DOCSLIB.ORG

A Dose Dependent Fashion

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Dose Dependent Fashion bioRxiv preprint doi: https://doi.org/10.1101/761064; this version posted September 9, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 ADNP promotes neural differentiation by modulating Wnt/β-catenin 2 signaling 3 Xiaoyun Sun1, Xixia Peng1, Yuqing Cao1, Yan Zhou2 & Yuhua Sun1* 4 5 Abstract 6 ADNP (Activity Dependent Neuroprotective Protein) is proposed as a neuroprotective 7 protein whose aberrant expression has been frequently linked to neural developmental 8 disorders, including the Helsmoortel-Van der Aa syndrome. However, its role in 9 neural development and pathology remains unclear. Using mESC (mouse embryonic 10 stem cell) directional neural differentiation as a model, we show that ADNP is 11 required for ESC neural induction and neuronal differentiation by maintaining Wnt 12 signaling. Mechanistically, ADNP functions to maintain the proper protein levels of 13 β-Catenin through binding to its armadillo domain which prevents its association with 14 key components of the degradation complex: Axin and APC. Loss of ADNP promotes 15 the formation of the degradation complex and hyperphosphorylation of β-Catenin by 16 GSK3β and subsequent degradation via ubiquitin-proteasome pathway, resulting in 17 down-regulation of key neuroectoderm developmental genes. We further show that 18 ADNP plays key role in cerebellar neuron formation. Finally, adnp gene disruption in 19 zebrafish embryos recapitulates key features of the mouse phenotype, including the 20 reduced Wnt signaling, defective embryonic cerebral neuron formation and the 21 massive neuron death. Thus, our work provides important insights into the role of 22 ADNP in neural development and the pathology of the Helsmoortel-Van der Aa 23 syndrome caused by ADNP gene mutation. 24 bioRxiv preprint doi: https://doi.org/10.1101/761064; this version posted September 9, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 25 Introduction 26 ADNP was first described as a neural protective protein and has been implicated in 27 various neural developmental disorders and cancers1. This protein contains nine zinc 28 fingers, a homeobox domain and a PxLxP motif, suggesting that it functions as a 29 transcription factor. The exact roles of ADNP remain unclear, but an increasing 30 number of studies have shown that it functions as a key chromatin regulator by 31 interacting with chromatin remodelers or regulators. For instances, ADNP interacts 32 with core sub-units of SWI/SNF chromatin remodeling complex such as BRG1 and 33 BAF2502. By association with the chromatin regulator HP1, ADNP localizes to 34 pericentromeric heterochromatin regions where it silences major satellite repeat 35 elements3. Recently, ADNP was shown to form a triplex with CHD4 and HP1 to 36 control the expression of lineage specifying genes in embryonic stem cells4. 37 Mouse Adnp mRNA is abundantly expressed during early gestation and reaches 38 its maximum expression on E9.5. Adnp-/- mice are early embryonic lethal, displaying 39 severe defects in neural tube closure and brain formation5. Of note, E8.5 Adnp mutant 40 embryos exhibited ectopic expression of pluripotency gene Pou5f1 and reduced 41 expression of neural developmental gene Pax6 in the anterior neural plate. These 42 observations strongly suggested that ADNP plays essential roles during neurogenesis 43 of mouse embryos. 44 De novo mutations in ADNP gene have recently been linked to neural 45 developmental disorders, including the Helsmoortel-Van der Aa syndrome6. Patients 46 display multiple symptoms, usually manifesting in early childhood with features such 47 as intellectual disability, facial dysmorphism, motor dysfunction and developmental bioRxiv preprint doi: https://doi.org/10.1101/761064; this version posted September 9, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 48 delay, which share many features with another neural developmental disorder: autism 49 spectrum disorder (ASD). In fact, ADNP has been proposed as one of the most 50 frequent ASD-associated genes as it is mutated in at least 0.17% of ASD cases7. In a 51 mouse model, haploinsufficiency of Adnp leads to defective neuronal/glial 52 formation and compromised cognitive function8. Due to the significant relevance of 53 ADNP to neural developmental disorders, it is of great interests and importance in the 54 field to elucidate the pathogenic mechanism by ADNP gene mutation6. 55 In this work, we hypothesized that loss of ADNP leads to neural developmental 56 defects. We took use of ES cell directional neural differentiation as a model system to 57 investigate the role of ADNP in embryonic neural development. We showed that 58 ADNP is required for proper neural induction by modulating Wnt/β-catenin signaling. 59 Mechanistically, ADNP functions to maintain protein levels of β-Catenin through 60 binding to its armadillo domain which prevents its interaction with key components of 61 degradation complex: Axin and APC. Loss of ADNP leads to hyperphosphorylation of 62 β-Catenin by GSK3β and subsequent degradation via ubiquitin-proteasome pathway, 63 resulting in down-regulation of neuroectoderm developmental genes. Small 64 molecule-mediated activation of Wnt signaling can rescue the defects by loss of 65 ADNP. This work provides important insights into the role of ADNP in neural 66 development which would be useful for understanding the pathology of the 67 Helsmoortel-Van der Aa syndrome caused by ADNP mutation. 68 . 69 70 bioRxiv preprint doi: https://doi.org/10.1101/761064; this version posted September 9, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 71 Results 72 Generation and characterization of Adnp-/- ESCs. To understand the molecular 73 function of ADNP, we generated Adnp mutant ESCs by using CRISPR/Cas9 74 technology. gRNAs were designed to target the 3' end of exon 4 of mouse Adnp gene 75 (Fig. 1a). We have successfully generated 2 Adnp mutant alleles (-4 and -5 bp), 76 revealed by DNA genotyping around the CRISPR targeting site (Fig. 1b). ADNP 77 protein was hardly detectable in Adnp-/- ESCs by Western blot using ADNP 78 antibodies from different resources (Fig. 1c), which strongly indicated that the mutant 79 alleles are functional nulls. 80 In the traditional self-renewal medium containing LIF-KSR plus FBS, the newly 81 established Adnp-/- ESC colonies overall exhibited typical ESC-like morphology (Fig. 82 1d). To understand how loss of Adnp affected the global gene expression, we 83 performed RNA-sequencing (RNA-seq) experiments for control and early passaged 84 Adnp-/- ESCs. Our RNA-seq analysis showed that the primitive endoderm genes such 85 as Gata6, Gata4, Sox17, Sox7 and Sparc were slightly up-regulated in the absence of 86 ADNP. However, loss of ADNP effects on pluripotency-related, mesodermal and 87 neuroectodermal genes were subtle. Our qRT-PCR and immunofluorescence assay 88 confirmed the RNA-seq results (Fig. 1e; Supplementary Fig. 1a). Consistently, 89 Adnp-/- ESCs can maintain self-renewal capacity for many generations before 90 eventually adopting a flatten morphology and exhibiting reduced alkaline phosphotase 91 activity (Supplementary Fig. 1b). Thus, our results indicated that acute ADNP 92 depletion in ESCs does not result in sudden and complete loss of self-renewal, while bioRxiv preprint doi: https://doi.org/10.1101/761064; this version posted September 9, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 93 prolonged ADNP depletion causes loss of ESC phenotype in the LIF/KSR medium. 94 To confirm that the observed phenotypes were not due to the possible off-target 95 effect of the CRISPR/Cas9 technology, we also reduced Adnp transcript levels in 96 ESCs by shRNA knockdown approach. The infection of lentivirus made from each of 97 the two individual shRNAs led to about 70-80% reduction of Adnp mRNA levels (Fig. 98 1c; Supplementary Fig. 1c). Adnp knockdown ESCs in the LIF-KSR medium 99 exhibited similar morphological characteristics and gene expression profile to Adnp-/- 100 ESCs, and could be passaged for many generations without obvious morphological 101 change (Supplementary Fig. 1d,e). 102 103 ADNP promotes ES cell directional neural differentiation. Next, we examined the 104 pluripotency of Adnp-/- ESCs by performing the classical embryoid bodies (EBs) 105 formation assay. Control ESCs were capable of forming large smooth spheroid EBs, 106 whereas Adnp-/- ESCs formed smaller rough disorganized structures (Fig. 1f). To 107 understand how loss of Adnp affected the global gene expression, we performed RNA 108 sequencing (RNA-seq) using day 6 EBs derived from control and Adnp-/- ESCs. A 109 total of 2,004 differentially expressed genes (DEGs) (log2 fold change>1.5 and p≤ 110 0.05) were identified based on two RNA-seq replicates. Of which, an average of 111 1,088 genes were significantly up-regulated and 916 genes were down-regulated. 112 Extra-embryonic endodermal genes such as Gata6, Gata4, Sox17, Sox7 and Foxa2 113 were substantially up-regulated, while pluripotency genes such as Nanog and Sox2, 114 and neural-ectodermal genes such as Pax6, Olig2, Sox1, Nestin and Wnt1 were bioRxiv preprint doi: https://doi.org/10.1101/761064; this version posted September 9, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 115 significantly down-regulated (Fig. 1g). Our qRT-PCR assay of selected genes 116 confirmed the RNA-seq results (Fig. 1h). Thus, based on the ESC-derived embryoid 117 body (EB) model, ADNP is required for the neuroectodermal differentiation of 118 mESCs, which was in line with the recent report4.
Load more

Recommended publications
  • Systematic Comparison of Sea Urchin and Sea Star Developmental Gene Regulatory Networks Explains How Novelty Is Incorporated in Early Development
    ARTICLE https://doi.org/10.1038/s41467-020-20023-4 OPEN Systematic comparison of sea urchin and sea star developmental gene regulatory networks explains how novelty is incorporated in early development Gregory A. Cary 1,3,5, Brenna S. McCauley1,4,5, Olga Zueva1, Joseph Pattinato1, William Longabaugh2 & ✉ Veronica F. Hinman 1 1234567890():,; The extensive array of morphological diversity among animal taxa represents the product of millions of years of evolution. Morphology is the output of development, therefore phenotypic evolution arises from changes to the topology of the gene regulatory networks (GRNs) that control the highly coordinated process of embryogenesis. A particular challenge in under- standing the origins of animal diversity lies in determining how GRNs incorporate novelty while preserving the overall stability of the network, and hence, embryonic viability. Here we assemble a comprehensive GRN for endomesoderm specification in the sea star from zygote through gastrulation that corresponds to the GRN for sea urchin development of equivalent territories and stages. Comparison of the GRNs identifies how novelty is incorporated in early development. We show how the GRN is resilient to the introduction of a transcription factor, pmar1, the inclusion of which leads to a switch between two stable modes of Delta-Notch signaling. Signaling pathways can function in multiple modes and we propose that GRN changes that lead to switches between modes may be a common evolutionary mechanism for changes in embryogenesis. Our data additionally proposes a model in which evolutionarily conserved network motifs, or kernels, may function throughout development to stabilize these signaling transitions. 1 Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, PA 15213, USA.
    [Show full text]
  • Transcription Profiles of Age-At-Maturity-Associated Genes Suggest Cell Fate Commitment Regulation As a Key Factor in the Atlant
    INVESTIGATION Transcription Profiles of Age-at-Maturity- Associated Genes Suggest Cell Fate Commitment Regulation as a Key Factor in the Atlantic Salmon Maturation Process Johanna Kurko,*,† Paul V. Debes,*,† Andrew H. House,*,† Tutku Aykanat,*,† Jaakko Erkinaro,‡ and Craig R. Primmer*,†,1 *Organismal and Evolutionary Biology Research Programme, University of Helsinki, Helsinki, Finland, 00014, †Institute of Biotechnology, University of Helsinki, Helsinki, Finland, 00014, and ‡Natural Resources Institute Finland (Luke), Oulu, Finland, 90014 ORCID IDs: 0000-0002-4598-116X (J.K.); 0000-0003-4491-9564 (P.V.D.); 0000-0001-8705-0358 (A.H.H.); 0000-0002-4825-0231 (T.A.); 0000-0002-7843-0364 (J.E.); 0000-0002-3687-8435 (C.R.P.) ABSTRACT Despite recent taxonomic diversification in studies linking genotype with phenotype, KEYWORDS follow-up studies aimed at understanding the molecular processes of such genotype-phenotype Atlantic salmon associations remain rare. The age at which an individual reaches sexual maturity is an important fitness maturation trait in many wild species. However, the molecular mechanisms regulating maturation timing process processes remain obscure. A recent genome-wide association study in Atlantic salmon (Salmo salar) vgll3 identified large-effect age-at-maturity-associated chromosomal regions including genes vgll3, akap11 mRNA and six6, which have roles in adipogenesis, spermatogenesis and the hypothalamic-pituitary-gonadal expression (HPG) axis, respectively. Here, we determine expression patterns of these genes during salmon de- cell fate velopment and their potential molecular partners and pathways. Using Nanostring transcription pro- regulation filing technology, we show development- and tissue-specific mRNA expression patterns for vgll3, akap11 and six6. Correlated expression levels of vgll3 and akap11, which have adjacent chromosomal location, suggests they may have shared regulation.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • A Heterozygous Microdeletion of 20Q13.13 Encompassing ADNP Gene in a Child with Helsmoortel–Van Der Aa Syndrome
    European Journal of Human Genetics (2018) 26:1497–1501 https://doi.org/10.1038/s41431-018-0165-8 ARTICLE A heterozygous microdeletion of 20q13.13 encompassing ADNP gene in a child with Helsmoortel–van der Aa syndrome 1,2 1 3 1 4 Minh-Tuan Huynh ● Elise Boudry-Labis ● Alfred Massard ● Caroline Thuillier ● Bruno Delobel ● 4 5 Bénédicte Duban-Bedu ● Catherine Vincent-Delorme Received: 8 September 2017 / Revised: 3 April 2018 / Accepted: 11 April 2018 / Published online: 13 June 2018 © European Society of Human Genetics 2018 Abstract Helsmoortel–van der Aa (SWI/SNF autism-related or ADNP syndrome) is an autosomal dominant monogenic syndrome caused by de novo variants in the last exon of ADNP gene and no deletions have been documented to date. We report the first case of a 3 years and 10 months old boy exhibiting typical features of ADNP syndrome, including intellectual disability, autistic traits, facial dysmorphism, hyperlaxity, mood disorder, behavioral problems, and severe chronic constipation. 60K Agilent array-comparative genomic hybridization (CGH) identified a heterozygous interstitial microdeletion at 20q13.13 chromosome region, encompassing ADNP and DPM1. Taking into account the clinical phenotype of previously reported cases with ADNP single-point variants, – – 1234567890();,: 1234567890();,: genotype phenotype correlation in the proband was established and the diagnosis of Helsmoortel van der Aa syndrome was made. Our report thus confirms that ADNP haploinsufficiency is associated with Helsmoortel–van der Aa syndrome as well as highlights the utility of whole-genome array-CGH for detection of unbalanced submicroscopic chromosomal rearrangements in routine clinical setting in patients with unexplained intellectual disability and/or syndromic autism.
    [Show full text]
  • Supplemental Figure 1. Recombination Pattern of Six3-Cre in the Adult Retina and Brain
    Supplemental Figure 1. Recombination pattern of Six3-cre in the adult retina and brain. The conditional reporter line, R26R, commences expression of β-galactosidase upon Cre-mediated recombination. The recombination pattern of the Six3-cre transgene in the retina on P21 reveals widespread recombination in all layers (A-C). At the retinal margin, areas devoid of recombination are apparent, as depicted by gaps in the X-gal staining pattern in this region (C, arrowheads). Co- immunolabeling using anti-Isl1 and anti-β-galactosidase reveals that most Isll+ cells in the INL co-localize with Six3-cre's lineage (D-F), although several Isl1+ cells are devoid of detectable reporter expression (D-F, arrowheads). At the retinal margin, many more Isl1+ cells devoid of detectable reporter expression are encountered (G-I, arrowheads). The recombination pattern of Six3-cre in the brain of P21 animals reveals widespread recombination in the hypothalamus, septum and striatum (J). Scale bar equals 50 µm in B (applies to B-C), in F (applies to D-F), in I (applies to G-I), and 1mm in J. Supplemental Figure 2. Additional cell marker expression in the Isl1-null retina. Isl1-null retinas display a 71% reduction in the expression of the RGC marker Pou4f1 (B) compared to control (A; average number of Pou4f1+ cells ± standard deviation: controls: 35 ± 7, n=3; Isl1-nulls: 10 ± 2, n=3, p<0.01, Student's t test). A slight 17% increase in the numbers of the horizontal cell marker, Calbindin-28K, in Isl1-null retinas is observed, although this change is not significant (compare C to D; average number of Calbindin-28K+ cells ± standard deviation: controls: 10 ± 2, n=4; Isl1-nulls: 12 ± 1, n=4, p=0.05, Student's t test).
    [Show full text]
  • Brain Region-Dependent Gene Networks Associated with Selective Breeding for Increased Voluntary Wheel-Running Behavior
    UC Riverside UC Riverside Previously Published Works Title Brain region-dependent gene networks associated with selective breeding for increased voluntary wheel-running behavior. Permalink https://escholarship.org/uc/item/8c49g8fd Journal PloS one, 13(8) ISSN 1932-6203 Authors Zhang, Pan Rhodes, Justin S Garland, Theodore et al. Publication Date 2018 DOI 10.1371/journal.pone.0201773 Peer reviewed eScholarship.org Powered by the California Digital Library University of California RESEARCH ARTICLE Brain region-dependent gene networks associated with selective breeding for increased voluntary wheel-running behavior Pan Zhang1,2, Justin S. Rhodes3,4, Theodore Garland, Jr.5, Sam D. Perez3, Bruce R. Southey2, Sandra L. Rodriguez-Zas2,6,7* 1 Illinois Informatics Institute, University of Illinois at Urbana-Champaign, Urbana, IL, United States of America, 2 Department of Animal Sciences, University of Illinois at Urbana-Champaign, Urbana, IL, United a1111111111 States of America, 3 Beckman Institute for Advanced Science and Technology, Urbana, IL, United States of a1111111111 America, 4 Center for Nutrition, Learning and Memory, University of Illinois at Urbana-Champaign, Urbana, a1111111111 IL, United States of America, 5 Department of Evolution, Ecology, and Organismal Biology, University of a1111111111 California, Riverside, CA, United States of America, 6 Department of Statistics, University of Illinois at Urbana-Champaign, Urbana, IL, United States of America, 7 Carle Woese Institute for Genomic Biology, a1111111111 University of Illinois at Urbana-Champaign, Urbana, IL, United States of America * [email protected] OPEN ACCESS Abstract Citation: Zhang P, Rhodes JS, Garland T, Jr., Perez SD, Southey BR, Rodriguez-Zas SL (2018) Brain Mouse lines selectively bred for high voluntary wheel-running behavior are helpful models region-dependent gene networks associated with for uncovering gene networks associated with increased motivation for physical activity and selective breeding for increased voluntary wheel- other reward-dependent behaviors.
    [Show full text]
  • Transcriptional and Post-Transcriptional Regulation of ATP-Binding Cassette Transporter Expression
    Transcriptional and Post-transcriptional Regulation of ATP-binding Cassette Transporter Expression by Aparna Chhibber DISSERTATION Submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Pharmaceutical Sciences and Pbarmacogenomies in the Copyright 2014 by Aparna Chhibber ii Acknowledgements First and foremost, I would like to thank my advisor, Dr. Deanna Kroetz. More than just a research advisor, Deanna has clearly made it a priority to guide her students to become better scientists, and I am grateful for the countless hours she has spent editing papers, developing presentations, discussing research, and so much more. I would not have made it this far without her support and guidance. My thesis committee has provided valuable advice through the years. Dr. Nadav Ahituv in particular has been a source of support from my first year in the graduate program as my academic advisor, qualifying exam committee chair, and finally thesis committee member. Dr. Kathy Giacomini graciously stepped in as a member of my thesis committee in my 3rd year, and Dr. Steven Brenner provided valuable input as thesis committee member in my 2nd year. My labmates over the past five years have been incredible colleagues and friends. Dr. Svetlana Markova first welcomed me into the lab and taught me numerous laboratory techniques, and has always been willing to act as a sounding board. Michael Martin has been my partner-in-crime in the lab from the beginning, and has made my days in lab fly by. Dr. Yingmei Lui has made the lab run smoothly, and has always been willing to jump in to help me at a moment’s notice.
    [Show full text]
  • Six3 Repression of Wnt Signaling in the Anterior Neuroectoderm Is Essential for Vertebrate Forebrain Development
    Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Six3 repression of Wnt signaling in the anterior neuroectoderm is essential for vertebrate forebrain development Oleg V. Lagutin,1 Changqi C. Zhu,1 Daisuke Kobayashi,2 Jacek Topczewski,3 Kenji Shimamura,2 Luis Puelles,4 Helen R.C. Russell,1 Peter J. McKinnon,1 Lilianna Solnica-Krezel,3 and Guillermo Oliver1,5 1Department of Genetics, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105-2794, USA; 2Department of Neurobiology, Graduate School of Medicine, University of Tokyo, Bunkyo-ku, Tokyo 113-0033, Japan; 3 Department of Biological Sciences, Vanderbilt University, Nashville, Tennessee 37232, USA; 4Department of Morphological Sciences, Faculty of Medicine, University of Murcia, E-30100 Murcia, Spain In vertebrate embryos, formation of anterior neural structures requires suppression of Wnt signals emanating from the paraxial mesoderm and midbrain territory. In Six3−/− mice, the prosencephalon was severely truncated, and the expression of Wnt1 was rostrally expanded, a finding that indicates that the mutant head was posteriorized. Ectopic expression of Six3 in chick and fish embryos, together with the use of in vivo and in vitro DNA-binding assays, allowed us to determine that Six3 is a direct negative regulator of Wnt1 expression. These results, together with those of phenotypic rescue of headless/tcf3 zebrafish mutants by mouse Six3, demonstrate that regionalization of the vertebrate forebrain involves repression of Wnt1 expression by Six3 within the anterior neuroectoderm. Furthermore, these results support the hypothesis that a Wnt signal gradient specifies posterior fates in the anterior neural plate. [Keywords: Six3; forebrain; mouse; homeobox; Wnt; zebrafish] Received November 15, 2002; revised version accepted December 9, 2002.
    [Show full text]
  • Lhx1 Maintains Synchrony Among Circadian Oscillator Neurons
    RESEARCH ARTICLE elifesciences.org Lhx1 maintains synchrony among circadian oscillator neurons of the SCN Megumi Hatori1*†‡, Shubhroz Gill1†, Ludovic S Mure1, Martyn Goulding2, Dennis D M O'Leary2, Satchidananda Panda1* 1Regulatory Biology Laboratory, Salk Institute for Biological Studies, La Jolla, United States; 2Molecular Neurobiology Laboratory, Salk Institute for Biological Studies, La Jolla, United States Abstract The robustness and limited plasticity of the master circadian clock in the suprachiasmatic nucleus (SCN) is attributed to strong intercellular communication among its constituent neurons. However, factors that specify this characteristic feature of the SCN are unknown. Here, we identified Lhx1 as a regulator of SCN coupling. A phase-shifting light pulse causes acute reduction in Lhx1 expression and of its target genes that participate in SCN coupling. Mice lacking Lhx1 in the SCN have intact circadian oscillators, but reduced levels of coupling factors. Consequently, the mice rapidly phase shift under a jet lag paradigm and their behavior rhythms gradually deteriorate under constant condition. Ex vivo recordings of the SCN from these mice showed rapid desynchronization of unit oscillators. Therefore, by regulating expression of genes mediating intercellular communication, Lhx1 imparts synchrony among SCN neurons and ensures consolidated rhythms of activity and rest that is resistant to photic noise. *For correspondence: mhatori@ DOI: 10.7554/eLife.03357.001 a6.keio.jp (MH); [email protected] (SP) †These authors contributed equally to this work Introduction Present address: ‡School of Circadian clocks generate ∼24 hr rhythms in behavior and physiology which allow an organism to Medicine, Keio University, Tokyo, anticipate and adjust to environmental changes accompanying the earth's day/night cycle.
    [Show full text]
  • ADNP Is a Therapeutically Inducible Repressor of WNT Signaling In
    Published OnlineFirst November 30, 2016; DOI: 10.1158/1078-0432.CCR-16-1604 Cancer Therapy: Preclinical Clinical Cancer Research ADNP Is a Therapeutically Inducible Repressor of WNT Signaling in Colorectal Cancer Cristina Blaj1, Agnes Bringmann1, Eva Marina Schmidt1, Manuela Urbischek1, Sebastian Lamprecht1, Thomas Frohlich€ 2, Georg J. Arnold2, Stefan Krebs2, Helmut Blum2, Heiko Hermeking1,3,4, Andreas Jung1,3,4, Thomas Kirchner1,3,4, and David Horst1,3,4 Abstract Purpose: Constitutively active WNT signaling is a hallmark Results: ADNP was overexpressed in colon cancer cells with of colorectal cancers and a driver of malignant tumor high WNT activity, where it acted as a WNT repressor. Silencing progression. Therapeutic targeting of WNT signaling is dif- ADNP expression increased migration, invasion, and prolifera- ficult due to high pathway complexity and its role in tissue tion of colon cancer cells and accelerated tumor growth in homeostasis. Here, we identify the transcription factor xenografts in vivo. Treatment with subnarcotic doses of ketamine ADNP as a pharmacologically inducible repressor of WNT induced ADNP expression, significantly inhibited tumor growth, signaling in colon cancer. and prolonged survival of tumor-bearing animals. In human Experimental Design: We used transcriptomic, proteomic, patients with colon cancer, high ADNP expression was linked to and in situ analyses to identify ADNP expression in colo- good prognosis. rectal cancer and cell biology approaches to determine its Conclusions: Our findings indicate that ADNP is a tumor function. We induced ADNP expression in colon cancer suppressor and promising prognostic marker, and that ketamine xenografts by low-dose ketamine in vivo.Clinicalassocia- treatment with ADNP induction is a potential therapeutic approach tions were determined in a cohort of 221 human colorectal that may add benefit to current treatment protocols for patients cancer cases.
    [Show full text]
  • Beta Cell Adaptation to Pregnancy Requires Prolactin Action on Both
    www.nature.com/scientificreports OPEN Beta cell adaptation to pregnancy requires prolactin action on both beta and non‑beta cells Vipul Shrivastava1, Megan Lee1, Daniel Lee1, Marle Pretorius1, Bethany Radford1, Guneet Makkar1 & Carol Huang1,2,3* Pancreatic islets adapt to insulin resistance of pregnancy by up regulating β‑cell mass and increasing insulin secretion. Previously, using a transgenic mouse with global, heterozygous deletion of prolactin receptor (Prlr+/−), we found Prlr signaling is important for this adaptation. However, since Prlr is expressed in tissues outside of islets as well as within islets and prolactin signaling afects β‑cell development, to understand β‑cell‑specifc efect of prolactin signaling in pregnancy, we generated a transgenic mouse with an inducible conditional deletion of Prlr from β‑cells. Here, we found that β‑cell‑specifc Prlr reduction in adult mice led to elevated blood glucose, lowed β‑cell mass and blunted in vivo glucose‑stimulated insulin secretion during pregnancy. When we compared gene expression profle of islets from transgenic mice with global (Prlr+/−) versus β‑cell‑specifc Prlr reduction (βPrlR+/−), we found 95 diferentially expressed gene, most of them down regulated in the Prlr+/− mice in comparison to the βPrlR+/− mice, and many of these genes regulate apoptosis, synaptic vesicle function and neuronal development. Importantly, we found that islets from pregnant Prlr+/− mice are more vulnerable to glucolipotoxicity‑induced apoptosis than islets from pregnant βPrlR+/− mice. These observations suggest that down regulation of prolactin action during pregnancy in non‑β‑cells secondarily and negatively afect β‑cell gene expression, and increased β‑cell susceptibility to external insults.
    [Show full text]
  • Sensory Reactivity Symptoms Are a Core Feature of ADNP Syndrome Irrespective of Autism Diagnosis
    G C A T T A C G G C A T genes Article Sensory Reactivity Symptoms Are a Core Feature of ADNP Syndrome Irrespective of Autism Diagnosis Paige M. Siper 1,2,3,*, Christina Layton 1,2, Tess Levy 1,2, Stacey Lurie 1,4, Nurit Benrey 1,4, Jessica Zweifach 1,2, Mikaela Rowe 5, Lara Tang 6, Sylvia Guillory 1,2, Danielle Halpern 1,2, Ivy Giserman-Kiss 7, Maria Del Pilar Trelles 1,2,3, Jennifer H. Foss-Feig 1,2, Silvia De Rubeis 1,2,3,8 , Teresa Tavassoli 9, Joseph D. Buxbaum 1,2,3,8,10,11 and Alexander Kolevzon 1,2,3,12 1 Seaver Autism Center for Research and Treatment, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA; [email protected] (C.L.); [email protected] (T.L.); [email protected] (S.L.); [email protected] (N.B.); [email protected] (J.Z.); [email protected] (S.G.); [email protected] (D.H.); [email protected] (M.D.P.T.); [email protected] (J.H.F.-F.); [email protected] (S.D.R.); [email protected] (J.D.B.); [email protected] (A.K.) 2 Department of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA 3 Mindich Child Health and Development Institute, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA 4 Ferkauf Graduate School of Psychology, Yeshiva University, Bronx, NY 10461, USA 5 Radiology and Biomedical Imaging, University of California San Francisco, San Francisco, CA 94143, USA; [email protected] 6 David Geffen School of Medicine at UCLA, Los Angeles, CA 90095, USA; [email protected] 7 Neurodevelopmental
    [Show full text]