpression of Six3, which appears to have two effects. First, elevated Six3 expression attenuates REFERENCES cell proliferation in the mesenchyme. The observed reduction of proliferation in vitro and in vivo at E6 could explain Altshuler, D., and Cepko, C. (1992). A temporally regulated, the overall decrease in the mesenchymal cell population in diffusible activity is required for rod photoreceptor development the limbal region, which underlies the reduced territories of in vitro. Development 114, 947–957. expression for Lmx1b and Pitx2. The iris hypoplasia caused Alward, W. L. (2000). Axenfeld–Rieger syndrome in the age of by Six3 misexpression is reminiscent of Pax6 and Lmx1b molecular genetics. Am. J. Ophthalmol. 130, 107–115. loss-of-function phenotypes (Pressman et al., 2000; Glaser Azuma, N., Hirakiyama, A., Inoue, T., Asaka, A., and Yamada, M. et al., 1995). However, the effects of these two transcription (2000). Mutations of a human homologue of the Drosophila eyes absent gene (EYA1) detected in patients with congenital cataracts factors on mesenchymal and/or anterior segment tissue and ocular anterior segment anomalies. Hum. Mol. Genet. 9, cell proliferation remain to be determined. Second, Six3 363–366. misexpression may also directly influence the differentia- Barrio-Asensio, C., Murillo-Gonzalez, J., Pena-Meliann, A., and tion of periocular mesenchymal derivatives. This is con- Puerta-Fonolla, J. (1999). Immunocytochemical study on the sistent with the altered expression of several corneal extra- triple origin of the sphincter iris in the chick embryo. Dev. Genes cellular matrix markers and the corresponding corneal Evol. 209, 620–624. phenotypes. A similar effect on anterior segment tissue Belecky-Adams, T., Cook, B., and Adler, R. (1996). Correlations differentiation has been observed in the case of Lim1b between terminal mitosis and differentiated fate of retinal precursor cells in vivo and in vitro: Analysis with the “window- loss-of-function mutation (Pressman et al., 2000). Further labeling” technique. Dev. Biol. 178, 304–315. understanding of eye anterior segment morphogenesis Bernier, G., Panitz, F., Zhou, X., Hollemann, T., Gruss, P., and will clearly require the identification of target genes of Pieler, T. (2000). Expanded retina territory by midbrain transfor- key transcription factors and cellular processes that they mation upon overexpression of Six6 (Optx2) in Xenopus em- regulate. bryos. Mech. Dev. 93, 59–69.

Bovolenta, P., Mallamaci, A., and Boncinelli, E. (1996). Cloning and Genetics of Ocular Disease” (J. L. Wiggs, Ed.) pp. 51–82. Wiley- characterisation of two chick homeobox genes, members of the Liss, New York. six/sine oculis family, expressed during eye development. Int. J. Grainger, R. M. (1992). Embryonic lens induction: Shedding light Dev. Biol. (Suppl. 1), 73S–74S. on vertebrate tissue determination. Trends Genet. 8, 349–355. Bovolenta, P., Mallamaci, A., Puelles, L., and Boncinelli, E. (1998). Graw, J. (1996). Genetic aspects of embryonic eye development in Expression pattern of cSix3, a member of the Six/sine oculis vertebrates. Dev. Genet. 18, 181–197. family of transcription factors. Mech. Dev. 70, 201–203. Grindley, J. C., Davidson, D. R., and Hill, R. E. (1995). The role of Coulombre, A. J., and Coulombre, J. L. (1964). Lens development. Pax-6 in eye and nasal development. Development 121, 1433– The role of the lens in eye growth. J. Exp. Zool. 156, 39–48. 1442. Cheyette, B. N., Green, P. J., Martin, K., Garren, H., Hartenstein, Hamburger, V., and Hamilton, H. L. (1992). A series of normal V., and Zipursky, S. L. (1994). The Drosophila sine oculis locus stages in the development of the chick embryo. 1951. Dev. Dyn. encodes a homeodomain-containing protein required for the 195, 231–272. development of the entire visual system. Neuron 12, 977–996. Hill, R. E., Favor, J., Hogan, B. L., Ton, C. C., Saunders, G. F., Craig, J. E., and Mackey, D. A. (1999). Glaucoma genetics: Where Hanson, I. M., Prosser, J., Jordan, T., Hastie, N. D., and van are we? Where will we go? Curr. Opin. Ophthalmol. 10, 126– Heyningen, V. (1991). Mouse small eye results from mutations in 134. a paired-like homeobox-containing gene. Nature 354, 522–525. Dreyer, S. D., Zhou, G., Baldini, A., Winterpacht, A., Zabel, B., Hong, H. K., Lass, J. H., and Chakravarti, A. (1999). Pleiotropic Cole, W., Johnson, R. L., and Lee, B. (1998). Mutations in LMX1B skeletal and ocular phenotypes of the mouse mutation congeni- cause abnormal skeletal patterning and renal dysplasia in nail tal hydrocephalus (ch/Mf1) arise from a winged helix/forkhead patella syndrome. Nat. Genet. 19, 47–50. transcriptionfactor gene. Hum. Mol. Genet. 8, 625–637. Dunlevy, J. R., Neame, P. J., Vergnes, J. P., and Hassell, J. R. (1998). Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., and Sutrave, P. Identification of the N-linked oligosaccharide sites in chick (1987). Adaptor plasmids simplify the insertion of foreign DNA corneal lumican and keratocan that receive keratan sulfate. into helper-independent retroviral vectors. J. Virol. 61, 3004– J. Biol. Chem. 273, 9615–9621. 3012. Ericson, J., Rashbass, P., Schedl, A., Brenner-Morton, S., Kawakami, Irwin, M. H., Silvers, S. H., and Mayne, R. (1985). Monoclonal antibody against chicken type IX collagen: Preparation, charac- A., van Heyningen, V., Jessell, T. M., and Briscoe, J. (1997). Pax6 terization, and recognition of the intact form of type IX collagen controls progenitor cell identity and neuronal fate in response to secreted by chondrocytes. J. Cell Biol. 101, 814–823. graded Shh signaling. Cell 90, 169–180. Jean, D., Bernier, G., and Gruss, P. (1999). Six6 (Optx2) is a novel Fitch, J., Fini, M. E., Beebe, D. C., and Linsenmayer, T. F. (1998). murine Six3-related homeobox gene that demarcates the pre- Collagen type IX and developmentally regulated swelling of the sumptive pituitary/hypothalamic axis and the ventral optic avian primary corneal stroma. Dev. Dyn. 212, 27–37. stalk. Mech. Dev. 84, 31–40. Fitch, J. M., Mentzer, A., Mayne, R., and Linsenmayer, T. F. (1988). Johnston, M. C., Noden, D. M., Hazelton, R. D., Coulombre, J. L., Acquisition of type IX collagen by the developing avian primary and Coulombre, A. J. (1979). Origins of avian ocular and periocu- corneal stroma and vitreous. Dev. Biol. 128, 396–405. lar tissues. Exp. Eye Res. 29, 27–43. Funderburgh, J. L., Caterson, B., and Conrad, G. W. (1986). Keratan Kania, A., Johnson, R. L., and Jessell, T. M. (2000). Coordinate roles sulfate proteoglycan during embryonic development of the for LIM homeobox genes in directing the dorsoventral trajectory chicken cornea. Dev. Biol. 116, 267–277. of motor axons in the vertebrate limb. Cell 102, 161–173. Funderburgh, J. L., Stenzel-Johnson, P. R., and Chandler, J. W. Kawakami, K., Ohto, H., Takizawa, T., and Saito, T. (1996). (1982). Monoclonal antibodies to rabbit corneal keratan sulfate Identification and expression of six family genes in mouse retina. proteoglycan. Curr. Eye Res. 2, 769–776. FEBS Lett. 393, 259–263. Gage, P. J., and Camper, S. A. (1997). Pituitary homeobox 2, a novel Kawakami, K., Sato, S., Ozaki, H., and Ikeda, K. (2000). Six family member of the bicoid-related family of homeobox genes, is a genes: Structure and function as transcription factors and their potential regulator of anterior structure formation. Hum. Mol. roles in development. Bioessays 22, 616–626. Genet. 6, 457–464. Kidson, S. H., Kume, T., Deng, K., Winfrey, V., and Hogan, B. L. Gallardo, M. E., Lopez-Rios, J., Fernaud-Espinosa, I., Granadino, B., (1999). The forkhead/winged-helix gene, Mf1, is necessary for the Sanz, R., Ramos, C., Ayuso, C., Seller, M. J., Brunner, H. G., normal development of the cornea and formation of the anterior Bovolenta, P., and Rodriguez de Cordoba, S. (1999). Genomic chamber in the mouse eye. Dev. Biol. 211, 306–322. cloning and characterization of the human homeobox gene SIX6 Kobayashi, M., Nishikawa, K., Suzuki, T., and Yamamoto, M. reveals a cluster of SIX genes in chromosome 14 and associates (2001). The homeobox protein Six3 interacts with the Groucho SIX6 hemizygosity with bilateral anophthalmia and pituitary corepressor and acts as a transcriptional repressor in eye and anomalies. Genomics 61, 82–91. forebrain formation. Dev. Biol. 232, 315–326. Gavrieli, Y., Sherman, Y., and Ben-Sasson, S. A. (1992). Identifica- Kobayashi, M., Toyama, R., Takeda, H., Dawid, I. B., and tion of programmed cell death in situ via specific labeling of Kawakami, K. (1998). Overexpression of the forebrain-specific nuclear DNA fragmentation. J. Cell Biol. 119, 493–501. homeobox gene six3 induces rostral forebrain enlargement in Genis-Galvez, J. M. (1966). Role of the lens in the morphogenesis of zebrafish. Development 125, 2973–2982. the iris and cornea. Nature 210, 209–210. Kulak, S. C., Kozlowski, K., Semina, E. V., Pearce, W. G., and Genis-Galvez, J. M., Santos-Gutierrez, L., and Rios-Gonzalez, A. Walter, M. A. (1998). Mutation in the RIEG1 gene in patients (1967). Causal factors in corneal development: an experimental with iridogoniodysgenesis syndrome. Hum. Mol. Genet. 7, 1113– analysis in the chick embryo. Exp. Eye Res. 6, 48–56. 1117. Glaser, T., Walton, D. S., Cai, J., Epstein, J. A., Jepeal, L., and Maas, Lagutin, O., Zhu, C. C., Furuta, Y., Rowitch, D. H., McMahon, R. L. (1995). PAX6 gene mutations in aniridia. In “Molecular A. P., and Oliver, G. (2001). Six3 promotes the formation of

ectopic optic vesicle-like structures in mouse embryos. Dev. Oliver, G., Mailhos, A., Wehr, R., Copeland, N. G., Jenkins, N. A., Dyn. 221, 342–349. and Gruss, P. (1995). Six3, a murine homologue of the sine oculis Linsenmayer, T. F., Fitch, J. M., Gordon, M. K., Cai, C. X., Igoe, F., gene, demarcates the most anterior border of the developing Marchant, J. K., and Birk, D. E. (1998). Development and roles of neural plate and is expressed during eye development. Develop- collagenous matrices in the embryonic avian cornea. Prog. Retin. ment 121, 4045–4055. Eye Res. 17, 231–265. Pasquier, L., Dubourg, C., Blayau, M., Lazaro, L., Le Marec, B., Liu, C. Y., Shiraishi, A., Kao, C. W., Converse, R. L., Funderburgh, David, V., and Odent, S. (2000). A new mutation in the six- J. L., Corpuz, L. M., Conrad, G. W., and Kao, W. W. (1998). The domain of SIX3 gene causes holoprosencephaly. Eur. J. Hum. cloning of mouse keratocan cDNA and genomic DNA and the Genet. 8, 797–800. characterization of its expression during eye development. J. Pellegata, N. S., Dieguez-Lucena, J. L., Joensuu, T., Lau, S., Mont- Biol. Chem. 273, 22584–22588. gomery, K. T., Krahe, R., Kivela, T., Kucherlapati, R., Forsius, H., Logan, M., Pagan-Westphal, S. M., Smith, D. M., Paganessi, L., and and de la Chapelle, A. (2000). Mutations in KERA, encoding Tabin, C. J. (1998). The transcription factor Pitx2 mediates keratocan, cause cornea plana. Nat. Genet. 25, 91–95. situs-specific morphogenesis in response to left–right asymmet- Pignoni, F., Hu, B., Zavitz, K. H., Xiao, J., Garrity, P. A., and ric signals. Cell 94, 307–317. Zipursky, S. L. (1997). The eye-specification proteins So and Eya Loosli, F., Winkler, S., and Wittbrodt, J. (1999). Six3 overexpression form a complex and regulate multiple steps in Drosophila eye initiates the formation of ectopic retina. Genes Dev. 13, 649– development. Cell 91, 881–891. 654. Pressman, C. L., Chen, H., and Johnson, R. L. (2000). LMX1B, a LIM Lu, M. F., Pressman, C., Dyer, R., Johnson, R. L., and Martin, J. F. homeodomain class transcription factor, is necessary for normal (1999). Function of Rieger syndrome gene in left–right asymme- development of multiple tissues in the anterior segment of the try and craniofacial development. Nature 401, 276–278. murine eye. Genesis 26, 15–25. McIntosh, I., Dreyer, S. D., Clough, M. V., Dunston, J. A., Eyaid, Rada, J. A., Cornuet, P. K., and Hassell, J. R. (1993). Regulation of W., Roig, C. M., Montgomery, T., Ala-Mello, S., Kaitila, I., corneal collagen fibrillogenesis in vitro by corneal proteoglycan Winterpacht, A., Zabel, B., Frydman, M., Cole, W. G., Franco- (lumican and decorin) core proteins. Exp. Eye Res. 56, 635–648. mano, C. A., and Lee, B. (1998). Mutation analysis of LMX1B Reneker, L. W., Silversides, D. W., Xu, L., and Overbeek, P. A. gene in nail-patella syndrome patients. Am. J. Hum. Genet. 63, (2000). Formation of corneal endothelium is essential for anterior 1651–1658. segment development: A transgenic mouse model of anterior Mears, A. J., Jordan, T., Mirzayans, F., Dubois, S., Kume, T., Parlee, segment dysgenesis. Development 127, 533–542. M., Ritch, R., Koop, B., Kuo, W. L., Collins, C., Marshall, J., Riddle, R. D., Ensini, M., Nelson, C., Tsuchida, T., Jessell, T. M., Gould, D. B., Pearce, W., Carlsson, P., Enerback, S., Morissette, J., and Tabin, C. (1995). Induction of the LIM homeobox gene Lmx1 Bhattacharya, S., Hogan, B., Raymond, V., and Walter, M. A. by WNT7a establishes dorsoventral pattern in the vertebrate (1998). Mutations of the forkhead/winged-helix gene, FKHL7, in limb. Cell 83, 631–640. patients with Axenfeld–Rieger anomaly. Am. J. Hum. Genet. 63, Riddle, R. D., Johnson, R. L., Laufer, E., and Tabin, C. (1993). Sonic 1316–1328. hedgehog mediates the polarizing activity of the ZPA. Cell 75, Mishima, N., and Tomarev, S. (1998). Chicken Eyes absent 2 gene: 1401–1416. Isolation and expression pattern during development. Int. J. Dev. Rong, P. M., Ziller, C., Pena-Melian, A., and Le Douarin, N. M. Biol. 42, 1109–1115. (1987). A monoclonal antibody specific for avian early myogenic Morgan, B. A., and Fekete, D. M. (1996). Manipulating gene Dev. Biol. expression with replication-competent retroviruses. Methods cells and differentiated muscle. 122, 338–353. Cell Biol. 51, 185–218. Saleem, R. A., Banerjee-Basu, S., Berry, F. B., Baxevanis, A. D., and Muhr, J., Andersson, E., Persson, M., Jessell, T. M., and Ericson, J. Walter, M. A. (2001). Analyses of the effects that disease-causing (2001). Groucho-mediated transcriptional repression establishes missense mutations have on the structure and function of the progenitor cell pattern and neuronal fate in the ventral neural winged-helix protein FOXC1. Am. J. Hum. Genet. 68, 627–641. tube. Cell 104, 861–873. Sarkar, P. S., Appukuttan, B., Han, J., Ito, Y., Ai, C., Tsai, W., Chai, Nishimura, D. Y., Searby, C. C., Alward, W. L., Walton, D., Craig, Y., Stout, J. T., and Reddy, S. (2000). Heterozygous loss of Six5 in J. E., Mackey, D. A., Kawase, K., Kanis, A. B., Patil, S. R., Stone, mice is sufficient to cause ocular cataracts. Nat. Genet. 25, E. M., and Sheffield, V. C. (2001). A spectrum of FOXC1 muta- 110–114. tions suggests gene dosage as a mechanism for developmental Schedl, A., Ross, A., Lee, M., Engelkamp, D., Rashbass, P., van defects of the anterior chamber of the eye. Am. J. Hum. Genet. Heyningen, V., and Hastie, N. D. (1996). Influence of PAX6 gene 68, 364–372. dosage on development: Overexpression causes severe eye abnor- Nishimura, D. Y., Swiderski, R. E., Alward, W. L., Searby, C. C., malities. Cell 86, 71–82. Patil, S. R., Bennet, S. R., Kanis, A. B., Gastier, J. M., Stone, E. M., Semina, E. V., Reiter, R., Leysens, N. J., Alward, W. L., Small, K. W., and Sheffield, V. C. (1998). The forkhead transcription factor gene Datson, N. A., Siegel-Bartelt, J., Bierke-Nelson, D., Bitoun, P., FKHL7 is responsible for glaucoma phenotypes which map to Zabel, B. U., Carey, J. C., and Murray, J. C. (1996). Cloning and 6p25. Nat. Genet. 19, 140–147. characterization of a novel bicoid-related homeobox transcrip- Ohto, H., Kamada, S., Tago, K., Tominaga, S. I., Ozaki, H., Sato, S., tion factor gene, RIEG, involved in Rieger syndrome. Nat. Genet. and Kawakami, K. (1999). Cooperation of six and eya in activa- 14, 392–399. tion of their target genes through nuclear translocation of Eya. Shields, M. B. (1998). “Textbook of Glaucoma.” Williams & Mol. Cell. Biol. 19, 6815–6824. Wilkins, Baltimore. Oliver, G., Loosli, F., Koster, R., Wittbrodt, J., and Gruss, P. (1996). Smith, R. S., Zabaleta, A., Kume, T., Savinova, O. V., Kidson, S. H., Ectopic lens induction in fish in response to the murine ho- Martin, J. E., Nishimura, D. Y., Alward, W. L., Hogan, B. L., and meobox gene Six3. Mech. Dev. 60, 233–239. John, S. W. (2000). Haploinsufficiency of the transcription factors

FOXC1 and FOXC2 results in aberrant ocular development. Xu, P. X., Adams, J., Peters, H., Brown, M. C., Heaney, S., and Maas, Hum. Mol. Genet. 9, 1021–1032. R. (1999). Eyal-deﬁcient mice lack ears and kidneys and show Stoker, A. W., and Bissell, M. J. (1987). Quantitative immunocyto- abnormal apoptosis of organ primordia. Nat. Genet. 23, 113–117. chemical assay for infectious avian retroviruses. J. Gen. Virol. 68, Xu, P. X., Woo, I., Her, H., Beier, D. R., and Maas, R. L. (1997). 2481–2485. Mouse Eya homologues of the Drosophila eyes absent gene Toy, J., and Sundin, O. H. (1999). Expression of the optx2 homeobox require Pax6 for expression in lens and nasal placode. Develop- gene during mouse development. Mech. Dev. 83, 183–186. ment 124, 219–231. Toy, J., Yang, J. M., Leppert, G. S., and Sundin, O. H. (1998). The Yang, X. J., and Cepko, C. L. (1996). Flk-1, a receptor for vascular optx2 homeobox gene is expressed in early precursors of the eye endothelial growth factor (VEGF), is expressed by retinal progeni- and activates retina-speciﬁc genes. Proc. Natl. Acad. Sci. USA tor cells. J. Neurosci. 16, 6089–6099. 95, 10643–10648. Zhang, X. M., and Yang, X. J (2001). Temporal and spatial effects of Trainor, P. A., and Tam, P. P. (1995). Cranial paraxial mesoderm Sonic hedgehog signaling in chick eye morphogenesis. Dev. Biol. and neural crest cells of the mouse embryo: Co-distribution in 233, 271–290. the craniofacial mesenchyme but distinct segregation in Zhu, C. C., Dyer, M. A., Uchikawa, M., Kondoh, H., Lagutin, O. V., branchial arches. Development 121, 2569–2582. and Oliver, G. (2002). Six3-mediated auto repression and eye Vollrath, D., Jaramillo-Babb, V. L., Clough, M. V., McIntosh, I., development requires its interaction with members of the Scott, K. M., Lichter, P. R., and Richards, J. E. (1998). Loss-of- Groucho-related family of co-repressors. Development 129, function mutations in the LIM-homeodomain gene, LMX1B, in 2835–2849. nail-patella syndrome. Hum. Mol. Genet. 7, 1091–1098. Zuber, M. E., Perron, M., Philpott, A., Bang, A., and Harris, W. A. Wallis, D. E., Roessler, E., Hehr, U., Nanni, L., Wiltshire, T., (1999). Giant eyes in Xenopus laevis by overexpression of Richieri-Costa, A., Gillessen-Kaesbach, G., Zackai, E. H., Rom- XOptx2. Cell 98, 341–352. mens, J., and Muenke, M. (1999). Mutations in the homeodomain of the human SIX3 gene cause holoprosencephaly. Nat. Genet. Received for publication February 14, 2002 22, 196–198. Revised May 10, 2002 Wallis, D., and Muenke, M. (2000). Mutations in holoprosen- Accepted May 10, 2002 cephaly. Hum. Mutat. 16, 99–108. Published online July 9, 2002