Transcription Factor Networks Play a Key Role in Human Brain Evolution and Disorders

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Transcription factor networks play a key role in human brain evolution and disorders Von der Fakultät für Mathematik und Informatik der Universität Leipzig eingereichte Dissertation zur Erlangung des akademischen Grades Doctor rerum naturalium (Dr. rer. nat.) im Fachgebiet Informatik vorgelegt von Stefano Berto geboren am 24. Juli 1983 in Conegliano (Italien) Die Annahme Der Dissertation wurde empfohlen von: 1. Professor Dr. Erich Bornberg-Bauer (Universität Münster) 2. Professor Dr. Peter F. Stadler (Universität Leipzig) Die Verleihung des akademischen Grades erfolgt mit Bestehen der Verteidigung am 19. Januar 2016 mit dem Gesamtprädikat magna cum laude i ii Acknowledgments I would like to thank my supervisor Katja Nowick for her support, encouragement, and advice throughout my PhD. I am truly thankful to her also for giving me this amazing opportunity to work in such a dynamic and inspiring environment. With her discussions, suggestions, and motivations, I have been able to gain insight into primate and, in particular, brain evolution. I also feel privileged for being part of her group and its multicultural environment. I would like to thank Alvaro Perdomo Sabogal, Maria Beatriz Walter Costa, Sree Rohit Raj Kolora, Sabina Kanton, and all the undergraduate students Lisa, Sandra, Nadine, Anna, and Cladia for all their help during discussions and lab meetings. One particular thank you goes to our lab manager, Katja Jacob, who helped me and followed me during these past years solving problems in the laboratory and teaching me the techniques I am currently working with. I would also like to thank the entire bioinformatic department, with a special thanks to Mario Fasold, Gero Doose, Steve Hoffman, Daniel Gerighausen, Lydia Muller, Christian Arnold, and Lydia Hopp for all the support, help, and suggestions they gave me during my PhD. Finally, I am heavily thankful to my current supervisor, Genevieve Konopka, and her laboratory, the Konopka lab, at UT Southwestern Medical Center in Dallas, for their exceptional support during the last year with suggestions and help to understand better the molecular mechanisms of cognition and brain development. A special thanks also to my friend, Andrea Trevisiol, who has provided me with an amazing Italian coffee machine, an exceptional support during the last PhD year. iii Dedication This thesis is dedicated to my wife Arianna Martin and to my parents. Three amazing and wonderful great apes. Without their help and support, I would not have reached my goals. A special dedication also goes to my little Jackie, a silly dog who has put a smile on my face, even on the most stressed days. “Darwin wasn't just provocative in saying that we descend from the apes - he didn't go far enough. We are apes in every way, from our long arms and tailless bodies to our habits and temperament.” Frans de Waal, Emory University iv v Abstract Although the human brain has been studied over past decades at morphological and histological levels, much remains unknown about its molecular and genetic mechanisms. Furthermore, when compared with our closest relative the chimpanzee, the human brain strikingly shows great morphological changes that have been often associated with our cognitive specializations and skills. Nevertheless, such drastic changes in the human brain may have arisen not only through morphological changes but also through changes in the expression levels of genes and transcripts. Gene regulatory networks are complex and large-scale sets of protein interactions that play a fundamental role at the core of cellular and tissue functions. Among the most important players of such regulatory networks are transcription factors (TFs) and the transcriptional circuitries in which TFs are the central nodes. Over past decades, several studies have focused on the functional characterization of brain-specific TFs, highlighting their pathways, interactions, and target genes implicated in brain development and often disorders. However, one of the main limitations of such studies is the data collection which is generally based on an individual experiment using a single TF. To understand how TFs might contribute to such human-specific cognitive abilities, it is necessary to integrate the TFs into a system level network to emphasize their potential pathways and circuitry. This thesis proceeds with a novel systems biology approach to infer the evolution of these networks. Using human, chimpanzee, and rhesus macaque, we spanned circa 35 million years of evolution to infer ancestral TF networks and the TF-TF interactions that are conserved or shared in important brain regions. Additionally, we developed a novel method to integrate multiple TF networks derived from human frontal lobe next-generation sequencing data into a high confidence consensus network. In this study, we also vi integrated a manually curated list of TFs important for brain function and disorders. Interestingly, such “Brain-TFs” are important hubs of the consensus network, emphasizing their biological role in TF circuitry in the human frontal lobe. This thesis describes two major studies in which DNA microarray and RNA-sequencing (RNA-seq) datasets have been mined, directing the TFs and their potential target genes into co-expression networks in human and non-human primate brain genome-wide expression datasets. In a third study we functionally characterized ZEB2, a TF implicated in brain development and linked with Mowat-Wilson syndrome, using human, chimpanzee, and orangutan cell lines. This work introduces not only an accurate analysis of ZEB2 targets, but also an analysis of the evolution of ZEB2 binding sites and the regulatory network controlled by ZEB2 in great apes, spanning circa 16 million years of evolution. In summary, those studies demonstrated the critical role of TFs on the gene regulatory networks of human frontal lobe evolution and functions, emphasizing the potential relationships between TF circuitries and such cognitive skills that make humans unique. vii viii Contents INTRODUCTION ..................................................................................... 1 1.1 The primate brain: anatomical evolution ..................................... 1 1.2 The primate brain: molecular evolution ....................................... 4 1.3 Transcription factors ..................................................................... 7 1.4 Gene regulation played by transcription factors ........................ 8 1.5 Transcription factors in human .................................................. 10 1.6 Transcription factors and brain development........................... 12 1.7 Transcription factors and networks ........................................... 16 CHAPTERS ............................................................................................ 20 CHAPTER 1 ........................................................................................... 23 Project summary ................................................................................ 23 Introduction ........................................................................................ 24 Results ................................................................................................ 26 Lineage-specific expression pattern changes .......................... 26 TF networks in each species ....................................................... 27 Network evolution ........................................................................ 30 Species differences in the networks of other tissues .............. 33 Expression Changed Sub-Networks ........................................... 35 Discussion .......................................................................................... 38 Methods .............................................................................................. 41 CHAPTER 2 ........................................................................................... 47 Project summary ................................................................................ 47 Introduction ........................................................................................ 48 ix Results ............................................................................................... 51 Transcription factors in cognition, brain development and disorders ................................................................................. 51 Ten different genome-wide TFs co-expression networks .. 53 The consensus network ......................................................... 56 The Brain-TFs and their role in the consensus network .... 58 Discussion ......................................................................................... 62 Methods .............................................................................................. 67 CHAPTER 3 ............................................................................................ 73 Introduction ....................................................................................... 73 Results ............................................................................................... 75 Genomic distribution of ZEB2 binding in three great apes 75 ZEB2 mediated gene expression .......................................... 81 Discussion ......................................................................................... 83 Methods .............................................................................................. 86 Summary, conclusions, and future perspective
Recommended publications
  • Activation of ATM Depends on Chromatin Interactions Occurring Before Induction of DNA Damage

    Activation of ATM Depends on Chromatin Interactions Occurring Before Induction of DNA Damage

    LETTERS Activation of ATM depends on chromatin interactions occurring before induction of DNA damage Yong-Chul Kim1,6, Gabi Gerlitz1,6, Takashi Furusawa1, Frédéric Catez1,5, Andre Nussenzweig2, Kyu-Seon Oh3, Kenneth H. Kraemer3, Yosef Shiloh4 and Michael Bustin1,7 Efficient and correct responses to double-stranded breaks the KAP-1 protein9. The local and global changes in chromatin organiza- (DSB) in chromosomal DNA are crucial for maintaining genomic tion facilitate recruitment of damage-response proteins and remodelling stability and preventing chromosomal alterations that lead to factors, which further modify chromatin in the vicinity of the DSB and cancer1,2. The generation of DSB is associated with structural propagate the DNA damage response. Given the extensive changes in chro- changes in chromatin and the activation of the protein kinase matin structure associated with the DSB response, it could be expected ataxia-telangiectasia mutated (ATM), a key regulator of the that architectural chromatin-binding proteins, such as the high mobility signalling network of the cellular response to DSB3,4. The group (HMG) proteins, would be involved in this process10–12. interrelationship between DSB-induced changes in chromatin HMG is a superfamily of nuclear proteins that bind to chromatin architecture and the activation of ATM is unclear4. Here we show without any obvious specificity for a particular DNA sequence and affect that the nucleosome-binding protein HMGN1 modulates the the structure and activity of the chromatin fibre10,12,13. We have previ- interaction of ATM with chromatin both before and after DSB ously reported that HMGN1, an HMG protein that binds specifically to formation, thereby optimizing its activation.
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
  • Systematic Comparison of Sea Urchin and Sea Star Developmental Gene Regulatory Networks Explains How Novelty Is Incorporated in Early Development

    Systematic Comparison of Sea Urchin and Sea Star Developmental Gene Regulatory Networks Explains How Novelty Is Incorporated in Early Development

    ARTICLE https://doi.org/10.1038/s41467-020-20023-4 OPEN Systematic comparison of sea urchin and sea star developmental gene regulatory networks explains how novelty is incorporated in early development Gregory A. Cary 1,3,5, Brenna S. McCauley1,4,5, Olga Zueva1, Joseph Pattinato1, William Longabaugh2 & ✉ Veronica F. Hinman 1 1234567890():,; The extensive array of morphological diversity among animal taxa represents the product of millions of years of evolution. Morphology is the output of development, therefore phenotypic evolution arises from changes to the topology of the gene regulatory networks (GRNs) that control the highly coordinated process of embryogenesis. A particular challenge in under- standing the origins of animal diversity lies in determining how GRNs incorporate novelty while preserving the overall stability of the network, and hence, embryonic viability. Here we assemble a comprehensive GRN for endomesoderm specification in the sea star from zygote through gastrulation that corresponds to the GRN for sea urchin development of equivalent territories and stages. Comparison of the GRNs identifies how novelty is incorporated in early development. We show how the GRN is resilient to the introduction of a transcription factor, pmar1, the inclusion of which leads to a switch between two stable modes of Delta-Notch signaling. Signaling pathways can function in multiple modes and we propose that GRN changes that lead to switches between modes may be a common evolutionary mechanism for changes in embryogenesis. Our data additionally proposes a model in which evolutionarily conserved network motifs, or kernels, may function throughout development to stabilize these signaling transitions. 1 Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, PA 15213, USA.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Transcription Profiles of Age-At-Maturity-Associated Genes Suggest Cell Fate Commitment Regulation As a Key Factor in the Atlant

    Transcription Profiles of Age-At-Maturity-Associated Genes Suggest Cell Fate Commitment Regulation As a Key Factor in the Atlant

    INVESTIGATION Transcription Profiles of Age-at-Maturity- Associated Genes Suggest Cell Fate Commitment Regulation as a Key Factor in the Atlantic Salmon Maturation Process Johanna Kurko,*,† Paul V. Debes,*,† Andrew H. House,*,† Tutku Aykanat,*,† Jaakko Erkinaro,‡ and Craig R. Primmer*,†,1 *Organismal and Evolutionary Biology Research Programme, University of Helsinki, Helsinki, Finland, 00014, †Institute of Biotechnology, University of Helsinki, Helsinki, Finland, 00014, and ‡Natural Resources Institute Finland (Luke), Oulu, Finland, 90014 ORCID IDs: 0000-0002-4598-116X (J.K.); 0000-0003-4491-9564 (P.V.D.); 0000-0001-8705-0358 (A.H.H.); 0000-0002-4825-0231 (T.A.); 0000-0002-7843-0364 (J.E.); 0000-0002-3687-8435 (C.R.P.) ABSTRACT Despite recent taxonomic diversification in studies linking genotype with phenotype, KEYWORDS follow-up studies aimed at understanding the molecular processes of such genotype-phenotype Atlantic salmon associations remain rare. The age at which an individual reaches sexual maturity is an important fitness maturation trait in many wild species. However, the molecular mechanisms regulating maturation timing process processes remain obscure. A recent genome-wide association study in Atlantic salmon (Salmo salar) vgll3 identified large-effect age-at-maturity-associated chromosomal regions including genes vgll3, akap11 mRNA and six6, which have roles in adipogenesis, spermatogenesis and the hypothalamic-pituitary-gonadal expression (HPG) axis, respectively. Here, we determine expression patterns of these genes during salmon de- cell fate velopment and their potential molecular partners and pathways. Using Nanostring transcription pro- regulation filing technology, we show development- and tissue-specific mRNA expression patterns for vgll3, akap11 and six6. Correlated expression levels of vgll3 and akap11, which have adjacent chromosomal location, suggests they may have shared regulation.
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming

    Supplemental Materials ZNF281 Enhances Cardiac Reprogramming

    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
  • HMGB1 in Health and Disease R

    HMGB1 in Health and Disease R

    Donald and Barbara Zucker School of Medicine Journal Articles Academic Works 2014 HMGB1 in health and disease R. Kang R. C. Chen Q. H. Zhang W. Hou S. Wu See next page for additional authors Follow this and additional works at: https://academicworks.medicine.hofstra.edu/articles Part of the Emergency Medicine Commons Recommended Citation Kang R, Chen R, Zhang Q, Hou W, Wu S, Fan X, Yan Z, Sun X, Wang H, Tang D, . HMGB1 in health and disease. 2014 Jan 01; 40():Article 533 [ p.]. Available from: https://academicworks.medicine.hofstra.edu/articles/533. Free full text article. This Article is brought to you for free and open access by Donald and Barbara Zucker School of Medicine Academic Works. It has been accepted for inclusion in Journal Articles by an authorized administrator of Donald and Barbara Zucker School of Medicine Academic Works. Authors R. Kang, R. C. Chen, Q. H. Zhang, W. Hou, S. Wu, X. G. Fan, Z. W. Yan, X. F. Sun, H. C. Wang, D. L. Tang, and +8 additional authors This article is available at Donald and Barbara Zucker School of Medicine Academic Works: https://academicworks.medicine.hofstra.edu/articles/533 NIH Public Access Author Manuscript Mol Aspects Med. Author manuscript; available in PMC 2015 December 01. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Mol Aspects Med. 2014 December ; 0: 1–116. doi:10.1016/j.mam.2014.05.001. HMGB1 in Health and Disease Rui Kang1,*, Ruochan Chen1, Qiuhong Zhang1, Wen Hou1, Sha Wu1, Lizhi Cao2, Jin Huang3, Yan Yu2, Xue-gong Fan4, Zhengwen Yan1,5, Xiaofang Sun6, Haichao Wang7, Qingde Wang1, Allan Tsung1, Timothy R.
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
  • Supplemental Figure 1. Recombination Pattern of Six3-Cre in the Adult Retina and Brain

    Supplemental Figure 1. Recombination Pattern of Six3-Cre in the Adult Retina and Brain

    Supplemental Figure 1. Recombination pattern of Six3-cre in the adult retina and brain. The conditional reporter line, R26R, commences expression of β-galactosidase upon Cre-mediated recombination. The recombination pattern of the Six3-cre transgene in the retina on P21 reveals widespread recombination in all layers (A-C). At the retinal margin, areas devoid of recombination are apparent, as depicted by gaps in the X-gal staining pattern in this region (C, arrowheads). Co- immunolabeling using anti-Isl1 and anti-β-galactosidase reveals that most Isll+ cells in the INL co-localize with Six3-cre's lineage (D-F), although several Isl1+ cells are devoid of detectable reporter expression (D-F, arrowheads). At the retinal margin, many more Isl1+ cells devoid of detectable reporter expression are encountered (G-I, arrowheads). The recombination pattern of Six3-cre in the brain of P21 animals reveals widespread recombination in the hypothalamus, septum and striatum (J). Scale bar equals 50 µm in B (applies to B-C), in F (applies to D-F), in I (applies to G-I), and 1mm in J. Supplemental Figure 2. Additional cell marker expression in the Isl1-null retina. Isl1-null retinas display a 71% reduction in the expression of the RGC marker Pou4f1 (B) compared to control (A; average number of Pou4f1+ cells ± standard deviation: controls: 35 ± 7, n=3; Isl1-nulls: 10 ± 2, n=3, p<0.01, Student's t test). A slight 17% increase in the numbers of the horizontal cell marker, Calbindin-28K, in Isl1-null retinas is observed, although this change is not significant (compare C to D; average number of Calbindin-28K+ cells ± standard deviation: controls: 10 ± 2, n=4; Isl1-nulls: 12 ± 1, n=4, p=0.05, Student's t test).
  • Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic

    Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic

    Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association between BMI and Adult-Onset Non- Atopic Asthma Ayoung Jeong 1,2, Medea Imboden 1,2, Akram Ghantous 3, Alexei Novoloaca 3, Anne-Elie Carsin 4,5,6, Manolis Kogevinas 4,5,6, Christian Schindler 1,2, Gianfranco Lovison 7, Zdenko Herceg 3, Cyrille Cuenin 3, Roel Vermeulen 8, Deborah Jarvis 9, André F. S. Amaral 9, Florian Kronenberg 10, Paolo Vineis 11,12 and Nicole Probst-Hensch 1,2,* 1 Swiss Tropical and Public Health Institute, 4051 Basel, Switzerland; [email protected] (A.J.); [email protected] (M.I.); [email protected] (C.S.) 2 Department of Public Health, University of Basel, 4001 Basel, Switzerland 3 International Agency for Research on Cancer, 69372 Lyon, France; [email protected] (A.G.); [email protected] (A.N.); [email protected] (Z.H.); [email protected] (C.C.) 4 ISGlobal, Barcelona Institute for Global Health, 08003 Barcelona, Spain; [email protected] (A.-E.C.); [email protected] (M.K.) 5 Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain 6 CIBER Epidemiología y Salud Pública (CIBERESP), 08005 Barcelona, Spain 7 Department of Economics, Business and Statistics, University of Palermo, 90128 Palermo, Italy; [email protected] 8 Environmental Epidemiology Division, Utrecht University, Institute for Risk Assessment Sciences, 3584CM Utrecht, Netherlands; [email protected] 9 Population Health and Occupational Disease, National Heart and Lung Institute, Imperial College, SW3 6LR London, UK; [email protected] (D.J.); [email protected] (A.F.S.A.) 10 Division of Genetic Epidemiology, Medical University of Innsbruck, 6020 Innsbruck, Austria; [email protected] 11 MRC-PHE Centre for Environment and Health, School of Public Health, Imperial College London, W2 1PG London, UK; [email protected] 12 Italian Institute for Genomic Medicine (IIGM), 10126 Turin, Italy * Correspondence: [email protected]; Tel.: +41-61-284-8378 Int.
  • Brain Region-Dependent Gene Networks Associated with Selective Breeding for Increased Voluntary Wheel-Running Behavior

    Brain Region-Dependent Gene Networks Associated with Selective Breeding for Increased Voluntary Wheel-Running Behavior

    UC Riverside UC Riverside Previously Published Works Title Brain region-dependent gene networks associated with selective breeding for increased voluntary wheel-running behavior. Permalink https://escholarship.org/uc/item/8c49g8fd Journal PloS one, 13(8) ISSN 1932-6203 Authors Zhang, Pan Rhodes, Justin S Garland, Theodore et al. Publication Date 2018 DOI 10.1371/journal.pone.0201773 Peer reviewed eScholarship.org Powered by the California Digital Library University of California RESEARCH ARTICLE Brain region-dependent gene networks associated with selective breeding for increased voluntary wheel-running behavior Pan Zhang1,2, Justin S. Rhodes3,4, Theodore Garland, Jr.5, Sam D. Perez3, Bruce R. Southey2, Sandra L. Rodriguez-Zas2,6,7* 1 Illinois Informatics Institute, University of Illinois at Urbana-Champaign, Urbana, IL, United States of America, 2 Department of Animal Sciences, University of Illinois at Urbana-Champaign, Urbana, IL, United a1111111111 States of America, 3 Beckman Institute for Advanced Science and Technology, Urbana, IL, United States of a1111111111 America, 4 Center for Nutrition, Learning and Memory, University of Illinois at Urbana-Champaign, Urbana, a1111111111 IL, United States of America, 5 Department of Evolution, Ecology, and Organismal Biology, University of a1111111111 California, Riverside, CA, United States of America, 6 Department of Statistics, University of Illinois at Urbana-Champaign, Urbana, IL, United States of America, 7 Carle Woese Institute for Genomic Biology, a1111111111 University of Illinois at Urbana-Champaign, Urbana, IL, United States of America * [email protected] OPEN ACCESS Abstract Citation: Zhang P, Rhodes JS, Garland T, Jr., Perez SD, Southey BR, Rodriguez-Zas SL (2018) Brain Mouse lines selectively bred for high voluntary wheel-running behavior are helpful models region-dependent gene networks associated with for uncovering gene networks associated with increased motivation for physical activity and selective breeding for increased voluntary wheel- other reward-dependent behaviors.
  • Exclusion of Dlx5/6 Expression from the Distal-Most Mandibular Arches Enables BMP-Mediated Specification of the Distal Cap

    Exclusion of Dlx5/6 Expression from the Distal-Most Mandibular Arches Enables BMP-Mediated Specification of the Distal Cap

    Exclusion of Dlx5/6 expression from the distal-most mandibular arches enables BMP-mediated specification of the distal cap Joshua W. Vincentza, Jose J. Casasnovasa, Ralston M. Barnesb, Jianwen Quec, David E. Clouthierd, Jun Wange, and Anthony B. Firullia,1 aRiley Heart Research Center, Herman B. Wells Center for Pediatric Research Division of Pediatric Cardiology, Departments of Anatomy, Biochemistry, and Medical and Molecular Genetics, Indiana University Medical School, Indianapolis, IN 46202; bBiologics Discovery California, Bristol-Myers Squibb, Redwood City, CA 94063; cDepartment of Medicine, Columbia University Medical Center, New York, NY 10032; dDepartment of Craniofacial Biology, University of Colorado Anschutz Medical Campus, Aurora, CO 80108; and eDepartment of Molecular Physiology and Biophysics, Texas Heart Institute, Baylor College of Medicine, Houston, TX 77030 Edited by Clifford J. Tabin, Harvard Medical School, Boston, MA, and approved May 26, 2016 (received for review March 8, 2016) Cranial neural crest cells (crNCCs) migrate from the neural tube to Smads, H2, and GATA2/3 provide positive transcriptional inputs the pharyngeal arches (PAs) of the developing embryo and, sub- that serve to counteract the activity of Dlx proteins, thereby re- sequently, differentiate into bone and connective tissue to form the lieving EDN1-meditated repression. Together, these findings in- mandible. Within the PAs, crNCCs respond to local signaling cues to tegrate the communication between BMP and EDN1 signaling partition into the proximo-distally oriented subdomains that convey that establishes the distal cap of the mandible. positional information to these developing tissues. Here, we show that the distal-most of these subdomains, the distal cap, is marked Results by expression of the transcription factor Hand1 (H1) and gives rise to The H1Cre Lineage Gives Rise to the Lower Incisors, in a HAND Factor- the ectomesenchymal derivatives of the lower incisors.