MOLECULAR CHARACTERIZATION AND ALLELOPATHIC MANAGEMENT OF Meloidogyne incognita (KOFOID AND WHITE) CHITWOOD IN TOMATO
BY
ISHRAT NAZ
A dissertation submitted to The University of Agriculture, Peshawar in partial fulfillment of the requirement for the Degree of
DOCTOR OF PHILOSOPHY IN AGRICULTURE (PLANT PATHOLOGY)
DEPARTMENT OF PLANT PATHOLOGY FACULTY OF CROP PROTECTION SCIENCES THE UNIVERSITY OF AGRICULTURE, PESHAWAR, KHYBER PAKHTUNKHWA, PAKISTAN FEBRUARY, 2013 MOLECULAR CHARACTERIZATION AND ALLELOPATHIC MANAGEMENT OF Meloidogyne incognita (KOFOID AND WHITE) CHITWOOD IN TOMATO
BY
ISHRAT NAZ
A dissertation submitted to The University of Agriculture, Peshawar in partial fulfillment of the requirement for the Degree of
DOCTOR OF PHILOSOPHY IN AGRICULTURE (PLANT PATHOLOGY) Approved by:
______Chairman Supervisory Committee Prof. Dr. Saifullah
______Co-Supervisor Prof. Dr. M. Rafiullah Khan (Director Phytopharmaceutical & Nutraceutical Research Laboratory (PNRL), University of Peshawar
______Member Prof. Dr. Musharaf Ahmad
______Member Prof. Dr. Iftikhar Hussain Khalil
______Chairman & Convener Board of Studies Prof. Dr. Saifullah
______Dean, Faculty of Crop Protection Sciences Prof. Dr. Mian Inayatullah
______Director Advanced Studies and Research Prof. Dr. Farhatullah
DEPARTMENT OF PLANT PATHOLOGY FACULTY OF CROP PROTECTION SCIENCES THE UNIVERSITY OF AGRICULTURE, PESHAWAR, KHYBER PAKHTUNKHWA, PAKISTAN FEBRUARY, 2013
MOLECULAR CHARACTERIZATION AND ALLELOPATHIC MANAGEMENT OF Meloidogyne incognita (KOFOID AND WHITE) CHITWOOD IN TOMATO
By
ISHRAT NAZ
THESIS APPROVED BY:
EXTERNAL EXAMINER: ______
MOLECULAR CHARACTERIZATION AND ALLELOPATHIC MANAGEMENT OF Meloidogyne incognita (KOFOID AND WHITE) CHITWOOD IN TOMATO
BY
ISHRAT NAZ
THESIS APPROVED BY:
EXTERNAL EXAMINER: ______ACKNOWLEDGEMENTS
Allah Almighty bestowed upon me the capability to complete this task and I express my absolute gratitude to Him. I take pride in acknowledging my assiduous and humble supervisor Prof. Dr. Saifullah, Chairman Department of Plant Pathology, The University of Agriculture, Peshawar, for his cooperation, valuable suggestions, constructive criticism and providing me all facilities during the course of this research work. I express my thanks to Dr. Musharaf Ahmad, Department of Plant Pathology, The University of Agriculture, Peshawar for technically reviewing the manuscript and for agreeing to be on my advisory committee. I am highly grateful to my affectionate co-supervisor, Prof. Dr. M. Rafiullah Khan, Director Phytopharmaceutical and Neutraceutical Research Laboratory (PNRL), Institute of Chemical Sciences, University of Peshawar for providing me all the lab facilities, technical and scholarly guidance and helpful discussions during my three years period at the PNRL. I highly acknowledge the contribution of my co-supervisor and his team particularly in the NMR spectroscopy and structure elucidation of phytochemical compounds. I am pleased to acknowledge my foreign supervisor, Dr. Vivian Carol Blok, Principle Investigator in Plant Pathology and Nematology, Cell and Molecular Sciences, James Hutton Institute (JHI), Invergowrie, Scotland, UK, for providing me all the lab facilities, technical guidance and for treating me like her own family member during my six months stay at her institute. I am grateful to Dr. Juan. E. Palomares-Rius for providing me help and support in molecular work, sequencing and Dr. Jim for his valuable suggestions in statistical analysis. My heartiest thanks are extended to Dr. Sean Conner and Dr. Alexander at the JHI for helpful discussions and conduction of GC/MS analysis. I am highly indebted to the Higher Education Commission (HEC) of Pakistan, for financial support through indigenous (5000 PhD) fellowship program and for a visit to the James Hutton Institute under the International Research Support Initiative program (IRSIP) for six months. I am thankful to Mr. Sardar Ali, Assistant Professor, Department of Agriculture, Haripur University who stood as my PhD scholarship guarantor to the HEC. I am thankful to my parents, brothers, sisters and all those who assisted me in any way in the completion of this study. ISHRAT NAZ
i
MOLECULAR CHARACTERIZATION AND ALLELOPATHIC MANAGEMENT OF Meloidogyne incognita (KOFOID AND WHITE) CHITWOOD IN TOMATO
Ishrat Naz and Saifullah Department of Plant Pathology, Faculty of Crop Protection Sciences, The University of Agriculture, Peshawar, Pakistan February, 2013
ABSTARCT
Root knot nematodes (Meloidogyne spp.) are important obligate parasites attacking many vegetables, fruits and ornamentals worldwide. Nematode populations from thirty commercial production fields of tomato of Malakand division in the Khyber Pakhtunkhwa province of Pakistan showed wide variations within and among species using the perineal pattern morphology and molecular tools. Three species viz., Meloidogyne incognita, Meloidogyne javanica and Meolidogyne areanaria were found either alone or co-infesting tomato roots (80.3%) and soil (87.3%). Disease was prevalent 100% with an average of 52.0% in the study area. More than one root knot nematode species were found together in the same plant roots; however, Meloidogyne javanica, occurred with the highest frequency (70.33%).
A comprehensive molecular characterization of root knot nematode (RKN) populations belonging to ten localities of the Khyber Pakhtunkhwa province was carried out at the James Hutton Institute (JHI), Scotland, UK, employing the ribosomal DNA (rDNA) primers (D2A/D3B and 194/195) and species-specific SCAR primers i.e. Finc/Rinc (M. incognita), Fjav/Rjav (M. javanica) and Far/Rar (M. arenaria). Regardless of the species, the D2-D3 of 28S of rDNA gene and ITS2 region between 5S and 18S rDNA genes amplified the expected bands of approximately 750 bp and 720 bp, respectively common to all the populations tested. The SCAR primers generated species-specific bands of 1200, 670 and 420 bp in M. incognita, M. javanica and M. arenaria, respectively. Meloidogyne spp., were discriminated using mtDNA as an additional genetic marker. The C2F3/1108 primer pair amplified the COII/lrRNA region of mtDNA and produced a 1.7 Kb size band common to all the three species of RKNs except Meloidogyne chitwoodi (520 bp), Meloidogyne fallax (520 bp) and Meloidogyne enterolobii (750 bp), employed as negative control. Restriction digestion of the mtDNA-PCR product (1.7 Kb) with different 4-bp (Hinf 1, Taq 1, Mbo1, Alu 1) and 6-bp (Eco R1) restriction enzymes, amplified characteristic diagnostic patterns in each Meloidogyne spp., except the Taq1 enzyme which did not cleave the mtDNA-PCR product. The Hinf I generated three-banded diagnostic fragments (1700, 1300 and 400 bp) in M. incognita. The Mbo1 (viz., 1700, 1300, 1000, 720 and 520 bp) and Eco R1 (1700, 1200 and 520 bp) generated a five and three banded- pattern in all RKN populations respectively, whereas the Alu 1 enzyme produced frequent cuts in the mitochondrial genomes of all the three tested species. Genetic diversity among and within Meloidogyne species and populations were determined using the randomly amplified polymorphic (RAPD) DNA method. Three RAPD primers SC 10-30, OPG-13 and OPG-19 grouped the three mitotic species (Meloidogyne incognita, M. javanica, M. arenaria), in distinct separate cluster than the other species (M. chitwoodi, M. fallax, M. hapla and M. enterolobii) utilized as positive control. Meloidogyne javanica and M. arenaria were grouped more closely (50 %) than M. incognita (42.8 %). DNA sequencing
ii of the 28S rDNA gene fragment of selected eight nematode genotypes (T1, W2, M3, J3, F2, J4, R2 and H1) belonging to three species (M. javanica, M. incognita, M. arenaria) representing the Khyber Pakhtunkhwa province were deposited to the Genbank with accession numbers (JQ317912-19). The intra-specific variability ranged from 3 nucleotides (0.4% differences) (between J3 and T1) to 27 nucleotides (4.2 % differences) (between W2, M3 and J3) for M. javanica (636 bp alignment). Sequence analysis of D2- D3 expansion segment of 28S rDNA did not discriminate the three closely related Meloidogyne spp.
Juveniles and eggs of M. incognita were challenged in a series of in vitro experiments to plant extracts and pure compounds from a medicinal herb and annual weed, Fumaria parviflora Lam. The roots and stem crude extracts of the above plant showed the highest hatch inhibition (74.42 and 64.33%) and juvenile mortality (78.83 and 64.33%) against M. incognita at 12.5 mg mL-1. In in vitro experiments, the n-hexane extracts of the roots and stems showed the highest hatch inhibition (100%) and J2s mortality (100%). Hatch inhibition and J2s mortality were directly related to exposure time. The area under cumulative percentage hatch inhibition (AUCPHI) and mortality (AUCPM) were both augmented with increase in concentration. Silica gel column chromatography of the n- hexane and methanol fractions afforded eleven (F1 to F11) and seven (FM2.1 to FM2.7) sub-fractions, respectively. The F3 (98.77 %), F4 (90.25%) and FM2.1 (99.75%) exhibited the highest hatch inhibition at a concentration of 400 µg mL.-1 The J2s mortality for F3, F11, F4 and FM2.1 were 95.00, 88.25, 86.0 and 100%, respectively.
The phytochemical screening of F. parviflora revealed the presence of seven classes of bioactive compounds (viz., alkaloids, flavonoids, glycosides, tannins, saponins, steroids and phenols). The quantitative determination of the plant extracts showed the highest percentage of alkaloids (0.9 ± 0.04) and saponins (1.3 ± 0.07) in the roots and total phenolic contents in the stem (16.75 ± 0.07 µg dry g-1). Three known nematicidal bioactive compounds viz., nonacosane-10-ol, 23a-homostigmast-5-en-3ß-ol from the roots n-hexane fraction and cis- and trans- prtopinium from the MeOH roots fractions of F. parviflora were isolated through activity-guided isolation. These compounds were identified through 1H NMR and 13C-NMR, characterized and their physical properties determined. The 1H NMR and 13C NMR chemical shifts of cis-protopinium (minor) and trans-prtopinium (major) at 25 oC occurred in 2:1 and stability of trans-protopinium at 80 oC.
Stem and root extracts of F. parviflora were evaluated for possible nematicidal activity against M. incognita in a screen-house trials. In pot trials with tomato, cv. Riogrande, F. parviflora roots and stem extracts, at concentrations of 1000, 2000 and 3000 ppm, applied as a soil drench, significantly reduced the root knot nematode number of galls, galling index, eggs masses, eggs and reproduction factor in comparison to the water control. Regardless of the concentrations, the application of all the extracts significantly increased the host plant parameters. The n-hexane extracts from the roots and stem were the most effective followed by methanol at all concentrations. In a second screen-house experiment, dried plant parts (roots, stem, foliage and the whole plant powder) of F. parviflora evaluated under varying application doses (0, 10, 20 and 30 g kg-1) significantly reduced the disease parameters. The number of galls and galling index, egg masses g-1 of roots, eggs per egg mass, adult root knot nematode females and J2 population were decreased substantially. The root powder dramatically reduced the galls (46.63 and 61.13), galling indices (2.33 and 2.96) and J2s populations (122.1, 250.7) in the spring and fall, 2010 in
iii comparison to the control. The host plant growth parameters (shoot length, root length, fresh and dry shoot weight, number of branches plant-1 and number of flowers plant-1) increased significantly (P < 0.05).
Field performance of amending soil with F. parviflora (roots, stems, foliage and whole plant) at different application doses (0, 10, 20 and 30 g dry powder plant-1) around the tomato rhizosphere showed positive plant responses in the spring and fall, 2010. Number of galls (31.00 and 39.25) and GI (1.25 and 1.87) were markedly reduced with the Fumaria roots powder. The fresh shoot weight (55.00 and 53.0 g), dry shoot weight (27.00 and 29.0 g), shoot length (48.0 and 55.0 cm), root length (21.50 and 26.75 cm), number of branches plant-1 (20.0 and 22.50 branches plant-1), number of flowers plant-1 (65.0 and 69.50) and number of fruits plant-1 (57.25 and 55.25) were significantly higher (P < 0.05) in the field treatments amended with the roots powder at the highest application dose. Conversely, the disease was severe in the untreated control plots which negatively affected the plant growth parameters. Results revealed that plant extracts, pure compounds and dry powder of F. parviflora can be used for management of root knot nematodes. Extracts and pure compounds of F.parviflora provide new insight for the development bio-commercial nematicides, in addition, F. parviflora shows great potential as a bionematicide because of the richness and diversity of compounds effective against Meloidogyne spp.
iv LIST OF TABLES
Table No. Title Page No.
3.1. Root knot nematodes (Meloidogyne spp.) collected from major tomato growing areas of Khyber Pakhtunkhwa province of Pakistan..……………………………………… 41 Primer codes used for identification of Meloidogyne species, their sequences and 3.2. sources……………………………………..………...... 42
PCR amplification profiles used with different primers for the identification of 3.3. Meloidogyne species……………………………………………………………...... 42
The 4-bp restriction enzymes that digest COII/lRNA gene of mtDNA of three 3.4. Meloidogyne spp. and their sequences and positions of digestion……………………. 45 The 5-bp restriction enzymes that digest COII/lRNA gene of mtDNA of three 3.5. Meloidogyne spp.and their sequences and position of digestion...... 46 3.6. The 6-bp restriction enzymes that digest COII/lRNA gene of mtDNA of three Meloidogyne spp.and their sequence and positions of digestion……………………… 46 3.7. Field lay out of the spring and fall 2010 experiments conducted at Dargai fields.………………...... 65 4.1. Survey and identification of root knot nematodes collected from major tomato growing areas of Khyber Pakhtunkhwa province of Pakistan.……………………… 70 4.2. Molecular identification of root knot nematodes collected from Khyber Pakhtunkhwa Province of Pakistan………………………………….………………………………... 74 4.3. Restriction digestion patterns of three Pakistani Meloidogyne spp. for COII/lrRNA region of mt DNA with 4-bp and 6-bp restriction endonuclease……………………………………………………….………………….. 88 4.4. Population codes and summary of species identification of Pakistani RKN populations with three different RAPD pimers set…………………………………… 97 4.5. Genetic distance matrix of ten Meloidogyne populations belonging to three species... 98 4.6. Genetic distance matrix of similarities between and within M. javanica, M. incognita, M. arenaria, M. hapla, M. fallax, M. chitwoodi and M. enterolobii...... 99
v 1 13 5.1. H (500 MHz) and C (75 MHz) NMR in CDCl3 and HMBC Correlations of Nonacosan-10-ol (1)…………………………………………………………...... 103 1 13 5.2. H (400 MHz) and C (100 MHz) NMR in CDCl3 and HMBC Correlations
of 23a-homostigmast-5-en-3ß-ol (2)………………………………………………….. 107 1 13 o 5.3. H (400 MHz) and C (100 MHz) NMR in DMSO at 80 C and HMBC correlations
of trans-protopinium (ISH-02) (3)..………………………………………………...... 113 5.4. 1H-NMR and 13C-NMR comparison of ISH-02 with reported values of trans-
protopinium and cis-protopinium………………………………...... 114
5.5. 1H-NMR and 13C-NMR comparison of trans-protopinium and cis-protopinium components in ISH-02…………………………………….……………………...... 116 5.6. Phytochemical screening of different classes of compounds using four different solvent systems from the root and stem of Fumaria parviflora…………………….. 120 6.1. Area under cumulative percentage mortality and hatch inhibition percentage of Meloidogyne incognita over 72 h of incubation of roots extracts of Fumaria parviflora...... 130 6.2. Area under cumulative percentage mortality and hatch inhibition percentage of Meloidogyne incognita over 72 h of incubation of stem extracts of Fumaria parviflora ...... 131
7.1.1. Effect of root extracts of Fumaria parviflora on the number of galls plant-1 of tomato
infected with Meloidogyne incognita under screen house conditions………………… 141
7.1.2. Effect of root extracts of Fumaria parviflora on the galling index (GI) of tomato infected with Meloidogyne incognita under screen house conditions…………………. 142 -1 7.1.3. Effect of root extracts of Fumaria parviflora on the egg masses g of tomato roots infected with Meloidogyne incognita under screen house ………………...... 144 7.1.4. Effect of root extracts of Fumaria parviflora on the number of females g-1 of tomato roots infected with Meloidogyne incognita under green house conditions...... 145 7.1.5. Effect of root extracts of Fumaria parviflora on the fresh shoot weight of tomato infected with Meloidogyne incognita under screen house conditions……………...... 148 7.1.6. Effect of root extracts of Fumaria parviflora on fresh root weight of tomato infected with Meloidogyne incognita under screen house conditions…...... 151 7.2.1. Effect of stem extracts of Fumaria parviflora on number of galls plant-1 of tomato
vi infected Meloidogyne incognita in tomato under screen house conditions …………... 158 7.2.2. Effect of stem extracts of Fumaria parviflora on fresh root weight infected with Meloidogyne incognita in tomato under screen house conditions…………………….. 169 7.2.3. Effect of stem extracts of Fumaria parviflora on number of branches plant-1 infected with Meloidogyne incognita in tomato under screen house conditions…...... 171 7.2.4. Effect of stem extracts of Fumaria parviflora on plant height infected with Meloidogyne incognita in tomato under screen house conditions...... 172 7.3.1. Effect of dry powder of Fumaria parviflora on number of galls plant-1 of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010)…………………………………………………………………………...... 175 7.3.2 Effect of dry powder of Fumaria parviflora on galling index of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010)…………………………………………………………………………………… 176 7.3.3. Effect of dry powder of Fumaria parviflora on egg masses g-1 of tomato roots infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010) ………………………………..…………………...... 178 7.3.4. Effect of dry powder of Fumaria parviflora on eggs per egg mass of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010)……………...……………………………...…………………...... 179 7.3.5. Effect of dry powder of Fumaria parviflora on number of adult female g-1 of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010)……………………………………………………………...... 181 7.3.6 Effect of dry powder of Fumaria parviflora on number of juveniles in 100 cm3 soil of tomato plant infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010)…………………………………………………………………. 182 7.3.7. Effect of dry powder of Fumaria parviflora on shoot length of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010)……… 184 7.3.8. Effect of dry powder of Fumaria parviflora on root length of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010)……… 185
vii 7.3.9. Effect of dry powder of Fumaria parviflora on fresh shoot weight of tomato infected with Meloidogyne incognita under screen house conditions………………...... 186 7.3.10. Effect of dry powder of Fumaria parviflora on shoot dry weight of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010)….. 188 7.3.11. Effect of dry powder of Fumaria parviflora on number of branches plant-1 of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010). ………………………………...…………………...... 189 7.3.12. Effect of dry powder of Fumaria parviflora on number of flowers plant-1 of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010). ………………………………...…………………...... 190 7.4.1. Effect of dry powder of Fumaria parviflora on number of galls plant-1 of tomato infected with Meloidogyne incognita under naturally infested field conditions of Dargai (spring and fall, 2010)…………………………………………………………. 192 7.4.2. Effect of dry powder of Fumaria parviflora on galling index plant-1 of tomato infected with Meloidogyne incognita under naturally infested field conditions of Dargai (spring and fall, 2010)………………………………………………………... 193 7.4.3. Effect of dry powder of Fumaria parviflora on egg masses g-1 of tomato infected with Meloidogyne incognita under naturally infested field conditions of Dargai (spring and fall, 2010)……………………………………………………………...... 195 7.4.4. Effect of dry powder of Fumaria parviflora on eggs egg mass-1 of tomato infected with Meloidogyne incognita under naturally infested field conditions of Dargai (spring and fall, 2010)……………………………………………………………...... 196 7.4.5 Effect of dry powder of Fumaria parviflora on number of adult females g-1 of tomato infected with Meloidogyne incognita under naturally infested field conditions of Dargai (spring and fall, 2010)…………………………………………………………. 197 7.4.6 Effect of dry powder of Fumaria parviflora on number of initial nematode population 100 g-1 of soil infected with Meloidogyne incognita under naturally infested field conditions of Dargai (spring and fall, 2010)…………………………..... 199 7.4.7 Effect of dry powder of Fumaria parviflora on number of final nematode population 100 g-1 of soil infected with Meloidogyne incognita under naturally infested field conditions of Dargai (spring and fall, 2010)…………………………………………. 201
viii 7.4.8 Effect of dry powder of Fumaria parviflora on fresh shoot weight of tomato infected with Meloidogyne incognita under naturally infested field conditions of Dargai (spring and fall, 2010)………………………………………………………...... 202 7.4.9 Effect of dry powder of Fumaria parviflora on dry shoot weight of tomato infected with Meloidogyne incognita under naturally infested field conditions of Dargai (spring and fall, 2010)………………………………………………………………... 203 7.4.10 Effect of dry powder of Fumaria parviflora on fresh root weight of tomato infected with Meloidogyne incognita under naturally infested field conditions of Dargai (spring and fall, 2010)………………………………………………………………... 205 7.4.11 Effect of dry powder of Fumaria parviflora on fresh shoot length of tomato infected with Meloidogyne incognita under naturally infested field conditions of Dargai (spring and fall, 2010)…………………………...…………………………………… 206 7.4.12 Effect of dry powder of Fumaria parviflora on root length of tomato infected with Meloidogyne incognita under naturally infested field conditions of Dargai (spring and fall, 2010)…………………………...…………………………………………………. 207 7.4.13 Effect of dry powder of Fumaria parviflora on number of branches plant-1 of tomato infected with root knot nematodes under naturally infested field conditions of Dargai (spring and fall, 2010)…………………………………………………….. 210 7.3.14. Effect of dry powder of Fumaria parviflora on number of flowers plant-1 of tomato infected with root knot nematodes under naturally infested field conditions of Dargai (spring and fall,2010)…………………………………………………………………. 211 7.4.15. Effect of dry powder of Fumaria parviflora on number of fruits plant-1 of tomato infected with root knot nematodes under naturally infested field conditions of Dargai (spring and fall, 2010)………………………………………………………………… 212 7.4.16. Effect of dry powder of Fumaria parviflora on fruits weight (kg) plant-1 of tomato infected with root knot nematodes under naturally infested field conditions of Dargai (spring and fall, 2010)…………………………………………………………. 213
ix LIST OF FIGURES
Figure No. Title Page No.
2.1. Chemical structures of selected phytochemicals with nematotoxic activity ……… 26 2.2. Structures of selected alkaloids of Fumaria parviflora ………………………...... 32 2.3. Structures of selected alkaloids of Fumaria parviflora …………………………… 33 3.1. General scheme for the extraction of stem and roots of Fumaria parviflora………. 5 1 3.2. Schematic pathway for the isolation of compounds from n-hexane root extract of Fumaria parviflora………………………………………………………………… 53 3.3. Scheme for the isolation of alkaloids from the methanol (MeOH) fraction of the roots of Fumaria parviflora……………………………………………...... 54 4.1. The % frequency of three Meloidogyne spp. collected from tomato growing fields of Khyber Pakhtunkhwa, Pakistan………………………………………………. 69 4.2. Perineal patterns of adult females observed in Pakistani populations…………… 72 4.3(A) PCR amplification products of using primers D2A/D3B with DNA extracted from single females of ten populations from Pakistan….………...... 75 4.3(B) PCR amplification products of using primers D2A/D3B with DNA extracted from single females of ten populations from Pakistan...... 75 4.4. PCR amplification products of using primers 194/195 with DNA extracted from single females of ten populations from Pakistan. ….………………...…………….. 76 4.5. PCR amplification products of using Fjav/Rjav (M. javanica Specific SCAR primers) with DNA extracted from single females from ten RKN populations………………………………………………...... 76 4.6. PCR amplification products of using Finc/Rinc (Meloidogyne incognita specific SCAR primers) with DNA extracted from single females from three RKN populations ………………………………………………………………………… 77 4.7. Amplification products (420 bp SCAR fragment) of PCR reactions using Far/Rar (M. arenaria specific SCAR primers) with DNA extracted from single females from three RKN populations…….………………...... 77
x 4.8. Amplification products of PCR reactions using Fjav/Rjav (M. javanica), Finc/Rinc (M. incognita) and Far/Rar (M. arenaria) specific SCAR primers with DNA extracted from single females from eleven RKN populations………….………….. 78 4.9. Amplified PCR products of COII/lrRNA region of mtDNA (Meloidogyne spp.) with DNA extracted from single females from ten RKN populations …………….. 79 4.10. D2 and D3 expansion region of the 28S rDNA nuclear region gene PCR product aligned sequences from eight individual nematodes of three Meloidogyne spp. collected from major tomato growing areas of the Khyber Pakhtunkhwa, Pakistan…………………………………………………………………………….. 80 4.11. Restriction enzyme digestion of COII/lrRNA region of M. incognita, M javanica and M. arenaria, using 4-bp cutter Hinf 1…………….……………………………. 85 4.12. Restriction enzyme digestion of COII/lrRNA region of M. incognita, M. javanica and M. arenaria, using 4-bp cutter Taq 1 ………………………………………… 85 4.13. Restriction enzyme digestion of COII/lrRNA region of M. incognita, M. javanica and M. arenaria, using 4-bp cutter Mbo 1 ………………………………………… 86 4.14. Restriction enzyme digestion of COII/lrRNA region of M. incognita, M. javanica and M. arenaria, using 6-bp cutter Eco R 1 ……….……………………………… 86 4.15. Restriction enzyme digestion of COII/lrRNA region of M. incognita, M. javanica and M. arenaria, using 4-bp cutter Alu 1…………….…………………………….. 87 4.16. RAPD patterns using primers SC 10-30 obtained from single females of three Meloidogyne spp.from independent PCR reactions. ……………………… 90 4.17 (A) RAPD patterns using primers OPG-13 obtained from single females belonging to three Meloidogyne spp. from independent PCR reactions. …………………….. 91 4.17 B) RAPD patterns using primers OPG-13 obtained from single females belonging to two Meloidogyne spp. from independent PCR reactions……...... 91 4.17 (C) RAPD patterns using primers OPG-13 obtained from single females belonging to seven Meloidogyne spp. from independent PCR reactions………………………... 92 4.18 (A) RAPD patterns using primers OPG-19 obtained from single female belonging to three Meloidogyne spp. from independent PCR reactions…………...... 93 4.18 (B) RAPD patterns using primers OPG-19 obtained from single females belonging to two Meloidogyne spp., from independent PCR reaction……………...... 93
xi 4.19. Consensus dendrogram of Meloidogyne populations generated from the RAPD data from 35 lines of Meloidogyne spp., using dendro UPGMA software. …….. 96 5.1.1. Nonacosane-10-ol…………………………………………………………………. 100 5.1.2. Possible fragmentation pathway of nonacosane-10-ol (ISH-03)……………...... 102 5.1.3. HMBC Correlation of nonacosane-10-ol……………………………………...... 104 5.1.4. COSY Correlation of nonacosan-10-ol……………………………………………. 104 5.2.1. 23a-Homostigmast-5-en-3ß-ol (ISH-034)…………………………………………. 105 5.2.2 HMBC Correlation of 23a-homostigmast-5-en-3ß-ol (ISH-034)………………….. 108 5.2.3. COSY Correlation of 23a-homostigmast-5-en-3ß-ol (ISH-034)……………...... 109 5.3.1 Possible fragmentation pathway of Trans-ptotopinium (ISH-02)…………………. 111 5.3.2 Structure of Trans-protopinium (ISH-02)…………………………………………. 112 5.3.3. HMBC correlations of Trans-protopinium (ISH-02)…………………………….... 115 5.3.4 COSY correlations of Trans-protopinium (ISH-02)………………………………. 115 5.3.5 Trans-protopinium…………………………………………………………………. 118 5.3.6. Cis-protopinium……………………………………………………………………. 118 5.4. Standard curve for different concentrations of roots and stem extracts of Fumaria parviflora and their absorption measured at 760 nm………………………………. 119 6.1(A) In vitro effect of Fumaria parviflora crude extracts on egg hatch inhibition percent of M. incognita………………………………………………………………………….. 122 6.1 (B) In vitro effect of different concentrations of Fumaria parviflora on egg hatch percent inhibition of M. incognita………………………………………………..... 122 6.2 (A) In vitro effect of Fumaria parviflora crude extracts on J2s percent mortality of M. incognita…………………………………………………………………………… 123 6.2 (B) In vitro effect of different concentrations of Fumaria parviflora on J2s percent mortality of M. incognita…………………………………………………………... 123 6.3. Cumulative hatch inhibition of Meloidogyne incognita over 72 h incubation at 27 -1 ºC in a series of concentrations (expressed in mg mL ) of the root extracts from Fumaria parviflora. ……………………………………………………………...... 125 6.4. Cumulative hatch inhibition of Meloidogyne incognita over 72 h incubation at 27 -1 ºC in a series of concentrations (expressed in mg mL ) of the stem extracts from Fumaria parviflora. ………………………………………………………………. 126
xii 6.5. Cumulative mortality of Meloidogyne incognita over 72 h incubation at 27 ºC in a series of concentrations (expressed in mg mL-1) of the root extracts from Fumaria parviflora. ………………………………………………………...... 127 6.6. Cumulative mortality of Meloidogyne incognita over 72 h incubation at 27 ºC in a series of concentrations (expressed in mg mL-1) of the root extracts from Fumaria parviflora. …………………………………………………………………………. 128 6.7. In vitro effect of the root n-hexane fractions of Fumaria parviflora on egg hatching inhibition (%) of M. incognita…………………………………………… 132 6.8. In vitro effect of the root n-hexane fractions on egg hatch percent inhibition of M. incognita…………………………………...... 132 6.9. In vitro interaction effect between root n-hexane fractions and four different concentrations on egg hatch percent inhibition of M. incognita………………….. 133 6.10 In vitro effect of root n-hexane fractions of Fumaria parviflora on percent J2s mortality of M. incognita………………………………………………………… 133 6.11 In vitro effect of root n-hexane fractions at four different concentrations on percenr J2s mortality of M. incognita…..………………………………………… 135 6.12 In vitro interaction effect between root n-hexane fractions and four different concentrations on percent J2s mortality of M. incognita………………………… 135 6.13. In vitro effect of the MeOH fractions of the roots of Fumaria parviflora on percent egg hatching inhibition of M. incognita…………………………………... 136 6.14. In vitro effect of MeOH fractions of the roots at four different concentrations on percent egg hatch inhibition of M. incognita……………………………………… 136 6.15. In vitro interaction effect between MeOH fractions of the roots of Fumaria parviflora and four concentrations on percent egg hatching inhibition of M. incognita………………………………………………………………………...... 137 6.16. In vitro effect of the MeOH fractions of the roots of Fumaria parviflora on perncet J2s mortality of M. incognita……………………………………………… 137 6.17. In vitro effect of the MeOH fractions of roots at four different concentrations on percent J2s mortality of M. incognita……………………………………………… 139 6.18. In vitro interaction effect between MeOH fractions of the roots of Fumaria parviflora and four concentrations on percent J2s mortality of M.
xiii incognita……………………………………………………………………………….. 139 7.1.1. Effect of root extracts of Fumaria parviflora on eggs g-1 of tomato roots infected with Meloidogyne incognita under screen house conditions in spring, 2010……………………………………………………………………………….. 147 7.1.2. Effect of root extracts of Fumaria parviflora on eggs g-1 of tomato roots infected with Meloidogyne incognita under screen house conditions in fall, 2010……………………………………………………………………………….. 147 7.1.3. Effect of root extracts of Fumaria parviflora on dry shoot weight of tomato infected with Meloidogyne incognita under screen house conditions in spring, 2010……………………………………………………………………………….. 150 7.1.4. Effect of root extracts of Fumaria parviflora on dry shoot weight of tomato infected with Meloidogyne incognita under screen house conditions in fall, 2010………………………………………………………………………………… 150 7.1.5. Effect of root extracts of Fumaria parviflora on number of branches of tomato infected with Meloidogyne incognita under screen house conditions in spring, 2010………………………………………………………………………………. 154 7.1.6. Effect of root extracts of Fumaria parviflora on number of branches of tomato infected with Meloidogyne incognita under screen house conditions in fall, 2010……………………………………………………………………………….. 1 5 4 7.1.7. Effect of root extracts of Fumaria parviflora on plant height of tomato infected with Meloidogyne incognita under screen house conditions in spring, 2010…………………………………………………………………………...... 155 7.1.8. Effect of root extracts of Fumaria parviflora on plant height of tomato infected with Meloidogyne incognita under screen house conditions in fall, 155 2010………………………………………………………………………………...
7.1.9. Effect of root extracts of Fumaria parviflora on the reproduction factor (Rf) of tomato infected with Meloidogyne incognita under screen house conditions in 156 spring, 2010………………………………………………………………………...
7.1.10 Effect of root extracts of Fumaria parviflora on the reproduction factor (Rf) of tomato infected with Meloidogyne incognita under screen house conditions in fall, 156 2010…………………………………………………………………………………
xiv 7.2.1. Effect of stem extracts of Fumaria parviflora on galling index of tomato infected with Meloidogyne incognita under screen house conditions in spring, 159 2010………………………………………………………………………………... 7.2.2. Effect of stem extracts of Fumaria parviflora on galling index of tomato infected with Meloidogyne incognita under screen house conditions in fall, 159 2010……………………………………………………………………………….. 7.2.3. Effect of stem extracts of Fumaria parviflora on egg masses g-1 of tomato roots infected with Meloidogyne incognita under screen house conditions in spring, 161 2010………………………………………………………………………………... 7.2.4. Effect of stem extracts of Fumaria parviflora on egg masses g-1 of tomato roots infected with Meloidogyne incognita under screen house conditions in fall, 161 2010………………………………………………………………………………... 7.2.5. Effect of stem extracts of Fumaria parviflora on number of females g-1 of tomato roots infected with Meloidogyne incognita under screen house conditions in 163 spring, 2010…..……………………………………………………………………. 7.2.6. Effect of stem extracts of Fumaria parviflora on number of females g-1 of tomato roots infected with Meloidogyne incognita under screen house conditions in fall, 163 2010………………...……………………………………………………………… 7.2.7. Effect of stem extracts of Fumaria parviflora on eggs g-1 of tomato infected with Meloidogyne incognita under screen house conditions in spring, 164 2010…………………………………………………………….………………….. 7.2.8. Effect of stem extracts of Fumaria parviflora on eggs g-1 of of tomato infected with Meloidogyne incognita under screen house conditions in fall, 164 2010……………………………………………………………………………….. 7.2.9. Effect of stem extracts of Fumaria parviflora on fresh shoot weight of tomato infected with Meloidogyne incognita under screen house conditions in spring, 166 2010………………………………………………………………………………... 7.2.10. Effect of stem extracts of Fumaria parviflora on fresh shoot of tomato infected with Meloidogyne incognita under screen house conditions in fall, 166 2010………………………………………………………………………………...
xv 7.2.11. Effect of stem extracts of Fumaria parviflora on dry shoot weight of tomato infected with Meloidogyne incognita under screen house conditions in spring, 167 2010…………………………………………………………………………..……. 7.2.12 Effect of stem extracts of Fumaria parviflora on dry shoot of tomato infected with Meloidogyne incognita under screen house conditions in fall, 167 2010………………………………………………………………………………...
7.2.13. Effect of stem extracts of Fumaria parviflora on reproduction factor (Rf) of tomato infected with Meloidogyne incognita under screen house conditions in 173 spring, 2010…………………………………………………………………………
7.2.14. Effect of stem extracts of Fumaria parviflora on reproduction factor (Rf) of tomato infected with Meloidogyne incognita under screen house conditions in fall, 173 2010…………………………………………………………………………………
xvi LIST OF APPENDICES
Appendix No. Title Page No.
SPECTRA
1. Infrared spectra of Nonacosane-10-ol (ISH-03) ...... 286 2. EIMS spectra of Nonacosane-10-ol (ISH-03) ...... 287 3. 13C-NMR spectra of Nonacosane-10-ol (ISH-03) ...... 288 4. 1H-NMR spectra of Nonacosane-10-ol (ISH-03) ...... 289 5. HMBC spectra of Nonacosane-10-ol (ISH-03) ...... 290 6. COSY spectra of Nonacosane-10-ol (ISH-03) ...... 291 7. Infra Red spectrum of 23a-Homostigmast-5-en-3ß-ol (ISH-034) ...... 292 8. UV spectra of 23a-Homostigmast-5-en-3ß-ol (ISH-034) ...... 293 9. EIMS spectra of 23a-Homostigmast-5-en-3ß-ol (ISH-034) ...... 294 10. 13C-NMR spectra of 23a-Homostigmast-5-en-3ß-ol (ISH-034) ...... 295 11. 1H-NMR spectra of 23a-Homostigmast-5-en-3ß-ol (ISH-034) ...... 296 12. HMBC spectra of 23a-homostigmast-5-en-3ß-ol (ISH-034) ...... 297 13. COSY spectra of 23a-homostigmast-5-en-3ß-ol (ISH-034) ...... 298
14. UV spectrum of trans-protopinium (ISH-02) in CHCl3 ...... 299 15. ESI spectrum of trans-protopinium (ISH-02) ...... 300 16. EIMS spectra of trans-protopinium (ISH-02) ...... 301 17. HSQC correlation of ISH-02 at 80 oC in DMSO ...... 302 18. 13C-NMR spectra of ISH-02 at 80oC in DMSO ...... 303 19. 1H-NMR spectra of ISH-02 at 80 oC in DMSO ...... 304 20. HMBC spectra of ISH-02 at 80 oC in DMSO ...... 305 21. 13C-NMR spectra of ISH-02 in DMSO at 25oC ...... 306 22. 1H-NMR spectra of ISH-02 in DMSO at 25 oC ...... 307
xvii 23. Analyses of variance (ANOVA) tables of in vitro studies ...... 308 24. Analyses of variance (ANOVA ) of screen house studies using roots extracts (spring, 2010) (Experiment 1) ...... 316 25. Analyses of variance (ANOVA) of screen house studies using stem extracts (spring, 2010) (Experiment1) ...... 324 26. Analyses of variance (ANOVA ) of screen house studies using roots extracts (fall, 2010) (Experiment 2) ...... 332 27. Analyses of variance (ANOVA) of screen house studies using stem extracts (fall, 2010) (Experiment 2) ...... 340 28. Analyses of variance (ANOVA) of screen house studies using dry powder of Fumaria parviflora (spring and fall, 2010)……………………...... 348 29. Analyses of variance (ANOVA) of field studies using dry powder of Fumaria parviflora (spring and fall, 2010)……………………...... 355
xviii LIST OF ABBREVIATIONS AUCPHI Area under cumulative percentage hatch inhibition AUCPHM Area under cumulative percentage hatch mortality 13CNMR Carbon-13 Nuclear Magnetic Resonance Spectroscopy 1HNMR Hydrogen-1 Nuclear Magnetic Resonance Spectroscopy 1DNMR One dimensional Nuclear Magnetic Resonance Spectroscopy 2DNMR Two dimensional Nuclear Magnetic Resonance Spectroscopy BB Broadband COSY Correlation Spectroscopy COII Cytochrome oxidase II CC Column Chromatography
CHCl3 Chloroform DMSO Dimethyl Sulfoxide EI-MS Electron Impact-Mass Spectrometer EtOAC Ethyl acetate GI Galling Index HMBC Heteronuclear Multiple Bond Correlation HMQC Heteronuclear Multiple Quantum Coherence Hz Hertz IGS Intergenic spacer ITS Internal Transcribed Spacer IR Infra Red J Coupling constant mp Melting point m/z Mass to charge ratio MeOH Methanol MS Mass Spectroscopy RFLP Restriction Fragment Length Polymorphism RKNs Root knot nematodes RAPD Randomly Amplified Polymorphic DNA SCAR Sequence characterized amplified regions TLC Thin Layer Chromatography
xix
TABLE OF CONTENTS
ACKNOWLEDGEMENTS ………………………...……………………... i
ABSTRACT ………………………...……………………………………... ii
LIST OF TABLES ………………………...………………………………. v
LIST OF FIGURES ………………………...……………………………... x
LIST OF ABBREVIATIONS……………………………………………… xix
CHAPTER 1 INTRODUCTION ………………………...……………. 1
CHAPTER 2 REVIEW OF LITERATURE ………………………...… 9
CHAPTER 3 MATERIALS AND METHODS ………………………. 37
CHAPTER 4 RESULTS OF MOLECULAR STUDIES ….………….. 68
CHAPTER 5 RESULTS OF PHYTOCHEMICAL ANALYSES……... 100
CHAPTER 6 REULTS OF IN VITRO BIOASSAYS..………………… 121
CHAPTER 7 RESULTS OF SCREEN HOUSE AND FIELD
STUDIES………………………………………………. 140
CHAPTER 8 DISUSSION…………...... ……………………...……… 214
CHAPETR 9 SUMMARY …..……...………………………………..... 238
CHAPTER 10 CONCLUSIONS AND RECOMMENDATIONS……… 244
LITERATURE CITED………………………………….. 248
APPENDICES…………………………………………… 286
I. INTRODUCTION
Tomato (Solanum lycopersicum L.) is extensively grown and consumed as vegetable crop throughout the world. Tomato is a rich source of potassium, iron and vitamins A, B and C (Hobson and Davies, 1979), in addition to a range of antioxidants, carotenoids particularly lycopene (Di Masico et al., 1989). In Pakistan, tomato is cultivated over 52,300 hectares with the annual production of about 529, 600 tonnes (Anonymous, 2012); in Khyber Pukhtunkhwa province of Pakistan it is grown on an area of 12,600 hectares with 113,200 tonnes production annually (Anonymous, 2012). In Pakistan, the yield/unit area of tomato is lower (i.e. 10.12 tonnes/hectares) than other tomato growing countries (Anonymous, 2012). A number of viral, bacterial, fungal and nematode pathogens attack tomato and cause substantial losses (Khattak, 2008). Plant parasitic nematodes cause great economic losses to a wide range of agricultural crops worldwide (Sasser and Freckman, 1987). Meloidogyne, Goldi, 1892 or root knot nematodes (RKN) are among the main obligate parasites of tomato plants worldwide (Jacquet et al., 2005). The taxonomy of this genus (Meloidogyne) has been elaborated by numerous reviewers (Karssen and Van Hoenselaar, 1998; Karssen, 2002). Of a total of 90 Meloidogyne spp., identified so far (Luc et al., 1988), 4 species viz., M. incognita (Kofoid and White) Chitwood, M. javanica (Treub) Chitwood, M. arenaria (Neal) Chitwood and M. hapla Chitwood, are of major economic importance inducing major morphological and physiological changes within roots and reduce yield and quality of plants (Sasser, 1980). These four species comprised more than 99% of all species identified from a collection of 662 isolates from 70 countries (Taylor et al. 1982). Among these, M. incognita, M. javanica, M. arenaria have been regarded as tropical species whereas M. hapla, M. fallax and M. chitwoodi occur in regions with temperate climates (Taylor and Sasser, 1978). Root knot nematodes are polyphagous and infect over 5,500 host plants (Trudgill and Blok, 2001) whereas others have a host range restricted to a very few plant species for example Meloidogyne pini, which is associated with Pinus spp. only (Jepson, 1987).
1 Average yield losses due to RKN on global scale are estimated to be 5% (Sasser and Carter, 1982); however, these losses could be higher in developing countries located in the tropics and sub-tropic regions (Mai, 1985). Meloidogyne spp., are a major parasites of tomato (De Lannoy., 2001) and yield losses of 22-30 % have been reported by M. incognita in tomato (Sasser and Carter, 1982; Gul and Saeed, 1990). Nagnathan (1984) reported 61% yield losses in tomato due to M. incognita and 39% by Reddy (1985). Losses up to 80% in heavily infested fields have been recorded (Kaskalvalci, 2007). In order to reduce these losses, an estimated US $ 500 million is spent on nematode control globally (Keren-Zur et al., 2000). In Pakistan, extensive surveys of nematode fauna associated with cereals, vegetables, fruits, and other crops in the Sindh, Punjab, Balochistan and Khyber Pakhtunkhwa (Formerly known as Nort West Frontier Province) have been carried out (Brown, 1962). Gul and Saeed (1990) conducted an extensive survey of root knot nematodes on 74,521 sq km area in the Khyber Pakhtunkhwa Province and identified root knot nematodes on the basis of morphological characteristics and North Carolina differential host test. Four species of Meloidogyne viz. M. javanica, M. incognita, M. arenaria, and M. hapla were found equally distributed in this province of Pakistan. Two races of M. incognita (R-1 and R-2) and both races of M. arenaria were identified and documented. Maqbool and Shahina (2001) reported all the four species from crops, vegetables, fruits, ornamental plants, weeds and shrubs from various localities of Pakistan while M. graminicola was reported from rice fields of Sheikhpura (Munir and Bridge, 2003). Among others, M. incognita has been reported as the most abundant and damaging nematode in Pakistan infecting about 102 plant species (Zaki, 2000; Maqbool and Shahina, 2001). In the Khyber Pakhtukhwa province the problem of RKNs is more severe particularly in Malakand division (Khattak, 2008) as the area is more suitable for vegetables production and its enemies. Malakand divisions provide tomatoes to the plane of Peshawar and adjacent cities throughout the year and more particularly in the winter season. However, the nematodes are well adapted to the prevailing environmental and soil conditions of Malakand divisions because viable eggs of the pathogen survive in the soil for long periods. Furthermore due to sandy loam soil and
2 short life cycle of six to eight weeks, the RKN populations gradually built up in these areas in the presence of suitable host (Shurtleff and Averre, 2000). Some farmers have even stopped growing tomatoes in these areas because of severe root knot infestation. Nematodes control is challenging because these plant parasites mostly attack underground parts of plants resulting in poor growth and less production. Above ground symptoms are general and non-specific. The disease generally appears as clearly defined patches in the field (Williamson and Hussey, 1996). Below ground symptoms include galling on roots. Galls induced by root knot nematodes consist of hypertrophied cortical cells surrounding the nematodes. Lumps or galls, ranging in size from 1 to 10 mm in diameter, develop all over the roots. In severe infestations, heavily galled roots may rot away, leaving a poor root system with a few large galls (Jones, et al., 1991). Mature female nematodes lay hundreds of eggs in a gelatinous matrix/egg masses on the root surface and these eggs hatch in warm, moist soil to continue the life cycle. Continued infection of galled tissue by second and later generations of nematodes cause the formation of massive galls on roots. The length of the life cycle is temperature-dependent and varies from 4 to 6 weeks in summer to 10 to 15 weeks in winter. Root-knot nematode species differ in the number of generations they can produce per year; this number varies according to species and food availability. Usually there are many generations per year, but in some species (e.g. M. naasi) there is only one generation (Rivoal and Cook, 1993). Although traditional techniques for species identification of RKNs rely on morphological characters (Maqbool and Shahina, 2001); however, Meloidogyne spp., identification always presented challenges to the diagnosticians (Eisenback et al., 1981). In addition, identification of Meloidogyne species, especially the second stage juveniles (J2s), by their morphological and isozyme characteristics is not an easy task (Yukio, 1999). Researchers suggested that identification of all the major species of RKNs through Polymerase Chain Reaction (PCR) would help improve crop management decisions (Adam et al., 2007). A number of molecular techniques have been developed for the identification of Meloidogyne species. Curran et al. (1986) and Powers et al. (1986) pioneered the use of RFLP’s in genome and mitochondrial DNA to identify nematode species. Harris et al. (1990) and Powers et al. (1993) separated single
3 juveniles of the five major species of Meloidogyne using size variations in PCR amplified mitochondrial DNA. Cenis (1993) adopted RAPD-PCR for identification of four major Meloidogyne species. Subsequently, Yukio (1999) adopted PCR method and used 10-mer random primers for the identification of ten Meloidogyne spp. in Japan. A molecular diagnostic key developed by Adam et al. (2007) for identification of seven economically important root knot nematodes is routinely used in many nematological research laboratories. Non-chemical strategies employed for nematode management include application of soil organic amendments of crop residues (Gul et al., 1990; Alam, 1990; Khan et al., 1990; Siddiqui et al., 1998), chicken manures, cow dungs and urines (Kaplan and Noe, 1993; Abubakar and Majeed, 2000; Abubakar et al., 2004), heat treatment, soil solarization, oil seed cakes (Akhtar and Alam, 1991; Khan and Shaukat, 2000), marine algae, sea weed (Paracer et al., 1987) and Pleurotus ostreatus (Nordbring-Hertz et al., 2000) as well as destruction of residual infected roots (Brown et al., 1989; Stevens et al., 1990; Sikora, 1992). However, most of these strategies may not provide long term protection against the nematode pests. Soil solarization, for instance may not be effective method in protecting fruit trees, vines, and woody ornamental plants (Brown et al., 1991). Oil-cakes and animal manures have high nitrogen contents of 2-7% and are the most nematicidal amendments but they must be applied at 4-10 t/h to be effective (Brown et al., 1991). Planting resistant crops can reduce populations of Meloidogyne spp. in the soil (Roberts, 1992), however, when grown under high disease pressure, the resistant tomato cultivars can still exhibit some galls. Plant resistance for nematodes is not available in many important crops and effectiveness is often restricted to a few races of a nematode genus (Gheysen et al., 1996; Whitehead, 1998). Currently, resistant tomato cultivars are unavailable to growers in developing countries such as Pakistan. Marigold (Tagetes spp.) species as component in cropping system have been found effective in reducing RKN populations in different crops (Mukhtar et al., 2005). Studies have found that marigolds can be toxic to plant-parasitic nematodes and are capable of suppressing a wide range (up to 14 genera) of nematode pests (Wang et al., 2007). However, some hybrid marigold
4 cultivars such as Tangerine Gem have been reported to increase nematode populations (Wang et al., 2007). Agenst used for biological control is another alternative for the management of root knot nematodes, as it is sustainable and environment friendly (Khattak, 2008). These agents include the bacteria Pasteuria penetrans, Bacillus thuringiensis and Burkholderia cepacia (Meyer et al., 2000; Mateille et al., 2002); the nematicidal fungi Trichoderma harzianum (Khattak, 2008), Hirsutella rhossiliensis, Hirsutella minnesotensis (Jaffree et al., 1992), Verticillium chlamydosporum (Chen et al., 2000; Kopcke et al., 2001), Arthrobotrys dactyloides (Meyer et al., 1990), Paceilomyces lilacinus (Lysek and Krajei, 1987) and Myrothecium verrucaria (Anon, 1997). Currently bio-control agents are not available on commercial scale to the local growers. Those which have been used showed no consistent results under field conditions. Biological control is more inconsistent, less effective and slower than control normally achieved with chemicals and that their successful application will depend on integration with other control measures. Nematode populations can be reduced by using two year crop rotation with grass crops that are resistant to root knot nematodes such as corn, milo, sorghum and millet (Jones et al., 1991); however, rotation of high value crops with grasses may not be economical and acceptable to growers. Non fumigant chemicals such as Carbofuran and Oxamyl have been applied as granular or liquid formulations, and incorporated into the top few centimeters of soil. However, they are not as effective as fumigants and lack broad spectrum activity (Netscher and Sikor, 1990), but they are easier to apply, more economical, and less phytotoxic (Johnson, 1985). The most effective fumigant nematicides are Chloropicrin and Dibromochloropropane (DBCP) (Whitehead, 1998). Soil fumigants, although effective for the early period of plant growth, are dangerous to the users and are not economical for small-scale farmers. They are applied under certain conditions of soil tilth, soil moisture, and soil temperature, there is a re-entry period, and time for aeration of soil is required between fumigation and planting (Radewald et al., 1987). Resistance in nematode pests against these nematicides has been reported (Kerry, 2000; Larsen, 2000). Most of these nematicides for example DBCP and Ethylene dibromide (EDB) have been withdrawn from the market because of health and
5 environmental problems associated with their production and use (Oka et al., 2000; Fernandez et al., 2001; Gerhardson, 2002; Garima et al., 2005). Most of these nematicides cause toxicity to ground water, atmospheric ozone depletion (Thomas, 1996), and are hazardous to human health (Akhtar and Malik, 2000; Anastasiadis et al., 2008; Wachira et al., 2009). Consequently, several groups of researchers are looking nematicidal compounds. Numerous plant species, representing 57 families, have been found to contain compounds with nematicidal properties (Chitwood, 2002). These naturally occurring phytochemicals are biologically active plant compounds and have potential to inhibit plant diseases. The most important of these phytochemicals are alkaloids, tannins, flavonoids and phenolic compounds (Perez et al., 2003). Except a few, many of these phytochemicals are safer to the environment or humans than traditional chemical nematicides (Chitwood, 2002). Several repellents, attractants, hatching stimulants or inhibitors and nematicide compounds have been developed in response to nematodes and are involved in plant- nematode interaction. The allelochemistry and the study of chemicals-mediated interactions between a plant and other organisms have immersed in recent years (Chitwood, 2002). These compounds have been developed for use as nematicides or could serve as model compounds for the development of chemically synthesized derivatives with enhanced activity or environmental friendliness (Perez et al., 2003). Suppressive effects of many secondary metabolites against plant parasitic are well reported (Husan-bano et al., 1999; Ali et al, 2001). The effect of plant extracts of eucalyptus (Eucalyptus chamadulonsis), garlic (Allium sativum), and essential olis from marigold (Tagetes erecta) have shown biocidal action against Meloidogyne incognita juveniles under green house conditions (Kamal et al., 2009). Cold water extracts from the whole plant, root and stem of marigold significantly lowered root gall indices in susceptible tomato inoculated with M. incognita (Natarjan et al., 2006). Leaf extracts of neem tree (Azadarichta indica) and Gliricidia plant (Gliricidia maculate) inhibited egg hatching and juvenile mortality in up to 60% at various concentrations of M. incognita (Adegbite and Adesiyan, 2005; Nazli et al., 2008).
6 Some of these plant derived compounds have been tested in the fields and are commercially available. For example “Sincosin” the trade name of a recently developed product containing a mixture of extracts (from Cactaceae, Fagaceae, Anacardiaceae and Rhizophoraceae) has provided management of Tylenchulus semipenetrans on orange (Citrus sinensis), of Rotylenchulus reniformis on sunflower (Helianthus annuus) and of Heterodera schachtii on sugarbeet (Beta vulgaris) in the fields ( as reviewev by Chitwood, 2002). Root-knot nematodes can be controlled by application of green leaf manures and organic amendments to the infected soil (Riga et al., 2003). Green leaf manures have been found to suppress root diseases by changing soil physical and chemical properties and by enriching the soil with beneficial microflora. Incorporation of selected green leaf manures for example Crotalaria spp. can reduce root knot nematode populations and serve as poor host to many other plant parasitic nematodes including Rotylechulus reniformis, Radopholus similis, Belonolaimus longicaudatus and Hetrodera glycines by producing toxic or inhibitory allelochemicals (Wang et al., 2002; Treadwell and Alligood. 2008). Decomposition of organic amendments, including green manures from oily plant residues such as cottonseed meal, or meal from certain types of mustard have been reported to release chemicals which are toxic to nematodes (Chitwood, 2002; Riga, 2011). Fumaria parviflora Lam. (Syn: Fumaria indica (Hausskn) Pugsley, Fumariaceae) locally known as ‘Papra’ or Pitpapra’or ‘Shahtra’ is a small, scandent, branched annual herb growing wild in plains and lower hills of the KPK (Baquar, 1989). Fumaria parviflora was selected because this medicinal and annual herb is found in most agricultural fields of Pakistan particularly wheat and maize crops (Syed et al., 2006). Phytochemical studies on F. parviflora revealed the presence of alkaloids such as adlumidicein, copticine, fumariline, perfumine, protopine (Popova et al., 1982; Sasu et al, 2002; Rao et al., 2007), fumaranine, fumaritine, paprafumicin, paprarine (Atta-Ur- Rahman et al., 1982) and flavonoids, glycosides, tannins, saponins, steroids, and triterpenoids (Rao et al., 2007). The stems of F. indica have Narlumicine, a seco- phthalideisoquinoline alkaloid, protopine, protopine nitrate, dl-tetrahydrocoptisine and narlumidine (Tripathi and Pandey, 1992). These phytochemicals are known for their
7 antimicrobial activity (Cowman, 1999). Abid et al. (1997) reported 59 % mortality of Meloidogyne javanica J2s using crude ethanolic extracts of F. indica leaves and shoots. Athanasiadou et al. (2001) reported anthelmintic activity of plant extracts of F. parviflora on larvae and adults of gastrointestinal nematodes. Phytochemicals are good candidates and they can be developed for use as safe nematicides (Perez et al., 2003). Very little is known about the effect of F. parviflora and its phytochemical compounds on root knot nematodes. Therefore, the present study was undertaken to achieve the following objectives:
1. To identify root knot nematode species in Malakand division through morphological and molecular methods. 2. To determine phytochemical screening of F. parviflora; detection of bioactive constituents and activity-guided isolation; identification and characterization of phytochemical compounds of F. parviflora. 3. To study in vitro effect of F. parviflora extracts on egg hatch inhibition and J2 mortality of M. incognita; and in planta effect of stem and roots extracts of F. parviflora on M. incognita under screen house conditions. 4. To study in planta effect of different concentrations of F. parviflora used as dry amendment on M. incognita under screen house and naturally infested field conditions.
8 II. REVIEW OF LITERATURE
The following review reports the research findings on the identification of root knot nematodes using morphological and molecular tools; and the management of root knot nematodes based on plant derived compounds, and extracts.
2.1. Distribution of root knot nematodes Meloidogyne spp. attack more than 5500 host plants (Trudgill and Blok, 2001). Sasser and Carter (1985) reported that M. incognita constitutes about 47 % of the total root-knot nematodes population. Meloidogyne incognita and M. javanica were the mots dominant species associated with papaya, sugarcane, cabbage, okra in Sindh, Punjab and Khyber Pakhtunkhwa (formerly known as Nort West Frontier Province) (Ahmad and Saeed, 1981). Anwar et al. (1991) reported that M. incognita and M. javanica parasitized five vegetable crops including okra. Gul and Saeed (1990) reported M. javanica and M. incognita in Khyber Pakhtunkhwa on different vegetable crops including tomatoes, okra, egg plant, cucumber, and fruits like peach, plum, apricot, watermelon and muskmelon. Studies on the occurrence of root knot nematodes in various crops have been conducted in Punjab (Anwar, 1977) and Sindh (Maqbool et al., 1986). Anwar et al. (2007) reported 85.10% occurrence of Meloidogyne species associated with egetable crops in Punjab, whereas 81% infection of RKN on tomato in Punjab has been reported by Khan et al. (2005). Extensive studies have been conducted on roots and rhizosphere soil of peanut, chili, tomato, potato, okra, eggplant, banana, peach and apple infected with root-knot nematode (Anwar et al., 1992). Surveys have been conducted to record new hosts of root knot nematodes (Khan et al., 2005; Erum et al., 2005 and Shahid et al., 2007).
2.2. Identification of root knot nematodes (Meloidogyne) species Nematoed species identification utilizes several characters/features including morpho-anatomical, physiological, ecological, ethological, embryological and cytogenetical. Chitwood (1949) was the first to identify and describe species within genus Meloidogyne on the basis of morphological characters. In 1968 Whitehead described 23 species of Meloidogyne whereas in 1987 the number of species based on
9 morphological characters reached 51 (Jepson, 1987). Eisenback and Triantaphyllou (1991) further contributed 17 species and between 1949 and the year 1998, more than 80 nominal Meliodogyne (RKN) species were described, especially from North and South America, Africa, China and Europe (Karssen, 2002). More than 50 % species have been described during the last twenty years (Adam et al., 2007). Biochemical and molecular information can be used to supplement morphological data in species identification and often to verify identification of certain major species. These methods are discussed below.
2.2.1. Morphological characterization Chitwood (1949) used morphological characterization as a first method for identification of RKN species. He studied the morphology of diverse kinds of described nematodes and mentioned that genus Meloidogyne were extremely adaptable and their morphological characters showed considerable variations. Chitwood (1949) redescribed M. arenaria, M. exigua, M. javanica and M. incognita and described M. hapla and M. incognita var. acrita. The species concept introduced by Chitwood (1949) was based on perennial pattern morphology added with stylet knob shape and dorsal oesophageal gland orifice (DGO) length differences. Spaull (1977) for the first time introduced Scanning Electron Microscope images (SEM) during describing root knot nematodes. Several comparative SEM studies on morphology in the seventies and eighties increased the number of useful descriptive characters for eggs, males, females and second stage juveniles up to 140 (Jepson, 1987). However, few of them were as valuable as the most commonly used characters, the perennial pattern of the mature females: the posterior of the female including vulva and anus, tail terminus and phasmid (Jepson, 1987). Other characters frequently used were, total length, shape and hyaline tail terminus length in the second stage juveniles. Jepson (1987) described and published 51 species of Meloidogyne based on morphological characters. However, species identification based on morphological characters is difficult and require trained nematologists (Eisenback, 1985b).
10 2.2.2. Molecular diagnostics and PCR Significant progress over the last few decades in molecular diagnostics of nematodes has been made due to the development of polymerase chain reaction (PCR). This method enables numerous copies to be obtained from a single or few molecules of DNA extracted from an organism by chemical synthesis in vitro. A single nematode, egg or even part of the nematode body could be identified using this technology. Once identified, nematode target DNA generated by PCR amplification can be characterized further by various analyses: restriction fragment length polymorphism (RFLP), single strand conformation polymorphism (SSCP) or sequencing. The wide application of PCR in diagnostics is a reflection of the advantages of the technique which is very sensitive, rapid, easy to perform and inexpensive. PCR is used routinely for nematode diagnostic (Blok, 2005; Adam et al., 2007) and has been comprehensively reviewed by Powers (2004) and Subbotin and Moens (2006).
2.2.2.1. DNA sequence (rDNA) target for diagnostics and PCR The target DNA sequences could be selected for diagnostic purposes using two approaches: (i) using known conserved genes, common to all nematode species, and to explore the specific sequence variation in order to distinguish species and (ii) to randomly screen the whole genome and find specific DNA fragments that could be used as a marker for diagnostics. The main region targeted is the nuclear ribosomal RNA gene, especially the internal transcribed spacer (ITS1) and (ITS2) which are situated between 18S and 5.8S, and 5.8S and 28S rRNA genes, respectively. In fact these ribosomal genes and their spacers have undergone mutation which enables different regions to be used for diagnostics at a higher taxonomic level such as family and genus and down to species, subspecies and even population levels. The rDNA provides sufficient variation and stability within it for reliable discrimination of most species, although intraspecific variation has been found (Zijlstra et al., 1995; Adam et al., 2007) and there is evidence for intra-individual variation (Blok et al., 1997; Powers et al., 1997; Zijlstra et al., 1997; Hugall et al., 1999).
11 To distinguish most species of root knot nematodes, the intergenic spacer region (IGS) of nuclear rRNA (Petersen and Vrain, 1996) which is between 28S and 18S rRNA genes has been widely used for diagnostic purposes and phylogenetic studies. Petersen et al. (1997) designed molecular probes using unique signature sequence located within variable regions of the ribosomal intergenic spacer (IGS) and identified Meloidogyne spp. Multiplex-PCR amplification of DNA from single juveniles or a small number of eggs efficiently distinguished M. chitwoodi and M. fallax from M. hapla, M. incognita, M. javanica, M. arenaria, and M. mayaguensis. Zijlstra et al. (1995) were the first to use the amplified ITS region of the nuclear rRNA of several Meloidogyne spp. They discriminated M. hapla, M. chitwoodii and M. fallax from each other and from M. incognita, M. javanica by using several restriction enzymes. Devran et al. (2002) digested the ITS regions of the ribosomal rDNA with restriction enzymes Rsa1, Bam H1, EcoR1and distinguished four major Meloidogyne spp. They found that Rsal significantly distinguished M. hapla from other species. Orui (1999) used PCR-RFLP of the ITS regions to identify M. arenaria, M. camelliae, M.mali, M. marylandi and M. suginamiensis. Schmitz et al. (1998) suggested the simultaneous use of two restriction enzymes Hinf 1/Rsa1 or Rsa1/Dra1for identification of several species of root knot nematodes. However, these diagnostic enzymes did not facilitate the separation of M. incognita and M. javanica (Xue et al., 1992; Zijlstra et al. 1995; Schmitz et al., 1998). Hugall et al. (1999) sequenced the ITS-rRNA of M. incognita, M. javanica and M. arenaria and found that these sequences were almost identical. Similar sequences were also reported in several other closely related Meloidogyne spp. including M. hispanica and M. morocciensis (De Ley et al., 1999) and M. mayaguensis (Brito et al., 2004). Sequence analysis of 18S ribosomal gene, internal transcribed spacer (ITS1), 5.8S (ITS2) (Floyd et al., 2002) and the D2-D3 expansion of 28S (Landa et al., 2008) have revealed that these genes are also reliable diagnostics target at the species level. Sequence analysis of rDNA has been used for identification of Meloidogyne spp. (Powers, 2004) and this approach has been found effective only when sufficient resources were available (Adam et al, 2007). Zijlstra et al. (2004) aligned sequences from rDNA-ITS fragments of M. nassi and five other Meloidogyne species to design M.
12 naasi specific forward primer N-ITS using simple PCR. Qiu et al. (2006) carried out PCR with universal primers spanning the ITS of rRNA genes and rapidly identified the J2 of M. arenaria, M. incognita, and M. javanica. The procedure was used for several soil types and was found sensitive and accurate.
2.2.2.2. Mitochondrial DNA Several properties of mtDNA have made this molecule a useful molecular tool for revealing the genealogical history of many different animal species. Nucleotide changes in mtDNA occur at a very high rate, therefore, mtDNA evolves at high rate and exhibit extensive polymorphisms within most species (Blok and Powers, 2009) and thus provides sufficient nucleotide variation for species-level analysis (Thomas and Wilson, 1991). Sequence divergence usually averages from 1 to 3 % within species, but can be as high as 10 % (Hoeh et al., 1991). In addition, mtDNA molecules are maternally inherited (Clayton et al., 1974); only a few cases of biparental inheritance have been reported (Hoeh et al., 1991) which lack evidence for recombination between molecules. Nematode mtDNA displays greater variations in size, gene content and gene arrangement (Wolstenholme, 1993). The mitochondrial genome (mtDNA) has been used as a source of genetic markers for identification of root knot nematode (Rubinoff and Holland, 2005; Hu and Gasser, 2006). Sufficient copies of mitochondrial DNA have been found within each cell, providing ample template for PCR assay. A complete structural map of Meloidogyne has been determined (Okimoto et al., 1991). The map contained the location of 12 protien-coding genes, the large and smaller rRNA genes, and the tRNA genes. However, the overall structure and gene content of the Meloidogyne mitochondrial genome resembled the mtDNAs of other animals (Blok and Powers, 2009). The mtDNA of Meloidogyne is a circular molecule with coding genes arranged in co-linear fashion without intervening non-coding sequences. Extensive gene arrangement has occurred in the mtDNA of the M. javanica molecule (Hyman, 1988). Gene order in Meloidogyne mitochondria differed from that of two other nematodes, Ascaris suum and Caenorhabditis elegans (Okimoto et al., 1991). The differences in gene order allowed the development of PCR-based diagnostic assays with reduced probability of false-positive amplifications (Blok and Powers, 2009). Powers et al.,
13 (1986) for the first time demonstrated the use of mtDNA as a diagnostic tool for the rapid detection of Meloidogyne species and used DNA hybridization technique. Blok et al. (2002) amplified the 63 bp repeating of the mtDNA region by flanking primers and reported a 320 bp discrete product with M. enterolobii, however, obtained a multi- banded pattern with Meloidogyne species. Some researchers have determined the population dynamics with these repeated regions using them as markers (Hyman and Whipple., 1996; Lunt et al., 2002). The COII and 16S ribosomal region of of mtDNA has been widely used for diagnostic purposes. These two genes have tRNA-His gene (53 bp), while the mitotically-parthenogentic species have non-coding sequences that include a stem and loop structure characteristics of the AT-rich region of mitochondria (Hugall et al., 1994, 1997; Jeyaprakash et al., 2006). Powers and Harris (1993) reported that Meloidogyne spp amplified different-sized products by the primers positioned in the 3/ portion of COII and the 5/ portion of 16S rRNA. This resulted in amplification of different-sized products. For example the M. hapla produced 530 bp products with some flanking portion of COII and 16S rDNA and the complete tRNA-His without AT-rich region, whereas M. javanica and M. incognita produced the largest amplification product of approximately 1.6 Kb due to the presence of 1.0 Kb AT-rich region (Blok and Powers, 2009).
2.2.2.3. PCR-Restriction Fragment Length Polymorphism (PCR-RFLPs) Variation in sequences in PCR product can be revealed by restriction endonuclease digestion. The use of restriction fragment length polymorphism (RFLP) involves the extraction and purification of genomic DNA. The PCR product obtained from different species or population can be digested by a restriction enzyme and the resulting fragments are separated by electrophoresis followed by visualization of banding pattern. If there is some difference in sequences situated within the restriction site of the enzyme, the digestion of PCR products will lead to different electrophoretic profiles. Similar technique has been used for the root knot nematodes (Zijlistra et al., 1995; Schmitz et al., 1998). RFLP of the ITS-rDNA obtained after restriction with several enzymes and their combination identified important root knot nemsatodes
14 species; however, it failed to separate species from tropical group including M. javaniva, M. incognita and M. arenaria. PCR-RFLP of mtDNA fragments between the cytochrome oxidase subunit II gene and the large subunit (LSU) (Harris et al., 1990) has been applied successfully for the diagnostic of these nematodes (Powers and Harris, 1993). Curran et al. (1986, 1987) applied this approach first time to Meloidogyne spp. and isolated DNA from large number of eggs. The extracted DNA was digested with restriction enzymes and then subjected to gel electrophoresis in an agarose gel. The banding patterns obtained but this method represented highly repeated DNA regions and allowed the identification of Meloidogyne spp. However, this method utilized large amount of DNA and requires prior culturing of isolates. Restriction of mtDNA with Hinf 1 enzyme enabled the identification of important Meloiodogyne species, isolates and host races (Harris et al., 1990) suggesting that mtDNA has considerable potential for species identification (Powers and Sandall, 1988). Consequently, sequence polymorphism of the mtDNA digested with restriction enzymes (Hugall et al., 1994) has been achieved; however, this technique was unable to distinguish between haplotype C of M. arenaria and haplotype D of M. javanica. Stanton et al. (1997) digested mtDNA of six closely dominant haplotypes of Meloidogyne with Hinf1 and Mnl1enzymes and found twelve polymorphic nucleotide sites and variable restriction sites among these sequences. Some workers, later on combined, RFLP with DNA hybridization which involved the use of either probes labeled radioactively or not using randomly selected clones from genomic DNA or mitochondrial DNA, or satellite DNA sequences as probes (Castagnone-Sereno et al., 1991; Gárate et al., 1991; Cenis et al., 1992; Piotte et al., 1992, 1995; Xue et al., 1992; Baum et al., 1994; Hiatt et al., 1995). However, the utilization of DNA from multiple individuals and the use of radioactivity made these applications complicated and limited. The development of PCR based RFLP has largely replaced hybridization based techniques for nematode species identification.
15 2.2.2.4. Sequence Characterized Amplified Regions (SCARs) Diagnostics using PCR with specific primers has been developed for a wide range of plant parasitic nematodes. Many species-specific primers have been designed to amplify sequence characterized amplified regions (SCARs) through PCR (Adam et al., 2007). Adam et al. (2007) utilized SCAR primers and developed a protocol using single J2 or female of RKN. A molecular diagnostic key for identification of seven most common and economically important Meloidogyne spp. was presented. Dong et al. (2001) developed a procedure for identification of species-specific sequence tagged sites and designed species-specific PCR primer pairs for Meloidogyne arenaria, M. hapla, M. incognita and M. javanica through RAPD-PCR. In most cases RAPD primers have been converted into SCAR primers for the identification of major root knot nematode species. For example Zijlistra (2000) used this approach for the identification of temperate root knot nematodes (M. chitwoodi, M. fallax and M. hapla) whereas El-Ghore et al. (2004) developed SCAR primers MIE-for and MIE-rev and MJE-for and MJE-rev from two RAPD primers OPK-2 and OPB-3 for identification of M. incognita and M. javanica respectively. Williamson et al. (1997) developed a set of SCAR primers that enabled identification and discrimination of M. hapla and M. chitwoodi using single juveniles. In some cases these SCAR primers have been used together in multiplex reactions and Meloidogyne species were identified in a single reaction (Zijlstra, 2000). The multiplex PCR with specific primers for identification of several nematodes targets in one assay is limited by the number of primer pairs that can be used in a single reaction and the number of bands that can be clearly identified without giving false positive results. However, this technique requires precise optimization of the reaction conditions for the primers set used simultaneously in the test (Randing et al., 2002).
2.2.2.5. Randomly Amplified Polymorphic DNA (RAPD) Random amplification of polymorphic DNA (RAPD), assaying the entire genome is a powerful way to obtain DNA markers linked to characters of interest. The RAPD assay refers to PCR amplification of target DNA with single primers of arbitrary
16 nucleotide sequence and hence produces DNA fragments distributed over the entire target DNA pool (Williamson et al., 1997). RAPDs have been developed to examine intra- and intehrspecific relationships of Meloidogyne spp. (Blok et al., 1997). Twenty two primers have been evaluated to identify eighteen populations of Meloidogyne incognita, M. arenaria, M. javanica and M. hapla by Cenis (1993) and maximum polymorphism was achieved with primer OPA-01. Orui (1999) used randomly amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) for the identification of ten Meloidogyne species from a single individual of J2 or adult female. Meloidogyne incognita, M. arenaria, M. javanica, M. hapla, M. suginamiensis, M. marylandi, M. mali, M. camelliae were successfully identified by primer OPA-01. Results showed that magnesium concentration in the template DNA affected the RAPD patterns. Randing et al. (2001) performed RAPD profile using a single female of root knot nematode and showed that they remained stable for three successive generations. The procedure was also found effective for epidemiological and ecological studies on root-knot nematodes. RAPD markers have been widely used to characterize the genetic diversity and relationships of root-knot nematodes (RKN) in Brazil (Randing et al., 2002). A high level of polymorphism was observed in M. arenaria, M. exigua, and M.e hapla. It was shown that M. hapla and M. exigua were more closely related to one another as compared to other species. Three of the RAPD markers were further developed into SCAR markers which unambiguously identified M. exigua, M incognita and M. paranaensis associated with coffee. El-Ghorie (2004) converted two RAPD primers OPK-2 and OPB-3 into SCAR primers MIE-for, MIE-rev (M. incognita) and MIJ-for, MIJ-rev (M. javanica) and identified M. incognita and M. javanica respectively. Adam et al. (2007) obtained consistent amplification patterns from individual second stage juvenile (J2) of seven economically important Meloidogyne spp. using RAPDs-PCR. Using this information, molecular diagnostic key for M. incognita, M. javanica, M. arenaria, M. hapla, M. chitwoodi, and M. fallax was designed. RAPD-PCR used by El-hady (2009) to distinguish five M. incognita isolates, i.e. M1, M2, M3, M4 and M5 revealed genetic variations (polymorphic bands) when three arbitrary random primers were used.
17 RAPD finger print of isolates revealed 27, 29 and 24% variation (polymorphism) with OPA-13, OPD-8, and OPE-20 primers, respectively.
2.3. Management of root knot nematodes through crude plant extracts and organic amendments. The management of plant parasitic nematodes has been sought for many years, by the use of resistant varieties, crop rotation and chemical nematicides. However, pesticides use is risky and unsafe to human health, the environment, wild life and beneficial microorganisms (Thoden et al., 2009). In addition, the high cost of nematicides has made their use prohibitive in developing nations especially Pakistan where the population survives on subsistence-type of Agriculture and therefore, the farmers have to rely on other non-chemical methods for example plant derived nematicides. The use of plant extracts and organic amendments for the control of plant parasitic nematodes is an alternative could serve as novel non-chemical nematode management alternatives (Akhtar and Mahmood, 2003). Nematicidal substances have been isolated from several plants and have drawn the attention of researchers and pesticide manufacturing industries. Neem based pesticide formulations have been developed in the United States, India and elsewhere mainly for use as insecticides. The commercially available neem products include Neemark, Econeem, Rakshak, Replin, Welgrow, Azatin, Turplex, Align, Bioneem, Nimbecidine, Neemgold, Neemazal, Neemax, Neemix, Fortune Aza, Achook, Neemrich, and Margosan-O (Kumar and Khanna. 2006). Reshmi and Vijayalakshmi (1998) investigated the toxicity of five neem-based pesticidal formulations viz., neem seed kernel, neem seed coat, Achook, Neemark, and Nimbecidine against M. incognita juveniles. Achook was the most effective among commercially available neem pesticides tested. Akhtar and Mehmood (1996) evaluated Suneem (Azadirachtin 80 % a.i) and used it to coat tomato seeds for protection against M. incognita. They observed that number of galls and juveniles were significantly reduced. The nematicidal action of neem is actually related to the naturally occurring chemicals for example Azadirachtin, Nimbin, Salanin, Nimbidin, Kaemferol, Thionemone, Quercetin and others (Devakumar et al., 1985).
18 A substantial body of work has been conducted on neem leaves (Azadirachta indica). Neem leaves have been found effective for the control of RKNs especially the M. incognita on tomato (Akhtar and Alam, 1990), egg plant (Pathak et al., 1988), Chilli (Alktar and Alam, 1990) and mulberry (Govindaiah et al., 1989). In addition, M. javanica has been successfully managed in tomato (Zaki and Bhatti, 1989), okra (Abid et al., 1997) and Chikpea (Ram and Gupta, 1982) and M. arenaria on tomato, okra and egg plant by neem leaves and its product. Many researchers have evaluated soil amendments with neem extracts against M. incognita on Sugarcane (Salawu, 1992), M. javanica on Chikpea (Ram and Guppta, 1980) and Pratylenchus brachyurus on maize (Egunjobi and Onayemi, 1981). Adegbite and Adesiyan (2005) efficiently controlled M. incognita through root extracts of neem (A. indica and A. Jass) and achieved 100 % inhibition of egg hatch and larval mortality with neem and siam weed. Zarina et al. (2003) tested leaf extracts of neem, calatropis and datura against M. javanica in brinjal and found promising results. Neem leaf extract was found more effective than calatropis and datura. In another experiment, M. incognita on tomato was effectively controlled with the neem leaf (Khan et al., 2011). Extracts from A. verlotorum and A. absenthium have been found toxic to M. incognita juveniles (Dias et al., 2000). Mulching of A. dracunculus into soil at 2 to 4 % reduced Ditylenchus dipsaci by 90 to 96 %. The nematicidal action was considered due to the flavoniod group (Timchenko and Maiko, 1989). S-dos et al., (2003) demonstrated the activity of an ethanolic rhizome extract of A. vulgaris against M. megadora. The extracts inhibited egg hatching by 50 % when applied @ 2.35 mg/ml whereas 50 % juvenile mortality was reported when they were exposed to 55.67 mg/ml. Antibacterial, antifungal, antiviral, nematicidal, molluscicidal, insecticidal and allelopathic substances have been reported from Chenopodium spp. (Quarles, 1992). Chenopodium album, C. quinoa and C. ambrosioides have been found effective against plant parasitic nematodes. Many essential oils, saponins, steroids and flavonoids have been identified in Chenopodium spp. and were found toxic to plant parasitic nematodes (Bai et al., 2011). The methanolic extracts of the stem and leaves of C. album and C. murale species were found effective against M. javanica and T. semipenetrans. The
19 nematicidal action was considered due to the presence of mixtures of fatty acid, palmitic, stearic, oleic, linoleic, linolenic and palmitoleic acids (Malik et al., 1985). Calatropis procera (Asclepiadaceae) has been reported to possess nematicidal activity. Chopped leaves of C. procera reduced the population build up of many plant parasitic nematodes (Ahmad et al., 1996). Leaf extracts of C. procera have been found effective against M. javanica in binjal (Zarina et al., 2003). Bare root dip treatment of tomato with C. procera significantly reduced gall development by M. incognita in tomato and Capsicum annum (Akhtar and Mehmood, 1996). Significant control of M. incognita and R. reniformis in pigeon pea (Cajanus cajan) and chickpea (Cicer arietinum) has been achieved when seeds were dressed with the latex of C. procera. In addition, increase in plant growth, chlorophyll contents, water absorption capacity and nodulation was observed (Anwar and Alam., 1992). Seed dressing of okra, cabbage, cauliflower and aubergine with the latex from C. procera and C. gigantean reduced the nematode number and increased plant growth (Siddiqui and Alam, 1990; Wani et al., 1994). Garlic extract also possess nematicidal activity and demonstrated reduction in root-knot galling indices on tomato. Different concentrations of garlic bulb, neem,
Borelia spp. and ground nut leaf extracts effectively killed J2s and inhibited hatching of egg masses. A comparative study of neem and garlic bulb extracts prepared at 20% concentration revealed that garlic extract demonstrated greater potential than neem in controlling M. incognita (Agbenin et al., 2005). Kamal et al. (2009) also achieved successful suppression of M. incognita in tomato with garlic extracts and essential oils. Control of M. javanica in ground nut was achieved when garlic extract, mustard oil cake and neem oil were used. The garlic bulb extract showed higher response and promoted plant growth and suppressed the nemtaodes (Fatima and Ahmad, 2005). The application of garlic as organic amendment suppressed the reproductivity of M. incognita on grape and increased the lipid content of the grape roots (Al-Sayed et al., 2007). Meloidogyne incognita on tomato was effectively controlled with the garlic and chilli extracts (Khan et al., 2011).
20 Numerous weed species have been evaluated for their nematicidal and insecticidal potential. Extracts from Plantago lanceolata and P. rugelii have been evaluated for their toxicity to M. incognita, the beneficial microbes Enterobacter cloacae, Pseudomonas fluorescens and Trichoderma virens, and the plant-pathogenic fungi Fusarium oxysporum f. sp. gladioli, Phytophthora capsici, Pythium ultimum, and Rhizoctonia solani. Results revealed that J2s tended to be more sensitive than eggs to the toxic compounds at lower concentrations, while the higher concentrations (75% and 100%) were equally toxic to both life stages. The effective concentrations causing 50% reduction (EC50) in egg hatch and in J2s viability were 44.4% and 43.7%, respectively (Meyer et al., 2006). As many as 29 ethanolic and aqueous extracts of wild plant species were evaluated for the viability and mobility of second stage juveniles (J2s) of M. incognita. Results revealed that eleven extracts immobilized at least half of the J2 stage nematodes. About 90 % or better immobilization activity was achieved by aqueous extracts of Bidens pilosa L. var. radiata Scherff (Taba et al., 2008). Leaf extract from Lantana camara exhibited 75 % mortality of J2 of M. incognita under in vitro conditions (Faheem et al., 2010). Methanol extracts of twenty two species of seaweeds showed nematicidal activity against Meloidogyne javanica (Rizvi and Shameel, 2006). The aqueous extracts of a xerophytic plant Barleria acanthoides Vahl. inhibited egg hatching of M. javanica and showed larvicidal effect. Shaukat and Siddiqui (2001) tested aqueous extract of six weed species viz. Argemone maxicana, Abutilon indicum, Sonchus asper, Xanthium stromarium, Solanum nigrum, Mavastrum coromandielanum for their activity towards egg hatching and J2 mortality of M. javanica. Aqueous extract of A. maxicana was highly effective against J2 larvae and inhibition in egg hatch of M. javanica. Kamal et al. (2009) achieved control of M. incognita with eucalyptus (Eucalyptus chamadulonsis) and essential oils. Akhtar and Javed (1985) compared whole plant powder of Fumaria parviflora at 2 g/Kg, its water extract, ethanol extract and Morantel tartarate at 0.01 g/Kg for their efficacy against Trichostrongylus, Haemonchus and Trichuris nematodes in sheep and obtained the respective reduction in egg hatching. Eleven plant species viz. Achiella santolinea, Anthemis pseudoctula, Callingonum comorum, C. tetrapterum, Cleome quinqueneriva, Eryngium thyrsoideum, Euphorbia tinctoria, Heliotropium europaeum,
21 Lotus langinosus, Serratula cerinthefolia and Verbascum sinuatum belonging to nine different families have been evaluated for their nematicidal activites against M. javanica J2 larvae (Al-obedi et al., 1987). Plant extracts applied at 10 % over a period of 7 days showed effective results. Similarly pre-planting application of plant extracts inhibited the penetration of M. javanica into the tomato roots resulting in less root galling and egg production by females. Al-shaibani et al. (2009) evaluated the anthelmintic activity of F. parviflora against the gastrointestinal nematdoes of sheep. In vitro studies revealed that aqueous and ethanolic extracts at the concentration of 3.12, 6.3, 12.5, 25.0 and 50.0 mg/ml exhibited ovicidal and larvicidal effects against the eggs and larvae of Strongyloides papillosus and Haemonchus contortus. Shakeel et al. (2010) evaluated legume seed extracts for antifungal and nematicidal activity and achieved significant results. Ziaul Haq et al. (2010) evaluated ethanolic extracts of Ferula assafoetida resin, Grewia asiatica seed and leaves, Ipomoea hederacea seeds, Lepidium sativum seeds, Nigella sativa seeds and Terminalia chebula fruits for their potential toxicity against juveniles of root-knot nematodes and reported mortality of second stage juveniles of M. javanica, M. incognita at 2% and 1% concentration.
2.4. Nematicidal compounds derived from higher plants 2.4.1. Polythienyls Plant parasitic nematodes have been effectively controlled by marigolds (Tagetes spp.). These plants have been reported to be effective against 14 genera of plant parasitic nematodes, particularly against Meloiodogyne and Pratylenchus spp. (Reynolds et al., 2000). Natarajan et al. (2006) obtained significantly lower root gall indices in susceptible tomato treated with T. erecta plant extracts for their ability to control M. incognita. The nematicidal compounds, polythienyls from Tagetes spp., and other plants from Asteraceae have been reported (Chitwood, 2002). The chemical composition and nemtaicidal activities of volatile and non-volatile fractions of T. erecta have been studied (Debprasad et al., 2000). The methanolic extracts and essential oils from T. erecta have shown maximum nematicidal activities against M. incognita. A few pure compounds viz., dodecanoic acid, myristic acid, palmitic acid, steric acid, octaeicosane-8-one and tricontane-1-ol have been isolated from the non-volatile n-
22 hexane fraction of T. erecta. Many compounds viz., a-sesqui phellandrene, beta- sesqui phellendrene, 2-methyl-6(4-methyl cyclohexadienyl), hept-4-en-2-ol, myristoleic acid, and trieicosane have been isolated and identified from the essential oil fraction of T. erecta flowers (Debprasad et al., 2000).
2.4.2. Isothiocyanate and glucosinolate Isothiocyanate was the first major component of Brassica nigra seed oil which inhibited the hatching of Globodera rostochiensis eggs when applied at a concentration of 1 g/ml (Ellenby, 1945) (Figure 2.1). Another compound, 2-Phenylethyl isothiocyanate, that occurred in Sinapsis alba roots as allyl-isothiocyanate. This compound inhibited egg hatch of G. rostochiensis in laboratory experiments when it was applied at 50 g/ml and improved yield of potatoes in field experiments (Ellenby, 1951). Smedley (1939) investigated the isothiocyanate as nematicides as early as in 1935 whereas Johnson and Feldmesser (1987) reported that a nematicide, Metam- sodium degrade into the soil to yield isothiocyanate. Rapeseed or canola (B. napus) has been effective as green manure or as a rotation crop to provide control against nematodes and isothicyanates have been reported to involve in the toxicity (Halbrendt, 1996). Brown and Morra (1997) reported that all the members of Brassicaceae produce thioglucose conjugates called, glucosionlates, which react with the sulfhydryl groups of proteins. Isothiocyanates have shown activity against many crop pests in soil including plant parasitic nematodes (Brown and Morra, 1997). It has been found toxic to C. elegans, Xiphenema americanum and H. schachtii (Pinto et al., 1998). The 2- Phenylethyl isothiocyanate applied to soil at 16.2 g suppressed reproduction of P. neglectus (Potter et al., 1999) (Figure 2.1).
2.4.3. Glycosides Chitwood (2002) reported that some of the plants contain glycosides also release other nematicides. For example, Sudangrass (S. sudanense, Poaceae) suppressed nematodes when incorporated into soil as green manure. Another species of sorghum (S. bicolor) has been reported to contain glycosides, dhurrin (Figure 2.1), which when hydrolyzed into the soil released cynaide. The fractionated Sudan grass extracts
23 effectively controlled M. hapla and the activity was believed to be the presence of dhurrin (Widmer and Abawi, 2000).
2.4.4. Polyacetylenes Gommers (1988) reported a broad spectrum of polyacetylenes from Asteraceae family with broad biological and nematicidal activity. Helenium sp contain a compound, tridec-1-en-3,5,7,9,11-pentayne, which showed activity against P. penetrans (Gommers, 1973). The Asteraceae family contains red acetylenic dithio compounds called thiarubrines C (Figure 2.1) with broad spectrum toxicity and maximum activity against nematodes (Gommers and Voor-Holt, 1976). The thiarubrines C, isolated from the roots of the black-eyed Susan (Rudbeckia hirta) killed 50 % M. incognita and P. penetrans juveniles when applied at 12.4 and 23.5 g/ml respectively (Sanchez et al., 1998), whereas treatment of soil with 50 g/ml of thiarubrines C decreased M. incognita infection of tomato seedlings by nearly 95 %. Several other compounds from Asteraceae have revealed acetylenes with nematotoxicity as low as 1.0 g/ml and these compounds include 3-cis,11-trans- and 3-trans,11-trans-trideca-1,3,11-triene-5,7,9- triyne from flowers of Carthamus tinctorius (Kogiso et al., 1976), tridec-1-en- 3,5,7,9,11-pentayne and 9,10- epoxyheptadec-16-en-4,6-diyn-8-ol) from the roots of Cirsium japonicum (Kawazu et al., 1980), 1-phenylhepta-1,3,5-triyne and 2-phenyl-5- (1-propynyl)-thiophene from Coreopsis lanceolata (Kawazu et al., 1980), cis- dehydromatricaria ester from Solidago canadensis, methyl 2-trans,8-cis-deca-2,8-diene- 4,6-diynoate (2-trans,8-cis-matricaria ester) and 2-cis,8-cis-deca-2,8-diene-4,6-diynoate (2-cis,8-cis-matricaria ester) from roots of Erigeron philadelphicus (Kimura et al., 1981), and heptadeca-1,9-diene-4,6-diyne-3,8-diol from roots of Angelica pubescens (Apiaceae) (Munakata, 1983).
2.4.5. Alkaloids They include macromolecular compounds for example chitinase, β-1,3 gluconases, peroxidase, phenolases, lectins, protease inhibitors, polysaccharaides and poly terpenes. Alkaloids are among the most prominent class of secondary metabolites. More than 21 000 alkaloids (nitrogen containing secondary metabolites) have been identified. Most of these alkaloids are known to have potential to suppress parasitic
24 nematodes. Several active compounds representing a wide range of structures, including alkaloids, terpenoids and phenolic compounds have been isolated and characterized (Sener et al., 1998). As many as fifty five organosoluble extracts have been investigated for their biological activities against nematodes. The first alkaloid, the Physostigmine (a tricyclic carbamate) an acetylcholine esterase inhibitor, was isolated from Calabar bean (Physostigma venenosum, Fabaceae). This compound immobilized D. dipsaci at 1000 μg/ml (Bijloo, 1965). Likewise, the Pyrrolizidine alkaloid, monocrotaline from Crotalaria spectabilis, Fabaceae inhibited M. incognita at 10 μg/ml. More recently, the pyrrolizidine alkaloid (1,2-Dehydropyrrolizidine alkaloids PAs) has shown strong nematotoxicity against M. hapla in tomato (Thoden et al., 2009). Three alkaloids (viz., evodiamine, rutaecarpine and wuchuyuamide I) isolated from Evodia rutaecarpa (unripe fruits) exhibited stronger nematocidal activity against M. incognita (Liu et al., 2012) than the crude ethanol extracts of E. rutaecarpa. In another study, five alkaloids isolated from Sophora flavescens (Fabaceae) viz., N- methyl cysticine, anagyrine, martine, sophoramide and sophocarpine were found all nematicidal against Bursaphelenchus xylophilus (Matsuda et al., 1991). The serpentine (alkaloid) found in the roots of Catharanthus roseus (Apocynaceae) inhibited eggs of M. incognita at 0.2% (Chandravadana et al., 1994). Coating of tomato seeds with Serpentine alkaloid prevented seedlings from M. incognita infection (Rao et al., 1996).
2.4.6. Terpenoids and essential oils Terpenoids are 10-carbon compounds and are integral part of many essential oils and fragrants. These have been found to possess activity against insects and pathogens. The nematicidal activity of essential oils (Perez et al., 2003) and terpenoids is well documented (Chitwood, 2002). As many as 12 essential oils from 25 plants have been reported to possess activity against M. javanica juveniles at 1000 μl/L whereas eggs were inhibited at 125 μl/L (Oka et al., 2000). Al-Bana et al., (2003) isolated and evaluated volatile oils such as geranol and thymol, carvacol, cineole and menthol from the methanolic extracts of twenty Jordanian plants against M. javanica and M. incognita.
25
Figure 2.1. Chemical structures of selected phytochemicals with nematicidal activity (Chitwood, 2002).
26 The highest activity (11 % mortality) was achieved by the whole plant extract of Hypericum androsaemum while the leaf extract of Origanum syriacum increased M. javanica mortality. Mahfouz et al. (1995) explored the essential oils viz. carvone, p- cymene and terpinen-4-ol from four medicinal plants belonging to Lamiaceae family for phytonematodes control. All the four oils exhibited juvenile mortality and oxygenated compounds were found responsible for the nematicidal action. Ntalli et al. (2010) evaluated eight essential oils (EOs) and 13 single terpenes for their nematicidal activity againt M. incognita, for three immersion periods viz. 24, 48 and 96 hr. EOs of O. vulgare, O. dictamnus, M. pulegium, and M. officinalis showed high nematicidal activity against M. incognita. The activity of nematicidal terpenes was the highest for L- carvone. It was found that terpenes tested individually showed higher activity than as components in EOs, implementing anatagonistic action (Ntalli et al. (2010). Gossypol with other related terpenoids in the cotton has shown nematotoxicity against M. incognita (Veech, 1979). In a green house study, the menthol and α-terpineol inhibited M. incognita root galling on cotton (Bauske et al., 1994).
2.4.7. Sesquiterpenoids, flavonoids and isoflavoinds Sesquiterpenoids are formed by the condensation of three isoprene units and are
C15 compounds. The aldehyde hemigossypol was the first sesquiterpenoid found to possess nematotoxic activity. Sesquiterpenoids from Asteraceae demonstrated strong nematicidal activity against M. incognita at 1100 μg/ml (Mahajan et al., 1986). Another sesquiterpenoid i.e solavetvone has been found in genetically resistant potatoes against Globodera rostochiensis; however, its nematotoxicity has not been demonstrated (Desjardins et al., 1997). A sesquiterpen, α-humulene isolated from heart wood of Pinus massoniana (Pinaceae) exhibited strong nematicidal effect against larvae of B. xylophilus (Suga et al., 1993). Examples of nematicidal isoflavonoids include quercetin, which inhibited reproduction of M. javanica as a soil drench applied at 400 g/ml (Osman and Viglierchio, 1988). Two other flavonoids, the flavone glycosides linaroside and lantanoside from L. camara, cause mortality to M. incognita juveniles at 1.0% concentration (Begum et al., 2000). Plant extracts from various Artemisia species
27 (Asteraceae) have been found to possess toxicity to mosquitoes and root knot nematodes. Nematicidal, anthelmintic and pesticidal properties of Artemisia spp. have been reported (Barbosa et al., 2010).Extracts from A. verlotorum and A. absenthium have been found toxic to M. incognita juveniles (Dias et al., 2000). Mulching of A. dracunculus into soil at 2 to 4 % reduced Ditylenchus dipsaci by 90 to 96 %. The nematicidal action was considered due to the flavoniod group (Timchenko and Maiko, 1989). S-dos et al., (2003) demonstrated the activity of an ethanolic rhizome extract of A. vulgaris against M. megadora. The extracts inhibited egg hatching by 50 % when applied @ 2.35 mg/ml whereas 50 % juvenile mortality was reported when they were exposed to 55.67 mg/ml.
2.4.8. Steroids and Triterpenoids
Steroids and triterpenoids are C27-30 compounds containing six isoprene units. The glycosides of steroids and triterpenoids are termed as Saponnins. Two steroidal gllycoalkaloidal viz., α-tomatine and α-chaconine showed toxicity to Penegrellus redivivus (Allen and Feldmesser, 1970; 1971). The nematicidal acitivty of eight glycosides isolated from garden asparagus against M. incognita is well reported (Meher et al., 1988). Four compounds (viz., steroidal glycosides asparanin I and asparanin B from Liliaceae and two triterpenoid glycosides viz., albichinin II and sonunin III from Fabaceae) were found effective at a concentration of 200 μg/ml. Two more triterpenoids saponins i.e Acasiasides A and B from Acacia spp., inhibited root galling induced by M. incognita when applied at 10, 000 μg/ml as soil drenches or as foliar spray (4000 μg/ml) (Roy et al., 1993). A triterpenoid, camaric acid (Lanthana camara) killed M. incognita juveniles at 1.0% (Begum et al., 2000). Two flavones-C glycosides (schaftosides and isoschaftosides) isolated from Ariasema arubescens (Wall.) Schott tubers showed activity against M. incognita (Shu-Shan et al., 2011). The limonoids (nematicidal against M. incognita) are the compounds belonging to beta-furanotriterpenoids groups and has been isolated from neem seed kernel (Devakumar et al., 1985).
28 2.4.9. Phenolics and Tannins Phenolic compounds have been isolated from plant roots, identified and then examined for nematicidal activity (Chitwood, 2002). Chavicol induced 100% mortality in C. elegans. Salicyclic acid exhibited toxicity to M. incognita when applied at 50 g/ml and reduced the number of galls in tomato (Maheshwari and Anwar, 1990). Out of 55, eleven phenolic compounds showed toxicity to M. incognita juveniles at 1100 g/ml (Mahajan et al., 1992). Tannins are a group of highly heterogenous phenolic compounds (Jansman, 1993) and differences in their structure could explain their varying biological properties. It has also been demonstrated that condensed tannins had direct toxic effect on the nematodes (Athanasiadou et al., 2001). Tannins concentrations at 100, 250 and 450 g/m2 in pot soil significantly reduced eggs and juveniles/g root, total population density and reproduction rates of M. javanica (Maistrello et al., 2010). Hewlett et al. (1997) reported the efficacy of tannic acid in M. arenaria on tomato at three concentrations of 0.1, 1.0 and 10 g 500 cm-3. Tannic acid applied at a 1.0 g reduced galling whereas galls were suppressed at 10 g 500 cm,-3 however, this dose was toxic to tomato. In vitro and in planta nematicidal effect of different concentrations of tannins on cyst nematode (G. rhostochiensis) was demonstrated by Renco et al. (2012). The nematicidal properties of four organic amendments high in tannins have been evaluated against M. arenaria in in planta experiment (Mian and Rodriguez-Kabana, 1982). The in vitro nematicidal activity of tannins against L3 larvae of the gastrointestinal nematodes (GIN) for example, Haemonchus concortus and Trichostrongylous colubriformis has been demonstrated (Molan et al., 2003).
2.5. Phytochemicals from Fumaria parviflora and their biological activity Fumariacea family conists of about 19 genera and 400 species (Mabberely, 1987) and occurrsmainly in Europe, North America, Asia and Africa (Parveen and Qaiser, 2004). In Pakistan, it is represented by 2 genera and 30 species (Jafri, 1974). One of its member i.e F. parviflora is identical to F. indica Pugsley (Hussain et al., 1985). This herbaceous plant is widely distributed in Pakistan and is commonly known as Pit papra or papra (Al-Shaibani et al., 2009). The plant has been found to possess
29 tannins, saponins, steroids, alkaloids, flavonoids, glycosides, phenols (Naz et al., 2012) and triterpenoid (Rao et al., 2007). The plant is also considered to be a rich source of isoquinoloine alkaloids, most of which have been derived from (+)- reticuline (Hussain et al., 1981). Other alkaloids include protoberberine, the (-)- stylopine (Sasu et al., 2002), coptisine (Popova et al., 1982), and dehydrocheilanthifoline (Hussain et al., 1981); the phthalide isoquinoline alkaloids, (+) -bicuculline (Figure 2.2) (Heidari et al., 2004), (±)- Hydrastine, N-metylhydrasteine (Figure 2.2), narceineimide (Atta-ur- Rahman et al., 1995), fumaridine (Figure 2.3) (Atta-Ur-Rahman et al., 1982) and fumaramine (Atta-ur-Rahman et al., 1982), protoberberine, protopine and cryptopine (Figure 2.2) (Popova et al., 1982); the benziphenathridine sanguinarine (Figure 2.3); and the spirobenzyl isoquinolines fumariline, parfumidine (Figure 2.3) and parfumine (Sasu et al., 2002; Popova et al., 1982). Three new alkaloids from viz., (-)-corlumine, (+)-adlumidine (Figure 2.2) and (-)-cheilanthifoline (protobeberine) have been reported (Blasko and Sharma, 1982). Fumaria parviflora has shown to possess anthelmintic properties (Hordegen et al., 2003). The biological activity of Fumaria spp. is mostly associated with the presence of isoquinoline alkaloids (Erdogan, 2009).The protopine has been reported as the most medicinally active isoquinoline alkaloid because it has been attributed to numerous pharmacological actions (Deng et al., 2001). Likewise the hepatoprotective activity of the protopine is evident from the literature (Pandey et al., 1971). The n- hexane and ethyl acetate extracts of Fumariacea (F. densiflora DC and F. officinalis L.) has shown cytotoxic activity against the brine shrimps with LC50 < 1000 (Erdogan, 2009). The ethanol extracts of F. parviflora showed toxicity against gastrointestinal nematodes i.e. Trichostrongylous spp., Haemonchus spp., and Trichuris spp. (Iqbal et al., 2005). The ethanolic extracts of the plant at concentrations of 3.12, 6.3, 12.5, 25.0 and 50.0 mg ml-1 showed ovicidal and larvicidal effect against the eggs and larvae of gastrointestinal nematodes (Al-Shaibani et al., 2009). Heidrai et al. (2004) determined antinociceptive effect of the methanolic extract of the plant at 300 mg/kg in mice where as the n-hexane-chloroform extracts of the plant showed antipyretic effect in the rabbits (Khattak et al., 1985). The methanolic extracts of the plant exhibited the selective- protective effect against paracetmaole-induced hepatotoxicity (Gilani et al., 1996). The
30 antiparasitic activity of the plant is well documented (Hordegen et al., 2003). Orhan et al. (2007) reported that the alkaloids of F. parviflora did not show any notable antibacterial activity while they had significant antifungal activity at 8 μg ml-1 concentration. These authors further reported the in vitro antiviral effect of the seven alkaloids of the plant. These results were reported by others who reported that the hydro alcoholic extracts of F. parviflora showed less antibacterial activity (Vahabi et al., 2011).The acetylcholine esterase inhibitory effect of the plant has been reported (Orhan et al., 2004). In a preliminary phytochemical screening of ethanolic extracts of 60 plant species against J2s of M. javanica, the extracts of F. indica exhibited 59% mortality after 72 h (Abid et al., 1997). However, the nematicidal activity of the plant extracts and pure compounds of F. parviflora is not well reported in the literature against root knot nematodes.
31
Figure 2.2. Structures of selected alkaloids of Fumaria parviflora (Atta-ur- Rahman et al., 1992).
32
Figure 2.3. Structures of selected alkaloids of Fumaria parviflora (Atta-ur- Rahman et al., 1995).
33 2.7. Management of root knot nematodes with organic amendments Plant tissues contain diverse organic and inorganic compounds which decompose at different rates (Crow and Dunn, 2010). Most of these compounds have been found to be toxic to plant parasitic nematodes. These chemicals may reduce nematode numbers directly, in addition to other benefits derived from soil organic amendments. Green leaf manure of Glircidia maculate, Thespesia populnea, Calatropis gigantia, Azadiracta indica and Glycosmis pentaphylla. reduced galling index and reproductive factor (Rf) of M. incognita in a field experiment (Pakeerathan et al., 2009). Amongst the tested plant material, G. maculata ranked first and reduced galling (35.87), galling index (0.327) and reproductive factor (0.411). Green manures of cabbage, dry straw of rice, chopped pineapple leaves, rye, oat and cotton wastes have been found effective against root knot nematodes in the fields (Oka et al., 2007). It has also been reported in a number of studies that the application of soil organic amendments to the soil stimulated nematode-antagonistic fungi and hence, control wasachieved (Wachira et al., 2009). It is also believed that soil amendments could serve as effective alternatives to chemical fertilizers, thus promote soil fertility and productivity thereby adding organic matter and nutrients to the soil (Sullivan, 2003). Incorporating soil organic amendments to the soil to suppress plant parasitic nematodes has been investigated extensively by many researchers (Riga et al., 2003). For example, marine algae and garlic as control agents against plant parasitic nematodes has shown statistically significant effects in the fields (Anter et al., 1994). Previous studies showed that the addition of asparagus, marigold, Egyptian clover, neem, worm wood and olive dried plant materials reduced galls and egg masses of Meloidogyne spp. in sunflower plants (El-Nager et al., 1993; Abadir et al., 1994). In addition, application of linseed, castor bean, cotton seeds, mustard, sesame and soyabean effectively reduced root knot nematodes (Abid et al., 1995). Ibrahim et al. (2007) evaluated sesame, flakes seed cake, cotton seed cake, camphor dried leaves, termis and fenugreek seed powder, neem, wormwood, demassia, rosemary, asparagus and coleus plant material against M. incognita on sunflower. The coleus plant material showed best results and reduced egg masses and galling index (75.3-76.0%), significantly.
34 Dried plant materials from 20 leguminous species were incorporated into M. incognita infested soil at 1, 2, 2.5 and 5% (w/w) around the tomato rhizosphere. Legumes that were high in bioactive phytochemicalsy suppressed M. incognita, and alos enhanced dry weight and plant height (Morris and Walker 2002). Field study conducted on tomato plants for two consecutive years i.e. 2001/2002 and 2002/2003 satistically significant controlled root knot nematodes when three organic wastes viz., refuse dump, rice husk and sawdust were applied at 15, 30 and 45 metric tons per hectare (Hassan et al., 2010). Refused dump increased tomato yield by 17-100% whereas, sawdust and rice husk increased yield by 13-84 and 21-63%, respectively. Root knot nematodes have been managed in mash bean and okra crop when dried powder of leaves and stem of Rhizophora mucronata were applied at 0.1, 1 and 5% (w/w). Plant parts applied at highest application dose of 5% significantly inhibited M. javanica (Tariq et al., 2007). These authors also reported that stem powder was more effective than leaves in suppressing nematodes. Stone et al. (2000) showed that the addition of organic matter amendments to field soils suppressed a variety of soil borne organisms. Neem and other oil cakes as well as neem derivatives have been evaluated both in field and glass house conditions against many plant parasitic nematodes including M. incognita, Rotylenchulus reniformis, Tylenchorhyncus brassicae and Helicotylenchus indicus (Tyagi and Alam, 1995). The application of neem cake effectively reduced M. incognita population and promoted plant health. Abid et al. (1997) reported that neem derivatives significantly reduced galling indices of M. javanica and promoted plant growth in tomato, brinjal, okra and sponge gourds. The efficacy of neem derivatives to suppress root knot nematodes increased gradually when the period of decomposition increased for 15 to 20 days, which then declined after 30 days of amendments. Other researchers reported that increased in the decomposition time released increased concentration of toxic compounds which curbed nematodes juvenile in the soil (Alam et al., 1982).
35 More recently, the application of soil amendments with urea coated with nimin (neem based product with neem tritepene) and oils of neem, castor and rocket-salad at different doses 0.02, 0.04 and 0.06 g/pot of nimin reduced the development of M. incognita on mung bean, increased the plant growth and chlorophyll contents of the mung leaves (Wani and Bhat, 2012). Some studies have reported the reduction in nematode populations with organic amendments applied to soil in combination with biocontrol agents. Mehdi et al. (2001) showed that Avicennia marina and R. mucronata with or without Pseudomonas aeruginosa reduced root knot nematodes infection in tomatoes. Abid et al. (1997) evaluated neem oil cake in combination with Verticillium chlamydosporium, Paceilomyces lilacinus and Bacillius subtilis in okra, tomato, egg plant and sponge gourd. Verticillium chlamydosporium and P. lilacinus effectively inhibited galls whereas B. subtilus was found inactive. The application of organic amendments not only suppressed nematode population dynamics but also enhance soil nutrient level (McSorley, 1998 and 1999; Riga et al., 2003). The application of velvet bean and rapeseed as green manures and supplemental urea at 200, 300 and 400 mg N/kg soil effectively controlled M. incognita and M. arenaria on cucrbits in a greenhouse experiment. Rapeseed green manure was more effective than velvet bean on in reducing galling index on squash crop. Results showed that decreased viability in eggs of M. incognita was observed from treatments that received rates > 200 mg N/kg soil (Crow et al., 1996). In another study the leaves of rapseed B. napus cv. Jupiter as green manure reduced M. chitwoodi population on potato. The stem and root tissues also showed visible results and reduced J2s population of M. chitwoodi on potato roots at 10 and 23 mg of leaves/kg soil (Mojtahedi et al., 1993).
36 III. MATERIALS AND METHODS
3.1. Soil and root sampling Tomato growing areas of Dargai and Swat in Malakand division of the Khyber Pukhtunkhwa, Pakistan were surveyed during 2010. Tomato root samples with root knots produced by Meloidogyne spp. were collected. Sampling was carried out on the asis of previous crop history. Fields previously cropped with tomatoes and harbouring root knot nematodes were surveyed. Nematode populations were collected from ten different localities in Malakand division as well as from Peshawar (Khyber Pakhtunkhwa) for identification and molecular characterization of root knot nematodes. A total of 30 fields were surveyed and ten roots and five soil samples per field (1/2 acre) were collected randomly in a zigzag pattern (Table 3.1). One hundered grams of feeder roots and 1 kg soil from each field were collected from the tomato rhizosphere to a depth of 20 cm. Samples were carefully placed in polythene bags, properly labelled and transported to the Plant Pathology laboratory. Samples were stored at 4 ˚C (Santhosh et al., 2005) till further use.
3.2. Nematode bioassay The roots were carefully washed with tap water, blotted dry and their gall ratings determined. Roots were visually assessed and scored for the Galling index (GI) using a 0-5 galling scale, where 0 = no on roots, 1 = 1-2, 2 = 3-10, 3 = 11-30, 4 = 31-100, 5 = More than 100 galls per root (Taylor and Sasser, 1978). Twenty grams of the roots were stained in Phloxine B for 15-20 minutes according to Holbrook et al., (1983). The stained roots were rinsed in water and egg masses (EM) were visually counted and scored using a 0-5 egg mass rating index; where 0=no egg masses; 1=1-2; 2= 3-10; 3=11-30; 4=31-100 and 5 = > 100 EM/root system (Taylor and Sasser, 1978).
3.3. Extraction of nematodes from soil The soil was thoroughly mixed and a 100 cm3 sub-sample was used for nematode extraction employing a modified sieving/Baermann funnel technique (Thistlethwayte, 1970). Nematodes were collected after 3 days. The recovered nematodes were enumerated under a stereo-binocular microscope (Olympus SZ 61 at
37 3.5X magnification) and the density expressed as the number of nematodes in 100 cm3 of soil.
3.4. Extraction of nematodes from roots Galled roots of tomato plants were washed thoroughly in running tap water and cut into small segments (1–2 cm long) and agitated for 1 min in 1% NaOCl. The suspension was passed through 75 and 5 µm sieves. The eggs and second-stage juveniles (J2) caught on the 5 µm sieve were washed several times with water, resuspended, and their concentration determined by dilution counts (Hussey and Barker, 1973). Recovered eggs and juveniles were stored in 1 % saline in vials for use in the bioassay (Hussey and Barker, 1973). The recovered nematodes and eggs were enumerated under a stereo-binocular microscope (Olympus SZ 61 at 3.5X magnification) and the frequency of occurrence (prevalence) and incidence of the disease in each locality was calculated as follows:
Prevalence = Number of fields with root-knot nematode infestation X 100 Number of fields surveyed
Incidence = Number of plants with root galls X 100 Total No. of plants sampled
3.5. Maintenance of Meloidogyne incognita culture Meloidogyne incognita identified on the basis of perennial pattern was maintained on susceptible tomato cv. Rio Grande (Solanum lycopersicum) in a greenhouse (approximately 25 ± 5˚C, average relative humidity 70%; day length of 16 h) of the Plant Pathology Department, The University of Agriculture, Peshawar, Kyhber Pakhtunkhwa by inoculating a seedling in pot (15 cm diammeter) containing autoclaved soil with chopped infected roots collected from the infested tomato field in Dargai. Pure cultures from the field population was maintained on tomato cv. Rio-Grande in the greenhouse. Single mature egg mass was inoculated into a pot around the roots of a 2 to 3 week old tomato seedling (at 25 ± 3˚C for two months) using a disposable micropipette to prevent cross contamination. Sub-culturing was done by inoculating new tomato seedling of the same cultivar with at least 15 egg masses, each obtained
38 from pure culture and sufficient inoculum was maintained for bioassay and screen house studies.
3.6. Morphological identification of Meloidogyne species Identification of the Meloidogyne collected from Malakand and Peshawar divisions and those maintained in the greenhouse was carried out on the basis of perineal pattern morphology as described by Eisenback et al. (1981). Mature females from large galls on the roots of tomato plants were dissected. Perineal patterns (10-15) from each sample were mounted in glycerin. Glycerin-infiltrated specimens were examined under a light microscope with oil immersion to study their characteristics (Eisenback et al., 1981).
3.7. PCR identification of Meloidogyne spp. using specific primers Root knot nematode populations collected from Malakand and Peshawar divisions (Table 3.1) and females identified on the basis of their perineal patterns were used in polymerase chain reaction (PCR) assays. As it is not easy to identify Meloidogyne second stage juveniles, by their morphological characteristics, PCR served as a practical tool to assist with identification of the field samples. In this study D2A- D3B primers (De Ley et al., 1999) amplifying the D2 and D3 expansion region of the large subunit (LSU) rRNA nuclear gene, 194/195 primers amplifying the intergenic spacer region between the 5S-18S ribosomal gene (Blok et al., 1997), species-specific primers (SCAR-Sequence characterized amplified region) for diagnosis of M. javanica, M. incognita, and M. arenaria (Zijlstra, 2000), C2F3/1108 primers amplifying the COII/lrRNA region of the mtDNA of root knot nematodes (Hugall et al., 1994) and RAPD primers SC 10-30 (Zijlstra et al. 1997), OPG-13 and OPG-19 (Adam et al., 2007) were used (Table 3.2).
3.7 (a) Extraction of DNA from nematodes DNA was extracted from individual J2s and females from the populations listed in Table (3.1) using worm lysis buffer [WLB; 50 mM KCl, 10 mM Tris pH 8·0, 15 mM −1 MgCl2 60 μ g ml proteinase K (Roche), 0·45% Tween 20 (Sigma) (Castagnone- Sereno et al., 1995). Individual J2s were picked up with the help of needle. J2s were
39 placed in 10 μl worm lysis buffer on a glass microscopic slide and cut into two pieces with a scalpel under a stereomicroscope (Nikon, UK). Using a micropipette, the cut nematode in 20 μl buffer was then transferred to a 0·5 ml centrifuge tube. A similar procedure was applied to females. Females were picked up with tweezers, rinsed in distilled water and squashed with a mini plastic pestle in 20 μl lysis buffer in a 1.5 ml tube. Squashed females were then transferred to a 0.5 ml centrifuge tube using a micropipette. The tubes were centrifuged at 13, 500 r.p.m. for 2 min, then placed at - 80˚C for 10 min. The tubes were incubated at 65 ˚C for 1 h, followed by 95 ˚C for 10 min. The samples were then frozen at -20 ˚C or used immediately for PCR.
3.7 (b) PCR amplification with rDNA, SCAR and (COII/lrRNA) mtDNA primers PCR amplifications using rDNA, species-specific SCAR and mitochondrial DNA PCR primers were carried out in 25 μl reactions. 0.5 μl of DNA extract and 0·5 μl of each 10 μM primer (Table 3.2) were used with PuReTaq Ready-to-Go™ PCR beads (Amersham) or Taq polymerase (Promega, UK). The reactions using Taq polymerase also included 2.5 μl buffer, 1.5 μl of 50 mM MgCl2 and 2.5 μl 20 mM of each dNTP and 2 units of enzyme. The PCR amplification conditions used for each primer set are described in Table (3.3). All amplification tests included a no-template control. All primers were obtained from MWG Biotech (UK). PCR was performed in a Gene-Amp PCR Applied Bio-system 9700 (UK) at the James Hutton Institute, Dundee, Scotland (UK). The reaction products were resolved by electrophoresis on 1.0 % agarose gels in 1X Tris borate EDTA (TBE), stained with Sybr® safe DNA staining dye (Invitrogen, USA) and visualized with UV light (Uvitech-Cambridge, UK).
40 Table 3.1. Root knot nematodes (Meloidogyne spp.) collected from major tomato growing areas of Khyber Pakhtunkhwa province of Pakistan.
S.No Locality Fieldsa Cultivar Fieldsb Codec 1 Dargai D1 Riogrande D1 L1 2 Dargai D2 Riogrande D1 L2 3 Dargai D3 Riogrande D1 L3 4 Heroshah H1 Riogrande H1 M1 5 Heroshah H2 Riogrande H2 M2 6 Heroshah H3 Riogrande H2 M3 7 Swat S1 Riogrande H2 M4 8 Swat S2 Riogrande S3 J1 9 Swat S3 Riogrande S1 J2 10 Sakhakot SK1 Raja S3 J3 11 Sakhakot SK2 Riogrande S1 J4 12 Sakhakot SK3 Riogrande SK1 F1 13 Peshawar P1 Raja SK2 F2 14 Peshawar P2 Riogrande SK1 F3 15 Peshawar P3 Riogrande SK1 F4 16 Batkhela B1 Riogrande P2 T1 17 Batkhela B2 Riogrande P2 T2 18 Batkhela B3 Raja P3 T3 19 Jabban J1 Riogrande M1 W1 20 Jabban J2 Riogrande M1 W2 21 Jabban J3 Riogrande M1 W3 22 Malakander MK1 Raja J1 R1 23 Malakander MK2 Riogrande J1 R2 24 Malakander MK3 Raja J1 R3 25 Thana T1 Riogrande MK1 Q1 26 Thana T2 Riogrande MK1 Q2 27 Thana T3 Riogrande MK1 Q3 28 Wartair W1 Riogrande T1 H1 29 Wartair W2 Riogrande T3 H2 30 Wartair W3 Riogrande W1 E1 W1 E2
aFields surveyed for prevalence and incidence of RKNs. Three hundred roots (ten plants per field) and 150 soil (5 samples per field) were selected from 30 commercial production fields of tomato.
bFields selected for molecular identification cIndividual nematodes (juveniles or females) used in molecular identification
41 Table 3.2. Primer codes used for identification of Meloidogyne species, their sequences and sources.
Primers Primer sequence 5′-3′ Specificity and source Code D2A ACAAGTACCGTGAGGGAAAGTTG 28 S ribosome region D3B TCGGAAGGAACCAGCTACTA De Ley et al. (1999)
194 TTAACTTGCCAGATCGGACG 5S-18S ribosome region 195 TCTAATGAGCCGTACGC Blok et al. (1997) Far TCGGCGATAGAGGTAAATGAC M. arenaria-specific SCAR Rar TCGGCGATAGACACTACAAACT Zijlstra. (2000) Fjav GGTGCGCGATTGAACTGAGC M. javanica-specific SCAR Rjav CAGGCCCTTCAGTGGAACTATAC Zijlstra et al. (2000) Finc CTCTGCCCAATGAGCTGTCC M. incognita specific SCAR Rinc CTCTGCCCTCACATTAGG Zijlstra. (2000) C2F3 GGTCAATGTTCAGAAATTTGTGG COII/lrRNA region of mtDNA 1108 TACCTTTGACCAATCACGCT Hugall et al. (1994) SC 10–30 CCGAAGCCT Zijlstra et al. (1997) OPG −13 CTCTCCGCCA Operon Technologies
OPG −19 GTCAGGGCAA Operon Technologies All primers synthesized by MWG Biotech (UK).
Table 3.3 PCR amplification profiles used with different primers for identification of Meloidogyne species.
Once Denaturation Annealing Extension Once (Once) (45 cycles) 55 ˚C (D2A D3B) 50˚C (194/195) 61˚C (Far/Rar) 64˚C (Fjav/Rjav) 5 4˚C (Finc/Rinc) 94 ˚C for 2 94 ˚C for 30 min sec 30 Sec 72˚C 90 Sec (194/195) 72˚C 1 min for remaining 7 min 4 ˚C primers 60 °C for 3 min ∞ (C2F3/1108primers)
42 3.8. DNA sequencing of 28S rDNA The 28S nuclear rDNA gene fragment was amplified using DNA extracted from single females with primer-pair D2A and D3B (Chen et al., 2003; Tigano et al., 2005). PCR assays were performed according to Adam et al. (2007). PCR amplifications using rDNA D2A-D3B primers were carried out in 25 μl reactions. 0.5 μl aliquot of DNA extract and 0·5 μl of each 10 μM primer (Table 3.2) were used with PuReTaq Ready-to- Go™ PCR beads (Amersham). The PCR amplification conditions used for the rDNA gene (D2A-D3B) primer set are described in Table (3.3). PCR was performed in Gene- Amp PCR applied bio-system 9700 as describes above. The 28S rDNA PCR products were purified using a QIA-quick PCR purification kit (QIAGEN GmbH, UK) as recommended by the manufacturer and used for direct DNA sequencing. The resulting purified PCR products were run on agarose gel. The purified PCR product (25 ng) was added to a 1.5 ml Eppendorf tube for each sequencing reaction and diluted with 15 μl
PCR H2O. The lines of selected nematode populations (M3, J3, J4, F2, T1, W2, H1 and R2) belonging to the main tomato growing areas (Heroshah, Swat, Sakhakot, Peshawar, Batkhela, Jabban and Thana) of Khyber Pakhtunkhwa province (Table 3.1) were sequenced at the James Hutton Institute sequencing facilities with an ABI PRISM-3100 genetic analyzer (Applied Biosystems).
3.9. PCR-RFLP (PCR-Restriction Fragment Length Polymorphism) In order to perform PCR-RFLP, the nucleotide sequences of the mtDNA of root knot nematodes were retrieved from the NCBI database. Using the BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi), the nucleotide sequences of cytochrome oxidase subunit II (COII) gene and 16S ribosomal RNA gene of the mtDNA for each of M. javanica, M. incognita and M. arenaria were retrieved. The accession numbers of the nucleotide sequence of (COII) gene and 16S ribosomal RNA gene of the mtDNA of M. javanica, M. incognita, M. arenaria and M. arenaria MAk4 are presented in Table (3.4, 3.5 and 3.6). The restriction maps of these nucleotide sequences were obtained using Bio-edit program (Version 7.0.9.0 Restriction Mapping Utility; Tom Hall, 1998-2007) (http://www.mbio.ncsu.edu/bioedit/bioedit.html). Tables (3.4, 3.5 and 3.6) show the 4, 5 and 6-bp restriction enzymes with their recognition sites and positions. In order to distinguish the 3 species of root-knot nematodes, PCR-RFLP and subsequent digestion of
43 the amplicon with four 4-bp restriction enzymes viz., Taq 1 (Promega), Hinf 1(Promega), Mbo 1 (Promega), Alu 1 (Promega) and one 6-bp enzyme EcoR1 (Promega) was done. The primers used for PCR-RFLP analysis were used according to the method described by Powers and Harris (1993), which amplified the region between the COII gene and the lrRNA gene of the mtDNA (Table 3.2). The PCR reaction was carried out in a 25 μl (1 μl of primer, 1 μl of template DNA and 23 μl of distilled water) using PuReTaq Ready-to-Go™ PCR beads (Amersham). After an initial 2-minute denaturation step at 94˚C, 45-cycle amplification (94 ˚C for 30 sec, 54˚C for 30 sec, and 60 ˚C for 3 min) was performed. The final extension step was continued for 7 min at 60 ˚C. In order to confirm the successful amplification of DNA by PCR, electrophoresis was conducted using a 1× TBE buffered 1% agarose gel. The amplified products were digested separately with the 4-bp (Hinf I, Taq1 and Mbo1, Alu 1) and 6-bp (Eco R1) restriction digestion enzymes. Digestion was performed in a mixture of 7 μl of the PCR product, 0.5 μl of the enzyme, 2 μl of the 10X buffer, 0.2 μl of 10 μg/μl Acetylated BSA and 10.3 μl of the distilled water for 2 hrs at 37 ˚C incubation when Hinf 1 and Mbo1, Alu 1 or Eco R1 were used and 65 ˚C incubation for 2 hrs when Taq 1 was used. In order to confirm the successful digestion of the PCR products, electrophoresis was conducted using a 1× TBE buffered 1% agarose gel stained with 0.5 μl of Sybr® safe DNA staining dye (Invitrogen, USA). The product sizes were visualized using UV illumination (Uvitech-Cambridge, UK).
44
Table 3.4. The 4-bp restriction enzymes used to digest the COII/lRNA gene of the mtDNA of three Meloidogyne spp. and their sequences and positions of digestion.
S.NO Restriction Recognition Position Enzyme M. incognita M. javanica M. arenaria M. arenaria (MAK4)
Accession No. Accession No. Accession No. Accession No. AY635611 AY635612 AY635610 GQ266685 1 Alu 1 AG'CT 2 BsaBI GATnn'nnATC 785 - - - 3 BstF5I GGATG nn' 774 - - - 4 BstKTI GGAT'C 455, 789 - - - 5 CviJI rG'Cy 139, 832, 1068, 1115 - - - 6 MboI 'GATC_ 452, 786 565, 1006 484 480, 921 7 MboII GAAGAnnnnnnn_n' 657, 850, 995 - 607 - 8 MnlI CCTCnnnnnn_n' 1422 - 1032 - 9 MwoI GCnn_nnn'nnGC 1482 - 1092 - 10 PpiI GAACnnnnnCTCnnnnnnnn_nnnnn' 579 - 611 - 11 PpiI GAGnnnnnGTTCnnnnnnn_nnnnn' 611 - 643 - 12 SwaI ATTT'AAAT 1360 1581 970 - 13 TaiI _ACGT' 683, 822, 974 846, 1194 - 761, 957, 1109 14 TaqII CACCCAnnnnnnnnn_nn' 331 - 362 - 15 ATGAAnnnnnnnnn_nn' 24, 376, 866, 1016, - - TspDTI 1254 24, 407, 864 16 XmnI GAAnn'nnTTC 1003 - - - 17 DpnI GA'TC 454, 788 567, 1008 486 482, 923 18 Eco57I CTGAAGnnnnnnnnnnnnnn_nn' 720 - - - 19 Eco57MI CTGrAGnnnnnnnnnnnnnn_nn' 720 - - - 20 FokI GGATGnnnnnnnnn'nnnn- 761 21 HphI GGTGAnnnnnnn_n' 355 - - - 22 HpyCH4IV A'CG_T 680, 819, 971 843, 1191 - 758,954, 1106 23 HpyF10VI A'CGT- 1483 - 1093 -
45
Table 3.5. The 5-bp restriction enzymes used to digests the COII/lRNA gene of the mtDNA of three Meloidogyne spp. and the sequence and position of digestion.
S. No Restriction Recognition M. incognita M. javanica M. arenaria M. arenaria (MAK4) enzyme Accession No. Accession No. Accession No. Accession No. AY635611 AY635612 AY635610 GQ266685 1 SwaI ATTT'AAAT 1360 1581 970 1495
Table 3.6. The 6-bp restriction enzymes that digest COII/lRNA gene of the mtDNA of three Meloidogyne spp. and the sequence and positions of digestion.
S. No Restriction Recognition M. incognita M. javanica M. arenaria M. arenaria(MAK4) enzyme Accession No. AY635611 Accession No. Accession No. Accession No. AY635612 AY635610 GQ266685 1 AseI AT'TA_AT 27, 390, 861, 893, 1072, 111, 503, 1113, 27, 422, 682, 882 27, 418, 1028, 1207, 1272 1292, 1492 1408 2 DraI TTT'AAA 145, 165, 1221, 1326, 15, 229, 249, 818, 145, 165, 831, 936, 145, 165, 733, 1357, 1360, 1419,1581, 1640 1441, 1547 970, 1029 1461, 1495, 1554, 1495 3 EcoRI G'AATT_C 1003 1223 - 1138 4 HindIII A'AGCT_T 830 1050 - 965 5 MfeI C'AATT_G 210, 424, 1079 294, 537, 1299 456, 689 210, 452, 1214 6 PsiI TTA'TAA 230, 653, 1192, 1262, 314, 766, 1412, 230, 802, 872, 911, 230, 681, 1328, 1398, 1301, 1347 1482, 1521, 1568 957 1437, 1482 7 SnaBI TAC'GTA 681 844 - 759 8 SspI AAT'ATT 134, 244, 498, 566, 752, 6, 218, 328, 611, 134, 244, 530, 806, 134, 244, 526, 887, 1052, 1196, 1293 972, 1275, 1416, 903 1190, 1332, 1429 1513 9 SwaI ATTT'AAAT 1360 1581 970 1495
46
3.10. RAPD-PCR amplification PuReTaq Ready-to-Go™ RAPD beads were used in RAPD-PCR amplification. Three RAPD primers viz., SC 10-30, OPG-13 and OPG-19 (Table 3.2) were used. Amplification reactions were prepared with 1 μl of 10-μM RAPD primer and 23μL sterile distilled water, which were added to the PuReTaq Ready-to-Go™ PCR beads. 1 μL of DNA extracted from individual nematodes was added to each reaction and the tubes centrifuged briefly to ensure that the reaction contents were mixed. Amplification was carried out in Applied Bio-system thermocycler 9700 (UK) using cycling conditions of 94˚C for 2 min, followed by 45 cycles of 94°C for 1 min, 38˚C for 1 min and 72˚C for 2 min, and one final cycle of 72°C for 10 min. Amplification products were separated by electrophoresis in a 1% Tris-borate EDTA (TBE) buffered agarose gel at 50 V followed by gel staining with Sybr® safe DNA staining dye (Invitrogen, USA) and UV illumination (Uvitech-Cambridge, UK) (Adam et al., 2007).
3.11. Analysis of RAPD The bands present in the two replicates were scored as present (1) or absent (0). A bivariate (1-0) data matrix was generated. Genetic distances were calculated using the Unweighted Pair Group of Arithmatic mean (dendro-UPGMA) (http://genomes.urv.es/UPGMA/) procedure Nei and Lei (1979) [F=2Nxy/(Nx+Ny)]. Genetic distances based on Jaccard’s coefficient (dendro-UPGMA) were determined. The bivariate 1-0 data matrix for each population based on the data of three RAPDs primers were used to construct a dendogram/phylogram using dendro-UPGMA (http://genomes.urv.es/UPGMA/). In addition a bootstrap analysis (http://genomes.urv.es/cgi-bin/UPGMAboot_v4.cgi) was performed to generate 100 random sets from the original data in order to assess the support for groupings within the original dendogram.
3.12. Phytochemical studies (Part B) All chemical analyses were performed at the Phytopharmaceutical and Nutraceutical Research Lab (PNRL), Institute of Chemical Sciences, University of Peshawar. Spectra were done at the International Centre for Chemical Sciences, H.E.J,
47
Research Institute of Chemistry, University of Karachi and University of Strathclyde, Glasgow, UK.
3.12.1. Melting Points All melting points were determined in glass capilliary tubes using melting apparatus of Bibby Scientific Limited, Stone Staffordshire ST15 0SA, UK and these were not corrected.
3.12.2. Mass Spectra Mass spectra (EIMS) were determined on JEOL MSRoute, using direct insertion probe at H.E.J, Research Institute of Chemistry, University of Karachi.
3.12.3. Nuclear Magnetic Resonance (NMR) spectra 1 13 H-NMR and C-NMR spectra were recorded in CD3OD and CDCl3 on Bruker ANANCE 400 and 600 MHz instruments, J values were measured in Hz. Carbon atom types were assigned by employing a combination of 13C NMR spectra, broadband proton decoupled and distortionless enhancement by polarization transfer (DEPT) experiments. Assignments were done by employing a combination of 1-D and 2-D NMR experiments. 2-D NMR spectra were acquired and processed by Bruker TOPSPIN software. 1H-1H correlations by double quantum-filtered COSY. 1H-13C NMR correlations were established by using HMQC and HMBC pulse sequences.
3.12.4. Solvents All commercial grade solvents viz., n-hexane, ethyl acteate (EtOAC), methanol
(MeOH) and choloroform (CHCl3) were used after distillation. Dimethyl sulfoxide (DMSO, 99.9 %, Merck, Darmstadt, Germany) was used for dissolving the dried extracts. For column chromatography laboratory grade solvents (Merck, Germany) were used.
3.12.5. Filtration and Evaporation All extracts were filtered through Whatman No. 1 (11 µm) filter paper (GE Health care, UK) and evaporated to dryness at 60 ˚C under reduced pressure using a rotary evaporator (BUCHI, Rotavapor®, UK).
48
3.13. Purification of compounds 3.13.1. Column Chromatography (CC) Column chromatography (CC) was carried out using silica gel (Si 60, 70-240 mesh, E. Merck) as stationary phase and organic solvents (n-hexane, MeOH, EtOAC and CHCl3) as mobile phase.
3.13.2. Thin Layer Chromatography (TLC) All thin layer (TLC) plates were using Merck Kieselgel 60 F254 precoated silica gel (20 x 20 cm, 10 µm pore size, Merck, Germany).
3.14. Spray Reagents for TLC 3.14.1. Ceric sulphate The TLC plates were visualized by spraying with ceric sulphate solution made by dissolving 0.26 g of ceric sulphate in 10 ml of sulphuric acid and diluted to 100 mL.
3.14.2. Dragendorff’s reagent A mixture of 25 ml acetic acid, 2.6 g basic bismuth carbonate and 7.0 gm sodium iodide was boiled for a few minutes. The copious precipitates of sodium acetate were filtered through a sintered glass filter after about 12 h. 20 ml of the clear red- brown filtrate was mixed with 80 ml ethyl acetate and 0.5 ml water. This was the stock solution. The spray reagent was prepared by mixing 10 ml stock solution, 100 ml acetic acid and 140 ml ethyl acetate. Alkaloids and occasionally a number of compounds carrying no nitrogen appear as orange coloured spots after spraying.
3.15. Plant Collection Fumaria parviflora Lam, a medicinal plant and an annual herb was collected in March-April 2009 from the wheat fields of the Agricultural Research Farm, Malakandher, the University of Agriculture, Peshawar. The plant was authenticated and vochure specimen (No. ISH-1732) was deposited in the herbarium of the Department of Botany, University of Peshawar. Mature F. parviflora plants (stem and roots) were harvested, washed in tap water and frozen at -80 ˚C for 24 h. It was lyophilized and crushed in a grinder to particle size of around 1 mm long and finally stored in air tight polythene bags.
49
3.15.1 Preparation of methanolic extract of Fumaria parviflora a) Crude extracts The crude extract of the stem, roots and leaves of the plant was prepared according to the techniques described by Onyeyili et al. (2001) and Iqbal et al. (2006). Briefly, the powdered plant materials (50 g) were extracted with 99 % methanol at 50 ˚C for about 2 hrs in a flask. Following cooling to 30 ˚C, the residues were filtered. The filtered extract was evaporated to dryness under vacuum on a rotary evaporator at 60 ˚C and the yield of the dried crude extract (3.0 g stem, 3.5 g root and 4.6 g leaves) were recorded and stored at 4 ˚C until used. All the crude extracts were qualitatively analyzed using TLC and screened to determine nematicidal bioassays (egg hatching and juvenile mortality). The extracts exhibiting good activity were further fractionated into four fractions viz., n-hexane, ethylacetate, chloroform and methanol (Figure 3.1).
b) Stem and roots Lyophilized stem and root powder, 350 g (each) was separately and successively extracted with n-hexane (200 ml), chloroform (CHCl3) (200 ml), ethyl acetate (EtOAC) (200 ml) and methanol (MeOH) (200 ml) using a soxhlet extractor for about 3-4 h. All the extracts were filtered and evaporated to dryness at 60 °C under reduced pressure using a rotary evaporator. The yields of n-hexane, EtOAC, CHCl3 and MeOH extracts from the stem were 66.0, 52.0, 61.0 and 72.0 mg respectively and roots were 88.0, 65.0, 57.0 and 71.0 mg, respectively. TLC of all the fractions was performed. Dried fractions were stored at 4 °C in brown bottles for use in the nematicidal bioassays and the in planta study. The general scheme for extraction and fractionation is given in Figure 3.1.
3.15.2. Bioactivity-guided isolation and identification of nematicidal compounds from the root n-hexane and methanol fractions The air dried, powdered roots (1 kg each) were separately extracted with n- hexane and methanol (each for 4 h) in a soxhlet apparatus. The extracts were concentrated on a rotary evaporator under vacuum to yield the crude residue (Figure 3.1). For purification and isolation of the active plant extracts, the n-hexane (38.0 g) and methanol (MeOH) (22.0 g) fractions obtained from the roots were sequentially
50
Figure 3.1. General scheme for the extraction of stem and roots of Fumaria parviflora.
51
fractionated and each fraction and/or pure compound being subjected to nematotoxicity (juvenile mortality and egg hatch inhibition).
3.15.3. Column Chromatography of n-hexane fraction of the roots The n-hexane extract (38.0 g) obtained from the roots were subjected to column chromatography over silica gel. Elution was carried out using n-hexane:ethyl acetate (100:0, 90:10, 85:15, 80:20, 75:25, 70:30, 65:35, 60:40, 50:50, 40:60, 30:70, 20:80, 10:90, 0:100) and finally with methanol. A total of 69 eluents of 100 ml were collected in test tubes. TLC of all the fractions was performed and similar fractions were combined into eleven major fractions. Fraction F3 was purified through column chromatography (ethyl acetate: n-hexane, 1:19) and yielded compound 1 (90.0 mg). Fraction F4 was subjected to column chromatography, eluted with ethyl acetate: n- hexane (1:17) and yielded compound 2 (25.0 mg). Fraction F11 was subjected to pencil column chromatography over silica gel eluted with n-hexane: ethyl acetate (1:1) and yielded six sub fractions (F11.1, F11.2, F11.3, F11.4, F11.5 and F11.6), however these and other fractions (F1, F2, F5, F6, F7, F8, F9 and F10) due to their minute quantities were not further purified. Pure compounds were characterized by detailed spectroscopic data (1H NMR, 13C NMR and MS spectra) and chemical evidences (Pandey et al., 2007). The isolation scheme is given in Figure 3.2.
3.15.4. Column chromatography of the methanol fraction of the roots The methanol extract of the roots (22.0 g) was dried in vaccuo and extracted again with 10 % aqueous hydrochloric acid. The acidic fraction was extracted with EtOAC and the two layers viz., EtOAC (FM1, 3.0 g) and aqueous layers were separated. The aqueous layer was basified with ammonia (NH4OH) up to pH 8.0 followed by extraction with EtOAC layer to give FM2 (4.0 g, carrying alkaloids) and the aqueous layer FM3 (120.0 mg). The FM2 layer (4.0 g, dissolved in CHCl3) was chromatographed over silica gel column eluting with solvents of increasing polarity to afford sixty eluents (50.0 mL each). Fractions similar (on TLC) were combined into seven sub fractions (FM2.1, FM2.2, FM2.3, FM2.4, FM2.5, FM2.6 and FM2.7).
52
Figure 3.2. Schematic pathway for the isolation of compounds from n-hexane root extract of Fumaria parviflora.
53
Figure 3.3. Diagrammatic scheme for isolation of alkaloids from the methanol (MeOH) fraction of the roots of Fumaria parviflora.
54
The eluates from methanol-chloroform (1:17) of FM2.1 were crystallized in methanol and furnished an alkaloid as a colourless amorphous powder. It was characterized by detailed spectroscopic data i.e. 1H NMR, 13C NMR and MS spectra and chemical evidences (Pandey et al., 2007). The isolation scheme is given in Figure 3.3.
3.16. Determination of extractive values, phenolic contents and phytochemical screening of Fumaria parviflora
3.16.1. Extractive values For determination of extractive values, 30 g of dried powdered plant material (roots and stem) were separately and successively extracted with n-hexane, ethyl acteate
(EtOAC), cholorofrm (CHCl3) and methanol (MeOH) in a quantity of 30 mL (each). The soluble compounds were filtered and concentrated on a rotary evaporator under reduced pressure at 60 ˚C. The percentage yield of each extract was determined following the procedure described by Banso and Adeyemo (2007).
3.16.2. Determination of total phenolic contents using the Folin-ciocalteau Spectrophotometric method Dried stems and roots (20 g each) of Fumaria parviflora were extracted with 200 mL of ethanol at 30 ˚C, centrifuged at 150 rpm for 24 h, filtered, dried at 40 ˚C and the yield was recorded. Total soluble phenols in ethanolic extract (root and stem) were determined with Folin-ciocalteau reagent according to the method of slinkard (Slinkard and Singleton, 1977) using pyrocatechol as a standard. Briefly, one ml of the stem and roots extracts (10 mg/ml) was diluted with 46 ml of distilled water. To these, one ml
Folin-ciocalteau and 3 ml of Na2CO3 (2 %) were added. The mixture was allowed to stand for 2 hrs with continuous shaking. Standard solutions of pyrocatechol (reference phenolic compound) at concentrations of 1, 2, 3, 4 and 5 ppm were prepared. The standard curve was obtained by applying the Folin-ciocalteau Spectrophotometric method. The absorbance was measured at 760 nm.
55
The concentration of total phenolic compounds in the stem and root extracts was determined as microgram of pyrocatechol equivalent by using an equation that was obtained from standard pyrocatechol graph, using the following formula (Gezer et al., 2006; Mariela et al., 2003).
Total Phenolic contents = Graphical reading x volume Weight of sample
3.16.3. Quantitative determination of saponins and alkaloids Saponins and alkaloids were determined using dried and powdered plant material (roots and stem) of F. parviflora 100 g each extracted with 99 % methanol (150 ml). The solvent was evaporated and 10 g dried extract of the roots and stem were dissolved in 5% HCl (50 mL). The mixture was centrifuged and the supernatant was basified with NH4OH (pH 8-10). The aqueous (basic) portion was extracted with ˚ CHCl3, concentrated under reduced pressure at 60 C and the amount of alkaloids was determined (Sofowora, 1993). For quantification of saponins, 10 g of ground plant material (stem and roots) separately were defatted with 30 mL n-hexane, extracted three times with 30 ml methanol and concentrated to one third of the original volume. Cold acetone (100 mL) was added to the extract and refrigerated for 50 minutes. The extract was filtered and the weight of the saponins was determined (Sofowora, 1993).
3.16.4. Phytochemical screening of Fumaria parviflora
The qualitative phytochemical tests were performed on the n-hexane, CHCl3, EtOAC and MeOH extracts of the root and stem of F. parviflora following the standard procedures of Sofowora (1993) for identification of chemical constituents.
3.16.4.1. Tannins To each extract (0.2 g) in a test tube was added two drops of 5 % ferric chloride solution. The appearance of a dark green color was indicative of the presence of tannins.
56
3.16.4.2. Glycosides Each extract was hydrolyzed with HCl and neutralized with NaOH solution. A few drops of Fehling’s solution A and B were added to each mixture. Formation of red precipitates indicated the presence of glycosides.
3.16.4.3. Steroids Acetic anhydride (2 mL) was added to the mixture of 0.2 g of each extract and
H2SO4 (2 mL). The colour change from violet to blue or green in some samples indicated the presence of steroids.
3.16.4.4. Flavonoids To 0.2 g of each of the extract (roots and stem) of the plant in a test tube was added 10 mL of DMSO. The mixture was heated, followed by the addition of magnesium metal and 6 drops of concentrated hydrochloric acid. The appearance of red colour was indicative of the presence of flavonoids.
3.16.4.5. Alkaloids To each of the extract (0.2 g) (roots and stem) of the plant in two separate test tubes was added 2-3 drops of Dragendorff’s reagent. The development of an orange red precipitate in the tubes was indicative of the presence of alkaloids.
3.16.4.6. Saponins To 0.5 g of each of the extract (stem and root) of the plant in a test tube was added 5 ml de-ionised distilled water. The contents were vigorously shaken. The appearance of a persistent froth that lasted for 15 minutes was indicative of the presence of saponins.
3.17. Pathogenicity Test Two weeks old seedlings of Fumaria parviflora were singly transplanted into 6 earthen pots (replicated 4 times) containing one kg sterilized soil + river sand + farm yard manure (3:1:1) mixture. After one week each seedling was inoculated with 500, 1000, 2000, 4000 and 8000 second stage juveniles (J2) of M. incognita/kg soil. The
57
uninoculated pot served as a control. After 60 days the inoculated and uninoculated plants were uprooted and compared for the symptoms (galls) production.
3.18. In vitro bioassays 3.18.1. Preparation of stock solutions A microwell bio-assay was performed to determine the activity of all the fractions (crude extracts, stem and roots solvent fractions of the plant) against juveniles (J2s) and eggs of M. incognita, using the procedures of Al-Shabani et al. (2009). The stock solution of the extracts (n-hexane, EtOAC, CHCl3, and MeOH) was prepared by dissolving the respective dried extracts in dimethyl sulfoxide (DMSO) and further dilutions were made in distilled water. The final concentration of DMSO did not exceed 1% (v/v). An aliquot of the starting solutions (50.0 mg mL-1) was taken for preparation of final concentrations of 3.12, 6.24, 12.5, 25.0 and 50.0 mg mL-1 (Al-Shaibani et al., 2009). A preliminary nematicidal activity using crude extracts of root, stem and leaves at three different concentrations viz., 3.12, 6.24, 12.5 mg mL-1 was done against eggs and J2s of M. incognita. The crude extracts exhibiting good nematotoxicity were further fractionated with different solvents and activity guided fractions were subjected to column chromatography using different solvent systems. The nematicidal activity of the various fractions and/or pure compounds was further evaluated at different concentrations and time intervals according to the following procedures.
3.18.2. Effect of Fumaria parviflora extracts on egg of Meloidogyne incognita The eggs of M. incognita were surface sterilized with NaOCl (1%) by agitation in a sterile vial for 5 minutes. The eggs were rinsed on 25 µm aperture sieve with distilled water (Meyer et al., 2004). In an assay approximately 1000 ±50 eggs in a final volume of 1 mL at final concentration of 3.12, 6.24, 12.5, 25.0 and 50.0 mg mL-1 of F. parviflora extract (stem and roots separately) were used whereas distilled water (dissolved in DMSO (1 % v/v) was used as negative control. A total of four replications for each concentration of each extract along with control were performed and the experiment was performed twice in identical conditions in a completely randomized design (CRD). The microwell plates (MultiwellTM, 24 well, Becton Dickinson, USA) were incubated under humidified conditions at 27 oC temperature for three days in the
58
dark. Unhatched eggs and L1 larvae in each well was counted after 24, 48 and 72 h of incubation. Percentage of unhatched eggs in each well was calculated as follow.
Total number of unhatched eggs Percent egg hatch inhibition = ------X 100 Total number of eggs
In second and third in vitro experiments, microwell egg bioassays on eleven sub fractions (F1, F2, F3, F4, F5, F6, F7, F8, F9, F10 and F11) isolated from root n- hexane fractions and eight sub fractions of MeOH (FM2.1, FM2.2, FM2.3, FM2.5, FM2.6, FM2.7 and FM3-aqueous) were performed by taking 1000 ± 50 eggs of M. incognita and selecting four concentrations viz., 100, 200, 300 and 400 µg mL-1 of each fraction according to standard procedures (Al-Shaibani et al, 2009). Cabofuran (Furadan 3G) was used as positive control whereas distilled water (dissolved in DMSO (1% v/v) was used as negative control. Both experiments were performed twice and replicated four times in a completely randomized (CR) design in a factorial arrangement. All the experimental conditions as stated above were followed and percentage of unhatched eggs in each well was calculated according to the above formula.
3.18.3. Effect of Fumaria parviflora extracts on J2s mortality of Meloidogyne incognita Surface sterilized eggs were placed in fresh water in a cavity block to obtain juveniles which hatched after 3-4 days. About 200, J2s were dropped per microwell plate (MultiwellTM, 24 well, Becton Dickinson, USA) in a final volume of 1 mL at final concentration of 3.12, 6.25, 12.5, 25.0 and 50.0 mg mL-1 of the plant extract. Distilled water with 1 % DMSO (v/v) was used as negative control. Incubation was done at 27 oC in the dark and each treatment was replicated four times whereas the experiment was repeated two times in the same conditions in a completely randomized design (CRD).
Data were recorded after 24, 48 and 72 h and active and inactive J2s were counted in the extracts and control wells. Juveniles were defined as dead if their bodies were straight and they did not move, even after mechanical prodding (Choi et al., 2007). Percent J2s mortality was calculated.
59
No. of dead J2s Percent J2 mortality = ------X 100 Total J2s per well
J2 (M. incognita) bioassays (microwell bioassys) on eleven sub fractions of n- hexane (F1, F2, F3, F4, F5, F6, F7, F8, F9, F10 and F11) and eight sub fractions of MeOH (FM2.1, FM2.2, FM2.3, FM2.4, FM2.5, FM2.6, FM2.7 and FM3-aqueous) of the roots was done using four concentrations (100, 200, 300 and 400 µg mL-1) of each fraction according to standard procedures (Al-Shaibani et al, 2009). Furadan 3G as Carbofuran and distilled water with 1 % DMSO were used as positive and negative control, respectively. Both experiments were performed twice (each replicated four times) in a CR design with factorial arrangement. Finally, the percentage of J2s mortality in each well was calculated according to the formula as stated above.
3.18.4. Statistics Data were subjected to analysis of variance (ANOVA) using Statistix (NH Analytical Software, Roseville, MN, USA). Similarity between experiments was tested by preliminary ANOVAs, in order to check the suitability for both repeated experiments combination. In the hatching and J2 mortality experiments, for each treatment and repetition, the area under cumulative number of nematodes percentage hatch inhibition (AUCPHI) and mortality (AUCPM) were estimated by trapezoidal integration (Campbell and Madden, 1990). Treatment means of AUCPH and AUCPM were compared using Fisher’s protected Least Significant Difference test (LSD) at P = 0.05 (Gomez and Gomez, 1984). Data obtained from crude extracts, second and third in vitro experiments (eggs bioassays and J2s mortality) were subjected to statistical analysis using Analysis of Variance (AVONA) and Least Significant Difference (LSD) tests (Gomez and Gomez, 1984).
60
3.19. Screen House Experiments 3.19.1. In planta experiment using root and stem extracts of Fumaria parviflora during spring and fall, 2010 Two separate pot experiments were conducted in the screenhouse of the Plant Pathology Department, The University of Agriculture, Peshawar during spring and autumn 2010, temperature adjusted to 24-28ºC. Soil (composed of sand : clay loam, 1:1 , v/v) was steam sterilized, air dried and placed into 15 cm clay pots, each carrying 1kg soil. Eggs for the sreen house experiments were obtained from the roots of 3-month-old tomato (cv. Riogrande) plants as mentioned before. About 4,000 ± 10 eggs+J2s of M. incognita were applied close to the roots of 14 day old tomato seedlings using a sterilized micropipette. The four extracts prepared from the roots and stem of F. parviflora (n-hexane, EtOAC, CHCl3 and MeOH) (previously described) were first dissolved in 5 ml DMSO (1%, v/v). The stock solutions (each 50 mg mL-1) were used to prepare three final concentrations of 1000, 2000 and 3000 ppm. Each of the four root extracts (n-hexane, EtOAC, CHCl3 and MeOH) at a concentration of 1000, 2000 and 3000 ppm were applied at a rate of 50 mL to each pot as a root drench application, two days after inoculation. The same procedure was performed using the corresponding stem extracts at the same concentrations in simultaneous greenhouse experiment. Plants treated with only distilled water (45 mL + 5 mL of 1 % DMSO) served as control. The treatments combinations were arranged in a completely randomized design and replicated five times, each replicate consisted of a single potted plant. The experiment was repeated twice during spring and fall, 2010. The pots were watered three times a week with about 350 mL of fresh water and fertilized weekly with 100 mL 0.1 %, 20-5- 32 + micronutrients hydro-sol fertilizer (Engro Crop Ltd, Peshawar, Pakistan). Both experiments were evaluated 60 days after transplantation, when plants were completely developed showing important symptoms. The following variables were assessed: plant height (cm), number of branches, fresh shoot weight (g), dry shoot weight (g), fresh root weight (g), root galling index (GI), egg masses g-1 of root, number of females g-1 of -1 root, eggs g of root and reproduction factor (Rf = final population / initial population). The shoot of each plant was cut off at soil level and the roots were carefully washed in tap water, blotted dry and their gall ratings recorded (Taylor and Sasser 1978). Roots
61
were visually assessed and scored for galling index (GI) using a 0-5 galling scale, where 0 = no gall on roots, 1 = 1-2, 2 = 3-10, 3 = 11-30, 4 = 31-100, 5 = more than 100 galls per root. One gram of the roots was stained in phloxine B for 15-20 minutes. The stained roots were rinsed in water and egg masses (EM) were visually counted (Taylor and Sasser, 1978). Eggs were extracted as described above.
3.19.2. Statistics Data were subjected to analysis of variance (ANOVA) using Statistix (NH Analytical Software, Roseville, MN, USA) (Campbell and Madden, 1984). Similarity between experiments was tested by preliminary ANOVAs, in order to check the suitability for both repetitions experiments combination (Gomez and Gomez, 1984). The data were analyzed by ANOVA. Treatment means of the different parameters were compared using Fisher’s protected Least Significant Difference test (LSD) at P = 0.05.
3.20.1. In planta experiment using dry powder application of Fumaria parviflora and tomato cv. Rio Grande during the spring and fall, 2010 The experiments were carried out in a screen house of Plant Pathology Department, the University of Agriculture, Peshawar temperature (30 ± 5 oC, 70.0 % relative humidity and a 16 h photoperiod of fluorescent light). Tomato nursery (cv. Rio Grande) was raised in steam-sterilized sandy loam soil. About two weeks old tomato seedlings (single plant/pot) were transplanted into clay pots (15 cm) containing 1000 g soil (sand: clay loam, 2:1, v/v) that had been steam-heated at 100 oC for 6 hr to kill potential plant pathogens. For experimental treatments, the potting mixture was amended with lyophilized and homogenized plant material (stem, root, leaves and whole plant powder) of Fumaria parviflora @ 10, 20, and 30 g Kg-1. Uunamended soil and only inoculated served as control. Each treatment was replicated four times and pots were arranged on benches in screen house in a Completely Randomized Design (CRD) with factorial arrangement. The nematodes were obtained from culture on cv. ‘Rio- grande’ tomato and eggs and juveniles were extracted from roots with 0.5 % NaOCl (Hussey and Barker, 1973). A total of 4000 ± 10 eggs + J2s of M. incognita (contained in a 100 mL of H2O) were applied at root zone of tomato seedling using a sterilized micropipette three-days after transplanting (Khan et al., 1985) in the amended soil.
62
Plants were watered daily with 100 mL tap water and fertilized with a slow release fertilizers (14-14-14, N-P-K) (Sasser, 1990). The experiment was terminated 60 days after inoculation. The shoot of each plant was cut off at the soil level and the roots washed with tap water. Nematode population density was determined by extracting egg masses, eggs and J2s from the soil samples (Coolen, 1979) and from the entire root system after exposure to 1% NaOCl for 5 min (Hussey and Barker, 1973). Severity of nematode galling of the root system was assessed (Taylor and Sasser, 1978). The experiments were conducted twice during the spring and fall, 2010 and the data were recorded on disease and agronomic parameters (i.e. number of galls per root system, Galling Index (GI), number of egg masses g-1 of roots, number of eggs per egg mass, number of adult female g-1 of root, plant height (cm), fresh and dry root weight (g), fresh and dry shoot weight (g) and number of flowers plant-1).
3.20.2. Statistics Data were subjected to analysis of variance (ANOVA) using Statistix (NH Analytical Software, Roseville, MN, USA). Treatment means of the different parameters were compared using Fisher’s protected Least Ssignificant Difference test (LSD) at P = 0.05.
3.21. Field experiments using dry powder application of Fumaria parviflora in the spring and fall, 2010 growing seasons. Field experiments were carried out during two growing seasons (viz., spring and fall, 2010) in the naturally infested fields of Dargai, Khyber Pakhtunkhwa, Pakistan. Both experiments were performed in the same field of Dargai during the mentioned growing seasons. Susceptible tomato cultivar, Rio-grande was used in both growing seasons. Nursery was raised in steam sterilized soil (100 oC for 6 hrs) in earthen pots and four weeks old tomato seedlings were transplanted into the naturally infested fields of Dargai. The experiments were laid out in a Randomized Complete Block (RCB) design with factorial arrangement. A total of four replications were taken with plant to plant and row to row distance of 30 cm and 60 cm, respectively, whereas each replication comprised of two sub-rows, with 12 plants in each row. Normal agronomic practices practiced in the area (e.g irrigation, fertilization, earthing up near the root zone, hand weeding) were done
63
during the course of experiments. Data were recorded on four randomly selected plants (two from each sub-row) and pooled as means. Data on other parameters (i.e plant height, number of flowers per plant, fruit yield (kg plant-1) were recorded at the end of growing season. Chemical and physical properties of the field i.e pH (7.3-7.9), organic matter contents (9.9-11.0 g/kg of soil), Electrical Conductivity (ECs) (0.18-0.21 dSm-1), soil texture (29.9% sand, 23.0% clay and 47.1% silt in 1 kg soil at a depth of 30 cm) were all done in the Soil and Pesticide Chemistry department (Agricultural Research Institute (ARI), Tarnab, Peshawar). The experiments (spring and fall, 2010) consisted of the following factors and their combination/interaction as shown in the table 3.7. Both field experiments were terminated according to the schedule as mentioned above. The plants were carefully uprooted, separately labeled and brought to the laboratory. Shoots were cut off at soil line, roots were washed gently with running tap water and data were recorded on the following parameters. 3.21.1. Galls per plant root system Galls per plant root system on four randomly selected plants belonging to each treatment were counted and their means were calculated.
3.21.2. Galling index (GI) Roots were scored for GI using rating scale of 0-5 galling scale (where 0 = no gall on roots, 1 = 1-2, 2 = 3-10, 3 = 11-30, 4 = 31-100, 5 = more than 100 galls per root) was calculated following the reported procedures (Taylor and Sasser 1978).
3.21.3. Egg masses g-1 of galled root tissue Galled roots (one gram each) were stained for 15-20 minute in an aqueous solution of Phloxine B (15 mgL-1). Egg masses were as counted with help of stereomicroscope.
3.21.4. Eggs per egg mass Egg masses (twenty from each treatment) were teased gently with the needle and the released eggs were counted using seteromicroscope microscope under 10X magnification. Finally, the means were calculated.
64
Table 3.7. Field lay out of the spring and fall 2010 experiments conducted at Daragi showing plant parts as factor A, plant doses as factor B and their interaction.
Factor B (Doses in g plant-1) Factor A
(Plant parts of
F. parvilora) 0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1
Roots (R) R x 0 R x 10 R x 20 R x 30
Stem (S) S x 0 S x 10 S x 20 S x 30
Leaves (L) L x 0 L x 10 L x 20 L x 30
Whole plant (W) W x 0 W x 10 W x 20 W x 30
65
3.21.5. Number of adult females per gram of roots One gram of roots tissues was teased and the adult females released were counted and recorded using compound microscope (10X).
3.21.6. Initial nematode population (Pi) Initial nematode populations were calculated following nematodes extraction using modified Baremann funnel technique. Five soil samples (1 kg each) collected from naturally infested field of Dargai at a depth of 10 cm from each experimental plot were mixed to get a final composite core. The second stage juveniles (J2s) extracted from 100 g soil sample incubated at room temperature for 48 hrs was counted and average (five subsamples) was recorded using stereomicroscope.
3.21.7. Final nematode population (Pf ) Final nematode population in 100 g of composite soil sample (five soil cores per plot) of each treatment was determined and average was calculated, following the same extraction procedure as mentioned above.
3.21.8. Shoot lengths (cm) Shoot length data was recorded at the time of harvest. Shoots were at ground level and average lengths were measured from the soil line to shoot apices in cm.
3.21.9. Root length (cm) Root lengths were measured in cm and the averages were calculated.
3.21.10. Fresh shoot weight per plant (g) Fresh shoots were detached from the roots and their weights in (g) were taken. Finally, the mean values were calculated.
3.21.11. Dry shoot weight per plant (g) Shoots of each treatment were separately dried in an oven at 45 0C for 72 hours (Mc Govern et al., 1992). Dry weights (g) were recorded.
66
3.21.12. Fresh root weight per plant (g) Fresh roots were rinsed gently with tape water, blotted dry and were weighed separately.
3.21.13. Flowers per plant Four plants from each treatment were randomly selected and total numbers of flowers per plant at different intervals were recorded during growing season. Their means were calculated.
3.21.14. Number of branches per plant Number of branches of four randomly selected plants was counted and their means were calculated.
3.21.15. Fruits per plant Fruits per plant of the plants selected for number of flowers were counted in different intervals during the growing seasons and their means were recorded.
3.21.16. Fruit weight per plant (kg) Total ripened tomato fruits from each row were collected during each picking and weighed in kg and their means were recorded.
Finally all recorded data were analyzed statistically using analysis of variance (ANOVA) and means were compared using Least Significant Difference (LSD) test (Gomez and Gomez, 1984) using Statistix (8.1) (NH Analytical Software, Roseville, MN, USA) software.
67
IV. RESULTS OF MOLECULAR STUDIES
4.1. Prevalence, incidence (%) and population density of nematodes Thirty tomato fields in ten localities of Malakand division were surveyed during 2010 and 300 roots and 150 soil samples were collected, out of which 241 (80.3%) roots and 131 (87.3%) soil samples were found infested with root knot nematodes. The overall prevalence of RKNs in Malakand division was 83.3%. Meloidogyne incognita and M. javanica were found co-infesting 10 (33.33 %) of the fields (Figure 4.1). Three (10.0%) of the fields revealed the presence of M. javanica and M. arenaria together, whereas three (10.0%) of the fields revealed co-infestation by M. javanica, M. incognita and M. arenaria. Meloidogyne incognita and M. javanica were recovered (13.3 %) alone from 4 and 6 (20.0%) fields respectively, whereas M. arenaria was recovered (3.33%) alone from one sampling site (Figure 4.1). There was significant variability in the relative prevalence and incidence of Meloidogyne spp. between localities (Table 4.1). Disease was 100% prevalent in all localities, except Thana and Swat where the prevalence was 66.6%. Field infestation ranged from 0 to 100% with an average of 52.0% in the studied areas. Maximum incidence (100 %) was recorded in all the fields of Jabban followed by Batkhela (90 to 100 %). Disease incidence ranged from 0.0 to 80 % in all the fields of Swat, 60 to 80 % in Dargai and 40 to 80 % in Wartair followed by 40 to 70 % in Sakhakot. Disease incidence was the lowest in Malakander (10.0%), followed by Peshawar (0.0 to 20.0 %) (Table 4.1). The greatest galling index (GI) and egg mass index (EMI) were obtained from Jabban in which the incidence was also the greatest (Table 4.1) whereas minimal GI and EMI were recorded in samples collected from fields of Malakandher and Peshawar. Nematode soil populations per 100 cm3 of soil and 20 g of roots varied among the sampling sites (Table 4.1). Nematode population in soil ranged from 0 to 670 with an average of 259.5 nematodes in 100 cm3 of soil and 0 to 633 with a mean of 196.2 nematodes/eggs in 20 g roots.
68
Figure 4.1. The % frequency of three Meloidogyne spp. (alone or in combination) collected from tomato fields in Khyber Pakhtunkhwa, Pakistan.
*M. inc = Meloidogye incognita; M. java = Meloidogyne javanica; M. are = Meloidogyne arenaria
69
Table 4.1. Survey and identification of root knot nematodes collected from tomato growing areas of Khyber Pakhtunkhwa Province of Pakistan.
Location Cultivar Field % Incidence* Galling Index Egg Mass RKN RKN Meloidogyne spp. Index neatodes in nematodes in 100 cm3 soil 20 g roots Dargai Riogrande D1 80.0 (10) 5.0 4.0 435 327 M. incognita Riogrande D2 60.0 (10) 5.0 4.5 335 289 M. javanica + M. incognita Riogrande D3 70.0 (10) 4.0 3.5 314 312 M. javanica Heroshah Riogrande H1 60.0 (10) 3.5 3.0 321 189 M. javanica + M. incognita Riogrande H2 50.0 (10) 3.5 4.0 269 201 M. javanica + M. incognita Riogrande H3 40.0 (10) 3.0 3.0 118 179 M. incognita Swat Riogrande S1 70.0 (10) 4.0 4.0 209 69 M. incognita Riogrande S2 0.0 (10) 0.0 0.0 0.0 0.0 NIL Riogrande S3 80.0 (10) 4.0 3.0 295 114 M. arenaria + M. javanica Sakhakot Raja SK1 70.0 (10) 4.0 2.0 201 256 M. javanica + M. incognita Riogrande SK2 60.0 (10) 3.5 2.0 199 121 M. javanica + M. incognita Riogrande SK3 40.0 (10) 3.0 3.0 285 165 M. javanica Peshawar Riogrande P1 0.0 (10) 0.0 0.0 0.0 0.0 NIL Riogrande P2 20.0 (10) 2.0 1.0 58 38 M. javanica + M. incognita Riogrande P3 10.0 (10) 3.0 2.0 32 31 M. javanica Batkhela Riogrande B1 100.0 (10) 4.5 5.0 481 512 M. incognita + M. javanica Riogrande B2 100.0 (10) 5.0 4.0 670 431 M. incognita + M. javanica Raja B3 90.0 (10) 5.0 3.5 458 267 M. incognita + M. javanica Jabban Riogrande J1 100.0 (10) 5.0 5.0 533 633 M. incognita + M. javanica + M. arenaria Riogrande J2 100.0 (10) 5.0 5.0 670 319 M. incognita + M. javanica + M. arenaria Riogrande J3 100.0 (10) 5.0 5.0 486 230 M. incognita + M. javanica + M. arenaria Malakander Raja MK1 10.0 (10) 2.0 3.0 56 19 M. javanica Riogrande MK2 10.0 (10) 2.0 2.0 45 21 M. javanica Raja MK3 10.0 (10) 2.0 2.0 83 78 M. incognita Thana Riogrande T1 30.0 (10) 3.0 4.0 185 211 M. arenaria Riogrande T2 0.0 (10) 0.0 0.0 0.0 0.0 NIL Riogrande T3 30.0 (10) 2.5 3.0 223 165 M. javanica Wartair Riogrande W1 50.0 (10) 4.0 4.0 290 315 M. javanica + M. arenaria Riogrande W2 80.0 (10) 4.5 3.5 331 215 M. javanica + M. arenaria Riogrande W3 40.0 (10) 3.5 4.0 203 180 M. incognita + M. javanica * Number of plants in parentheses in column (4)
70
4.2. Perineal pattern morphology Microscopic examination of the perineal patterns morphology of adult females of eleven RKN populations/isolates indicated that the single egg mass line from isolate 1, population 2 (J2 and J4) and population 3 (F1, F3 and F4) were all M. incognita and there was no difference in the patterns of these nematodes or line. Lateral lines were absent and a squarish, high dorsal arch containing a distinct whorl around the tail terminus was the most conspicuous diagnostic character of this perineal pattern. Perineal patterns of single egg mass from population 2 (M1, M2, M3 and M4), population 3 (J1 and J3), population 4 (F2), population 5 (T1 and T3), population 6 (W1, W2 and W3), population 7 (R1 and R3), population 8 (Q1 and Q2), population 9 (H2) and population 10 (E1) were all identified as M. javanica. The most distinguishing feature of this pattern was the presence of the double lateral lines (Eisenback, 1985b). The perineal patterns of the single egg mass line from population 7 (R2), population 9 (H1) and population 10 (E2) were identified as M. arenaria (Figure 4.2). This pattern was characterized by a low dorsal arch and indented near the lateral fields, forming rounded shoulders (Eisenback, 1985a). The patterns of nematodes L1 and L2 (population 1) was not determined as the samples were lost during shipping from Pakistan to the UK.
4.3. Extraction method and PCR reaction The DNA extraction method took about 2 hrs to complete and yielded DNA from individuals (J2s and females) that was sufficient for more than 30 PCR reactions. Meloidogyne javanica, M. incognita and M. arenaria were identified with D2-D3, 194/195, SCAR (specie- specific), C2F3/1108 and RAPD (SC10-30, OPG-13 and OPG- 19) primer sets. All primers produced consistent results. The amplification was successful when PuReTaq Ready-to-Go™ PCR beads were used.
71
Figure 4.2. Perineal patterns of adult females observed in Pakistani populations. A: a representative line of isolate 1 identified as M. incognita; B: M. javanica; C: M. arenaria. Arrow indicates lateral lines.
72
4.4. Ribosomal DNA amplification (D2A/D3B and 194/195 primers) DNA obtained from individual J2s/females belonging to ten populations/isolates collected from ten different localities of Khyber Pakhtunkhwa province of Pakistan was used. Meloidogyne javanica lines (M1, M2, M3, M4, J1, J3, F2, T1, T2, T3, W1, W2, W3, R1, R3, Q1, Q2, Q3, H2 and E1), M. incognita lines (L3, J2, J4, F1, F3 and F4), M. arenaria lines (R2, H1and E2) were used in molecular identification with different primer set (Table 3.2). PCR amplification products from a single female/juvenile of these populations using D2A/D3B rDNA primers produced amplification products of 750 bp from tropical species populations viz., M. javanica lines (M1, M2, M3, M4, J1, J3, F2, T1, T2, T3, W1, W2, W3, R1, R3, Q1, Q2, Q3, H2 and E1), M. incognita lines (L3, J2, J4, F1, F3 and F4) and M. arenaria lines ( R2, H1and E2) (Figures 4.3A & B). The L1 and L2 lines produced a product slightly lower than 750 bp. The sizes of the amplified PCR products with 194/195 primers were all approximately 720 bp with a single amplicon, reflecting no variation in size among M. javanica, M. incognita and M. arenaria species, however amplicons of different sizes were produced for M. chitwodii, M. fallax and M. enterolobii which were utilized as positive controls (Figures 4.4; Table 4.2). L1 and L2 did not yield an amplification product with 194/195 primer set (Figure 4.4, Table 4.2).
4.5. PCR amplification of Sequence Characterized Amplified Regions (SCARs) The SCAR primer pairs (Table 3.2) used for diagnosis of Meloidogyne incognita, M. javanica and M. arenaria were screened for species specificity. The optimized primers resulted in consistent amplifications by DNA obtained from juveniles and females. PCR with specific SCAR primers (Fjav/Rjav) produced a 670 bp SCAR product only with RKN lines M1, M2, M3, M4, J1, J3, F2, T1, T2, T3, W1, W2, W3, R1, R3, Q1, Q2, Q3, H2 and E1(M. javanica) (Figure 4.5 and Figure 4.8). Out of 31 lines from ten populations, only six lines (L3, J2, J4, F1, F3 and F4) were identified as Meloidogyne incognita and produced a 1200 bp SCAR product with the species-specific Finc/Rinc primer pair (Figure 4.5 and Figure 4.8) while three lines of M. arenaria (R2, H1and E2) produced a SCAR product of 420 bp with specific primer pair Far/Rar (Figure 4.7 and Figure 4.8).
73
Table 4.2. Molecular identification of root knot nematodes collected from Khyber Pakhtunkhwa Province of Pakistan
Codea Location Field D2A D3B (194/195) Fjav/Rjav Finc/Rinc Far/Rar C2F3/1108 Molecular Primers Primers (SCAR) (SCAR) (SCAR) (mtDNA) Identification Primers Primers Primers Primers
L1 Dargai D1 + - - - - - Unknown L2 Dargai D1 + - - - - - Unknown L3 Dargai D1 750 bp 720 bp - 1200 bp - 1700bp M. incognita M1 Heroshah H1 750 bp 720 bp 670 bp - - 1700 bp M. javanica M2 Heroshah H2 750 bp 720 bp - - 1700 bp M. javanica M3 Heroshah H2 750 bp 720 bp - - 1700 bp M. javanicab M4 Heroshah H2 750 bp 720 bp - - 1700bp M. javanica J1 Swat S3 750 bp 720 bp - - 1700 bp M. javanica J2 Swat S1 750 bp 720 bp - 1200 bp - 1700 bp M. incognita J3 Swat S3 750 bp 720 bp 670 bp - - 1700 bp M. javanicab J4 Swat S1 750 bp 720 bp - 1200 bp - 1700bp M. incognitab F1 Sakhakot SK1 750 bp 720 bp - 1200 bp - 1700 bp M. incognita F2 Sakhakot SK2 750 bp 720 bp 670 bp - - 1700 bp M. javanicab F3 Sakhakot SK1 750 bp 720 bp - 1200 bp - 1700 bp M. incognita F4 Sakhakot SK1 750 bp 720 bp - 1200 bp - 1700bp M. incognita T1 Peshawar P2 750 bp 720 bp 670 bp - - 1700 bp M. javanicab T2 Peshawar P2 750 bp 720 bp 670 bp - - 1700 bp M. javanica T3 Peshawar P3 750 bp 720 bp 670 bp - - 1700 bp M. javanica W1 Batkhela B1 750 bp 720 bp 670 bp - - 1700bp M. javanica W2 Batkhela B1 750 bp 720 bp 670 bp - - 1700 bp M. javanicab W3 Batkhela B1 750 bp 720 bp 670 bp - - 1700 bp M. javanica R1 Jabban J1 750 bp 720 bp 670 bp - - 1700 bp M. javanicab R2 Jabban J1 750 bp 720 bp - - 420 bp 1700bp M. arenaria R3 Jabban J1 750 bp 720 bp 670 bp - - 1700 bp M. javanica Q1 Malakander MK1 750 bp 720 bp 670 bp - - 1700 bp M. javanica Q2 Malakander MK1 750 bp 720 bp 670 bp - - 1700 bp M. javanica Q3 Malakander MK1 750 bp 720 bp 670 bp - - 1700bp M. javanica H1 Thana T1 750 bp 720 bp - - 420 bp 1700 bp M. arenariab H2 Thana T3 750 bp 720 bp 670 bp - - 1700 bp M. javanica E1 Wartair W1 750 bp 720 bp 670 bp - - 1700 bp M. javanica E2 Wartair W1 750 bp 720 bp - - 420 bp 1700 bp M.arenaria + (present) and – (absence) of band aIndividual nematodes (Juveniles or females) bD2 and D3 expansion region of the 28S rDNA nuclear region gene PCR products sequenced from individual nematodes.
74
Figure 4.3 A. PCR amplification products of using primers D2A/D3B with DNA extracted from single females of ten populations from Pakistan. Codes for each population are given in Table (4.2). Positive control (M. javanica), negative control (NTC) and 1 Kb ladder (Promega, UK).
Figure 4.3 B. PCR amplification products of using primers D2A/D3B with DNA extracted from single females of ten populations from Pakistan. Codes for each population are given in Table (4.2). Negative control (NTC) and 1 Kb ladder (Promega, UK).
75
Figure 4.4. PCR amplification products of using primers 194/195 with DNA extracted from single females of ten populations from Pakistan. Codes for each population are given in Table (4.2). Positive control (M. javanica, M. incognita, M. arenaria, M. hapla, M. chitwoodi, M. fallax, M. enterolobii), Negative control (NTC) and 1 Kb ladder (Promega, UK).
Figure 4.5. PCR amplification products of using Fjav/Rjav (M. javanica Specific SCAR primers) with DNA extracted from single females from ten RKN populations (Table 4.2) and the two negative control lines (M. incognita), (M.arenaria), NTC (no tamplate control), three lines for positive control (M. javanica), 1Kb and 100 bp ladder (Promega, UK).
76
Figure 4.6. PCR amplification products of using Finc/Rinc (M. incognita specific SCAR primers) with DNA extracted from single females from three RKN populations (Table 4.2) and the two positive control lines (M. incognita), NTC (no template control) and 1 Kb ladder (Promega, UK).
Figure 4.7. PCR amplification products (420 bp SCAR fragment) of using Far/Rar (M. arenaria specific SCAR primers) with DNA extracted from single females from three RKN populations (Table 4.2) and the three positive control lines (M. arenaria), NTC (no template control) and 1 Kb ladder (Promega, UK).
77
Figure 4.8. PCR amplification products of using Fjav/Rjav (M. javanica), Finc/Rinc (M. incognita) and Far/Rar (M. arenaria) specific SCAR primers with DNA extracted from single females from eleven RKN populations/isolates (Table 4.2) and the three positive control lines (M. javanica, M.incognita and M. arenaria), NTC (no template control) and 1 Kb ladder (Promega, UK).
Two nematode lines in population 1 (L1 and L2) remained uncertain with the SCAR primers. The SCAR primers identified Meloidogyne spp. with the highest frequency of M. javanica (64.5 %) followed by M. incognita (19.3 %) and M. arenaria (9.7 %) (Table 4.2).
4.6. PCR amplification of the COII/lrRNA of mtDNA region PCR primers C2F3 and 1108 were used for amplification of COII/lrRNA of the mitochondrial region (mtDNA) from individual female/J2 of each examined population. Figure (4.9) illustrates the sizes of amplified products of the 31 different lines belonging to ten populations. All M. javanica populations (M1, M2, M3, M4, J1, J3, F2, T1, T2, T3, W1, W2, W3, R1, R3, Q1, Q2, Q3, H2 and E1), M. incognita populations (L3, J2, J4, F1, F3 and F4) and M. arenaria populations (R2, H1and E2) produced one major product of approximately at 1700 bp specific for these species. M. chitwoodi and M. fallax produced 520 bp products, whereas M. enterolobii produced a 750 bp product (Figure 4.9). The L1 and L2 did not yield an amplification product with C2F3/1108 primer set (Figure 4.9).
78
Figure 4.9. PCR amplification products of COII/lrRNA region of mtDNA (Meloidogyne spp.) with DNA extracted from single females from ten RKN populations (Table 4.2) and positive control lines (M. javanica, M. incognita, M. arenaria, M. chitwoodi, M. fallax and M. enterolobii), NTC (no template control) and 1 Kb ladder (Promega, UK).
4.7. DNA sequencing of 28S rDNA The 28S rDNA gene fragment of three Meloidogyne spp. (M. javanica, M. incognita and M. arenaria) was amplified using DNA extracted from single females with primer-pair D2A and D3B. M. javanica lines (M3, J3, F2, W2, T1), M. incognita line (J4) and M. arenaria lines (H1 and R2) collected from major tomato growing areas (Heroshah, Swat, Sakhakot, Batkhela, Jabban and Peshawar) were sequenced. Intraspecific variability ranged from 3 nucleotides (0.4% differences) (between J3 and T1) to 27 nucleotides (4.2% differences) (between W2, M3 and J3) for M. javanica (636 bp alignment), while for M. arenaria no differences were found (H1 and R2). M. javanica nematodes (T1, W2, M3, J3 and F2) showed highest similarity with M. hispanica (98%) (EU443606.1) and M. thialandica (97%) (EU364890.1). Other closest sequence-related neighbours of M. javanica were M. arenaria and M. paranaensis. M. arenaria (R2 and H1) showed highest similarity with M. incognita (99%) (AF435794.1), M.paranensis (99%) (AF435799.1) and M. thilandica (97%) (EU364890.1) whereas M. incognita (J4) showed similarity with M. hispanica (99%) (EU443606.1) and M. thialandica (97%) (EU364890.1). In general sequencing 28S rDNA with D2A/D3B primer did not differentiate the three tropical Meloidogyne species. New sequences obtained in this study (Figure 4.10) were deposited in the GenBank with accession numbers JQ317912-19 for T1, W2, M3, J3, F2, J4, R2 and H1, respectively.
79
Figure 4.10. D2 and D3 expansion region of the 28S rDNA nuclear region gene PCR product aligned sequences from eight individual nematodes of three Meloidogyne spp. and their codes collected from major tomato growing areas of Khyber Pakhtunkhwa, Pakistan.
....|....| ....|....| ....|....| ....|....| ....|....| 10 20 30 40 50 T1 CACTTTGAAG AGAGAGTTAA AGAGGACGTG AAACCGGTGA GGTGGAAACG W2 ------GAAG AGAGAGTTAA AGAGGACGTG AAACCGGTAA GGTGGAAACG M3 ------AG AGAGAGTTAA AGAGGACGTG AAACCGGTAA GGTGGAAACG J3 ------AG AGAGAGTTAA AGAGGACGTG AAACCGGTGA GGTGGAAACG F2 ------AG AGAGAGTTAA AGAGGACGTG AAACCGGTAA GGTGGAAACG J4 ------AG AGAGAGTTAA AGAGGACGTG AAACCGGTAA GGTGGAAACG R2 ------AG AGAGAGTTAA AGAGGACGTG AGACCGGTAA GGTGGAAACG H1 ------AG AGAGAGTTAA AGAGGACGTG AGACCGGTAA GGTGGAAACG
....|....| ....|....| ....|....| ....|....| ....|....| 60 70 80 90 100 T1 GATAGAGTCG GCGTATCTTT CAAGTATTCA TTTACATTAT TATTGTGTTG W2 GATAGAGTCG GCGTATCATT CAATTATTCA GTTACATTAT TTTTATGTTG M3 GATAGAGTCG GCGTATCATT CAATTATTCA GTTACATTAT TTTTATGTTG J3 GATAGAGTCG GCGTATCTTT CAAGTATTCA TTTACATTAT TATTGTGTTG F2 GATAGAGTCG GCGTATCATT CAAKTATTCA GTTACATTAT TTTTATGTTG J4 GATAGAGTCG GCGTATCTCT CAAGTATTCA TTTACATTAT TTTTATGTTG R2 GATAAAGTCG GCGTATCATT CAAGTATTCA GTTACATTAT TTTTATGTTG H1 GATAAAGTCG GCGTATCATT CAAGTATTCA GTTACATTAT TTTTATGTTG
....|....| ....|....| ....|....| ....|....| ....|....| 110 120 130 140 150 T1 TGATCTCTGA GCTCCAGATT GGGACAGAGG GAAGCAGCAT AATTTTCTGT W2 TGACCTCTGA GCTCCAGATT GGGACAGAGG GAATCAGCAT AATTTTTTGT M3 TGACCTCTGA GCTCCAGATT GGGACAGAGG GAATCAGCAT AATTTTTTGT J3 TGATCTCTGA GCTCCAGATT GGGACAGAAA GAAGCAGCAT AATTTTCTGT F2 TGACCTCTGA GCTCCAGATT GGGACAGAGG GAATCAGCAT AATTTTYTGT J4 TGACCTCTGA GCTCCAGATT GGGACAGAGG GAAKCAGCAT AATTTTCTGT R2 TGACCTCTGA GCTCCAGATT GGGACAGAGG GAATCAGCAT AATTTTTTGT H1 TGACCTCTGA GCTCCAGATT GGGACAGAGG GAATCAGCAT AATTTTTTGT
80
....|....| ....|....| ....|....| ....|....| ....|....| 160 170 180 190 200 T1 GATGCATTTA CTTGTTTGGT GCTTGGGGAT GTTTGAGGCA GATTTGTATC W2 GGTGCATTTA CTTGATTGGT GCTTGGGGAT GTTTGAGGCA GATTTGTTTC M3 GGTGCATTTA CTTGATTGGT GCTTGGGGAT GTTTGAGGCA GATTTGTTTC J3 GATGCATTTA CTTGATTGGT GCTTGGGGAT GTTTGAGGCA GATTTGTAAC F2 GGTGCATTTA CTTGATTGGT GCTTGGGGAT GTTTGAGGCA GATTTGTTTC J4 GGTGCATTTA CTTGTTTGGT GCTTGGGGAT GTTTGAGGCA GATTTGTGTC R2 GGTGCATTTA CTTGATTGGT GCTTGGGGAT GTTTGAGGCA GATTTGTTTC H1 GGTGCATTTA CTTGATTGGT GCTTGGGGAT GTTTGAGGCA GATTTGTTTC
...|....| ....|....| ....|....| ....|....| ....|....| 210 220 230 240 250 T1 CGCCGTTTTG AGGCCAGCTT GCTGGTACCC AAACGGTGTT ACCATTTTTT W2 CGCCGTTTTG AGGCCAGCTT GCTGGTACCC AAACGGTGTT AGCATTTTTT M3 CGGCGTTTTG AGGCCAGCTT GCTGGTACCC AAACGGTGTT AGCATTTTTT J3 CGCCGTTTTG AGGCCAGCTT GCTGGTACCC AAACGGTGTT AGCATTTTTT F2 CGCCGTTTTG AGGCCAGCTT GCTGGTACCC AAACGGTGTT AGCATTTTTT J4 CGCCGTTTTG AGGCCAGCTT GCTGGTACCC AAACGGTGTT AGCATTTTTT R2 CGCCGTTTTG AGGCCAGCTT GCTGGTACCC AAACGGTGTT AGCATTTTTT H1 CCCCGTTTTG AGGCCAGCTT GCTGGTACCC AAACGGTGTT AGCATTTTTT
....|....| ....|....| ....|....| ....|....| ....|....| 260 270 280 290 300 T1 GTCTTGGCCA TTTGAGTATG GCTTACRGGC ATTTATTGGT TCGATCTGAG W2 GTCTTGGGCA TTTGAGTATG GCTCACGTGT ATTTATTGGA CAGATCTGAG M3 GTCTTGGGCA TTTGAGTATG GCTCACGTGT ATTTATTGGA CAGATCTGAG J3 GTCTTGGVCA TTTGAGTATG GCTTACRGGC ATTTATTGGT TCGATCTGAG F2 GTCTTGGGCA TTTGAGTATG GCTCACGTGY ATTTATTGGA CAGATCTGAG J4 GTCTTGGACA TTTGAGTATG GCTCACGGGC ATTTATTGGT TCGATCTGAG R2 GTCTTGGGCA TTTGAGTATG GCTCACGTGT ATAATATTGGA CAGATCTGAG H1 GTCTTGGGCA TTTGAGTATG GCTCACGTGT ATTTATTGGA CAGATCTGAG
....|....| ....|....| ....|....| ....|....| ....|....| 310 320 330 340 350 T1 TGTAAGTTAC GGTCGCATGC GACACGTGCT TTTCAATTAG AACGGTCCAG W2 TGTAAGTTAC GGTCGCATGC GACACGTGCT TTTCAATTAG TTCGGTCCAG M3 TGTAAGTTAC GGTCCCATGC GACACGTGCT TTTCAATTAG TTCGGTCCAG J3 TGTAAGTTAC GGTCGCATGC GACACGTGCT TTTCAATTAG TTCGGTCCAG F2 TGTAAGTTAC GGTCGCATGC GACACGTGCT TTTCAATTAG TTCGGTCCAG
81
J4 TGTAAGTTAC GGTCGCATGC GACACGTGCT TTYCAATTAG TTCGGTCCAG R2 TGTAAGTTAC GGTCGCATGC GACACGTGCT TTTCAATTAG TTCGGTCCAG H1 TGTAAGTTAC GGTCGCATGC GACACGTGCT TTTCAATTAG TTCGGTCCAG
....|....| ....|....| ....|....| ....|....| ....|....| 360 370 380 390 400 T1 TTAATGCTCT CGTACTCCTT CCCCATGTAA AAGCCGGTCA TCTATGGGAC W2 TTAATGCTCT CGTACTCGTT CCCCATGTAA AAGCCGGTCA TCTATCCGAC M3 TTAATGCTCT CGTACTCGTT CCCCATGTAA AAGCCGGTCA TCTATCCGAC J3 TTAATGCTCT CGTACTCCTT CCCCATGTAA AAGCCGGTCA TCTATCCGAC F2 TTAATGCTCT CGTACTCGTT CCCCATGTAA AAGCCGGTCA TCTATCCGAC J4 TTAATGCTCT CGTACTCGTT CCCCATGTAA AAGCCGGTCA TCTATCCGAC R2 TTAATGCTCT CGTACTCGTT CCCCATGTAA AAGCCGGTCA TCTATCCGAC H1 TTAATGCTCT CGTACTCGTT CCCCATGTAA AAGCCGGTCA TCTATCCGAC
....|....| ....|....| ....|....| ....|....| ....|....| 410 420 430 440 450 T1 CCGTCTTGAA ACACGGACCA AGGAGTTTAT CGTGTGCGCA AGTTTTTGGG W2 CCGTCTTGAA ACACGGACCA AGGAGTTTAT CGTGTGCGCA AGTTTTTGGG M3 CCGTCTTGAA ACACGGACCA AGGAGAATAT CGTGTGCGCA AGTTTTTGGG J3 CCGTCTTGAA ACACGGACCA AGGAGTTTAT CGTGTGCGCA AGTTTTTGGG F2 CCGTCTTGAA ACACGGACCA AGGAGTTTAT CGTGTGCGCA AGTTTTTGGG J4 CCGTCTTGAA ACACGGACCA AGGAGTTTAT CGTGTGCGCA AGTTTTTGGG R2 CCGTCTTGAA ACACGGACCA AGGAGTTTAT CGTGTGCGCA AGTTTTTGGG H1 CCGTCTTGAA ACACGGACCA AGGAGTTTAT CGTGTGCGCA AGTTTTTGGG
....|....| ....|....| ....|....| ....|....| ....|....| 460 470 480 490 500 T1 TGTTAAAAAC CKAAAAGCGA AATGAAAGTA AATGGCTCTT TAGAGTCTGA W2 TGTTAAAAAC TTAAAAGCGA AATGAAAGTA AATGACTCTT TAGAGTCTGA M3 TGTTAAAAAC TTAAAAGCGA AATGAAAGTA AATGACTCTT TAGAGTCTGA J3 TGTTAAAAAC TTAAAAGCGA AATGAAAGTA AATGRCTCTT TAGAGTCTGA F2 TGTTAAAAAC TTAAAAGCGA AATGAAAGTA AATGACTCTT TAGAGTCTGA J4 TGTTAAAAAC CTAAARGCGA AATGAAAGTA AATGGCTCTT TAGAGTCTGA R2 TGTTAAAAAC TTAAAAGCGA AATGAAAGTA AATGACTCTT TAGAGTCTGA H1 TGTTAAAAAC TTAAAAGCGA AATGAAAGTA AATGACTCTT TAGAGTCTGA
82
....|....| ....|....| ....|....| ....|....| ....|....| 510 520 530 540 550 T1 TGTGCGATCT TGTAAAAAAG TGCAGCATGG CCCCATTCTA ACTGTTTACA W2 TGTGCGATCT TGTAAAAAAG TGTAGCATGG CCCCATTCTA ACTGTTTACA M3 TGTGCGATCT TGTAAAAAAG TGTAGCATGG CCCCATTCTA ACTGTTTACA J3 TGTGCGATCT TGTAAAAAAG TGCAGCATGG CCCCATTCTA ACTGTTTACA F2 TGTGCGATCT TGTAAAAAAG TGYAGCATGG CCCCATTCTA ACTGTTTACA J4 TGTGCGATCT AGTAAAAAAG TGCAGCATGG CCCCATTCTA ACTGTTTACA R2 TGTGCGATCT TGTAAAAAAG TGTAGCATGG CCCCATTCTA ACTGTTTACA H1 TGTGCGATCT TGTTTAAAAG TGTAGCATGG CCCCATTCTA ACTGTTTACA ....|....| ....|....| ....|....| ....|....| ....|....| 560 570 580 590 600 T1 GTAGGGTGGC GGAAGAGCGT ACGCGGTGAG ACCCGAAAGA TGGTGAACTA W2 GTAGGGTGGC GGAAGAGCGT ACGCGGTGAG ACCCGAAAGA TGGTGAACTA M3 GTAGGGTGGC GGAAGAGCGT ACGCGGTGAG ACCCGAAAGA TGGTGAACTA J3 GTAGGGTGGC GGAAGAGCGT ACGCGGTGAG ACCCGAAAGA TGGTGAACTA F2 GTAGGGTGGC GGAAGAGCGT ACGCGGTGAG ACCCGAAAGA TGGTGAACTA J4 GTAGGGTGGC GGAAGAGCGT ACGCGGTGAG ACCCGAAAGA TGGTGAACTA R2 GTAGGGTGGC GGAAGAGCGT ACGCGGTGAG ACCCGAAAGA TGGTGAACTA H1 GTAGGGTGGC GGAAGAGCGT ACGCGGTGAG ACCCGAAAGA TGGTGAACTA ....|....| ....|....| ....|....| ....|....| ....|....| 610 620 630 640 650 T1 TTCCTGAGCA GGACGAAGCC AGAGGAAACT CTGGTGGAAG TCCG------W2 TTCCTGAGCA GGACGAAGCC AGAGGAAACT CTGGTGGAAG TCCGAAGCGG M3 TTCCTGAGCA GGACGAAGCC AGAGGAAACT CTGGTGGAAG TCCGAAGCGG J3 TTCCTGAGCA GGACGAAGCC AGAGGAAACT CTGGTGGAAG TCCGAAGCGG F2 TTCCTGAGCA GGACGAAGCC AGAGGAAACT CTGGTGGAAG TCCGAAGCGG J4 TTCCTGAGCA GGACGAAGCC AGAGGAAACT CTGGTGGAAG TCCGAAGCGG R2 TTCCTGAGCA GGACGAAGCC AGAGGAAACT CTGGTGGAAG TCCGAAGCGG H1 TTCCTGAGCA GGACGAAGCC AGAGGAAACT CTGGTGGAAG TCCGAAGCGG ....|....| ....|....| ....|....| ....|....| .... 660 670 680 690 T1 ------W2 ATCTGACGTG CAAATCGATC GTCTGACTTG ------M3 TTCTGACGTG CAAATCGATC GTCTGACTTG GGTATAGGG- ---- J3 TTCTGACGTG CAAATCGATC GTCTGACTTG GGTATAGGG- ---- F2 TTCTGACGTG CAAATCGATC GTCTGACTTG GGTATAGGGG CGAA J4 TTCTGACGTG CAAATCGATC GTCTGACTTG GGTATAG------R2 TTCTGACGTG CAAATCGATC GTCTGACTTG G------H1 TTCTGACGTG CAAATCGATC GTCTGACTTG G------
83
4.8. PCR-RFLP PCR-RFLP analysis was conducted in order to differentiate among M. incognita, M. arenaria, and M. javanica based on the expected sizes of the fragments digested with four 4-bp recognizing enzymes (endo-nucleases) viz. Hinf 1, Taq 1, Mbo1, Alu 1 and the 6-bp enzyme Eco R1 in Table (4.3). The restriction enzyme digestion of the 1.7 kb (1700bp) amplification products with Hinf I generated a diagnostic pattern for M. incognita isolates (Figure 4.10). Two restriction sites in M. incognita resulted in cleavage into 1700, 1300 and 400 bp fragments while with M. javanica and M. arenaria, there was no digestion. M. fallax and M. chitwoodi produced a 520 bp fragment whereas M. enterolobii (M. mayaguensis) produced a 750 bp fragment and they remained undigested (Figure 4.11). The Taq 1 enzyme did not cleave the 1700 bp amplification product and hence did not generate any specific digestion pattern for these species of the RKN (Figure 4.12). Restriction digestion with Mbo 1 and Eco R1 produced a characteristic five banded- pattern (Table 4.3) for M. javanica, M. incognita and M. arenaria (Figure 4.13 and Figure 4.14). The Mbo 1 produced identical size fragments viz., 1700, 1300, 1000, 720 and 520 bp respectively in all the tested populations and did not cleave products of M. chitwoodi, M. fallax and M. enterolobii. The 6-bp cutter EcoR1 enzyme cleaved the 1.7 kb mtDNA fragments in all the tested populations giving identical fragments of approximately 1700, 1200 and 520 bp respectively. In general this enzyme did not distinguish the species. The restriction enzyme Alu 1 recognized considerably more restriction sites in mitochondrial genomes and a greater number of fragments differences were revealed in the tested species. About five fragments in M. javanica and M. arenaria were observed, whereas more than five fragments were generated in M. incognita (Table 4.3; Figure 4.15). The Alu 1 enzyme also distinguished M. chitwoodi and M. enterolobii from tropical species and produced two and three fragment characteristic patterns respectively (Figure 4.15).
84
Figure 4.11. Restriction enzyme digestion of COII/lrRNA region of M. incognita, M javanica and M. arenaria, using 4-bp cutter Hinf 1 (Table 4.3). NTC (no template control), positive controls (M. javanica, M. incognita, M. chitwoodii, M. fallax and M. enterolobii) and I Kb ladder (Promega, UK).
Figure 4.12. Restriction enzyme digestion of COII/lrRNA region of M. incognita, M. javanica and M. arenaria, using 4-bp cutter Taq 1 (Table 4.3). NTC (no template control), positive controls (M. javanica, M.incognita, M. chitwoodi, M. fallax and M. enterolobii) and I Kb ladder (Promega, UK).
85
Figure 4.13. Restriction enzyme digestion of COII/lrRNA region of M. incognita, M. javanica and M. arenaria, using 4-bp cutter Mbo 1 (Table 4.3). NTC (no template control), positive controls (M. javanica, M. incognita, M. arenaria, M. chitwoodi, M. fallax and M. enterolobii) and I Kb ladder (Promega, UK).
Figure 4.14. Restriction enzyme digestion of COII/lrRNA region of M. incognita, M. javanica and M. arenaria, using 6-bp cutter Eco R 1 (Table 4.3). NTC (no template control), positive controls (M. javanica, M. incognita, M. arenaria, M. fallax) and I Kb ladder (Promega, UK).
86
Figure 4.15. Restriction enzyme digestion of COII/lrRNA region of M. incognita, M. javanica and M. arenaria, using 4-bp cutter Alu 1(Table 4.3). NTC (no template control), positive controls (M. javanica, M. incognita, M. arenaria, M. chitwoodi, M. fallax and M. enterolobii) and I Kb ladder (Promega, UK).
4.9. Randomly Amplified Polymorphic DNA (RAPD) The RAPD experiment was conducted using decamer (Oligonucelotides) primers SC10-30, OPG-13 and OPG-19 (Table 3.2) and ten populations belonging to three different Meloidogyne species. Successful RAPD amplifications were obtained from individuals of Meloidogyne species using 1 µl of the individual nematode lysate with 1 µl of 10 µM each primer and Pure Taq Ready-To-Go PCR beads or with Promega Taq polymerase. All three primers produced polymorphic bands which were used to generate RAPD fingerprinting of 6 M. incognita, 20 M. javanica and 3 M. arenaria nematodes from ten populations. The total number of amplified polymorphic DNA fragments obtained was 97, 324 and 48 for M. incognita, M. javanica and M. arenaria populations, respectively. Three kinds of polymorphic DNA fragments could be distinguished. DNA fragments common to all genotypes, DNA fragments amplified in all populations of one species (intraspecific DNA fragments) and DNA fragments amplified in not all but at least two nematode lines (L1 and L2).
87
Table 4.3. Restriction digestion patterns of three Pakistani Meloidogyne spp. for COII/lrRNA region of mtDNA with 4- bp and 6-bp restriction endonucleases.
Nematode Species Origination Fragments (bp) code 4 bp cutter 6 bp cutter Taq 1 Hinf 1 Mbo 1 Alu 1 Eco R1 L3 M. javanica Heroshah 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 M1 M. javanica Heroshah 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 M2 M. javanica Heroshah 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 M3 M. javanica Heroshah 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 M4 M. javanica Swat 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 J1 M. javanica Swat 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 J2 M. javanica Sakhakot 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 J3 M. javanica Peshawar 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 J4 M. javanica Peshawar 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 F1 M. javanica Peshawar 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 F2 M. javanica Batkhela 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 F3 M. javanica Batkhela 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 F4 M. javanica Batkhela 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 T1 M. javanica Jabban 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 T2 M. javanica Jabban 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 T3 M. javanica Malakander 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 W1 M. javanica Malakander 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 W2 M. javanica Malakander 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 W3 M. javanica Thana 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 R1 M. javanica Wartair 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 R2 M. incognita Dargai 1700 1700, 1300, 400 1700, 1300, 1000, 720,520 1600, 1500, 1250, 1100, 1000, 900, 750, 550 1700, 1200, 500 R3 M. incognita Swat 1700 1700, 1300, 400 1700, 1300, 1000, 720,520 1600, 1500, 1250, 1100, 1000, 900, 750, 550 1700, 1200, 500 Q1 M. incognita Swat 1700 1700, 1300, 400 1700, 1300, 1000, 720,520 1600, 1500, 1250, 1100, 1000, 900, 750, 550 1700, 1200, 500 Q2 M. incognita Sakhakot 1700 1700, 1300, 400 1700, 1300, 1000, 720,520 1600, 1500, 1250, 1100, 1000, 900, 750, 550 1700, 1200, 500 Q3 M. incognita Sakhakot 1700 1700, 1300, 400 1700, 1300, 1000, 720,520 1600, 1500, 1250, 1100, 1000, 900, 750, 550 1700, 1200, 500 H1 M. incognita Sakhakot 1700 1700, 1300, 400 1700, 1300, 1000, 720,520 1600, 1500, 1250, 1100, 1000, 900, 750, 550 1700, 1200, 500 H2 M. arenaria Jabban 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 E1 M. arenaria Thana 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500 E2 M. arenaria Wartair 1700 1700 1700, 1300, 1000, 720,520 1600, 1250, 1000, 750, 550 1700, 1200, 500
88
4.9 (a) RAPD primer SC10-30 Figures 4.16 show the banding pattern obtained by using decamer primer SC10-30. Genetic polymorphisms were observed for three Meloidogyne species; however polymorphism within the species was very low. Our results suggest that the three mitotic parthenogenetic species are more closely related to each other than to any of the other four species used as controls (M. hapla, M. chitwoodi, M. fallax and M. enterolobii) (Figure 4.16). The primer set SC10-30 produced consistent patterns within M. incognita and M. arenaria, but revealed variation between M. javanica isolates (Figure 4.16). This primer generated maximum number of bands (216) in all the tested populations as compared to other primers (Table 4.4). The primer SC10-30 amplified an approximately 750 bp common band observed in all the tested populations. The two unknown nematodes (L1 and L2) belonging to population 1 produced different banding pattern with the primer SC10-30 than any of the Meloidogyne spp. (Figure 4.16).
4.9 (b) RAPD primer OPG-13 The amplification products produced from single females from three species with OPG-13 show the ability of this primer to distinguish M. javanica, M. incognita and M. hapla from the other species (M. hapla, M. fallax, M. chitwoodi and M. mayaguensis) (Figure 4.17 A, B & B). Like the primer SC10-30, this primer also showed consistent pattern within M. incognita and M. arenaria isolates but revealed variation between M. javanica isolates, however only low levels of polymorphisms between the populations were observed. Figures 4.17 A, B and C represent typical fingerprints obtained with primer OPG- 13 of all populations of each of M. incognita, M. javanica and M. arenaria and show all types of polymorphisms. Primer OPG-13 amplified common bands approximately 750 and 1000 bp which were observed in all examined populations and also produced species- specific bands. This primer amplified several polymorphic DNA fragments specific to only L1 and L2 populations. These two unknown nematodes L1 and L2 from Dargai showed similarities in banding pattern with M. javanica populations (Figure 4.17 B). The summary of the results of identification the RKN lines are listed in Table (4.4). This primer clearly distinguished the three Meloiodogyne spp. from other species (M. hapla, M. chitwoodi, M. fallax and M. enterolobii) by differences in their fingerprint patterns and fragment sizes (Figure 4.17 C).
89
Figure 4.16. Example of RAPD patterns using primers SC 10-30 obtained from single females of three Meloidogyne spp. from independent PCR reactions. Codes for each population are given in Table 4.4. NTC (No template control), positive controls (M. javanica, M. incognita, M. hapla, M. enterolobii, and M. chitwoodi) and 1 Kb ladder (Promega, UK).
90
Figure 4.17 A. Example of RAPD patterns using primers OPG-13 obtained from single females belonging to three Meloidogyne spp. from independent PCR reactions. Codes for each population are given in Table 4.4. NTC (No template control) and 1 Kb ladder (Promega, UK).
Figure 4.17 B. Example of RAPD patterns using primers OPG-13 obtained from single females belonging to two Meloidogyne spp. from independent PCR reactions. Codes for each population are given in Table 4.4. NTC (No template control) and 1 Kb ladder (Promega, UK).
91
Figure 4.17 C. Example of RAPD patterns using primers OPG-13 obtained from single females belonging to seven Meloidogyne spp. from independent PCR reactions. Codes for each population are given in Table 4.4. NTC (No template control) and 1 Kb ladder (Promega, UK).
4.9 (c) RAPD primer OPG-19 The primer OPG-19 yielded a few, species-specific bands that enabled differentiation of M. incognita, M. javanica and M. arenaria (Figures 4.18 A and B). The populations of each of M. incognita, M. javanica and M. arenaria were easily distinguished by differences in the fragment patterns. This primer amplified patterns of polymorphic DNA fragments with two major bands of approximately 1500 and 750 bp common to all populations tested and amplified several polymorphic DNA fragments specific to only L1 and L2 nematodes (Figure 4.18 A). Unlike other primers, this primer showed consistent patterns within M. incognita, M. javanica and M. arenaria populations. The primer showed no significant polymorphism for M. javanica populations. Summary of the results are listed in the Table (4.4).
92
Figure 4.18 A. Example of RAPD patterns using primers OPG-19 obtained from single female belonging to three Meloidogyne spp. from independent PCR reactions. Codes for each population are given in Table 4.4. NTC (No template control) and 1 Kb ladder (Promega, UK).
Figure 4.18 B. Example of RAPD patterns using primers OPG-19 obtained from single females belonging to two Meloidogyne spp., from independent PCR reaction. Codes for each population are given in Table 4.4. NTC (No template control) and 1 Kb ladder (Promega, UK).
93
4.10. RAPD Dendogram analysis and Genetic distance of Similarity (%) For the quantitative evaluation of the RAPD results, the values of genetic similarities were calculated using all scorable bands that amplified with all primers. Finally 100 random data sets were generated from the three RAPD dataset by bootstrap analyses from which 100 trees were generated in order to test the confidence in the population groupings (Figure 4.19). The results show strong support (100%) for the M. javanica populations forming one group and for M. incognita and M. arenaria forming another group (Figure 4.19). The perineal patterns and cluster analysis obtained with the 3 different primer sets showed that the nematode populations in cluster I (W3, R1, R3, T2, T3, W1, Q2, M1, H2, E1, Q1, T1, W2, Q3, M2, M3, M4, J1, J3 and F2) were determined as M. javanica, while in cluster II the nematode populations R2, H1 and E2 were determined as M. arenaria with 97 % bootstrap support. The populations L3, J2, J4, F1, F3 and F4 in the third cluster were determined as M. incognita with the 3 primers dataset. The 3 primers dataset divided Meloidogyne javanica populations in 4 sub-clusters (Figure 4.19). The sub-cluster 1contained the populations W3, R1, R3, T2, T3, J3, W1, Q2 and M1 with 100 % bootstrap support. The sub-cluster 2 was the smallest and consisted of only the single nematode line H2 from Thana (Khyber Pakhtunkhwa). Sub-cluster 3 had two different populations E1 and Q1 each from Wartair and Malakander respectively with 55 % bootstrap support. Sub-cluster 4 was the largest with nine nematodes of which four were from Heroshah and three from Swat region. The genetic distance between M. javanica populations ranged from 0 to 0.75 (Table 4.5). The populations in M. incognita group were grouped into two sub-clusters. The sub-cluster 1 had only single nematode (L3) from Dargai whereas the sub-cluster 2 contained 5 nematode lines of which three were from Sakhakot with 62 % bootstrap support. The two unknown nematodes (L1 and L2) were clustered together with 78 % bootstrap support. The RAPD patterns also support some similarities between M. javanica and the two unknown nematodes (L1 and L2) (Figures 4.16, 4.17 B and 4.18 A, Table 4.4). However, in general all the populations were clustered independent of geographic origin. The cluster analysis revealed a clear separation of M. hapla, M. fallax, M. chitwoodi and M. enterolobii from M. incognita,
94
M. javania and M. arenaria. The summary of the results of identification of Meloidogyne spp. is listed in the Table (4.4). Comparing variation between the species as shown by RAPD analysis, it is definite that the three mitotic parthenogenetic species are more closely related to each other than to any of the four species (M. hapla, M. chitwoodi, M. fallax and M. enterolobii) (Table 4.6). Moreover, considering this group, the highest similarity was observed between M. javanica and M. arenaria. The average similarity between them was 50%. Meloidogyne fallax and M. chitwoodii grouped together with an average similarity of 33.3 % whereas M. fallax and M. enterolobii clustered together with a relatively low similarity (25.0%) (Table 4.6). Variations at the intra-specific level were only observed between M. javanica populations with an average similarity of 90.5% between them. In contrast M. incognita and M. arenaria populations showed 98.5 and 100 % average similarity, respectively (Table 4.6).
95
Figure 4.19. Consensus dendrogram of Meloidogyne populations generated from the RAPD data from 35 lines of Meloidogyne spp., using dendro UPGMA software. The numbers show bootstrap values (100 replicates). Population codes are given in Table 4.4. (Hap) M. hapla, (Chit) M. chitwoodi, (Fal) M. fallax and (Ent) M. enterolobii (Syn = M. mayaguensis).
96
Table 4.4. Population codes and summary of species identification of Pakistani RKN populations with three different RAPD pimers set. Codea Location Field RAPD Primer Number of RAPD Number of RAPD Number of Molecular SC10-30b Bands Primer Bands Primer Bands Identification SC10-30 OPG-13 OPG-13 OPG-19 OPG-19
L1 Dargai D1 Differentc 5 Different 5 Different 5 Unknown L2 Dargai D1 Different 5 Different 6 Different 7 Unknown L3 Dargai D1 MI4 7 MI3 6 MI2 5 M. incognita M1 Heroshah H1 MJ4 8 MJ1 4 MJ1 4 M. javanica M2 Heroshah H2 MJ3 7 MJ2 5 MJ1 4 M. javanica M3 Heroshah H2 MJ3 7 MJ2 5 MJ2 5 M. javanica M4 Heroshah H2 MJ3 7 MJ2 5 MJ1 4 M. javanica J1 Swat S3 MJ3 7 MJ2 5 MJ1 4 M. javanica J2 Swat S1 MI3 6 MI3 6 MI2 5 M.incognita J3 Swat S3 MJ3 7 MJ2 5 MJ1 4 M. javanica J4 Swat S1 MI3 6 MI1 6 MI2 5 M. incognita F1 Sakhakot SK1 MI3 6 MI1 4 MI2 5 M. incognita F2 Sakhakot SK2 MJ3 7 MJ1 4 MJ1 4 M. javanica F3 Sakhakot SK1 MI3 6 MI1 4 MI2 5 M.incognita F4 Sakhakot SK1 MI3 6 MI1 4 MI2 5 M. incognita T1 Peshawar P2 MJ3 7 MJ1 4 MJ1 4 M. javanica T2 Peshawar P2 MJ4 8 MJ2 5 MJ1 4 M. javanica T3 Peshawar P3 MJ4 8 MJ1 4 MJ1 4 M. javanica W1 Batkhela B1 MJ4 8 MJ2 5 MJ1 4 M. javanica W2 Batkhela B1 MJ3 7 MJ1 4 MJ1 4 M. javanica W3 Batkhela B1 MJ4 8 MJ2 5 MJ1 5 M. javanica R1 Jabban J1 MJ3 7 MJ3 7 MJ1 4 M. javanica R2 Jabban J1 MA3 7 MA2 6 MA1 3 M. arenaria R3 Jabban J1 MJ4 8 MJ3 7 MJ1 4 M. javanica Q1 Malakander MK1 MJ3 7 MJ2 5 MJ1 4 M. javanica Q2 Malakander MK1 MJ4 8 MJ2 5 MJ1 4 M. javanica Q3 Malakander MK1 MJ3 7 MJ2 5 MJ1 4 M. javanica H1 Thana T1 MA3 7 MA2 6 MA1 3 M. arenaria H2 Thana T3 MJ4 8 MJ1 4 MJ1 4 M. javanica E1 Wartair W1 MJ3 7 MJ2 5 MJ1 4 M. javanica E2 Wartair W1 MA3 7 MA2 6 MA1 3 M. arenaria aIndividual nematodes (juveniles of females), bMI1= Meloidogyne incognita pattern 1, MA1= Meloidogyne arenaria pattern 1, MJ1= Meloidogyne javanica pattern 1, cDifferent = Pattern resemble to M. javanica
97
Table 4.5. Genetic distance matrix of ten Meloidogyne populations belonging to three species generated by the formula of Nei and Li (1979) from the three RAPDs primer data set.
W3 R1 R3 H2 E1 T2 T3 L3 J2 J4 R2 H1 E2 W1 Q1 Q2 L1 L2 M1 F1 F3 F4 T1 W2 Q3 M2 M3 M4 J1 J3 F2 Hp Cht Fal May
W3 0.00
R1 0.00 0.00
R3 0.00 0.00 0.00
H2 0.125 0.125 0.125 0.00
E1 0.125 0.125 0.125 0.125 0.00
T2 0.00 0.00 0.00 0.125 0.125 0.00
T3 0.00 0.00 0.00 0.125 0.125 0.00 0.00
L3 0.5 0.5 0.5 0.625 0.625 0.5 0.5 0.00
J2 0.625 0.625 0.625 0.75 0.75 0.625 0.625 0.25 0.00
J4 0.625 0.625 0.625 0.75 0.75 0.625 0.625 0.25 0.00 0.00
R2 0.333 0.333 0.333 0.444 0.444 0.333 0.333 0.625 0.571 0.571 0.00
H1 0.333 0.333 0.333 0.444 0.444 0.333 0.333 0.625 0.571 0.571 0.00 0.00
E2 0.333 0.333 0.333 0.444 0.444 0.333 0.333 0.625 0.571 0.571 0.00 0.00 0.00
W1 0.00 0.00 0.00 0.125 0.125 0.00 0.00 0.5 0.625 0.625 0.333 0.333 0.333 0.00
Q1 0.125 0.125 0.125 0.25 0.00 0.125 0.126 0.625 0.75 0.75 0.444 0.444 0.444 0.125 0.00
Q2 0.00 0.00 0.00 0.125 0.125 0.00 0.00 0.5 0.625 0.625 0.333 0.333 0.333 0.00 0.125 0.00
L1 0.375 0.375 0.375 0.5 0.5 0.375 0.375 0.5 0.4 0.4 0.286 0.286 0.286 0.375 0.5 0.375 0.00
L2 0.375 0.375 0.375 0.5 0.5 0.375 0.375 0.5 0.4 0.4 0.286 0.286 0.286 0.375 0.5 0.375 0.00 0.00
M1 0.00 0.00 0.00 0.125 0.125 0.00 0.00 0.5 0.625 0.625 0.333 0.333 0.333 0.00 0.125 0.00 0.375 0.375 0.00
F1 0.625 0.625 0.625 0.75 0.75 0.625 0.625 0.625 0.00 0.00 0.571 0.571 0.571 0.625 0.75 0.625 0.4 0.4 0.625 0.00
F3 0.625 0.625 0.625 0.75 0.75 0.625 0.625 0.625 0.00 0.00 0.571 0.571 0.571 0.625 0.75 0.625 0.4 0.4 0.625 0.00 0.00
F4 0.625 0.625 0.625 0.75 0.75 0.625 0.625 0.625 0.00 0.00 0.571 0.571 0.571 0.625 0.75 0.625 0.4 0.4 0.625 0.00 0.00 0.00
T1 0.125 0.125 0.125 0.25 0.25 0.125 0.125 0.429 0.571 0.571 0.25 0.25 0.25 0.125 0.25 0.125 0.286 0.286 0.125 0.571 0.571 0.571 0.00
W2 0.125 0.125 0.125 0.25 0.25 0.125 0.125 0.429 0.571 0.571 0.25 0.25 0.25 0.125 0.25 0.125 0.286 0.286 0.125 0.571 0.571 0.571 0.00 0.00
Q3 0.125 0.125 0.125 0.25 0.25 0.125 0.125 0.429 0.571 0.571 0.25 0.25 0.25 0.125 0.25 0.125 0.286 0.286 0.125 0.571 0.571 0.571 0.00 0.00 0.00
M2 0.125 0.125 0.125 0.25 0.25 0.125 0.125 0.429 0.571 0.571 0.25 0.25 0.25 0.125 0.25 0.125 0.286 0.286 0.125 0.571 0.571 0.571 0.00 0.00 0.00 0.00
M3 0.125 0.125 0.125 0.25 0.25 0.125 0.125 0.429 0.571 0.571 0.25 0.25 0.25 0.125 0.25 0.125 0.286 0.286 0.125 0.571 0.571 0.571 0.00 0.00 0.00 0.00 0.00
M4 0.125 0.125 0.125 0.25 0.25 0.125 0.125 0.429 0.571 0.571 0.25 0.25 0.25 0.125 0.25 0.125 0.286 0.286 0.125 0.571 0.571 0.571 0.00 0.00 0.00 0.00 0.00 0.00
J1 0.125 0.125 0.125 0.25 0.25 0.125 0.125 0.429 0.571 0.571 0.25 0.25 0.25 0.125 0.25 0.125 0.286 0.286 0.125 0.571 0.571 0.571 0.00 0.00 0.00 0.00 0.00 0.00 0.00
J3 0.125 0.125 0.125 0.25 0.25 0.125 0.125 0.429 0.571 0.571 0.25 0.25 0.25 0.125 0.25 0.125 0.286 0.286 0.125 0.571 0.571 0.571 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
F2 0.125 0.125 0.125 0.25 0.25 0.125 0.125 0.429 0.571 0.571 0.25 0.25 0.25 0.125 0.25 0.125 0.286 0.286 0.125 0.571 0.571 0.571 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
Hp 0.625 0.625 0.625 0.75 0.75 0.625 0.625 0.6 0.5 0.5 0.571 0.571 0.571 0.625 0.5 0.5 0.5 0.571 0.571 0.571 0.571 0.571 0.571 0.571 0.571 0.571 0.571 0.571 0.571 0.571 0.571 0.00
Cht 0.75 0.75 0.75 0.714 0.875 0.75 0.75 0.8 0.75 0.75 0.714 0.714 0.714 0.75 0.875 0.75 0.6 0.6 0.75 0.75 0.75 0.75 0.714 0.714 0.714 0.714 0.714 0.714 0.714 0.714 0.714 o.75 0.00
Fal 0.667 0.667 0.667 0.625 0.778 0.667 0.667 0.667 0.833 0.833 0.778 0.778 0.778 0.667 0.778 0.667 0.714 0.714 0.667 0.833 0.833 0.833 0.625 0.625 0.625 0.625 0.625 0.625 0.625 0.625 0.625 0.833 0.5 0.00
Ma 0.556 0.556 0.556 0.667 0.667 0.556 0.556 0.5 0.667 0.667 0.667 0.667 0.667 0.556 0.667 0.556 0.571 0.571 0.556 0.667 0.667 0.667 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.667 0.6 0.5 0.00
98
Table 4.6. Genetic distance matrix of similarities between and within M. javanica, M. incognita, M. arenaria, M. hapla, M. fallax, M. chitwoodi and M. enterolobii generated by the formula of Nei and Li (1979), from the RAPD data.
Species M. javanica M. incognita M. arenaria M. hapla M. Chitwoodi M. fallax
M. javanica 90.5
M. incognita 42.8 98.5
M. arenaria 50.0 37.5 100
M. hapla 14.3 14.2 12.5 _
M. chitwoodi 28.5 33.3 22.2 20.0 _
M. fallax 33.3 28.5 16.6 16.6 33.3
M. enterolobii 33.3 22.2 12.5 12.5 25.0 _
99
V. RESULTS OF PHYTOCHEMICAL ANALYSES
5.1. Phytochemicals isolated from Fumaria parviflora Three known compounds have been isolated from F. parviflora of Pakistani origin. Various experimental techniques and extensive spectroscopic techniques were applied for the isolation and structure determination of these compounds. All the isolated compounds showed nematicidal activity including egg hatch inhibition and J2s mortality. Various parts (stem, roots and leaves) of F. parviflora were collected from Peshawar. Initially crude extracts from all parts of the plant were subjected to nematicidal bioassays. Based on bioactivity guided fractionation, the dried powdered parts (stem and roots) were extracted with n-hexane, ethyl acetate, chloroform and methanol in the increasing order of polarity using a soxhlet apparatus. After evaporating the solvent, the residue (n-hexane and methanol) were subjected to column chromatography. The n-hexane fraction of the roots have resulted in eleven fractions (F1 to F11), of which two fractions (F3 and F4) yielded two known compounds (1 and 2), whereas the fraction F11 on column chromatography yielded six sub-fractions. Similarly the methanol fraction of the roots yielded seven sub- fractions (FM2.1 to FM2.7) and aqueous layer (FM3). Only the fraction FM2.1 yielded an alkaloid (3). The nematicidal activity of all the fractions and compounds are described in the next chapter.
5.1.1. Structure elucidation of nonacosane-10-ol (1)
Figure 5.1.1 Nonacosane-10-ol
White amorphous compound (n-hexane), mp 83-84 °C (literature mp, 81-82 °C) (Choi et al., 1996). Infrared ѵ: 3318.1 (O-H stretching) and 2953.9 (C-H saturated
100
stretching) (Appendix-01). Molecular formula C29H60O, deduced from the EIMS m/z 424.7 13 (calcd. 424 for C29H60O) (Appendix-02) and C NMR (Appendix-3). EIMS m/z= 424.7 + + (M ), 406.3 (M -H2O), 297.2, 279.3, 171.0, 157.0, 139.0, 127.2, 111.1, 85.1 (Possible fragmentation pattern showed in Figure 5.1.2). The 1H-13C connectivities were determined by the HMQC correlation, while the long range 1H-13C correlations were assigned through the HMBC technique. The 1H and 13C NMR spectral data (Table 5.1.) of the compound was in close agreement to that of the reported for nonacosan-10-ol (Choi et al., 1996). The broad band 13C NMR showed twenty nine carbon including; 2 methyl, 26 methylene and 1 methine. The peak at δ 14.10 was assigned to C-1 and C-29. The characteristic peaks at δ 22.68, 25.66, 29.32, 29.70, 31.93 and 37.50 were assigned to C-2, C-28, C-8, C-12, C-4, C-26, C-14 to C-25, C-3, C-27, C-9 and C-11 respectively. The signal at δ 72.03 was attributed to C-10 (Appendix-03). The presence of two methyl triplet at δ 0.860 (t, H-1 and H-29), 24 methylene multiplet at δ 1.235 (m, H-2 to H-8 and H-12 to H-28), two methylene multiplet at δ 1.409 (m, H-9 and H-11), one methine multiplet at δ 3.561 (m, H-10) (1H NMR spectrum in
CDCl3) (Appendix-04). From the mass and NMR spectra the structure of the compound 1 was established as nonacosan-10-ol (1). The structure was confirmed by using 1D and 2D techniques. In HMBC experiment the resonance at δ 0.860 (H-1 and H-29) shows correlation to δ 22.68 (C-2 and C-3) and 31.93 (C-3 and C-27). The resonance at δ 3.561 (H-10) correlated with δ 25.66 (C-8 and C- 12) (Appendix-05). The HMBC correlation is represented in the Figure 5.1.3. The DQF COSY correlations (Appendix-06) are represented in the structure by double arrows (Figure 5.1.4).
101
Figure 5.1.2. Fragmentation pathway of nonacosane-10-ol (ISH-03).
102
1 13 Table 5.1. H (500 MHz) and C (75 MHz) NMR in CDCl3 and HMBC correlations of nonacosan-10-ol (1).
* 13 1 C. No. C NMR (δ) Multiplicity H NMR (δ) (JHH Hz) HMBC Correlation
1 14.10 CH3 0.860 (3H, t, J1, 2 = 6.5 Hz) C-2, C-3 2 22.68 CH2 1.235 (2H, m)
3 31.93 CH2 1.235 (2H, m)
4 29.32 CH2 1.235 (2H, m)
5 29.70 CH2 1.235 (2H, m)
6 29.70 CH2 1.235 (2H, m)
7 31.90 CH2 1.235 (2H, m)
8 25.66 CH2 1.235 (2H, m)
9 37.50 CH2 1.409 (2H, m) 10 72.03 CH 3.561 (1H, m)
11 37.50 CH2 1.409 (2H, m)
12 25.66 CH2 1.235 (2H, m)
13 31.90 CH2 1.235 (2H, m)
14 29.70 CH2 1.235 (2H, m)
15 29.70 CH2 1.235 (2H, m)
16 29.70 CH2 1.235 (2H, m)
17 29.70 CH2 1.235 (2H, m)
18 29.70 CH2 1.235 (2H, m)
19 29.70 CH2 1.235 (2H, m)
20 29.70 CH2 1.235 (2H, m)
21 29.70 CH2 1.235 (2H, m)
22 29.70 CH2 1.235 (2H, m)
23 29.70 CH2 1.235 (2H, m)
24 29.70 CH2 1.235 (2H, m)
25 29.70 CH2 1.235 (2H, m)
26 29.32 CH2 1.235 (2H, m)
27 31.93 CH2 1.235 (2H, m)
28 22.68 CH2 1.235 (2H, m)
29 14.10 CH3 0.860 (3H, t, J28, 29 = 6.5 Hz) C-27, C-28 *Carbon number
103
Figure 5.1.3. HMBC Correlation of nonacosane-10-ol
Figure.5.1.4. COSY Correlation of nonacosan-10-ol
104
5.2. Structure elucidation of 23a-Homostigmast-5-en-3ß-ol (17-(6-ethyl-7- methyloctan-2yl)-10,13-dimethyl- 2,3,4,7,8,9,10,-11,12,13,14,15,16,17- tetradecahydro-1H-cyclopenta[a]-phenanthren-3-ol) (2)
Figure 5.2.1. 23a-homostigmast-5-en-3ß-ol (ISH-034)
White amorphous powder (CHCl3), mp 125-127 °C (literature m.p. 125-127 °C). IR ѵ: 3421.1, 2917.3, 2848.8 and 2359.0 showed OH and C-H saturated (Appendix-07). UV spectra of ISH-034 showed absorbance at 280nm (Appendix-08). Molecular formula
C30H52O, deduced from the EIMS m/z 428.4 (calcd. 428 for C30H52O) (Appendix-09) and 13C NMR (Appendix-10). The 1H and 13C NMR spectral data (Table 5.2) of the compound in Figure 5.2.1 was in close agreement to that of the reported for ß-sitosterol (Ageta and Ageta, 1984). The 13C NMR data indicated that the main difference between this compound and ß-sitosterol was the presence of one extra CH2 group at δ 29.70 (CH2-23). The 1H-13C connectivities were determined by the HMQC spectrum, while the long range 1H-13C correlations were assigned through the HMBC technique. The 13C NMR showed thirty carbons in the broad band spectrum including; 6 methyl, 12 methylene, 9 methine and 3 quaternary carbons. The characteristic peaks at δ 140.77 and 121.72 were assigned to C-5 and C-6 respectively. The signals at δ 71.83, 56.88, 55.98 and 50.18 were attributed to C-3, C-14, C-17 and C-9 respectively. The carbon resonances at δ 45.86, 42.32, 39.79 and 37.27 were assigned to C-25, C-13, C-4, C-12 and C-1 respectively. The signal at δ 36.52 was assigned to C-10, 36.15 to C-20 and at d 33.97
105
was attributed to C-22. The signals resonated at δ 31.68, 31.92, 31.92, 29.70, 29.25 and 28.24 were assigned to C-7, C-8, C-2, C-23, C-26 and C-16 respectively. While the signals at δ 26.11, 24.37, 23.08 and 21.08 were attributed to C-23a, C-15, C-28 and C-11 respectively. The high field signals at δ 19.81, 19.40, 18.99, 18.90, 12.24 and 11.87 were assigned to C27, C-19, C-26, C-21, C-29 and C-18 respectively (Appendix-10). The presence of two methyl singlets at δ 0.746 (s, H-18) and 0.804 (s, H-19), three methyl doublets at δ 0.990 (d, J = 6.6 Hz, H-21), 0.785 (d, J = 7.2 Hz, H-26) and δ 0.834 (d, J = 6.6 Hz, H-27). One methyl triplet at δ 0.859 (t, J = 7.5 Hz, H-29), an olefinic proton broad doublet at δ 5.335 (d, J = 4.8 Hz H-6) and a multiplet at δ 3.504 (H-3) (1H NMR spectrum in CDCl3) (Appendix-11). From mass and NMR spectra the structure of the compound in Figure 5.2.1. was established as 23a-homostigmast-5-en-3ß-ol in Figure 5.2.1 (17-(6-ethyl-7-methyloctan-2- yl)-10,13-dimethyl 2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]- phenanthren-3-ol . The structure was confirmed by using 1D and 2D techniques. In HMBC experiment the resonance at δ 5.335 (H-6) shows correlation to C-4, C-8 and C-10. The resonance at d 2.251 (H-4) correlated with C-2, C-3, C-5, C-6 and C-10. The signals at δ 1.812 and 1.063 (H-1) correlated with resonates at δ 71.83 (C-3), 140.77 (C-5) and 19.40 (C-19). The signal at δ 0.804 (H-19) correlated to δ 36.52 (C-10), 50.18 (C-9) and 140.77 (C-5). The resonance at δ 1.063 (H-14) showed correlation to C-9, C-12 and C- 17 and the signal at δ 0.990 (H-21) correlated to δ 33.97 (C-22), 36.15 (C-20) and 55.98 (C- 17). The signal at δ 0.909 (H-9) correlated to C-5 and C-14. The signal at δ 0.834 (H-27) correlated to C-24, C-25, C-26 and the signal at δ 0.785 (H-26) correlated to C-24, C-25 and C-27. The resonance at δ 0.746 (H18) correlated to resonates at δ 39.79 (C-12), 42.32 (C-13), 55.98 (C-17) and 56.88 (C14) (Appendix-12). The HMBC correlation is represented in the Figure 5.2.2.
106
1 13 Table 5.2. H (400 MHz) and C (100 MHz) NMR in CDCl3 and HMBC correlations of 23a-homostigmast-5-en-3ß-ol (2).
* 13 1 C. No. C NMR (δ) Multiplicity H NMR (δ) (JHH Hz) HMBC Correlation
1 37.27 CH2 1.812 (2H, m) C-3, C-5, C-9 - - 1.063 (2H, m) -
2 31.92 CH2 1.498 (2 H, m) - 3 71.83 CH 3.504 (1H, m) -
4 42.32 CH2 2.251 (2H, m) C-3, C-5, C-6 5 140.77 C - - 6 121.72 CH 5.335 (1H, d J= 4.8Hz) C-4, C-8, C-10
7 31.68 CH2 1.933 (2H, m) - - - 1.837 (2H, m) - 8 31.92 CH 1.977 (1H, m) - 9 50.18 CH 0.909 (1H, m) C-5, C-14
10 36.52 C - -
11 21.08 CH2 1.52, 1.45 (2H, m) -
12 39.79 CH2 1.14 (2H, m) -
13 42.32 C - - 14 56.88 CH 1.063 (1H, m) C-9, C-12, C-17
15 24.37 CH2 1.537 (2H, m) - - - 1.091 (2H, m) -
16 28.24 CH2 1.163 (2H, m) - 17 55.98 CH 1.091 (1H, m) -
18 11.98 CH3 0.746 (3H, s) C-12, C-13, C-14, C-17
19 19.40 CH3 0.804 (3H, s) C-1, C-5, C-9, C-10 20 36.15 CH 1.428 (1H, m) -
21 18.78 CH3 0.990 (3H, d, J=8.0Hz) C-17, C-20, C-22
22 33.97 CH2 1.512 (2H, m) - - - 0.899 (2H, m) - ______
107
13 1 C. No. C NMR (δ) Multiplicity H NMR (δ) (JHH Hz) HMBC Correlation
23 29.70 CH2 1.522 (2H, m) C-20, C-24
23a 26.10 CH2 1.115 (2H, m) C-22, C-24, C-25 24 45.86 CH 0.909 (1H, m) - 25 29.25 CH 1.812 (1H, m) -
26 18.99 CH3 0.785 (3H, d, J=6.8 Hz) C-24, C-25, C-27
27 19.81 CH3 0.834 (3H, d, J=6.8 Hz) C-24, C-25, C-26
28 23.08 CH2 1.234 (2H, m) -
29 12.05 CH3 0.859 (3H, t, 7.0 Hz) C-24, C-28 *Carbon number
Figure 5.2.2. HMBC Correlation of 23a-homostigmast-5-en-3ß-ol (ISH-034)
The DQF COSY correlations (Appendix-13) are represented in the structure by double arrows (Figure 5.2.3).
108
Figure 5.2.3. COSY Correlation of 23a-homostigmast-5-en-3ß-ol (ISH-034)
5.3. Properties of Trans-Protopinium (ISH-02) ISH-02 was isolated from the Methanol fraction of roots of Fumaria parviflora on column chromatography. ISH-02 is a white amorphous compound (MeOH), MP 207-208 °C (Lit. value: 207 °C) (Xu et al., 2006). UV: In UV ISH-02 showed absorbance at wave length of 240 and 290 nm (Appendix- 14).
-1 Infrared νmax: 3424, 2911 and 1605 cm showed OH, C-H and C=C respectively
(Siddiqui et al., 2009; Tousek et al., 2005). 1H and 13C NMR (Table 5.3) MS ESI: 354.1329 (Appendix-15) EIMS: 281.2, 207.1, 148.1 (Appendix-16)
5.3.1. Characterization of ISH-02 as Trans-protopinium Trans-protopinium gives deep gray color on TLC when expose to UV light. On spraying with Dragendorff’s reagent it gives bright orange color. Molecular formula + C20H19N O5, deduced from the ESI m/z 354.1329. Figure 5.3.1 showed the possible fragmentation pathway of trans-protopinium (Appendix-16).
109
The 1H-13C connectivities were determined by the HSQC spectrum (Appendix-17), while the long range 1H-13C correlations were assigned through the HMBC technique. The deptq135 13C-NMR (Appendix-18) showed fourteen peaks spectrum including; 1 methyl, 5 methylene, 3 methine and 7 quaternary carbons. The characteristic peaks at δ 42.7 were assigned NCH3. The signals at δ 23.9, 53.7, 55.0, 102.0 and 102.3 were attributed to C-5, C-6, C-8, C-15 and C-16 respectively while the 13C peak for C-13 were missing due to resonance effect. The carbon resonances at δ 122.6, 108.9, 108.9 and 106.5 were assigned to C-12, C-4, C-11, and C-1 respectively. The signal at δ 148.6, 148.0, 146.1, 144.1, 125.3, 123.7 and 109.5 were assigned to C-2, C-3, C-9, C-10, C-4a, C-12a and C-8a respectively while signals for C-13 and C-14 in deptq135 were not visible due to resonance (Table 5.3). 1H-NMR (Appendix-19) showed the presence of one methyl singlet at δ 2.95 (s,
H-NCH3), one methylene broad singlet at δ 4.55 (s, H-2), one methylene broad singlets at δ 3.81(br.s, H-7) and 3.73 (br.s, H-7), one methylene broad singlets at δ 3.23 (br.s, H- 6) and 3.11 (br.s, H-6), methine at C-13 were missing in proton spectra like carbon spectra, one methylene singlet at δ 6.07 (s, H-15), one methylene at δ 6.10 (s, H-16), two methine singlets at δ 7.28 (s, H-1) and 6.89 (s, H-4), 8.70 and two methine doublets at δ 6.97 (d, H-11, J=8.0) and 6.80 (d, H-12, J=7.6) (1H NMR spectrum in DMSO). Structure of the compound (3) was established as Trans-protopinium (Figure 5.3.2) by comparing its mass and NMR spectral values with those of literature values as listed in table (5.4) (Tousek et al., 2005).
110
Figure 5.3.1. Possible fragmentation pathway of Trans-protopinium (ISH-02)
111
Figure 5.3.2. Structure of Trans-protopinium (ISH-02)
The structure was confirmed by using 1D and 2D techniques. In HMBC experiment the resonance at δ 7.28 (H-1) shows correlation to C-2, C-3, and C-4a (Appendix-20). The resonance at δ 6.89 (H-4) correlated with C-2, C-3, and C-14a. The signals at δ 6.07 (H-15) correlated with resonates at δ 148.0 (C-2) and 148.6 (C-3). The signal at δ 4.55 (H-8) correlated to δ 42.7 (C-NCH3), 53.7 (C-6), 109.5 (C-8a), 144.1 (C-9) and 123.7 (C-12a). The resonance at δ 6.10 (H-16) showed correlation to C-9 and C-10, the signal at δ 6.97 (H-11) correlates to C-8a, C-9, C-10 and C-12a and the signal at δ 6.80 (H-12) correlated to δ 109.5 (C-8a), 144.1 (C-9) and 146.1 (C-10). The HMBC correlations were represented by arrows in figure (5.3.11) while the DQF COSY correlations are represented in the structure by double arrows in figure (5.3.4).
112
Table 5.3. 1H (400 MHz) and 13C (100 MHz) NMR in DMSO at 80oC and HMBC correlations of Trans-Protopinium (ISH-02) (3).
13 1 C. No C NMR (δ) Multiplicity H NMR (δ) (JHH Hz) HMBC correlations 1 106.5 CH 7.28 (1H, br.s) C-2, C-3, C-4a 2 148.0 C 3 148.6 C 4 108.9 CH 6.89 (1H, s) C-2, C-3, C-13b 4a 125.3 C
5 23.9 CH2 3.23 (1H, br.s), 3.11 (1H, br.s)
6 53.7 CH2 3.81 (1H, br.s) 3.73 (1H, br.s)
8 55.0 CH2 4.55 (2H, br.s) C-6, C-8a, C-12a, C-NCH3 8a 109.5 C 9 144.1 C 10 146.1 C 11 108.9 CH 6.97 (1H, d, J=8.0Hz) C-8a, C-9, C-10, C-12a 12 122.6 CH 6.80 (1H, d, J=7.6Hz) C-8a, C-9, C-10 12a 123.7 C
13 CH2 14 C 14a 127.1 C
15 102.0 CH2 6.07 (2H, s) C-2, C-3
16 102.2 CH2 6.10 (2H, s) C-9, C-10
NCH3 42.7 CH3 2.95 (3H, s) C-6, C-8
113
Table 5.4. 1H-NMR and 13C-NMR comparison of ISH-02 with reported values of Trans-protopinium and Cis-protopinium.
Carbon Trans-Protopinium Cis-Protopinium ISH-02 Number Bruker Avance DRX 500 Bruker Avance 300 Bruker Avance 400 13-C NMR 1H-NMR 13-CNMR 1H-NMR 13-NMR 1H-NMR (125.76MHz) (500.13MHz) (75.47MHz) (300.13MH (100.62MH (400.13MHz) z) z) 1 105.99 7.19 105.93 7.12 106.51 7.28 2 147.78 147.20 148.00 3 149.08 148.92 148.55 4 108.53 6.84 108.80 6.82 108.91 6.89 4a 142.74 142.74 125.29 5 23.66 3.13, 3.37 23.20 23.88 3.23, 3.11 6 54.92 3.66, 4.07 53.91 53.72 3.81, 3.73 8 55.87 4.52-4.88 55.36 4.52-4.88 54.97 4.55 8a 108.92 109.51 109.50 9 144.18 144.13 144.05 10 146.37 146.37 146.09 11 109.48 6.98 109.16 6.92 108.91 6.97 12 122.91 6.92 121.86 6.77 122.53 6.80 12a 122.31 122.15 123.67 13 35.15 3.49, 3.98 38.76 3.45, 3.69 14 92.12 93.25 8.73 (OH) 14a 124.50 126.72 127.10 15 102.23 6.05 102.10 5.99-6.05 102.04 6.07 16 102.44 6.00, 6.09 102.39 5.99-6.05 102.27 6.10
NCH3 42.65 3.07 44.75 3.15 42.70 2.95
114
Figure 5.3.3. HMBC correlations of Trans-protopinium (ISH-02)
Figure 5.3.4. COSY correlations of Trans-protopinium (ISH-02)
115
Table 5.5. 1H-NMR and 13C-NMR comparison of Trans-protopinium (ISH-02) with major (Trans-protopinium) and minor (Cis-protopinium) components in ISH-02 recorded at 25oC.
*C. No. Trans-protopinum (ISH-02) Major ISH-02 Minor ISH-02
13C-NMR 1H-NMR 13C-NMR 1H-NMR 13C-NMR 1H-NMR (100.62MHz) (400.13MHz) (125.82MHz) (500.33MHz) (125.82MHz) (500.33MHz) T=80oC T=80oC T=25oC T=25oC T=25oC T=25oC 1 106.51 7.28 106.24 7.33 105.57 7.08 2 148.00 147.02 147.02 3 148.55 148.10 148.10 4 108.91 6.89 108.60 6.89 108.60 6.88 4a 125.29 125.51 125.51 5 23.88 3.23, 3.11 23.37 3.29, 3.02 22.91 3.18 6 53.72 3.81, 3.73 53.36 3.87, 3.67 52.63 3.78 8 54.97 4.55 54.80 4.53 54.20 4.67 8a 109.50 109.20 109.20 9 144.05 143.57 143.57 10 146.09 145.61 145.61 11 108.91 6.97 108.46 6.97 108.22 6.97 12 122.53 6.80 122.22 6.81 121.47 6.74 12a 123.67 124.58 123.25 13 34.58 4.04 38.50 3.67, 3.29 14 8.73 (OH) 91.61 8.65 (OH) 92.39 8.70 (OH) 14a 127.10 127.40 127.40 15 102.04 6.07 101.58 6.06 101.58 6.06 16 102.27 6.10 101.80 6.09 101.80 6.09
NCH3 42.70 2.95 42.16 2.91 44.01 3.02
*Carbon number
116
The ID and 2D spectra of ISH-02 were also taken in DMSO at 25oC which showed the presence one major and one minor compound (Appendix-21,22) (Table 5.5). These spectral values were compared with the established Trans-protopinium (ISH-02), recorded at 80oC as listed in table (5.4). The major component was similar to Trans- protopinum (Figure 5.3.5) while the minor one was Cis-protopinium (Figure 5.3.6) as reported (Tousek et al., 2005).
Trans-protopinium was more stable than Cis-protopinium due to its less steric repulsion. Trans-protopinium and Cis-protopinium were present in 2:1 ratio in the spectra recorded at 25oC in DMSO. These two isomers were shifted to the most stable one by taking the spectra at 80oC in the same solvent.
5.4. Thin layer chromatography (TLC) and qualitative phytochemical screening
Thin layer chromatography (TLC) of all the crude fractions and various extracts (n- hexane, EtOAC, CHCl3 and MeOH) from the stem and roots of F. parviflora was performed. TLC plates when sprayed with Ceric sulphate (10 % H2SO4) (followed by heating) revealed the presence of black and green spots, which indicated the presence of non-alkaloids and orange colour spots appeared when sprayed with Dragendorrf’s reagent indicated the presence of alkaloids. The retention factor of all the tested extracts ranged from 0.35 to 0.40 (Table 5.6). The TLC examination and retention factor values revealed non-alkaloids in n-hexane and EtOAC and alkaloids compounds in MeOH whereas the
CHCl3 extract showed the presence of both. The phytochemical screening and quantitative determination of F. parviflora root and stem extracts showed the presence of seven bioactive secondary metabolites (Table 5.6). The n-hexane root extracts contained steroids, tannins and flavonoids, whereas the n-hexane extract of the stem only had tannins. The EtOAC extract of the root possessed glycosides and tannins whereas the EtOAC extract of the stem had glycosides only. The CHCl3 extracts of the root and stem showed the presence of alkaloids and saponin together whereas the MeOH extracts of the root and stem showed the presence of alkaloids only. The fractions were evaluated for their solvent extractive values with the highest values obtained for all the root extracts except CHCl3 (Table 5.6). The alkaloids and saponins contents (%) of the roots (0.9 ± 0.04 and 1.3 ± 0.07, n=10, respectively) were relatively higher than the stem (0.5 ± 0.03 and 0.9 ± 0.08, n= 10, respectively).
117
Conversely, the total phenolic contents were the highest in the stem (16.75 ± 0.07 µg g-1 of pyrocatechol) in comparison to the roots (12.0 ± 0.05 µg g-1 of pyrocatechol) (Table 5.6, Figure 5.4).
Figure 5.3.5. Trans-protopinium
Figure 5.3.6. Cis-protopinium
118
Figure 5.4. Standard curve for different concentrations (ppm) of roots and stem extracts of F. parviflora and their absorption measured at 760 nm.
119
Table 5.6. Qualitative and quantitative phytochemical screening of different classes of compounds using four different solvent systems from the roots and stem of Fumaria parviflora.
Chemical components
a b b c b d Plant Extracts Alkaloids Saponins Steroids Glycosides Tannins Flavonoids Rf values Ext values TPC Part Root 0.9 ± 0.04 1.3 ± 0.07 12.0 ± 0.05 0.39, 0.37, n-hexane - - + - + + 11.71± 0.02 0.4,0.38 EtOAC - - - + + - 0.35, 0.37 6.28 ± 0.04 e CHCl3 + + - - - - 0.4, 0.36 5.24 ± 0.05 MeOH + - - - - - 0.38 8.9 ± 0.02 16.75 ± Stem 0.5 ± 0.03 0.9 ± 0.08 0.07 0.38, 0.36, n-hexane - - - - + - 9.42 ± 0.00 0.35 0.36 EtOAC - - - + - - 6.0 ± 0.01
0.35, 0.39 CHCl + + - - - - 5.90 ± 0.02 3 0.4, 0.5 MeOH + - - - - - 8.0 ± 0.06
aSolvent use; + (present); - (absent) bExt values = Extractive values; Results expressed in percentage per dry plant material. (N=10) c Rf = (Retention factor values). dTPC = Total phenolic contents expressed as µg of pyrocatechol g-1 plant tissue. eNon-alkaloid compound.
120
VI. RESULTS OF IN VITRO BIOASSAYS
6.1. Pathogenicity Test The seedlings of F. parviflora inoculated with 500, 1000, 2000, 4000 and 8000 J2s of M. incognita/kg soil were harvested 60 days after inoculation and observed for symptoms production (galls, yellowing, stunting). Results revealed that F. parviflora plants inoculated with M. incognita J2s produced no galls, yellowing and stunting symptoms. Inoculated and uninoculated plants were identical in appearance and morphology.
6.2. Effect of the crude extracts of Fumaria parviflora on Meloidogyne incognita 6.2.1. Egg hatch inhibition (%) of M. incognita Results in Figures 6.1.A and 6.1.B indicated that the crude extracts of F. parviflora and their concentration significantly (R2 = 1 and 0.96) increased the percent egg hatch inhibition. Comparison of the treatments means reflects that root extracts showed the maximum egg hatch inhibition (74.42 %; R2 = 1) followed by stem extracts (64.33 %). Data revealed that increase in concentration of crude extracts significantly increased (R2 = 0.96) egg hatch inhibition. There was linear increase in egg hatch inhibition when the concentration of extracts was increased three folds (Figure 6.1).
6.2.2. J2s mortality (%) of Meloidogyne incognita Data in Figure 6.2.A and 6.2.B revealed that all the crude extracts of F. parviflora and their concentrations significantly (R2 = 1 and 0.99) increased percent J2 mortality of M. incognita. Comparison of the treatments means revealed that root extracts of F. parviflora significantly killed J2s (78.83 %; R2 = 1) followed by stem extracts (65.58 %; R2 = 1). Data revealed that J2 mortality was significantly (P < 0.05) increased at increasing concentration with the highest concentration 0f 12.5 mg mL-1 as the most effective (57.81 %) (R2 = 0.99) (Figure 6.2.B).
121
Figure 6.1.A. In vitro effect of Fumaria parviflora crude extracts on egg hatch inhibition (%) of Meloidogyne incognita.
Figure 6.1.B. In vitro effect of different concentrations of Fumaria parviflora on egg hatch inhibition (%) of Meloidogyne incognita.
122
Figure 6.2. A. In vitro effect of Fumaria parviflora crude extracts on J2s mortality (%) of Meloidogyne incognita.
Figure 6.2.B. In vitro effect of different concentrations of Fumaria parviflora on J2s mortality (%) of Meloidogyne incognita.
123
6.3. Nematicidal effect of the roots and stem crude extracts of Fumaria parviflora on Meloidogyne incognita
6.3.1. Effect of the root and stem extracts of Fumaria parviflora on egg hatch inhibition (%) Percentage hatch inhibition of M. incognita eggs was significantly influenced (P < 0·05) by the concentration of the root and stem extracts of F. parviflora throughout the experiment. Egg hatching inhibition significantly increased (P < 0·05) in eggs incubated at 3.12, 6.24, 12.5, 25.0 and 50.0 mg mL-1 of the root and stem extracts concentrations with respect to the control (Figure 6.3 and 6.4). However, between some concentrations, differences were not found by LSD test (Figure 6.3 and 6.4). Similar results of hatching inhibition were obtained by the different solvent extracts of stem or roots. Hatch inhibition increased as the concentration was increased. Stem and root extracts have a similar graph pattern and effect in egg hatching inhibition. Similar results were recorded for both the in vitro experiments (Figure 6.3 and 6.4).
6.3.2. Effect of the root and stem extracts of Fumaria parviflora on J2s (%) Results revealed that the viability of J2s of M. incognita significantly influenced (P < 0.05) over time by the concentration of the root and stem extracts of the plant throughout the experiment (Figure 6.5 and 6.6). All the solvent extracts from the root and stem at 3.12, 6.24, 12.5, 25.0 and 50.0 mg mL-1 concentrations had significant effects on J2s mortality with respect to the control (Figure 6.5 and 6.6). However, between some concentration differences were not found by LSD test. Percentage mortality was similar within all the extracts and was independent of the root or stem (Figure 6.5 and 6.6). The
EtOAC and CHCl3 extracts from the roots and stem significantly increased the J2s mortality at all concentrations with the 50.0 mg mL-1 as the most effective. Results revealed that the exposure period and increase in concentrations of the root and stem extracts increased the J2s mortality. Stem and root extracts have a similar graph pattern and effect on J2s mortality. Similar results were recorded for both in vitro experiments.
124
Figure 6.3. Cumulative hatch inhibition of Meloidogyne incognita over 72 h incubation at 27 ºC in a series of concentrations (expressed in mg mL-1) of the root extracts from Fumaria parviflora. Each point represents the average of two experiments with four replicates. AUCPHI of curves from each treatment combination followed by the same lower case (first experiment) or upper- case letters (second experiment), do not differ (P > 0.05) according to Fisher’s protected LSD test. A: n-hexane, B: EtOAC, C: CHCl3 D: MeOH extracts from the root of F. parviflora.
125
Figure 6.4. Cumulative hatch inhibition of Meloidogyne incognita over 72 h incubation at 27 ºC in a series of concentrations (expressed in mg mL-1) of the stem extracts from Fumaria parviflora. Each point represents the average of two experiments with four replicates. AUCPHI of curves from each treatment combination followed by the same lower case (first experiment) or upper- case letters (second experiment), do not differ (P > 0.05) according to Fisher’s protected LSD test. A: n-hexane, B: EtOAC, C: CHCl3, D: MeOH extracts from the stem of F. parviflora.
126
Figure 6.5. Cumulative mortality of Meloidogyne incognita over 72 h incubation at 27 ºC in a series of concentrations (expressed in mg mL-1) of the root extracts from Fumaria parviflora. Each point represents the average of two experiments with four replicates. AUCPM of curves from each treatment combination followed by the same lower case (first experiment) or upper- case letters (second experiment), do not differ (P > 0.05) according to Fisher’s protected LSD test. A: n-hexane, B: EtOAC, C: CHCl3 and D: MeOH extracts from the roots of F. parviflora.
127
Figure 6.6. Cumulative mortality of Meloidogyne incognita over 72 h incubation at 27 ºC in a series of concentrations (expressed in mg mL-1) of the root extracts from Fumaria parviflora. Each point represents the average of two experiments with four replicates. AUCPM of curves from each treatment combination followed by the same lower case (first experiment) or upper- case letters (second experiment), do not differ (P > 0.05) according to Fisher’s protected LSD test. A: n-hexane, B: EtOAC, C: CHCl3 and D: MeOH extracts from the stem of F. parviflora.
128
The area under cumulative percentage mortality (AUCPM) and hatch inhibition (AUCPHI) significantly (P < 0.05) increased at an increasing concentrations when four roots and stem extracts were applied. The AUCPM was the highest for n-hexane extracts followed by MeOH extracts of root and stem in both experiments (Table 6.1 and 6.2).
AUCPM was significant for EtOAC and CHCl3 extracts and were increased at an increasing concentration. Similar results were obtained for the stem extracts in both experiments. Conversely, the AUCPHI was the highest for MeOH extracts of the root extracts during spring and fall, 2010 experiments. The AUCPHI was the highest for CHCl3 extracts of the stem in the spring, 2010 whereas in the fall, 2010 it was slightly lower than MeOH extracts of the stem. Results were similar for both the experiments (Table 6.1 and 6.2).
6.4. In vitro effect of the root n-hexane fractions of Fumaria parviflora on hatch inhibition (%) and J2s mortality (%) of Meloidogyne incognita Results showed that all the root n-hexane fractions significantly (R2 = 0.66) increased the hatch inhibition (%) (Figure 6.7). The highest hatch inhibition (77.94 %) was achieved with fraction F3 which gave 4.0 % increase in hatch inhibition over positive control (Carbofuran). F11 inhibited 72.25 % eggs of M. incognita whereas the fractions F6 (64.38%) and F7 (64.13 %) were statistically at par. Conversely, the negative control treatments with distilled water showed 6.75 % hatch inhibition. Results revealed that all the four concentrations (100, 200, 300 and 400 µg mL-1) significantly increased the hatch inhibition with the highest concentration (400 µg mL-1) as the most effective (R2 = 0.99) (Figure 6.8). The interaction between fractions and concentration was highly significant. The fraction F3 showed 98.75% hatch inhibiton at 400 μg mL-1 and gave a 6.18% increase in hatch inhibition over the standard Carbofuran (Figure 6.9). The fractions F4 and F11 ranked second and showed 90.25% hatch inhibition at the highest concentration (Figure 6.9).
129
Table 6.1. Area under cumulative percentage mortality (AUCPM) and hatch inhibition (AUCPHI) of Meloidogyne incognita over 72 h incubation at 27 oC in a series of concentrations (expressed in mg mL-1) of the root extracts of Fumaria parvifloraa.
AUCPM AUCPM AUCPHI AUCPHI Root Concentrations Spring, Fall, 2010 Spring, 2010 Fall, 2010 Extractsb (mg mL-1) 2010 n-Hexane H2O 023.38 e 025.00 e 031.00 e 023.50 e 3.12 253.13 d 191.63 d 237.25 d 179.88 d 6.24 288.13 c 214.63 cd 267.63 c 211.12 c 12.5 319.50 b 240.50 bc 286.13 bc 244.75 b 25.0 338.88 a 261.50 ab 300.50 ab 275.88 a 50.0 350.00 a 283.00 a 313.50 a 298.25 a LSD value at P > 0.05 18.43 38.41 18.59 25.75
EtOAC H2O 023.38 e 025.00 e 031.00 c 023.50 e 3.12 187.88 d 153.25 d 150.63 b 138.00 d 6.24 239.37 c 174.75 cd 193.00 ab 166.88 cd 12.5 260.00 bc 205.63 bc 218.00 ab 198.38 bc 25.0 276.75 ab 228.75 bc 246.00 a 228.12 ab 50.0 285.13 a 250.75 a 255.00 as 255.25 a LSD value at P > 0.05 21.72 40.43 70.11 34.10
CHCl3 H2O 023.38 e 025.00 d 031.00 d 023.50 3.12 219.88 d 198.25 c 213.75 c 163.50 c 6.24 255.00 c 215.63 bc 247.87 b 200.50 bc 12.5 259.13 bc 235.87 ab 253.75 b 234.37 ab 25.0 278.38 ab 246.75 ab 276.13 ab 253.50 ab 50.0 290.50 a 258.50 a 286.75 a 272.63 a LSD value at P > 0.05 21.75 34.96 30.94 59.59
MeOH H2O 023.38 e 025.00 b 031.00 e 023.00 e 3.12 272.63 d 224.25 a 252.75 d 224.25 d 6.24 286.88 cd 227.13 a 282.75 c 256.63 c 12.5 304.00 bc 245.00 a 310.63 b 279.12 b 25.0 318.38 ab 259.38 a 319.63 ab 295.38 ab 50.0 335.00 a 274.13 a 332.75 a 310.25 a LSD value at P > 0.05 27.98 85.77 15.55 16.44
aData are mean of 5 replications per treatment recorded on AUCPM and AUCPHI during spring and fall, 2010. bSolvent used in the extraction.
*Means followed by the same letters do not differ significantly (P > 0.05) according to Fisher’s protected LSD test within each extract.
130
Table 6.2. Area under cumulative percentage mortality (AUCPM) and hatch inhibition (AUCPHI) of Meloidogyne incognita over 72 h incubation at 27 oC in a series of concentrations (expressed in mg mL-1) of the stem extracts from Fumaria parvifloraa.
Root Concentrations AUCPM AUCPM AUCPHI AUCPHI Extractsb (mg mL-1) Spring, 2010 Fall, 2010 Spring, 2010 Fall, 2010 n-Hexane H2O 022.63 e 024.13 d 031.00 e 031.25 e 3.12 223.25 d 169.63 c 187.88 d 168.75 d 6.24 259.63 c 192.50 c 239.37 c 197.38 c 12.5 293.63 b 229.12 b 260.00 bc 241.88 b 25.0 310.50 b 254.12 ab 276.75 ab 257.88 b 50.0 333.0 a 279.38 a 285.13 a 285.25 a LSD value at P > 0.05 16.93 36.46 21.69 24.27
EtOAC H2O 022.63 d 024.13 e 031.00 e 031.25 e 3.12 208.38 c 128.38 d 219.88 d 149.38 d 6.24 221.25 c 152.63 cd 255.00 c 181.00 cd 12.5 233.50 bc 185.00 bc 259.13 bc 211.75 bc 25.0 260.63 ab 205.50 ab 278.38 ab 237.50 ab 50.0 282.63 a 230.75 a 290.50 a 268.13 a LSD value at P > 0.05 35.58 32.72 21.72 31.94
CHCl3 H2O 022.63 d 024.13 e 031.00 e 031.25 e 3.12 228.25 c 163.13 d 253.13 d 162.88 d 6.24 242.00 bc 192.50 cd 288.13 c 194.38 cd 12.5 250.75 abc 219.87 bc 319.50 b 224.00 bc 25.0 270.13 ab 246.88 ab 338.88 a 251.02 ab 50.0 282.50 a 263.00 a 350.00 a 277.88 a LSD value at P > 0.05 33.08 31.89 18.40 38.40
MeOH H2O 022.63 e 024.13 c 031.00 e 031.25 e 3.12 232.88 d 182.25 b 272.63 d 185.88 d 6.24 254.63 cd 197.88 b 286.88 cd 209.88 d 12.5 376.50 bc 234.38 ab 304.00 bc 238.63 c 25.0 295.38 ab 255.50 a 318.38 ab 266.25 b 50.0 316.13 a 272.00 a 335.00 a 294.13 a LSD value at P > 0.05 23.13 55.85 27.96 27.09 aData are mean of 5 replications per treatment recorded on AUCPM and AUCPHI during spring and fall, 2010. bSolvent used in the extraction.
*Means followed by the same letters do not differ significantly (P > 0.05) according to Fisher’s protected LSD test within each extract.
131
Figure 6.7. In vitro effect of the root n-hexane fractions of Fumaria parviflora on egg hatching inhibition (%) of Meloidogyne incognita.
Figure 6.8. In vitro effect of the root n-hexane fractions at four different concentrations on egg hatch inhibition (%) of Meloidogyne incognita.
132
Figure 6.9. In vitro interaction effect between root n-hexane fractions and four different concentrations on egg hatch inhibition (%) of Meloidogyne incognita.
Figure 6.10. In vitro effect of root n-hexane fractions of Fumaria parviflora on J2s mortality (%) of Meloidogyne incognita.
133
It is evident from the Figures 6.10 and 6.11 that differences among n-hexane root fractions and their concentrations significantly (R2 = 0.66 and 0.99; P < 0.05) increased the J2s mortality. Comparison of treatment means reflect that the highest J2s mortality was achieved with the fraction F3 (72.81 %) after positive control (carbofuran). Fraction F4 killed J2s (68.94 %) followed by F11 (66.63 %) and F9 (64.00 %) whereas F2, F6 and F7 were statically at par (Figure 6.10). Likewise F8 (62.38 %) and F10 (61.88 %) showed an equivocal effect on J2s mortality. J2s mortality was the lowest in distilled water treatment (7.37 %). Figure 6.11 revealed that all the concentration significantly (R2 = 0.99) killed J2s of M. incognita. There was linear relationship between the concentrations of the root n- hexane fractions and J2s mortality. The interaction between the fractions and four concentrations positively influenced juvenile mortality. The highest mortality (95.0%) was shown by F3 followed by F11 (88.25%) and F4 (86.0%) (Figure 6.12). The former fraction increased the mortality by 2.98% over the standard carbofuran at 400 μg mL-1 (Figure 6.12).
6.5. In vitro effect of the methanol fractions of the roots of Fumaria parviflora on egg hatch inhibition (%) and J2s mortality (%) of Meloidogyne incognita Data in Figures 6.13 and 6.14 revealed that the MeOH fractions of the roots and their concentrations significantly (R2 = 0.66 and 0.99) inhibited the eggs of M. incognita from hatching. The fraction FM2.1 inhibited the highest number of eggs (79.06 %) from hatching and showed 6.65 % increase in hatch inhibition over the standard (carbofuran). The egg hatch inhibition by FM2.6 was 74.00 % whereas FM2.5 (68.88 %), FM2.2 (65.69 %) and FM2.3 (63.06 %) showed significant effect on hatch inhibition. FM2.4 (50.75 %) FM2.7 (54.56 %) and FM3 (57.13 %) increased the hatch inhibition over the control (distilled water) (13.13 %). Figure 6.14 revealed that the four concentrations showed a linear significant effect on hatch inhibition with the highest concentration (400 µg mL-1) as the most effective. Figure 6.15 showed significant interaction between methanol root fractions and four concentrations. The hatch inhibition was the highest of 99.75 % by FM2.1, followed by FM2.6 ((2.25 %) at the highest concentration of 400 µg mL-1 as compared to the standard Carbofuran (91.25 %) and distilled water (7.50 %) (Figure 6.15).
134
Figure 6.11. In vitro effect of root n-hexane fractions at four different concentrations on J2s mortality (%) of Meloidogyne incognita.
Figure 6.12. In vitro interaction effect between root n-hexane fractions and four different concentrations on J2s mortality (%) of Meloidogyne incognita.
135
Figure 6.13. In vitro effect of the MeOH fractions of the roots of Fumaria parviflora on egg hatching inhibition (%) of Meloidogyne incognita.
Figure 6.14. In vitro effect of MeOH fractions of the roots at four different concentrations on egg hatch inhibition (%) of Meloidogyne incognita.
136
Figure 6.15. In vitro interaction effect between MeOH fractions of the roots of Fumaria parviflora and four concentrations on egg hatching inhibition (%) of Meloidogyne incognita.
Figure 6.16. In vitro effect of the MeOH fractions of the roots of Fumaria parviflora on J2s mortality (%) of Meloidogyne incognita.
137
Data pertaining to Figures 6.16 and 6.17 show that the MeOH fractions of the roots and their four concentrations showed significant (R2 = 0.76 and 0.99) effect on J2s mortality of M. incognita. J2s mortality was the highest (81.63 %) with the fraction FM2.1 and showed 1.0 % increase over the standard (carbofuran) (80.81 %) M2 inhibited 73.56 % eggs of M. incognita whereas FM2.2 (62.94 %), FM2.3 (65.56 %) and FM2.5 (66.88 %) although showed an effect on hatch inhibition, however, showed no significant differences among their means. Likewise, FM2.4 (49.19 %) and FM2.7 (49.81 %) were statistically at par (Figure 6.16). Figure 6.17 shows that J2s mortality was increased linearly when the concentration was increased from 100 to 400 µg mL-1. The interaction between root fractions of methanol and the four concentrations was highly significant (P < 0.05) as shown in the Figure (6.17). The fractions FM2.1 and FM2.6 revealed the highest mortality of 100 and 91.25 % when exposed to a concentration of 400 µg mL-1 as compared Carbofuran (99.50 %) and distilled water (13.25 %) (Figure 6.18).
138
Figure 6.17. In vitro effect of the MeOH fractions of roots at four different concentrations on J2s (%) of Meloidogyne incognita.
Figure 6.18. In vitro interaction effect between MeOH fractions of the roots of Fumaria parviflora and four concentrations on J2s mortality (%) of Meloidogyne incognita.
139
VII. RESULTS OF SCREEN HOUSE AND FIELD STUDIES
7.1. Screen house studies using the root extracts of Fumaria parviflora during the spring and fall, 2010. 7.1.1. Effect of the root extracts of Fumaria parviflora on galls plant-1 Organic extracts from roots of F. parviflora applied at three different concentrations viz. 1000, 2000 and 3000 ppm showed significant differences (P < 0.05) among all the treatments in comparison to the H2O treatment (Table 7.1.1). The four root extracts at all concentrations significantly (P < 0.05) influenced number of galls plant-1 during the spring and fall, 2010. The n-hexane extract of the roots showed the strongest nematicidal effects and reduced the galls plant-1 by 59.44 and 71.03% over untreated control during spring and fall, 2010 respectively at the highest concentration
(3000 ppm), followed by MeOH, EtOAC and CHCl3 (Table 7.1.1). Comparison between different solvent extracts at the same concentrations of 1000, 2000 and 3000 ppm showed significant (P < 0.05) differences in the number of galls plant-1, recorded during both growing seasons (Table 7.1.1).
7.1.2. Effect of the root extracts of Fumaria parviflora on the galling index (GI) Data in Table 7.1.2 revealed that the root extracts and their different concentrations (viz., 1000, 2000 and 3000 ppm) showed significant differences (P < 0.05) among all the treatments. GI was significantly (P < 0.05) reduced during spring and fall, 2010 experiments. GI was the lowest (1.3 and 1.4) for n-hexane extract followed by MeOH (1.6 and 1.7) at 3000 ppm concentration, applied during the spring and fall, 2010 growing seasons, respectively. The CHCl3 extract reduced the GI by
60.0% over the control (H2O) followed by EtOAC extract (48.0%) at the highest concentration during the spring. Similar results were obtained for the fall, 2010 growing season. Comparisons between different solvent extracts at the same concentration showed differences between them in the GI for both growing seasons (Table 7.1.2).
140
Table 7.1.1 Effect of oot extracts of Fumaria parviflora on galls plant-1 and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditionsa.
Organic solvent ppmb Spring, 2010 Fall, 2010 extracts No. of galls % Decrease No. of galls % Decrease Plant-1 over control Plant-1 over control
* * n-hexane H2O 108.00 a (--) 100.80 a (--) 1000 66.20 bC 38.70 58.60 bC 41.86 2000 58.20 bD 46.11 50.80 cD 49.60 3000 43.80 cC 59.44 29.20 dC 71.03 LSD value at P < 0.05 8.76 (--) 4.8 (--)
EtOAC H2O 108.00 a (--) 100.80 a (--) 1000 85.60 bAB 20.74 79.60 bAB 21.03 2000 75.40 cB 30.18 71.00 cB 25.56 3000 69.60 cA 35.55 62.40 dA 38.09 LSD value at P < 0.05 7.20 (--) 7.0 (--)
CHCl3 H2O 108.00 a (--) 100.80 a (--) 1000 90.80 bA 15.92 86.60 bA 16.39 2000 84.60 bA 21.66 80.00 cA 20.63 3000 73.20 cA 32.22 68.20 dA 32.34 LSD value at P < 0.05 7.80 (--) 5.6 (--)
MeOH H2O 108.00 a (--) 100.80 a (--) 1000 78.40 bB 27.40 73.40 bB 27.18 2000 67.00 cC 37.96 64.40 cC 36.11 3000 55.20 dB 48.88 51.00 dB 49.40 LSD value at P < 0.05 7.52 (--) 4.6 (--)
aData are the mean of 5 replicated plants per treatment recorded during the spring and fall, 2010. b H2O was mixed with DMSO (1%; v/v).
*Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to the Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among roots extracts.
141
Table 7.1.2. Effect of root extracts of Fumaria parviflora on the galling index (GI) and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditionsa.
Organic solvent ppmb Spring, 2010 Fall, 2010 extracts Galling % Decrease Galling % Decrease index (GI)c over control index (GI)c over control * * n-hexane H2O 5.0a (--) 5.0 a (--) 1000 2.5bC 50.0 2.3 bB 54.0 2000 2.3bB 54.0 2.1 bcC 58.0 3000 1.3cC 74.0 1.4 cC 72.0 LSD value at P < 0.05 0.06 (--) 0.03 (--)
EtOAC H2O 5.0 a (--) 5.0 a (--) 1000 3.5 bA 30.0 3.5 bA 30.0 2000 3.2 bA 36.0 3.1 bA 38.0 3000 2.6 cA 48.0 2.5 cA 50.0 LSD value at P < 0.05 0.05 (--) 0.04 (--)
CHCl3 H2O 5.0 a (--) 5.0 a (--) 1000 3.4 bAB 32.0 3.6 bA 28.0 2000 2.7 bAB 46.0 2.8 cAB 44.0 3000 2.0 dAB 60.0 2.1 dAB 58.0 LSD value at P < 0.05 0.10 (--) 0.08 (--)
MeOH H2O 5.0 a (--) 5.0 a (--) 1000 2.9 bBC 42.0 3.1 bAB 38.0 2000 2.4 bB 52.0 2.40 cBC 52.0 3000 1.6 cBC 68.0 1.7 dBC 66.0 LSD value at P < 0.05 0.09 (--) 0.04 (--)
aData are the mean of 5 replicated plants per treatment recorded during the spring and fall, 2010. b H2O was mixed with DMSO (1%; v/v). c Galling index data was transformed into log10 (X + 1) before analysis.
*Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to the Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among roots extracts.
142
7.1.3. Effect of the root extracts of Fumaria parviflora on of egg masses g-1 of tomato roots Data in Table 7.1.3 showed significant differences (P < 0.05) among all the treatments in comparison to the control (H2O) when the four roots extracts were applied at three different concentrations (viz., 1000, 2000 and 3000 ppm) in the spring and fall, 2010. The number of egg masses g-1 of tomato roots were significantly (P < 0.05) reduced by 85.54, 71.08 and 53.01% when n-hexane extracts at 1000, 2000 and 3000 ppm concentrations, respectively were applied. The MeOH performed as the second best nematicidal extract and reduced the egg masses g-1 by 72.04% at the highest concentration, followed by EtOAC and CHCl3 in the spring 2010 growing season. Similar results were achieved for n-hexane and MeOH extracts during fall, 2010 trial, whereas the CHCl3 extracts performed slightly better than the EtOAC extracts at all the tested concentrations (Table 7.1.3). Comparisons between different roots extracts at the same concentration showed significant (P < 0.05) differences between them in the egg masses g-1 for both growing seasons (Table 7.1.3).
7.1.4. Effect of the root extracts of Fumaria parviflora on females g-1 of tomato roots It is evident from data (Table 7.1.4) that differences among all the four root extracts from F. parviflora and their concentrations were significant (P < 0.05) among -1 all the treatments in comparison to the H2O. Number of females g of roots were reduced by 72.96 and 68.14% by n-hexane extracts at 3000 ppm concentration followed by MeOH extracts which reduced the females in one gram of root tissues by 51.42 and
63.71% during the spring and fall, 2010, respectively. The EtOAC and CHCl3 extracts reduced the females significantly (P < 0.05) at all the tested concentrations of the four root extracts during both growing seasons. Comparisons between different organic extracts at the same concentration of 1000, 2000 and 3000 ppm showed significant differences (P < 0.05) between them in the females g-1 of roots recorded in both growing seasons (Table 7.1.4).
143
Table 7.1.3. Effect of root extracts of Fumaria parviflora on egg masses g-1 of root and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditionsa.
Organic extracts ppmb Spring, 2010 Fall, 2010 Egg masses % Decrease Egg masses % Decrease g-1 of roots over control g-1 of roots over control * * n-hexane H2O 83.00 a (--) 84.00 a (--) 1000 39.00 bA 53.01 43.20 bB 48.57 2000 24.80 cB 71.08 29.80 cB 64.52 3000 12.00 dC 85.54 17.40 dA 79.28 LSD value at P < 0.05 9.6 (--) 8.4 (--)
EtOAC H2O 83.00 a (--) 84.00 a (--) 1000 44.80 bA 46.98 57.00 bA 32.14 2000 45.40 bA 45.30 47.80 cA 43.09 3000 37.20 bA 55.18 39.80 cA 52.61 LSD value at P < 0.05 7.3 (--) 8.3 (--)
CHCl3 H2O 83.00 a (--) 84.00 a (--) 1000 54.80 bA 33.97 54.60 bA 35.00 2000 47.00 bcA 43.37 46.80 bA 45.23 3000 39.20 cA 52.77 32.20 cA 61.66 LSD value at P < 0.05 9.6 (--) 13.9 (--)
MeOH H2O 83.00 a (--) 84.00 a (--) 1000 50.40 bA 39.27 54.00 bA 35.71 2000 43.60 bA 47.46 45.20 cA 46.19 3000 23.20 cB 72.04 28.60 dAB 65.95 LSD value at P < 0.05 10.5 (--) 8.2 (--)
aData are the mean of 5 replicated plants per treatment recorded during the spring and fall, 2010. b H2O was mixed with DMSO (1%; v/v).
*Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to the Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among the roots extracts.
144
Table 7.1.4. Effect of root extracts of Fumaria parviflora on females g-1 of tomato roots and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditionsa.
Organic solvent ppmb Spring, 2010 Fall, 2010 extracts No. of % Decrease No. of females % Decrease females g-1 over control g-1 of roots over control of roots * * n-hexane H2O 91.00 a (--) 94.80 a (--) 1000 53.40 bC 41.31 52.80 bB 44.30 2000 42.40 cC 53.40 40.80 cC 56.96 3000 24.60 dC 72.96 30.20 dB 68.14 LSD value at P < 0.05 7.2 (--) 5.4 (--)
EtOAC H2O 91.00 a (--) 94.80 a (--) 1000 71.00 bA 21.97 70.60 bA 25.52 2000 56.60 cB 37.80 61.40 bcAB 35.23 3000 51.60 cA 43.19 51.20 cA 45.99 LSD value at P < 0.05 8.3 (--) 12.1 (--)
CHCl3 H2O 91.00 a (--) 94.80 a (--) 1000 74.60 bA 18.02 74.60 bA 21.30 2000 66.00 cA 27.47 64.60 cA 31.85 3000 54.00 dA 40.65 52.00 dA 45.14 LSD value at P < 0.05 6.2 (--) 7.3 (--)
MeOH H2O 91.00 a (--) 94.80 a (--) 1000 61.40 bB 32.52 60.00 bB 36.70 2000 58.00 bB 36.26 53.00 bB 44.09 3000 44.20 cB 51.42 34.40 cB 63.71 LSD value at P < 0.05 6.6 (--) 12.7 (--)
aData are the mean of 5 replicated plants per treatment recorded during spring and fall, 2010. b H2O was mixed with DMSO (1%; v/v).
*Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to the Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among the roots extracts.
145
7.1.5. Effect of root extracts of Fumaria parviflora on eggs g-1 of tomato roots Figures 7.1.1 and 7.1.2 revealed that all the four root extracts and their concentrations had significant (P < 0.05) effect on eggs g-1 of tomato roots during the spring and fall, 2010. Figure 7.1.1 revealed that maximum reduction in eggs g-1 of roots was recorded when n-hexane extracts were applied at 3000 (1020.0), 2000 (1100.0) and 1000 ppm (1260.0) concentration, respectively, followed by MeOH at all the tested concentrations during the spring, 2010. The EtOAC and CHCl3 extracts were statistically at par, however both root extracts showed significant (P < 0.05) reduction in -1 egg g of roots in comparison to H2O (12800.0) (Figure 7.1.1). Similar results were recorded for all the four roots extracts when applied at three concentrations in the fall, 2010 (Figure 7.1.2). Comparisons between different roots extracts at the same concentration (1000, 2000 and 3000 ppm) showed significant differences between them in the eggs g-1 of tomato roots for both growing seasons (Figures 7.1.1 and 7.1.2).
7.1.6. Effect of the root extracts of Fumaria parviflora on fresh shoot weight (g) of tomato Statistical analysis revealed that all the four root extracts and their concentrations had significant (P < 0.05) effect on fresh shoot weight of tomato (Table 7.1.5). The fresh shoot weight of tomato was significantly increased (P < 0.05) when n- hexane, MeOH, EtOAC and CHCl3 extracts were applied at 1000, 2000 and 3000 ppm, respectively during both growing seasons (Table 7.1.5). The shoot weight of tomato was increased by 65.40 and 74.21% at 3000 ppm application of n-Hexane extracts in comparison to H2O during the spring and falls growing seasons, respectively. The MeOH extract was the second best at all the tested concentrations whereas the EtOAC and CHCl3 extracts, although statistically at par, increased the shoot weight over the control during the spring 2010 (26.41 and 32.70) and fall, 2010 (30.81 and 34.59), respectively (Table 7.1.5). Comparison between different extracts at the same concentration showed significant differences between them fresh shoot weight at 3000 ppm concentration, in both growing seasons of 2010 (Table 7.1.5).
146
Figure 7.1.1. Effect of root extracts of Fumaria parviflora on eggs g-1 of roots and the nematicidale ffect on Meloidogyne incognita in tomato under screen house conditions of the spring, 2010 (LSD values: n-hexane, EtOAC, CHCl3 = 873.03 and MeOH = 843.18).
Figure 7.1.2. Effect of root extracts of Fumaria parviflora on eggs g-1 of roots and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of the fall, 2010 (LSD values: n-hexane = 950.16; EtOAC = 939.0; CHCl3 = 947.0; MeOH = 984.5).
Data shown in figures 7.1.1 and 7.1.2 are mean of 5 replicated plants per treatment recorded during spring and fall, 2010. Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to the Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among the roots extract.
147
Table 7.1.5. Effect of root extracts of Fumaria parviflora on fresh shoot weight and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditionsa.
Organic extracts ppmb Spring, 2010 Fall, 2010 Fresh shoot % Increase Fresh shoot % Decrease weight over control weight over (g) (g) control * * n-hexane H2O 31.80 c (--) 31.80 c (--) 1000 40.40 bA 27.04 40.60 bA 27.67 2000 48.00 aA 50.94 49.00 aA 54.08 3000 52.60 aA 65.40 55.40 aA 74.21 LSD value at P < 0.05 4.5 (--) 6.4 (--)
EtOAC H2O 31.80 b (--) 31.80 c (--) 1000 37.60 aA 18.23 36.20 bcA 13.83 2000 40.20 aB 26.41 41.00 abB 28.93 3000 40.20 aB 26.41 41.60 aB 30.81 LSD value at P < 0.05 2.5 (--) 5.2 (--)
CHCl3 H2O 31.80 c (--) 31.80 c (--) 1000 35.60 bA 11.94 35.80 bA 12.57 2000 40.00 aB 25.78 40.40 aB 27.04 3000 42.20 aB 32.70 42.80 aB 34.59 LSD value at P < 0.05 2.9 (--) 3.4 (--)
MeOH H2O 31.80 c (--) 31.80 c (--) 1000 38.00 bA 19.49 39.00 bA 22.64 2000 45.80 aAB 44.02 45.60 aAB 43.39 3000 46.60 aAB 46.54 47.60 aB 49.68 LSD value at P < 0.05 6.1 (--) 5.3 (--)
aData are the mean of 5 replicated plants per treatment recorded during the spring and fall, 2010. b H2O was mixed with DMSO (1%; v/v).
*Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to the Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among the roots extracts.
148
7.1.7. Effect of the root extracts of Fumaria parviflora on dry shoot weight of tomato (g) It is evident from the figures 7.1.3 and 7.1.4 that all the four roots extracts and their concentrations significantly (P < 0.05) increased the dry shoot weight of tomato. Dry shoot weight was increased by 209.09, 140.90 and 143.18 % at 3000, 2000 and 1000 ppm concentrations, respectively in the spring, 2010 and 174.0, 122.0 and 118.0% at 3000, 2000 and 1000 ppm concentrations, respectively in the fall 2010. The MeOH extracts increased the dry weights (18.40 and 20.40), followed by EtOAC (18.20 and
18.60) and CHCl3 (16.00 and 17.00) over untreated control (8.80 and 10.00) in the spring and fall, 2010 growing seasons. Comparisons between different organic extracts at the same concentration showed significant differences (P < 0.05) for n-hexane extracts whereas differences in the same concentrations among other roots extracts were statistically at par when recorded in both growing seasons (Figures 7.1.3 and 7.1.4).
7.1.8. Effect of the root extracts of Fumaria parviflora on fresh root weight of tomato (g) Statistical analysis of data in table 7.1.6 showed significant differences (P < 0.05) among all the four roots extracts of F. parviflora and their concentrations on the fresh root weight. Fresh root weight was the highest in the control treatments (29.00) than the treatments where the roots extracts were applied (Table 7.1.6). Fresh root weight was 15.20, 22.0 and 25.20 in the treatments where n-hexane was applied at 3000, 2000 and 1000 ppm, respectively during the spring 2010. The MeOH, EtOAC and CHCl3 extracts showed reduction in fresh root weight at all the tested concentrations in comparison to H2O. Differences among similar concentrations for all the four roots extracts were significantly different (P < 0.05). Results were similar for the spring and fall, 2010 trials (Table 7.1.6).
149
Figure 7.1.3. Effect of root extracts of Fumaria parviflora on dry shoot weight and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of the spring, 2010. (LSD value: n-hexane = 3.8; EtOAC = 2.3; CHCl3 and MeOH = 3.1).
Figure 7.1.4. Effect of root extracts of Fumaria parviflora on dry shoot weight and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of the fall, 2010 (LSD value: n-hexane = 4.1; EtOAC = 2.0; CHCl3 and MeOH = 3.1).
Data shown in figures 7.1.3 and 7.1.4 are mean of 5 replicated plants per treatment recorded during spring and fall, 2010. Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to the Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among the roots extracts.
150
Table 7.1.6. Effect of root extracts of Fumaria parviflora on fresh root weight and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditionsa.
Organic solvent ppmb Spring, 2010 Fall, 2010 extracts Fresh root % Decrease Fresh root % Decrease weight (g) over control weight (g) over control * * n-hexane H2O 29.00 a (--) 29.00 a (--) 1000 25.20 bA 15.07 25.40 bB 12.41 2000 22.0 bB 24.13 21.80 cB 24.82 3000 15.20 cB 47.58 14.60 dB 49.65 LSD value at P < 0.05 3.5 (--) 3.1 (--)
EtOAC H2O 29.00 a (--) 29.00 a (--) 1000 26.60 aA 8.27 26.60 abAB 8.27 2000 23.80 bB 17.93 23.20 bcAB 20.0 3000 23.40 bA 19.31 22.00 cA 24.13 LSD value at P < 0.05 2.4 (--) 3.4 (--)
CHCl3 H2O 29.00 a (--) 29.00 a (--) 1000 27.00 bA 6.89 28.40 aA 2.06 2000 26.40 bA 10.34 25.20 bA 13.10 3000 23.00 cA 20.68 22.20 cA 23.44 LSD value at P < 0.05 1.8 (--) 2.9 (--)
MeOH H2O 29.00 a (--) 29.00 a (--) 1000 25.80 bA 11.03 25.20 bB 13.10 2000 24.00 bB 17.24 25.20 bA 13.10 3000 21.00 cA 27.58 20.60 cA 28.96 LSD value at P < 0.05 2.0 (--) 2.3 (--)
aData are the mean of 5 replicated plants per treatment recorded during the spring and fall, 2010. b H2O was mixed with DMSO (1%; v/v).
*Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to the Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among the roots extracts.
151
7.1.9. Effect of the root extracts of Fumaria parviflora on branches plant-1 of tomato Analysis of variance showed that the four roots extracts of F. parviflora and their concentrations had significant effect (P < 0.05) on mean number of branches plant- 1 (Figures 7.1.5 and 7.1.6). The highest number of branches plant-1 (27.20 and 26.20) was recorded in n-hexane treatments followed by MeOH (22.60 and 22.20) at 3000 ppm concentration during the spring and fall 2010, respectively. The CHCl3 and EtOAC extracts increased the number of branches at all the tested concentrations as compared to untreated control during spring (9.60) and fall (11.80) 2010, respectively. Comparisons between different roots extracts at the same concentration showed significant differences (P < 0.05) among them in number of branches plant-1 in both growing seasons (Figures 7.1.5 and 7.1.6).
7.1.10. Effect of the root extracts of Fumaria parviflora on plant height of tomato (cm) Analysis of data in the Figures 7.1.7 and 7.1.8 revealed that roots extracts and their concentrations showed significant (P < 0.05) variations for the trait under reference. The maximum plant height (56.80 cm) was achieved by n-hexane followed by MeOH (47.40 cm) at 3000 ppm concentration. The CHCl3 and EtOAC increased the plant height by 32.89 and 35.52 % over control (30.40 cm) at the highest concentration applied in the spring, 2010. Results were similar for the fall, 2010 trial. The n-hexane extract increased the plant height by 57.77 and 38.88 % at 3000 and 2000 ppm concentration followed by MeOH (30.00 cm) when applied at the same concentrations.
The CHCl3 and EtOAC extracts significantly increased the plant height over the untreated control (Figure 7.1.8).
7.1.11. Effect of the root extracts of Fumaria parviflora on nematode reproduction
factor (Rf) in tomato roots
Analysis of the data revealed that nematode reproduction factor (Rf) was significantly influenced by four root extracts at all the tested concentrations in the spring and fall, 2010 (Figure 7.1.9 and 7.1.10). The n-hexane extracts reduced nematode
Rf by 92.85, 92.26 and 90.47 %, respectively at 1000, 2000 and 3000 ppm
152
concentration, over the untreated control (3.36). The MeOH was the second most effective extract and reduced the Rf by 88.69 % followed by CHCl3 (86.01 %) and EtOAC (85.41 %) at 3000 ppm concentrations in the spring, 2010 (Figure 7.1.9). Results were similar for fall, 2010 experiment where the n-hexane and MeOH reduced the Rf by 90.94 and 86.06 %, respectively at the highest concentration of 3000 ppm.
The EtOAC and CHCl3 significantly reduced the Rf whereas the highest Rf value was recorded in the control treatment (2.87) during fall, 2010 (Figure 7.1.10). Comparisons between different extracts at the same concentration showed significant differences between them in the Rf values recorded in both growing seasons (Figures 7.1.9 and 7.1.10).
153
Figure 7.1.5. Effect of root extracts of Fumaria parviflora on branches plant-1 and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of spring, 2010 (LSD values: n-hexane = 4.2; EtOAC = 5.1; CHCl3 and MeOH = 4.0).
Figure 7.1.6. Effect of root extracts of Fumaria parviflora on branches plant-1 and nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of fall, 2010 (LSD values: n-hexane = 4.3; EtOAC = 4.7; CHCl3; 3.6; MeOH = 3.4).
Data shown in figures 7.1.5 and 7.1.6 are the mean of 5 replicated plants per treatment recorded during the spring and fall, 2010. Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to the Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among the roots extract.
154
Figure 7.1.7. Effect of root extracts of Fumaria parviflora on plant height and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of the spring, 2010 (LSD values : n-hexane = 6.4; EtOAC = 5.7; CHCl3 = 4.1; MeOH = 5.1).
Figure 7.1.8. Effect of root extracts of Fumaria parviflora on plant height and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of the fall, 2010 (LSD values: n-hexane = 4.9; EtOAC = 3.0; CHCl3 = 3.7; MeOH = 4.4).
Data shown in figures 7.1.7 and 7.1.8 are the mean of 5 replicated plants per treatment recorded during the spring and fall, 2010. Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among organic extract.
155
Figure 7.1.9. Effect of root extracts of Fumaria parviflora on reproduction factor (Rf) and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of the spring, 2010 (LSD values: n-hexane and EtOAC = 0.05; CHCl3 = 0.09; MeOH = 0.06).
Figure 7.1.10. Effect of root extracts of Fumaria parviflora on reproduction factor (Rf) and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of the fall, 2010 (LSD values: n-hexane = 0.03; EtOAC = 0.02; CHCl3 = 0.02; MeOH = 0.04).
Data shown in figures 7.1.9 and 7.1.10 are the mean of 5 replicated plants per treatment recorded during the spring and fall, 2010. Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to the Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among the roots extracts.
156
7.2. Screen house studies using Fumaria parviflora stem extracts during the spring and fall, 2010. 7.2.1. Effect of the stem extracts of Fumaria parviflora on galls plant-1 of tomato Results in table 7.2.1 revealed that all the stem extracts and their three concentrations (viz., 1000, 2000 and 3000 ppm) had significant (P < 0.05) effect on number of galls plant-1 during spring and fall, 2010. Compared with the untreated control (116.20), the n-hexane extracts of the stem showed the strongest nematicidal effects and reduced the galls plant-1 at 3000 (45.40), 2000 (58.60) and 1000 (67.20) ppm, respectively in the spring 2010 growing season. The MeOH was the second best in nematicidal effect and reduced the galls plant-1 by 51.80 (3000 ppm), 42.34 (2000 ppm) and 31.84% (1000 ppm) followed by EtOAC and CHCl3 extracts. In fall, 2010, all the extracts significantly reduced the galls plant-1 with the 3000 ppm as the most effective for n-hexane (55.60), MeOH (56.20), CHCl3 (64.60) and EtOAC (55.20). Maximum number of galls plant-1 (104.80) were recorded in the untreated control. Comparison between different organic extracts at the same concentrations (1000, 2000 and 3000 ppm) showed significant differences in number of galls plant-1, recorded in spring 2010 season only (Table 7.2.1).
7.2.2. Effect of stem extracts of Fumaria parviflora on galling index (GI) Figures 7.2.1 and 7.2.2 revealed that stem extracts and their different concentrations (viz., 1000, 2000 and 3000 ppm) showed significant (P < 0.05) reduction in GI during spring and fall, 2010 growing seasons. GI was the lowest (1.4) for n-
Hexane extract followed by MeOH (1.7) at the highest concentration, over H20 (5.0) when applied during spring, 2010 growing seasons, respectively. The CHCl3 and EtOAC extracts reduced the GI by 58.0 % and 44.0 % respectively (Figure 7.2.1). During fall, 2010 growing season, the application of all the stem extracts significantly reduced the GI at all the tested concentrations, with the highest concentration as the most effective for MeOH (64.0 %) followed by n-hexane (60.0 %) (Figure 7.2.2).
157
Table 7.2.1. Effect of stem extracts of Fumaria parviflora on galls and nematicidal effect on Meloidogyne incognita in tomato under screen house conditionsa.
Organic extracts ppmb Spring, 2010 Fall, 2010 No. of galls % Decrease No. of galls % Decrease over over control control * * n-Hexane H2O 116.20 a (--) 104.80 a (--) 1000 67.20 bC 42.16 74.40 bA 29.00 2000 58.60 cD 49.56 66.00 bcA 37.02 3000 45.40 dC 60.92 55.60 cA 46.94 LSD value at P < 0.05 7.7 (--) 12.9 (--)
EtOAC H2O 116.20 a (--) 104.80 a (--) 1000 86.00 bAB 25.98 82.00 bA 21.75 2000 75.60 cB 34.93 67.00 bcA 36.06 3000 70.20 cA 39.58 55.20 cA 47.32 LSD value at P < 0.05 6.8 (--) 16.3 (--)
CHCl3 H2O 116.20 a (--) 104.80 a (--) 1000 90.20 bC 22.37 79.80 bA 23.85 2000 84.60 bA 27.19 71.20 bcA 32.06 3000 72.60 cA 37.52 64.60 cA 38.35 LSD value at P < 0.05 6.4 (--) 11.4 (--)
MeOH H2O 116.20 a (--) 104.80 a (--) 1000 79.20 bB 31.84 79.00 bA 24.61 2000 67.00 cC 42.34 70.0 bA 33.20 3000 56.00 dB 51.80 56.20 cA 46.37 LSD value at P < 0.05 6.3 (--) 11.3 (--) aData are mean of 5 replicated plants per treatment recorded during spring and fall, 2010. b H2O was mixed with DMSO (1%; v/v).
*Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among organic extract.
158
Figure 7.2.1. Effect of stem extracts of Fumaria parviflora on galling index and nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of spring, 2010 (LSD values: n-hexane = 0.08; EtOAC = 0.04; CHCl3 and MeOH = 0.06).
Figure 7.2.2. Effect of stem extracts of Fumaria parviflora on galling index and nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of fall, 2010 (LSD values: n-hexane = 0.06; EtOAC = 0.07; CHCl3 = 0.09; MeOH = 0.08).
Data shown in figures 7.2.1 and 7.2.2 are mean of 5 replicated plants per treatment recorded during spring and fall, 2010. Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among organic extract.
159
The CHCl3 and EtOAC extracts reduced the GI at all concentration. Comparisons between different organic extracts at the same concentration showed non-significant differences between them in the GI for the fall growing seasons (Figure 7.2.2).
7.2.3. Effect of stem extracts of Fumaria parviflora on egg masses g-1 of tomato roots Figures 7.2.3 and 7.2.4 showed significant differences (P < 0.05) among all the four stem extracts and their concentrations in comparison to the H2O when evaluated during spring and fall, 2010. The number of egg masses g-1 of tomato roots were significantly (P < 0.05) reduced by 86.80, 69.47 and 53.53% when n-hexane extracts at 1000, 2000 and 3000 ppm concentrations, respectively were applied (Figure 7.2.3). The MeOH extracts reduced the egg masses at all concentrations with the highest concentration (3000 ppm) as the most effective (69.93%). The CHCl3 and EtOAC extracts were significantly (P < 0.05) different from control (87.80) at all the tested concentrations. Similar results were achieved for all the stem extracts at all the tested concentrations in the fall, 2010 (Figure 7.2.4). Comparisons between different stem extracts at the same concentration showed significant differences between them in the egg masses g-1 for spring growing season only (Figure 7.2.3).
7.2.4. Effect of stem extracts of Fumaria parviflora on females g-1 of tomato roots It is evident from data that differences among all the stem extracts of F. parviflora and their concentrations had significant (P < 0.05) effect on females g-1 of tomato roots in comparison to the control (Figures 7.2.5. and 7.2.6). Number of females g-1 of roots were reduced by 68.21 and 49.66% by n-hexane and MeOH extracts at 3000 ppm concentration followed by EtOAC (42.60%) and CHCl3 (39.29%), respectively
(Figure 7.2.5). The application of n-hexane, MeOH, CHCl3 and EtOAC extracts reduced the females to minimum of 44.40, 47.00, 44.00 and 47.80 at 3000 ppm concentration, respectively in the spring, 2010 (Figure 7.2.6).
160
Figure 7.2.3. Effect of stem extracts of Fumaria parviflora on egg masses g-1 of root nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of the spring, 2010 (LSD values: n-hexane = 9.1; EtOAC = 14.5; CHCl3 and MeOH = 10.2 and 10.1).
Figure 7.2.4. Effect of stem extracts of Fumaria parviflora on egg masses g-1 of root and nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of the fall, 2010 (LSD values: n-hexane = 10.5; EtOAC = 8.7; CHCl3 = 12.7; MeOH = 12.7).
Data shown in figures 7.2.3 and 7.2.4 are mean of 5 replicated plants per treatment recorded during spring and fall, 2010. Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among organic extract.
161
Comparisons between different stem extracts at the same concentration showed significant differences between them in the females g-1 of roots for the spring growing season (Figure 7.2.5). In fall, 2010, the application of all the stem extracts reduced the females by 37.69, 47.0, 47.89 and 51.2% by n-hexane, MeOH, EtOAC and CHCl3 over untreated control (90.20) at 3000 ppm concentration, respectively. However, comparison of treatment mean at the same concentration showed non-significant differences between them in females g-1 of roots for the fall growing season (Figure 7.2.6).
7.2.5. Effect of root extracts of Fumaria parviflora on eggs g-1 of tomato roots Analysis of data in the figures 7.2.7 and 7.2.8 revealed that all the four stem extracts and their concentrations had significant (P < 0.05) effect on eggs g-1 of tomato roots during spring and fall, 2010. Figure 7.2.7 revealed that maximum reduction in eggs g-1 of roots was 1300, 1180 and 2700 for n-hexane extracts when applied at 3000, 2000 and 1000 ppm, respectively is comparison to control (12400.0). The MeOH extracts was the second best in nematicidal activity and reduced the eggs g-1 of roots to a minimum of 1540.0 at the highest concentration, whereas CHCl3 and EtOAC reduced the eggs g-1 of roots to a minimum of 1920.0 and 2000.0 at 3000 ppm concentration, respectively in comparison to control (12400.0) (Figure 7.2.7). Similar results were recorded for all the four stem extracts, applied at three concentrations during fall, 2010 (Figure 7.2.8). Comparisons between different stem extracts at the same concentration showed significant differences between them in the eggs g-1 of tomato roots for the spring growing season only (Figures 7.2.7).
7.2.6. Effect of stem extracts of Fumaria parviflora on fresh shoot weight of tomato (g) Data pertaining to Figures 7.2.9 and 7.2.10 revealed that all the four stem extracts and their concentrations had significant (P < 0.05) effect on fresh shoot weight of tomato in both spring and fall, 2010.
162
Figure 7.2.5. Effect of stem extracts of Fumaria parviflora on females g-1 of root and nematicidal effect on Meloidogyne incognita in tomato under screen house conditions (LSD values: n-hexane = 7.7; EtOAC = 7.1; CHCl3 and MeOH = 5.2 and 5.6).
Figure 7.2.6. Effect of stem extracts of Fumaria parviflora on females g-1 of root and nematicidal effect on Meloidogyne incognita in tomato under screen house a conditions (LSD values: n-hexane = 9.5; EtOAC = 12.6; CHCl3 = 12.2 MeOH = 12.1).
Data shown in figures 7.2.5 and 7.2.6 are mean of 5 replicated plants per treatment recorded during spring and fall, 2010. Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among organic extract.
163
Figure 7.2.7. Effect of stem extracts of Fumaria parviflora on eggs g-1 of root and nematicidal effect on Meloidogyne incognita in tomato under screen house conditionsa (LSD values: n-hexane = 2672.0; EtOAC = 902.8; CHCl3 = 874.6; MeOH = 863.6).
Figure 7.2.8. Effect of stem extracts of Fumaria parviflora on eggs g-1 of root and nematicidal effect on Meloidogyne incognita in tomato under green house conditionsa (LSD values: n-hexane = 751.0; EtOAC = 751.0; CHCl3 = 4862.0; MeOH = 748.0).
Data shown in figures 7.2.7 and 7.2.8 are mean of 5 replicated plants per treatment recorded during spring and fall, 2010. Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among organic extract.
164
The fresh shoot weight of tomato were significantly increased (P < 0.05) when n-hexane
(51.20), MeOH (46.40), EtOAC (40.80) and CHCl3 (42.60) extracts were applied at the highest concentration of 3000 ppm in the spring, 2010 (Figure 7.2.9). In the fall, 2010, the application of all the stem extracts at all concentrations significantly increased the shoot weight with the highest increase for EtOAC (48.00) followed by n-hexane (44.20) in comparison to control (30.40) at 3000 ppm concentration, respectively (Figure 7.2.10). Comparison between different extracts at the same concentration showed significant differences between them in fresh shoot weight at 3000 ppm concentration for the spring, 2010 growing season only (Figure 7.2.9).
7.2.7. Effect of the stem extracts of Fumaria parviflora on dry shoot weight of tomato (g) It is evident from figures 7.2.11 and 7.2.12 that all the four stem extracts and their concentrations had significant (P < 0.05) effect on dry shoot weight of tomato. The dry shoot weight of tomato were significantly (P < 0.05) increased with the application of n-hexane (27.00), MeOH (18.20), EtOAC (18.20) and CHCl3 (15.40) extracts at the highest concentration of 3000 ppm in the spring growing season (Figure 7.2.11). Whereas the increase in dry shoot weight was 98.11, 90.56, 86.79 and 75.47% for the n- hexane, MeOH, EtOAC and CHCl3 extracts, respectively over the control (10.60) at the highest concentration of 3000 ppm evaluated in the fall, 2010 growing season (Figure 7.2.12). Comparisons between different stem extracts at the same concentration showed significant differences (P < 0.05) between them in dry shoot weights at all the concentrations among during spring growing season only (Figure 7.2.11).
7.2.8. Effect of the stem extracts of Fumaria parviflora on the fresh root weight of tomato (g) Statistical analysis of data in table 7.2.2 showed significant differences (P < 0.05) among all the stem extracts of F. parviflora and their concentrations on fresh root weight. Fresh root weight was the highest in the control treatments (29.00) whereas it was the lowest for n-hexane (13.00) followed by MeOH (20.40) at 3000 ppm concentration recorded in the spring, 2010 (Table 7.2.2).
165
Figure 7.2.9. Effect of stem extracts of Fumaria parviflora on fresh shoot weight and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of the spring, 2010 (LSD values: n-hexane = 5.5; EtOAC = 4.2; CHCl3 = 2.9; MeOH = 5.2).
Figure 7.2.10. Effect of stem extracts of Fumaria parviflora on fresh shoot weight and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of the fall, 2010 (LSD values: n-hexane = 3.7; EtOAC = 4.6; CHCl3 = 4.2; MeOH = 5.7).
Data shown in figures 7.2.9 and 7.2.10 are mean of 5 replicated plants per treatment recorded during spring and fall, 2010. Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among organic extract.
166
Figure 7.2.11. Effect of stem extracts of Fumaria parviflora on dry shoot weight and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of the spring, 2010 (LSD values: n- hexane = 4.7; EtOAC = 2.9; CHCl3 and MeOH = 3.1).
Figure 7.2.12. Effect of stem extracts of Fumaria parviflora on dry shoot weight and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditions of the fall, 2010 (LSD values: n- hexane = 6.4; EtOAC = 4.2; CHCl3 = 3.6 MeOH = 5.3).
Data shown in figures 7.2.11 and 7.2.12 are mean of 5 replicated plants per treatment recorded during spring and fall, 2010. Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among organic extract.
167
The EtOAC and CHCl3 significantly reduced the fresh root weight at all the tested concentration as compared to the control (29.00). Likewise, reduction in the fresh root weights were 18.20, 19.00, 18.60 and 22.80 for the n-hexane, MeOH, EtOAC and
CHCl3 extracts at 3000 ppm concentration, respectively, recorded in the fall, 2010 (Table 7.2.2). The control showed the highest (30.20) fresh root weight. Differences among similar concentrations for all the four stem extracts had significant (P < 0.05) effect on the parameter under study in the spring, 2010 trial only (Table 7.2.2).
7.2.9. Effect of the stem extracts of Fumaria parviflora on number of branches plant-1 of tomato Analysis of variance showed that all the four stem extracts of F. parviflora and their concentrations had significant effect (P < 0.05) on mean number of branches plant- 1 (Table 7.2.3) recorded in the spring and fall, 2010. The highest number of branches plant-1 (26.80) was recorded in the n-hexane treatment followed by MeOH (22.20) at
3000 ppm concentration during spring, 2010 (Table 7.2.3). The CHCl3 and EtOAC extracts increased the number of branches at all the tested concentrations as compared to untreated control (8.80). In the fall 2010, maximum increase in number of branches -1 plant were recorded in n-hexane (22.80) followed by CHCl3 (22.00) at the highest concentration of 3000 ppm. The control showed the minimum (10.20) number of branches plant-1. Comparisons between different organic extracts at the same concentration showed significant differences (P < 0.05) among them in number of branches plant-1 in the spring, 2010 growing season only (Table 7.2.3).
168
Table 7.2.2 Effect of stem extracts of Fumaria parviflora on fresh root weight and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditionsa.
Organic extracts ppmb Spring, 2010 Fall, 2010 Fresh root % Decrease Fresh root % Decrease weight (g) over control weight (g) over control * * n-hexane H2O 29.00 a (--) 30.20 a (--) 1000 23.60 bA 18.62 23.80 bA 21.19 2000 20.40 cB 29.65 20.00 bcA 33.77 3000 13.00 dB 55.17 18.20 cA 39.73 LSD value at P < 0.05 3.1 (--) 4.1 (--)
EtOAC H2O 29.00 a (--) 30.20 a (--) 1000 26.00 bAB 10.34 25.00 bA 17.21 2000 23.00 cB 20.68 21.40 bcA 29.13 3000 22.80 cA 21.37 18.60 cA 38.41 LSD value at P < 0.05 2.7 (--) 4.6 (--)
CHCl3 H2O 29.00 a (--) 30.20 a (--) 1000 27.20 abA 6.20 25.80 bA 14.56 2000 26.00 bA 10.34 24.20 bA 19.86 3000 22.40 cA 22.75 22.80 bA 24.50 LSD value at P < 0.05 2.2 (--) 3.5 (--)
MeOH H2O 29.00 a (--) 30.20 a (--) 1000 25.80 bAB 11.03 26.80 abA 11.25 2000 23.20 cAB 20.0 22.00 bcA 27.15 3000 20.40 dA 29.65 19.00 cA 37.08 LSD value at P < 0.05 2.4 (--) 5.7 (--) aData are mean of 5 replicated plants per treatment recorded during spring and fall, 2010. b H2O was mixed with DMSO (1%; v/v).
*Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among organic extract.
169
7.2.10. Effect of the stem extracts of Fumaria parviflora on plant height of tomato (cm) Analysis of data in the Table 7.2.4 indicated that the stem extracts and their concentrations showed significant (P < 0.05) variations for the trait under reference. The maximum tomato plant height (55.40 cm) was achieved by n-hexane followed by MeOH
(49.80 cm) at 3000 ppm concentration in the spring, 2010. The EtOAC and CHCl3 extracts increased the plant height by 38.85 and 36.30% over control (31.40 cm) at the highest concentration recorded in the spring, 2010. Results were similar for the fall, 2010 experiment. The n-hexane extract increased the plant height by 55.75% at 3000 ppm concentration followed by MeOH (43.63%) at the same concentration. The CHCl3 and EtOAC extracts increased the plant height over untreated control (Table 7.2.4). Comparisons between different stem extracts at the same concentration showed significant differences (P < 0.05) among them in the plant height of the spring, 2010 data only (Table 7.2.3).
7.2.11. Effect of the stem extracts of Fumaria parviflora on nematode reproduction
factor (Rf) in tomato roots
Analysis of the data revealed that nematode reproduction factor (Rf) was significantly influenced by the four stem extracts at all the tested concentrations in the spring and fall, 2010 (Figure 7.1.9 and 7.1.10). The n-hexane extracts reduced the nematode
Rf by 92.85, 91.96 and 89.59%, respectively at 1000, 2000 and 3000 ppm concentration, over the untreated control (3.36). The MeOH was the second most effective extract and reduced the Rf by 88.69 % followed by CHCl3 (85.71 %) and EtOAC (84.82 %) at 3000 ppm concentrations in the spring, 2010 (Figure 7.2.13). Results were similar for the fall,
2010 experiment where the n-hexane and MeOH reduced the Rf by 87.67 and 86.61%, respectively at the highest concentration of 3000 ppm. The EtOAC and CHCl3 significantly reduced the Rf whereas the highest Rf value was recorded in the control treatment (2.84) during fall, 2010 (Figure 7.2.14). Comparisons between different extracts at the same concentration showed significant differences between them in the Rf values recorded in the spring, 2010 growing season only (Figures 7.2.13).
170
Table 7.2.3. Effect of stem extracts of Fumaria parviflora on the number of branches plant-1 and the nematicidal effect on Meloidogyne incognita in tomato under screen house conditionsa.
Organic extracts ppmb Spring, 2010 Fall, 2010 No. of % Increase No. of % Increase branches over branches over control control * * n-hexane H2O 8.80 d (--) 10.20 c (--) 1000 15.60 cAB 77.27 15.00 bA 47.05 2000 19.40 bAB 120.45 20.40 aA 100.0 3000 26.80 aA 204.54 22.80 aA 123.52 LSD value at P < 0.05 3.2 (--) 4.7 (--)
EtOAC H2O 8.80 c (--) 10.20 (--) 1000 11.80 bcC 34.09 16.00 aA 56.86 2000 14.40 abC 63.63 19.20 aA 88.23 3000 16.80 aC 68.18 19.80 aA 94.11 LSD value at P < 0.05 4.7 (--) 4.4 (--)
CHCl3 H2O 8.80 b (--) 10.20 c (--) 1000 12.00 bBC 36.36 16.00 bA 56.88 2000 15.80 aBC 79.54 16.80 bNS 64.70 3000 19.20 aBC 118.18 22.00 aA 115.68 LSD value at P < 0.05 3.6 (--) 4.3 (--)
MeOH H2O 8.80 c (--) 10.20 b (--) 1000 17.00 bA 93.18 18.00 aA 76.47 2000 20.60 aA 134.09 18.80 aA 84.31 3000 22.20 aB 152.27 19.80 aA 94.11 LSD value at P < 0.05 2.1 (--) 5.2 (--) aData are mean of 5 replicated plants per treatment recorded during spring and fall, 2010. b H2O was mixed with DMSO (1%; v/v).
*Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among organic extract.
171
Table 7.2.4. Effect of stem extracts of Fumaria parviflora on plant height and the nematicidal effect on Meloidogyne incognita in tomato under green house conditionsa.
Organic extracts ppmb Spring, 2010 Fall, 2010 Height % Increase Height % Increase (cm) over control (cm) over control * * n-Hexane H2O 31.40 c (--) 33.00 c (--) 1000 42.80 bA 36.30 41.20 bA 24.84 2000 46.80 bA 49.04 43.20 bA 30.90 3000 55.40 aA 76.43 51.40 aA 55.75 LSD value at P < 0.05 6.9 (--) 5.4 (--)
EtOAC H2O 31.40 c (--) 33.00 c (--) 1000 33.80 cC 14.01 39.20 bA 18.78 2000 38.40 cB 22.29 41.60 bA 26.06 3000 43.60 aC 38.85 48.20 aA 46.06 LSD value at P < 0.05 4.3 (--) 5.4 (--)
CHCl3 H2O 31.40 c (--) 33.00 c (--) 1000 36.60 bBC 16.56 37.20 bcA 12.72 2000 38.60 bB 22.92 41.00 abA 24.24 3000 42.80 aC 36.30 44.80 aA 35.75 LSD value at P < 0.05 3.6 (--) 5.1 (--)
MeOH H2O 31.40 a (--) 33.00 bA (--) 1000 41.80 bAB 33.12 40.80 aA 23.63 2000 46.20 abA 47.13 42.20 aA 27.87 3000 49.80 aB 58.59 47.40 aA 43.63 LSD value at P < 0.05 5.7 (--) 6.8 (--)
aData are mean of 5 replicated plants per treatment recorded during spring and fall, 2010. b H2O was mixed with DMSO (1%; v/v).
*Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among organic extract.
172
Figure 7.2.13. Effect of stem extracts of Fumaaria parviflora on reproduction factor and nematicidal effect on Meloidogyne incognita in tomato under screen house conditions (LSD values: n-hexane; EtOAC; CHCl3; MeOH = 0.05).
Figure 7.2.14. Effect of stem extracts of Fumaria parviflora on reproduction factor and nematicidal effect on Meloidogyne incognita in tomato under screen house conditions (LSD values: n-hexane = 0.06; EtOAC = CHCl3 = MeOH = 0.05).
aData shown in figures 7.2.13 and 7.2.14 are mean of 5 replicated plants per treatment recorded during spring and fall, 2010. Means followed by the same lowercase letter do not differ significantly (P > 0.05) according to Fisher’s protected LSD test. Upper-case letters refer to mean comparisons at the same concentration among organic extract.
173
7.3. Screen house studies using dry powder application of Fumaria parviflora during the spring and the fall, 2010. 7.3.1. Effect of dry powder of Fumaria parviflora on number of galls per plant Table 7.3.1 showed significant (P < 0.05) effect of plant parts, application doses of F. parviflora and their interaction on the number of galls plant-1 of tomato in the spring and fall, 2010. All the dried plant parts significantly reduced the galls plant-1 in the spring, 2010. Maximum number of galls plant-1were reduced by the root (46.63) and stem (46.63) powder, followed by the whole plant powder (59.63). The three application doses (viz., 10, 20 and 30 g kg-1) significantly (P < 0.05) reduced the galls plant-1 with the highest dose (30 g kg-1) as the most effective (36.88). All the interaction between plant parts and application doses significantly (P < 0.05) reduced the galls plant-1. Similar results were recorded in the fall, 2010. The root powder showed the highest reduction in the galls plant-1 (61.13) followed by the stem (72.88). Whereas the leaf and the whole plant powder showed non-significant differences. Increase in the application doses significantly reduced the galls plant-1. Minimum galls plant-1 (31.00) were recorded when root powder were applied at 30 g kg-1 followed by the stem powder (48.75). The interaction between plant parts and application doses were significant (Table 7.3.1).
7.3.2. Effect of dry powder of Fumaria parviflora on galling index (GI) Table 7.3.2 revealed that plant powder and their different doses (viz., 10, 20 and 30 g kg-1) showed significant (P < 0.05) reduction in GI during the spring and fall, 2010 growing seasons. GI was the lowest for the root (2.33 and 2.96) and the stem powder (3.19 and 3.59) during the spring and fall, 2010. Increase in the plant doses significantly reduced the GI during both growing seasons. GI was minimum of 2.29 and 2.46 at the highest application dose of 30 g kg-1 during the spring and fall, 2010 respectively. The interaction between plant parts and doses showed significant (P < 0.05) reduction by the root powder at all the application doses with the highest dose of 30 g kg-1 as the most effective in the spring (1.13) and fall (1.50), 2010 followed by the stem powder (Table 7.3.2).
174
Table 7.3.1. Effect of dry powder of Fumaria parviflora on galls plant-1 of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010).
Doses
Plant parts Mean 0 g Kg-1 10 g Kg-1 20 g Kg-1 30 g Kg-1 (control)
80.00 A† 46.75 C 36.75 DE 23.00 F 46.63* C Roots 99.25 a‡ 63.50 de 50.75 f 31.00 g 61.13 c
74.75 A 44.50 CD 38.25 D 29.00 EF 46.63 C Stem 100.3 a 78.75 b 63.75 cde 48.75 f 72.88 b
79.25 A 62.50 B 61.25 B 56.50 B 64.88 A Leaves 103.8 a 75.50 b 71.50 bc 61.50 e 78.06 a
Whole plant 81.00 A 60.25 B 58.25 B 39.0 CD 59.63 B 106.8 a 71.00 bcd 71.25 bcd 66.75 cde 78.94 a
78.75 A 53.50 B 48.63 C 36.88 D Mean 102.5 a 72.19 b 64.31 c 52.00 d
†LSD values for plant parts = 3.96 ‡LSD values for plant parts = 3.92 LSD values for application doses = 3.92 LSD values for application doses = 3.92 LSD values for interaction 7.934 LSD values for interaction = 7.85
†Upper case values represent data recorded during the spring 2010, ‡Lower case values represent data recorded during the fall, 2010.
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
175
Table 7.3.2. Effect of dry powder of Fumaria parviflora on galling index of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010).
Plant parts Doses Mean
0 g Kg-1 10 g Kg-1 20 g Kg-1 30 g Kg-1 (control)
† * Roots 4.70 A 1.87 E 1.63 EF 1.13 F 2.33 C 4.87 a‡ 3.00 ef 2.50 f 1.50 g 2.96 c
Stem 4.90 A 2.85 D 3.00 CD 2.00 E 3.19 B 5.00 a 3.62 bcd 3.25 de 2.50 f 3.59 b
Leaves 4.82 A 3.85 B 3.53 BC 3.03 CD 3.81 A 4.92 a 4.07 b 3.50 cde 3.25 de 3.93 a
Whole plant 4.82 A 3.47 BC 3.25 CD 3.03 CD 3.64 A 5.00 a 3.62 bcd 4.00 bc 2.62 f 3.81 ab
2.29 C 4.81 A 3.01 B 2.85 B Mean 2.46 d 4.95 a 3.58 b 3.31 c
†LSD values for plant parts = 0.28 ‡LSD values for plant parts = 0.26 LSD values for application doses = 0.28 LSD values for application doses = 0.52 LSD values for interaction 0.56 LSD values for interaction = 0.26
†Upper case values represent data recorded during the spring 2010, bLower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
176
7.3.3. Effect of dry powder of Fumaria parviflora on egg masses per gram of tomato roots The number of egg masses g-1 of tomato roots were significantly (P < 0.05) reduced by the application of all the four dried plant parts (roots, stem, leaves and whole plant), increasing doses and their interaction (Table 7.3.3). The root source significantly reduced the egg masses g-1 to 34.00 and 54.88 as compared to the corresponding control (65.75 and 98.00) in the spring and the fall, 2010 growing season followed by the stem (37.81 and 64.06). The three increasing doses reduced the egg masses g-1 with the highest dose of 30 g kg-1 as the most effective in the spring (27.38) and the fall (46.38), 2010. The interaction between the four plant parts viz., roots, stem, leaves and the whole plant and the three increasing doses were highly significant (P < 0.05) with the root source as the best at the highest application dose of 30 g kg-1 in the spring (17.75) and the fall, (26.00), 2010 for the trait under reference (Table 7.3.3).
7.3.4. Effect of dry powder of Fumaria parviflora on eggs per egg mass of tomato roots Table 7.3.4 indicated that the four plant parts, three doses and their interaction significantly reduced the number of Meloidogyne eggs per egg mass. Treatments amended with the root (282.0), stem (282.4) and the whole plant (285.5) showed non- significant differences in the spring growing season, however differences were significant in the fall. Eggs per egg mass were significantly reduced with all the doses with the highest dose (30 g kg-1) as the best in the spring (278.3) and the fall (276.3) season. The interaction of all the plant parts with the three doses showed statistically significant results in the number of eggs per egg mass for all the treatments (7.3.4).
7.3.5. Effect of dry powder of Fumaria parviflora on adult females per gram of tomato roots Table 7.3.5 indicated significant (P < 0.05) reduction in the number of adult female g-1 of roots by the application of four dried plant material at three different doses in the spring and fall, 2010.
177
Table 7.3.3. Effect of dry powder of Fumaria parviflora on egg masses g-1 of tomato roots infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010).
Plant parts Doses Mean
0 g Kg-1 10 g Kg-1 20 g Kg-1 30 g Kg-1 (control)
† * Roots 65.75 AB 28.00 GH 24.50 HI 17.75 I 34.00 C 98.00 a‡ 50.50 fg 45.00 g 26.00 h 54.88 d
Stem 61.25 B 36.00 DEF 30.50 FGH 23.50 HI 37.81 B 94.00 a 62.00 de 56.25 ef 44.00 g 64.06 c
Leaves 69.00 A 44.00 C 41.25 CD 36.00 DEF 47.56 A 97.50 a 82.50 b 74.75 bc 66.50 cd 80.31 a
Whole plant 69.50 A 40.75 C D 38.75 CDE 32.25 EFG 45.31 A 93.25 a 73.25 c 64.25 de 49.00 fg 69.94 b
66.38 A 37.19 B 33.75 B 27.38 C Mean 95.69 a 67.06 b 60.06 c 46.38 d
†LSD values for plant parts = 3.76 ‡LSD values for plant parts = 4.5 LSD values for application doses = 3.76 LSD values for application doses = 4.5 LSD values for interaction 7.52 LSD values for interaction = 8.9
†Upper case values represent data recorded during the spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
178
Table 7.3.4. Effect of dry powder of Fumaria parviflora on eggs egg mass-1 of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010).
Plant part Doses Mean
0 g Kg-1 10 g Kg-1 20 g Kg-1 30 g Kg-1
(control)
† * Roots 302.5 A 279.8 CD 273.0 D 272.8 D 282.0 B 293.3 a‡ 290.0 a 279.5 cd 275.3 cd 284.5 a
Stem 300.0 A 280.3 CD 278.8 CD 270.8 D 282.4 B 292.3 a 281.5 bc 278.8 cd 281.8 bc 283.6 ab
Leaves 302.0 A 294.8 AB 294.3 AB 293.8 AB 296.2 A 288.8 ab 280.0 cd 278.8 cd 273.8 d 280.3 bc
Whole plant 299.8 A 286.0 BC 280.3 CD 276.0 CD 285.5 B 288.3 ab 280.3 cd 274.3 cd 274.3 cd 279.3 c
301.1 A 285.2 B 281.6 BC 278.3 C Mean 290.6 a 282.9 b 277.8 c 276.3 c
†LSD values for plant parts = 5.74 ‡LSD values for plant parts = 3.78 LSD values for application doses = 5.74 LSD values for application doses = 3.78 LSD values for interaction 11.50 LSD values for interaction = 7.57
†Upper values represent data recorded during spring 2010, ‡Lower values represent data recorded during fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
179
The adult females g-1 of roots were significantly reduced by 47.87, 45.79, 41.70 and 41.04% by the root, stem, whole plant and leaves material, respectively over their corresponding control in the spring, 2010. The three application doses of 30, 20 and 10 g kg-1 significantly reduced the adult females g-1 of roots to 15.94, 22.50 and 25.69, respectively as compared to the control (51.56). Similar results were achieved in the fall, 2010, where the maximum reduction in the number of adult females (29.25) was observed for the root powder and at the highest dose of 30 g kg-1 (21.88). Whereas the interaction between the plant parts and their doses were significant among all the treatments during the spring and fall, 2010 (Table 7.3.5).
7.3.6. Effect of dry powder of Fumaria parviflora on juveniles in 100 cm3 soil The application of dried plant parts and their increasing doses had significant (P < 0.05) effect on the number of juveniles in 100 cm3 soil. The data in table 7.3.6 revealed that significant reduction in juvenile population was observed in the treatments amended with the root (122.1 and 250.7) powder followed by the stem (147.4 and 296.2) in the spring and fall, 2010 growing season. Out of three doses applied, maximum reduction was observed at 30 g kg-1 (118.9 and 203.8) in both growing season. The interaction between the four plant parts (root, stem, leaves and whole plant) and application doses (10, 20 and 30 g kg-1) were significant among all the treatments with the root powder as the most effective at 30 g kg-1 in the spring (79.75) and fall (145.5), 2010 (Table 7.3.6).
7.3.7. Effect of dry powder of F. parviflora on shoot length of tomato (cm) The spring and fall, 2010 trials showed significant increase in the shoot length of tomato with the application of powdered plant parts of F. parviflora applied (Table 7.3.7). Increase in the shoot length was the highest of 45.19 and 40.63 cm for the root powder followed by the stem (36.69 and 30.81 cm) in the spring and fall, respectively.
180
Table 7.3.5. Effect of dry powder of Fumaria parviflora on adult female g-1 of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010).
Plant parts Doses Mean
0 g Kg-1 10 g Kg-1 20 g Kg-1 30 g Kg-1
(control)
† * Roots 41.25 C 19.00 FGH 17.75 GH 8.00 I 21.50 C 70.75 ab‡ 20.75 gh 16.75 h 8.750 i 29.25 c
Stem 58.00 A 25.50 DEF 26.25 DE 16.00 H 31.44 AB 67.50 b 34.25 e 26.50 f 19.75 h 37.00 b
Leaves 56.50 AB 31.25 D 22.75 EFGH 22.75 EFGH 33.31 A 75.50 a 51.75 c 42.75 d 33.00 e 50.75 a
Whole plant 50.50 B 27.00 DE 23.25 EFG 17.00 GH 29.44 B 74.00 a 52.25 c 41.50 d 26.00 fg 48.44 a
51.56 A 25.69 B 22.50 B 15.94 C Mean 71.94 a 39.75 b 31.88 c 21.88 d
†LSD values for plant parts = 3.38 ‡LSD values for plant parts = 2.80 LSD values for application doses = 3.38 LSD values for application doses = 2.80 LSD values for interaction = 6.77 LSD values for interaction = 5.60
†Upper case values represent data recorded during the spring 2010, ‡Lower case values represent data recorded during the fall, 2010.
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
181
Table 7.3.6. Effect of dry powder of Fumaria parviflora on juveniles in 100 cm3 soil of tomato plant infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010).
Plant parts Doses Mean
0 g Kg-1 10 g Kg-1 20 g Kg-1 30 g Kg-1
(control)
† * Roots 195.0 A 102.0 DE 111.5 D 79.75 E 122.1 C 471.5 b‡ 205.3 efg 180.5 fg 145.5 g 250.7 c
Stem 200.0 A 145.3 C 147.0 C 97.50 DE 147.4 B 500.5 b 254.3 cde 221.8 def 208.3 ef 296.2 b
Leaves 202.5 A 195.3 A 192.5 A 183.3 AB 193.4 A 569.8 a 308.0 c 293.0 c 275.5 cd 361.6 a
Whole plant 201.0 A 162.3 BC 150.0 C 115.0 D 157.1 B 486.5 b 256.0 cde 212.3 ef 186.0 fg 285.2 b
199.6 A 151.2 B 150.3 B 118.9 C Mean 507.1 a 255.9 b 226.9 bc 203.8 c
†LSD values for plant parts = 11.84 ‡LSD values for plant parts = 30.72 LSD values for application doses = 11.84 LSD values for application doses = 30.72 LSD values for interaction = 23.67 LSD values for interaction = 61.44
†Upper case values represent data recorded during the spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
182
Data of both seasons showed linear relationship between the shoot length and application doses. Amongst the interaction, the increase in the shoot length was highest for the root at 30 g kg-1 in the spring (53.25 cm) and fall (52.50 cm) experiments (7.3.7).
7.3.8. Effect of dry powder of Fumaria parviflora on root length of tomato (cm) Data in the Table 7.3.8 revealed significant increased in the root length of tomato for the treatments amended with the plant material, doses and their interaction. The highest increase (18.75 and 20.00 cm) in the root length was observed for the interaction between the root powder and the highest dose (30 g kg-1) in the spring and fall. Root length was the lowest for all the un amended treatments. Out of the four plant sources, the treatments amended with the root powder showed the highest increase of 12.68 and 13.24 cm in the spring and fall trials respectively. Root length was maximum (13.59 and 14.29 cm) at an application of 30 g kg-1 dose whereas minimum in the corresponding control recorded in the spring (5.76) and the fall (7.30) trials (7.3.8).
7.3.9. Effect of dry powder of Fumaria parviflora on fresh shoot weight (g) The four plant parts applied as dry powder showed significant increase in the fresh shoot weight of tomato at three different doses. Fresh shoot weight significantly increased to 47.63 and 55.70 for the interaction between the root powder applied at 30 g kg-1 in the spring and fall, respectively (Table 7.3.9). Fresh shoot weight was the heaviest of 33.22 and 32.99 for the treatment amended with dried whole plant and root powder of F. parviflora in the spring and fall seasons, respectively. The highest increase of 35.74 and 36.79 at 30 g kg-1 dose application was observed in both seasons (7.3.9).
183
Table 7.3.7. Effect of dry powder of Fumaria parviflora on shoot length of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010).
Plant parts Doses Mean
0 g Kg-1 10 g Kg-1 20 g Kg-1 30 g Kg-1
(control)
† * Roots 26.25 J 48.75 B 52.50 A 53.25 A 45.19 A 30.25 efgh‡ 38.25 bc 41.50 b 52.50 a 40.63 a
Stem 28.75 I 37.75 EF 41.50 C 38.75 DE 36.69 B 28.75 gh 29.25 efgh 31.25 defgh 34.00 cde 30.81 b
Leaves 26.50 J 35.50 H 38.50 DE 39.00 D 34.88 C 29.00 fgh 28.50 gh 33.75 cdef 26.75 h 29.50 b
Whole plant 28.50 I 35.75 GH 36.75 FG 35.50 H 34.13 D 27.25 gh 31.75 defg 30.00 efgh 35.50 cd 31.13 b
27.50 D 39.44 C 42.31 A 41.63 B Mean 28.81 c 31.94 b 34.13 b 37.19 a
†LSD values for plant parts = 0.62 ‡LSD values for plant parts = 2.41 LSD values for application doses = 0.62 LSD values for application doses = 2.41 LSD values for interaction = 1.24 LSD values for interaction = 4.83
†Upper case values represent data recorded during the spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
184
Table 7.3.8. Effect of dry powder of Fumaria parviflora on root length of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010).
Plant parts Doses Mean
0 g Kg-1 10 g Kg-1 20 g Kg-1 30 g Kg-1
(control)
† * Roots 5.72 F 13.38 B 12.88 B 18.75 A 12.68 A 7.82 fgh‡ 9.52 de 15.63 b 20.00 a 13.24 a
Stem 5.80 F 10.25 CD 11.50 BC 12.38 B 9.98 B 8.00 fg 9.22 def 12.00 c 12.07 c 10.32 b
Leaves 5.72 F 7.75 EF 9.23 DE 11.70 BC 8.600 C 6.40 h 8.00 fg 12.13 c 12.32 c 9.71 bc
Whole plant 5.80 F 7.15 EF 10.13 CD 11.52 BC 8.65 C 7.00 gh 8.40 efg 10.13 d 12.75 c 9.56 c
5.76 D 9.63 C 10.93 B 13.59 A Mean 7.30 d 8.78 c 12.47 b 14.29 a
†LSD values for plant parts = 1.04 ‡LSD values for plant parts = 0.74 LSD values for application doses = 1.04 LSD values for application doses = 0.74 LSD values for interaction = 2.08 LSD values for interaction = 1.49
†Upper case values represent data recorded during the spring 2010, ‡Lower case values represent data recorded during the fall, 2010.
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
185
Table 7.3.9. Effect of dry powder of Fumaria parviflora on fresh shoot weight of tomato infected with Meloidogyne incognita under screen house conditions.
Doses Mean Plant parts
0 g Kg-1 10 g Kg-1 20 g Kg-1 30 g Kg-1
(control)
† * Roots 19.33 GH 24.88 EF 38.88 BC 47.63 A 32.67 A 18.13 gh‡ 23.40 ef 34.75 c 55.70 a 32.99 a
Stem 19.38 GH 20.50 GH 27.25 E 32.00 D 24.78 B 24.27 def 20.75 efg 21.63 efg 25.72 de 23.09 bc
Leaves 19.20 GH 20.05 GH 24.50 EF 22.13 FG 21.47 C 23.95 def 19.38 fg 22.10 efg 23.55 ef 22.24 c
Whole plant 18.42 H 35.50 C 37.75 C 41.20 B 33.22 A 13.20 h 17.38 gh 28.83 d 42.20 b 25.40 b
Mean 19.08 D 25.23 C 32.09 B 35.74 A 19.89 c 20.23 c 26.83 b 36.79 a
†LSD values for plant parts = 1.69 ‡LSD values for plant parts = 2.55 LSD values for application doses = 1.69 LSD values for application doses = 2.55 LSD values for interaction = 3.39 LSD values for interaction = 5.11
†Upper case values represent data recorded during the spring 2010, ‡Lower case values represent data recorded during the fall, 2010.
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
186
7.3.10. Effect of dry powder of Fumaria parviflora on dry shoot weight tomato (g) Dry powder application of F. parviflora (root, stem, leaves and whole plant) and their increasing doses showed an increase in the dry shoot weight of tomato in both growing seasons (Table 7.3.10). The interaction between the plant parts and application doses was highly significant (P < 0.05) with the highest increase in the dry shoot weight being recorded for the root source (17.13 and 19.13 g) followed by the whole plant application (17.75 and 17.50 g) in the spring and fall, 2010. Amongst the four plant parts/sources, the whole plant increased the dry weight by 60.96 and 60.97% over the corresponding control in the spring and fall trials. Increase in the plant doses increased the dry weight instantly with the highest increase witnessed at 30 g kg-1 (Table 7.3.10).
7.3.11. Effect of dry powder of Fumaria parviflora on number of branches per plant of tomato Significant increase in the number of branches plant-1 was registered with the application of dried plant material at an increasing dose rate of 10, 20 and 30 g kg-1 (Table 7.3.11). Data of the two seasons revealed the highest increase in the number of branches plant-1 for the root source (16.25 and 17.25) followed by the stem (10.0 and 10.75) at the highest dose of 30 g kg-1, recorded in the spring and fall, 2010. Number of branches was the highest (12.06) at 30 g kg-1 and the lowest (8.81) at 10 g kg-1 in the spring, 2010 trial. Similar results were recorded in the fall, 2010 (Table 7.3.11).
7.3.12. Effect of dry powder of Fumaria parviflora on number of flowers per plant Number of flowers plant-1 was increased directly with the increase in the dose rate during the spring and fall experiments (Table 7.3.12). The interaction between the root powder and the highest dose of 30 g kg-1 yielded maximum number of branches in the spring (44.50) and fall (48.75), followed by the stem powder application. Amongst the various plant parts and doses evaluated, the root source was the best of all at all application doses with the most effectual at 30 g kg-1 (38.88 and 37.69) in both seasons (Table 7.3.12).
187
Table 7.3.10. Effect of dry powder of Fumaria parviflora on shoot dry weight of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010).
Doses Mean Plant parts
0 g Kg-1 10 g Kg-1 20 g Kg-1 30 g Kg-1 (control)
† * Roots 8.48 FG 8.33 FG 14.55 B 17.13 A 12.12 B 7.47 gh‡ 7.62 g 14.95 c 19.13 a 12.29 a
Stem 7.70 G 9.10 F 12.13 CD 12.50 C 10.36 C 5.30 i 8.62 fg 9.25 ef 12.13 d 8.82 b
Leaves 7.50 G 9.30 F 10.50 E 11.25 DE 9.64 D 5.77 i 6.10 hi 8.75 fg 10.43 e 7.76 c
Whole plant 8.25 FG 12.50 C 14.63 B 17.75 A 13.28 A 8.02 fg 10.63 de 15.50 c 17.50 b 12.91 a
Mean 7.98 D 9.80 C 12.95 B 14.66 A 6.64 d 8.24 c 12.11 b 14.79 a
†LSD values for plant parts = 0.57 ‡LSD values for plant parts = 0.76 LSD values for application doses = 0.57 LSD values for application doses = 0.76 LSD values for interaction = 1.2 LSD values for interaction = 1.5
†Upper case values represent data recorded during the spring 2010, ‡Lower case values represent data recorded during the fall, 2010.
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
188
Table 7.3.11. Effect of dry powder of Fumaria parviflora on number of branches plant-1 of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010).
Plant parts Doses Mean
0 g Kg-1 10 g Kg-1 20 g Kg-1 30 g Kg-1
(control)
† * Roots 7.75 E 9.25 CDE 12.00 BC 16.25 A 11.31 A 8.75 de‡ 10.25 cde 14.25 b 17.25 a 12.63 a
Stem 10.00 CDE 9.25 CDE 11.50 BCD 13.25 B 11.00 A 11.00 cd 10.25 cde 12.25 bc 14.00 b 11.88 a
Leaves 8.75 DE 9.00 DE 9.500 CDE 8.75 DE 9.00 B 9.75 de 8.25 e 10.50 cde 9.75 de 9.56 b
Whole plant 7.25 E 7.75 E 9.75 CDE 10.00 CDE 8.68 B 8.25 e 8.75 de 10.75 cd 10.75 cd 9.62 b
8.43 B 8.81 B 10.69 A 12.06 A Mean 9.43 b 9.37 b 11.94 a 12.94 a
†LSD values for plant parts = 1.39 ‡LSD values for plant parts = 1.20 LSD values for application doses = 1.39 LSD values for application doses = 1.20 LSD values for interaction = 2.78 LSD values for interaction = 2.42
†Upper cae values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010.
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
189
Table 7.3.12. Effect of dry powder of Fumaria parviflora on flowers plant-1 of tomato infected with Meloidogyne incognita under screen house conditions (spring and fall, 2010).
Doses Mean Plant parts
0 g Kg-1 10 g Kg-1 20 g Kg-1 30 g Kg-1
(control)
† * Roots 29.00 EF 33.00 CDE 37.50 BC 44.50 A 36.00 A 23.00 ef‡ 26.25 def 37.75 b 48.75 a 33.94 a
Stem 25.50 F 33.00 CDE 38.00 B 39.00 B 33.88 A 21.75 f 28.50 cde 32.25 bc 36.75 b 29.81 b
Leaves 26.75 F 28.50 EF 32.00 DE 36.50 BCD 30.94 B 21.75 f 23.00 ef 28.50 cde 29.50 cd 25.69 c
Whole plant 25.00 F 29.25 EF 35.25 BCD 35.50 BCD 31.25 B 23.50 ef 27.25 cdef 25.50 def 35.75 b 28.00 bc
Mean 26.56 D 30.94 C 35.69 BA 38.88 A 22.50 d 26.25 c 31.00 b 37.69 a
†LSD values for plant parts = 2.36 ‡LSD values for plant parts = 2.77 LSD values for application doses = 2.36 LSD values for application doses = 2.77 LSD values for interaction = 4.73 LSD values for interaction = 5.55
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010.
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
190
7.4. Effect of dry powder of Fumaria parviflora during the spring and fall, 2010 under natural field conditions of Dargai. 7.4.1. Effect of dry powder of Fumaria parviflora on galls per plant of tomato root The application of plant parts of F. parviflora, doses and their interaction showed significant effect (P < 0.05) effect on the number of galls per root system of tomato in the spring and fall, 2010 (Table 7.4.1). Maximum number of galls per root system were reduced by the roots powder (61.13) followed by the stem (72.88) in the spring. Differences were non-significant between the leaf (78.06) and the whole plant (78.94) powder. The three application doses (viz., 10, 20 and 30 g plant-1) significantly (P < 0.05) reduced the galls per root system with the highest dose (30 g plant-1) as the most effective (52.00). Number of gall per root system was the highest in the control (102.5). All the interaction between the plant parts and application doses significantly reduced the galls per root system. Results were similar in the fall, where the root powder showed the highest reduction of 60.06 in number of galls per root system followed the stem (63.63). Amongst the application doses, maximum reduction in the galls per root system (51.31) was recorded at the highest dose of 30 g plant-1 and minimum (89.69) in the control (0.0 g plant-1). Increase in the application doses significantly reduced the galls per root system. The interaction between plant parts and application doses were significant (P < 0.05) (Table 7.4.1).
7.4.2. Effect of dry powder of Fumaria parviflora on the galling index (GI) Table 7.4.2 revealed that different doses (viz., 0, 10, 20 and 30 g plant-1), plant parts (roots, stem, leaves and the whole plant part) and their interaction showed significant (P < 0.05) reduction in GI during the spring and fall, 2010 growing seasons. GI was lower (2.69 and 2.98) for the root powder than the stem, leaves and the whole plant powder including the control in both trials. Increase in the doses of application significantly reduced the GI, with the highest reduction witnessed at 30 g plant-1 (2.15 and 2.18) in the spring and fall. GI were maximum (4.95 and 4.93) in the control where no dose was applied. The interaction between the four plant parts and the doses showed significant reduction in the GI in both the spring and fall trials (Table 7.4.2).
191
Table 7.4.1. Effect of dry powder of Fumaria parviflora on galls plant-1 of tomato roots infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Doses
Plant parts Mean
0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
99.25 A† 63.50 DE 50.75 F 31.00 G 61.13 C* Roots 86.00 b‡ 61.25 de 53.75 fg 39.25 h 60.06 c
100.3 A 78.75 B 63.75 CDE 48.75 F 72.88 B Stem 89.25 ab 63.25 de 53.75 fg 48.25 g 63.63 c
103.8 A 75.50 B 71.50 BC 61.50 E 78.06 A Leaves 87.00 b 70.75 c 71.25 c 64.75 cd 73.44 a
Whole plant 106.8 A 71.00 BCD 71.25 BCD 66.75 CDE 78.94 A 96.50 a 67.50 cd 56.50 ef 53.00 fg 68.38 b
102.5 A 72.19 B 64.31 C 52.00 D Mean 89.69 a 65.69 b 58.81 c 51.31 d
†LSD value for plant parts = 3.93 ‡LSD value for plant parts = 3.63 LSD value for application doses = 3.93 LSD value for application doses = 3.63 LSD value for interaction = 7.86 LSD value for interaction = 7.27
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010.
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
192
Table 7.4.2. Effect of dry powder of Fumaria parviflora on galling index (GI) of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Doses
Plant parts Mean
0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
4.95 A† 2.50 D 2.07 DE 1.25 F 2.69 C* Roots 4.92 a‡ 2.75 cdef 2.37 efg 1.87 fg 2.98 c
4.92 A 3.23 C 2.50 D 1.82 E 3.11 B Stem 4.95 a 3.12 bcde 2.62 def 1.50 g 3. bc
4.95 A 3.75 BC 3.57 BC 3.32 C 3.90 A Leaves 4.92 a 3.75 b 3.62 bc 3.12 bcde 3.85 a
Whole plant 4.97 A 3.97 B 3.45 BC 2.20 DE 3.65 A 4.95 a 3.00 bcde 3.50 bcd 2.25 efg 3.45 ab
4.95 A 3.36 B 2.90 C 2.15 D Mean 4.93 a 3.15 b 3.03 b 2.18 c
†LSD value for plant parts = 0.28 ‡LSD value for plant parts= 0.44 LSD value for application doses = 0.28 LSD value for application doses = 0.44 LSD value for interaction = 0.56 LSD value for interaction = 0.88
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
193
7.4.3. Effect of dry powder of Fumaria parviflora on egg masses per gram of tomato roots Table 7.4.3 showed that eggs masses g-1 of tomato roots were significantly (P < 0.05) reduced by the interaction between the plant parts and increasing doses of application in both spring and fall trials. Egg masses g-1 of tomato were the lowest of 45.25 and 31.00 at the highest dose of 30 g plant-1 for the root powder followed by the stem in the spring and fall, respectively. Amongst the four plant parts evaluated, the roots showed the greatest reduction (69.0 and 50.31 egg masses per gram of root) in the egg masses g-1 in both seasons, whereas differences among the stem, leaves and the whole plant parts were non-significant in the spring. The increasing application doses had significant (P < 0.05) effect on the parameter under study with the highest dose of 30 g plant-1 as the most effective in the spring 56.63 and fall (39.25 egg masses per gram of root) growing seasons.
7.4.4. Effect of dry powder of Fumaria parviflora on eggs per egg mass Number of eggs per egg mass varied significantly with different plant parts, doses and their interaction. The roots (301.3) and stem (308.4) showed significant differences in the spring, whereas the leaves (305.8) and the whole plant (306.2) showed non-significant differences. However, number of eggs per egg mass was non- significant for all the four plant parts applied in the fall season. Eggs per egg mass were the greatest of 311.1 and 327.9 in the control. Increase in the doses considerably reduced the eggs per egg mass in both seasons. The interaction between the four plant parts and doses were significant in both trials (Table 7.4.4).
7.4.5. Effect of dry powder of Fumaria parviflora on adult females per gram of tomato roots Table 7.4.5 revealed that the number of adult females varied significantly by the four plant parts, doses and their interaction. Number of adult females per gram of roots was the lowest (40.25 and 18.50) for the interaction between the plant roots applied at 30 g plant-1 of soil in both growing seasons.
194
Table 7.4.3. Effect of dry powder of Fumaria parviflora on egg masses g-1 of tomato roots infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Doses
Plant parts Mean
0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
109.3 A† 62.75 DE 58.75 EF 45.25 G 69.00 B* Roots 83.25 ab‡ 43.50 fg 43.50 fg 31.00 h 50.31 c
109.5 A 72.75 BC 69.50 BCD 54.50 F 76.56 A Stem 90.00 a 52.25 de 49.75 ef 38.75 g 57.69 b
109.3 A 73.75 B 72.25 BC 65.75 CDE 80.25 A Leaves 81.75 b 69.50 c 57.50 d 49.75 ef 64.63 a
Whole plant 105.3 A 75.00 B 70.00 BCD 61.00 EF 77.81 A 85.50 ab 57.50 d 52.50 de 37.50 gh 58.25 b
108.3 A 71.06 B 67.63 B 56.63 C Mean 85.13 a 55.69 b 50.81 c 39.25 d
†LSD value for plant parts= 3.89 ‡LSD value for plant parts = 3.49 LSD value for application doses = 3.89 LSD value for application doses = 3.49 LSD value for interaction = 7.79 LSD value for interaction = 6.98
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
195
Table 7.4.4. Effect of dry powder of Fumaria parviflora on eggs egg mass-1 of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Doses
Plant parts Mean
0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
308.3 ABC† 306.8 ABC 298.0 CD 292.0 D 301.3 B* Roots 333.0 a‡ 308.5 cde 305.8 cde 297.8 e 311.3 NS**
307.5 ABC 311.5 AB 313.0 AB 301.8 BCD 308.4 A Stem 322.8 abc 307.0 cde 303.0 de 300.0 de 308.2 NS
313.3 AB 307.0 ABC 304.5 ABC 298.3 CD 305.8 AB Leaves 327.5 ab 309.5 bcde 303.0 de 302.0 de 310.5 NS
Whole plant 315.5 A 307.0 ABC 298.5 CD 303.8 ABCD 306.2 AB 328.5 a 317.8 abcd 305.5 cde 304.0 de 313.9 NS
311.1 A 308.1 AB 303.5 BC 298.9 C Mean 327.9 a 310.7 b 304.3 bc 300.9 c
†LSD value for plant parts = 6.14 ‡LSD value for plant parts = NS** LSD value for application doses = 6.14 LSD value for application doses = 9.32 LSD value for interaction = 12.28 LSD value for interaction = 18.65
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test. **NS = Non-significant
196
Table 7.4.5. Effect of dry powder of Fumaria parviflora on adult females g-1 of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Doses
Plant parts Mean
0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
95.50 A† 58.50 DE 45.75 FG 40.25 G 60.00 C* Roots 59.00 b‡ 28.50 f 19.25 g 18.50 g 31.31 c
94.00 A 62.75 CD 60.00 D 51.75 EF 67.13 B Stem 63.75 ab 44.00 cde 39.50 e 27.50 f 43.69 b
90.25 A 74.00 B 68.00 BC 66.25 BCD 74.63 A Leaves 66.25 a 50.00 c 43.50 cde 37.50 e 49.31 a
Whole plant 92.25 A 64.50 CD 60.25 CD 51.50 EF 67.13 B 66.00 a 48.75 cd 47.00 cd 43.00 de 51.19 a
93.00 A 64.94 B 58.50 C 52.44 D Mean 63.75 a 42.81 b 37.31 c 31.63 d
†LSD value for plant parts = 3.92 ‡LSD value for plant parts = 3.47 LSD value for application doses = 3.92 LSD value for application doses = 3.47 LSD value for interaction = 7.84 LSD value for interaction = 6.94
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
197
Amongst the four plant parts applied, the roots showed the greatest reduction (60.0 and 31.31) in number of adult females in the spring and fall. Whereas the stem (67.13) and the whole plant (67.13) showed an equivocal effect in the spring only. Increase in the doses reduced the adult females directly. Number of adult females was the greatest in the control (Table 7.4.5).
7.4.6. Effect of dry powder of Fumaria parviflora on initial nematode population
(Pi) per 100 g of soil The initial nematode population fluctuated significantly (P < 0.05) in both growing seasons by the plant parts, doses and their interaction (Table 7.4.6). The Pi was the greatest in the leaves (207.6 and 253.2) followed by the whole plant powder in the spring (201.7) and fall (233.1). Amongst the plant doses applied, the Pi was the maximum of 276.9 and 284.3 in the control where no dose (0.0 g plant-1) was applied in the spring and fall, respectively. The interaction between the four plant parts (i.e roots, stem, leaves and whole plant) and plant doses (0.0, 10, 20, 30 g plant-1) were highly significant in both trials (Table 7.4.6).
7.4.7. Effect of dry powder of Fumaria parviflora on final nematode population
(Pf) per 100 g of soil
Table 7.4.7 indicated that final nematode population (Pf) was reduced significantly with the application of plant material at an increasing doses and their interaction. Pf was the lowest (147.1) for the stem powder followed by the roots - (174.6) in the spring. Pf was reduced to 192.9, 128.3 and 122.8 at 10, 20 and 30 g plant 1 -1 dose application. Maximum Pf was recorded in the control (280.9) at 0.0 g plant dose application. Similar results were recorded in the fall trial, where both the roots powder and the highest dose were superior. Amongst the interaction, the roots powder showed -1 the greatest reduction in the Pf at 30 g plant in the spring (74.75) and fall (139.5), 2010 (Table 7.4.7).
198
Table 7.4.6. Effect of dry powder of Fumaria parviflora on initial nematode populations per 100 g of soil in tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Plant parts Doses Mean
0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
278.8 AB† 184.8 C 174.5 CD 74.75 F 178.2 B* Roots 277.5 ab‡ 213.0 efgh 202.8 ghi 187.8 i 220.3 c
261.3 B 146.3 E 96.25 F 76.00 F 144.9 C Stem 287.3 a 227.3 def 217.8 efgh 206.0 fghi 234.6 b
281.3 AB 186.8 C 170.0 CDE 192.5 C 207.6 A Leaves 290.0 a 257.5 bc 242.0 cd 223.3 defg 253.2 a
286.3 A 266.8 AB 93.75 F 160.0 DE 201.7 A Whole plant 282.5 a 234.8 cde 214.8 efgh 200.3 hi 233.1 b
276.9 A 196.1 B 133.6 C 125.8 C Mean 284.3 a 233.1 b 219.3 c 204.3 d
†LSD value for plant parts = 12.35 ‡LSD value for plant parts = 11.38 LSD value for application doses = 12.35 LSD value for application doses = 11.38 LSD value for interaction = 24.69 LSD value for interaction = 22.75
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
199
7.4.8. Effect of dry powder of Fumaria parviflora on fresh shoot weight of tomato (g) Fresh shoot weight was significantly increased with the four plant parts applied as powder, doses and their interaction in the spring and fall, 2010 (Table 7.4.8). The interaction between the plant parts and the doses showed the greatest increase in fresh shoot weight with the roots powder as the most effective in the spring (55.0) and fall (53.0) at 30 g plant-1 application dose. Amongst the four plant parts used, the roots powder showed maximum increase in the fresh weight (36.26 and 46.50) compared with the corresponding control in the spring (22.0) and fall (34.25) respectively. Fresh shoot weight was increased with increasing doses. Increase was the highest at 30 g plant-1 in the spring (40.19) and fall (50.38) (Table 7.4.8).
7.4.9. Effect of dry powder of Fumaria parviflora on dry shoot weight of tomato (g) The interaction between the plant parts of F. parviflora and increasing doses showed the greatest increase in the dry shoot weight (Table 7.4.9). Amongst the interaction, the roots (27.0 and 29.25) and the whole plant (19.50 and 25.75) showed significant increase in the dry shoot weight at 30 g plant-1 application dose. Dry shoot weight was the lowest of 9.62 and 14.88 in the control treatments both in the spring and fall, respectively. The highest (19.50 and 26.13) increase in the dry weight was recorded at 30 g plant-1 in both growing seasons (Table 7.4.9).
7.4.10. Effect of dry powder of Fumaria parviflora on fresh root weight of tomato (g) Data in table 7.4.10 indicated significant effect of plant powder, doses and their interaction on fresh root weight of tomato in the spring and fall, 2010 growing season. Amongst the interaction, fresh root weight was minimum of 13.25 and 15.50 g for the leaves powder in the spring and fall, respectively followed by the stem (15.25 and 16.50) at 10 g plant-1 application dose. Fresh weight was maximum in the spring (27.63) and fall (29.06) at 0.0 g plant-1 (control) application dose and minimum (15.56 and 16.75) at 10 g plant-1 dose, respectively.
200
Table 7.4.7. Effect of dry powder of Fumaria parviflora on final nematode populations per 100 g of soil in tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Plant parts Doses Mean
0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
286.3 A† 180.8 CD 156.8 E 74.75 G 174.6 B* Roots 299.0 a‡ 179.5 cd 168.5 de 139.5 e 196.6 c
265.3 B 145.0 E 95.50 FG 82.50 FG 147.1 C Stem 285.3 a 206.0 bc 207.5 bc 180.0 cd 219.7 b
290.0 A 181.3 CD 162.3 DE 191.3 C 206.2 A Leaves 304.3 a 226.0 b 230.8 b 212.8 bc 243.4 a
Whole plant 282.0 AB 264.8 B 98.75 F 142.5 E 197.0 A 298.8 a 205.3 bc 203.5 bc 184.8 cd 223.1 b
280.9 A 192.9 B 128.3 C 122.8 C Mean 296.8 a 204.2 b 202.6 b 179.3 c
†LSD value for plant parts = 10.39 ‡LSD value for plant parts = 17.33 LSD value application doses = 10.39 LSD value for application doses = 17.33 LSD value for interaction = 20.77 LSD value for interaction = 34.67
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
201
Table 7.4.8. Effect of dry powder of Fumaria parviflora on fresh shoot weight (g) of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Doses
Plant parts Mean
0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
22.00 I† 31.25 DE 36.75 C 55.00 A 36.25 A* Roots 34.25 d‡ 47.75 b 51.00 ab 53.00 a 46.50 a
23.00 HI 28.00 EFG 30.00 DEF 37.50 BC 29.63 B Stem 27.00 e 42.25 c 48.00 b 47.75 b 41.25 b
23.50 HI 25.50 GHI 26.50 FGH 27.00 FGH 25.63 C Leaves 27.00 e 39.25 c 47.75 b 49.25 ab 40.81 b
22.00 I 29.50 DEFG 32.25 D 41.25 B 31.25 B Whole plant 28.00 e 40.50 c 48.75 ab 51.50 ab 42.19 b
22.63 D 28.56 C 31.38 B 40.19 A Mean 29.06 c 42.44 b 48.88 a 50.38 a
†LSD value for plant parts = 2.10 ‡LSD value for plant parts = 2.13 LSD value for application doses = 2.10 LSD value for application doses = 2.13 LSD value for interaction = 4.20 LSD value for interaction = 4.26
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
202
Table 7.4.9. Effect of dry powder of Fumaria parviflora on shoot dry weight (g) of tomato infected with Meloidogyne incognita under natural filed conditions of Dargai (spring and fall, 2010).
Doses
Plant parts Mean
0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
9.25 I† 16.75 CD 19.00 BC 27.00 A 18.00 A* Roots 16.00 f‡ 23.50 cd 27.75 ab 29.25 a 24.13 a
10.50 HI 14.20 EF 15.00 DEF 17.75 BC 14.36 B Stem 14.75 f 20.25 de 24.50 bc 25.50 abc 21.25 b
9.25 I 11.63 GH 12.88 FG 13.75 EFG 11.88 C Leaves 14.75 f 17.75 ef 24.25 bcd 24.00 bcd 20.19 b
9.50 HI 14.38 EF 15.25 DE 19.50 B 14.66 B Whole plant 14.00 f 21.75 cde 24.25 bcd 25.75 abc 21.44 b
9.62 D 14.24 C 15.53 B 19.50 A Mean 14.88 c 20.81 b 25.19 a 26.13 a
†LSD value for plant parts = 1.14 at alpha = 0.05 ‡LSD value for plant parts = 2.10 LSD value for application doses = 1.14 LSD value for application doses = 2.10 LSD for interaction = 2.29 LSD value for interaction = 4.20
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
203
7.4.11. Effect of dry powder of Fumaria parviflora on shoot length of tomato (cm) Significant increase in the shoot length of tomato was recorded by the roots, stem, leaves and the whole plant powder of F. parviflora applied at 10, 20 and 30 g plant-1doses in the spring and fall, 2010 trials (Table 7.4.11). The interaction of the roots (48.50 and 55.0) and stem (47.0 and 48.50) with 30 g plant-1 application dose exhibited maximum increase in the shoot length in both the spring and fall trials. Shoot weight was significantly increased when plant doses were increased ten times. The roots powder was superior to all and showed the greatest increase in the shoot length in the spring (41.63) and fall (45.88) trials (Table 7.4.11).
7.4.12. Effect of dry powder of Fumaria parviflora on root length of tomato (cm) Table 7.4.14 revealed significant increased in the root length of tomato exposed to various powdered plant parts of F. parviflora and increasing doses. Root length was increased by 116.94 and 182.22% when exposed to dried roots powder in the spring and fall, 2010, compared with the corresponding control (14.75 and 11.25). The leaves and the whole powder showed non-significant differences in the root length in both growing seasons. Likewise, substantial increase in the root length was observed at 10 (13.69 and 16.69), 20 (16.19 and 19.13) and 30 (20.13 and 22.25) g kg-1 in the spring and fall experiments. All interactions showed a marked increase in the root length at all doses compared with the control (Table 7.4.12).
204
Table 7.4.10. Effect of dry powder of Fumaria parviflora on fresh root weight (g) of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Doses
Plant parts Mean
0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
28.50 A† 18.00 CDEF 19.50 CDE 21.63 BC 21.91 A* Roots 28.50 a‡ 17.75 de 18.50 de 20.75 bc 21.38 a
28.75 A 15.25 FG 18.00 CDEF 18.63 CDEF 20.16 AB Stem 29.25 a 16.50 ef 18.75 cd 19.25 bcd 20.94 ab
29.25 A 13.25 G 15.00 FG 14.75 FG 18.06 B Leaves 29.00 a 15.50 f 17.25 def 18.50 de 20.06 b
Whole plant 24.00 B 15.75 EFG 16.75 DEFG 20.25 BCD 19.19 B 29.50 a 17.25 def 19.25 bcd 21.00 b 21.75 a
27.63 A 15.56 C 17.31 BC 18.81 B Mean 29.06 a 16.75 d 18.44 c 19.88 b
†LSD value for plant parts = 2.11 ‡LSD value for plant parts = 1.07 LSD value for application doses = 2.11 LSD value for application doses = 1.07 LSD value for interaction = 4.23 LSD value for interaction = 2.14
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
205
Table 7.4.11. Effect of dry powder of Fumaria parviflora on shoot length (cm) of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Doses
Plant parts Mean
0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
31.25 HI† 40.75 CDE 46.00 AB 48.50 A 41.63 A* Roots 30.00 i‡ 48.00 b 50.50 b 55.00 a 45.88 a
27.50 I 38.25 DEF 43.75 BC 47.00 AB 39.13 B Stem 29.50 i 41.25 ef 44.00 cd 48.50 b 40.81 b
28.50 I 36.75 EFG 41.75 CD 44.00 BC 37.75 B Leaves 29.50 i 33.75 h 36.25 gh 41.75 de 35.31 d
Whole plant 28.50 I 33.25 GH 34.25 FGH 38.25 DEF 33.56 C 30.00 i 38.75 fg 42.00 cde 44.50 c 38.81 c
28.94 D 37.25 C 41.44 B 44.44 A Mean 29.75 d 40.44 c 43.19 b 47.44 a
†LSD value for plant parts = 2.11 ‡LSD value for plant parts = 1.35 LSD value for application doses = 2.11 LSD value for application doses = 1.35 LSD value for interaction = 4.22 LSD value for interaction = 2.71
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
206
Table 7.4.12. Effect of dry powder of Fumaria parviflora on root length (cm) of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Doses
Plant parts Mean
0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
14.75 CD† 15.25 CD 17.50 BC 21.50 A 17.25 A* Roots 11.25 f‡ 19.50 bc 24.50 a 26.75 a 20.50 a
14.75 CD 14.25 CD 16.00 CD 20.25 AB 16.31 AB Stem 10.25 f 14.75 e 17.25 cde 21.00 b 15.81 b
14.00 CD 15.00 CD 14.75 CD 17.50 BC 15.31 B Leaves 10.50 f 15.25 de 17.25 cde 19.75 bc 15.69 b
Whole plant 13.50 DE 10.25 E 16.50 CD 21.25 A 15.38 B 11.00 f 17.25 cde 17.50 cd 21.50 b 16.81 b
14.25 C 13.69 C 16.19 B 20.13 A Mean 10.75 d 16.69 c 19.13 b 22.25 a
†LSD value for plant parts = 1.84 ‡LSD value plant parts = 1.31 LSD value for application doses = 1.84 LSD value for application doses = 1.31 LSD value for interaction = 3.69 LSD value for interaction = 2.62
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
207
7.4.13. Effect of dry powder of Fumaria parviflora on branches per plant of tomato Data of two seasons showed that the four plant parts at an increasing dose rate of 10, 20 and 30 g plant-1 increased the number of branches plant-1 in 2010. Maximum number of branches plant-1 was recorded in the interaction between the roots at the highest dose (30 g plant-1) which produced 20.0 and 22.50 branches plant-1 compared with the root control (10.0 and 10.25) in the spring and fall. Number of branches plant-1 were maximum at 30 g plant-1 (17.19 and 20.13) and minimum (10.44 and 10.94) at 0.0 g plant-1 (control) in both the spring and fall season. Amongst the plant parts evaluated, the roots produced maximum branches plant-1 in the spring (15.63) and fall (17.81) (Table 7.4.13).
7.4.14. Effect of dry powder of Fumaria parviflora on flowers per plant of tomato Table 7.4.14 indicated significant effect (P < 0.05) of the four plant parts, doses and their interaction on the number of flowers plant-1 in both seasons. Maximum number of flowers plant-1 was recorded from the interaction between the roots (65.0 and 69.50) followed by the whole plant (56.0 and 57.75) in the spring and fall at the highest dose of 30 g plant-1. The interaction between other plant parts and doses were significant. The roots powder yielded maximum number of flowers plant-1 in spring (49.88) and fall (57.75) than all other treatments. Increase in the dose rate directly increased the number of flowers plant-1.
7.4.15. Effect of dry powder of Fumaria parviflora on fruits per plant of tomato The interaction between the plant powder and doses showed significant increase in the number of fruits plant-1 with the highest increase registered for the roots powder in the spring (57.25) and fall (55.25) at 30 g plant-1 application dose (Table 7.4.15). All the plant parts showed significant increase in the fruits number; however, the roots proved more effective and increased the number of fruits by 88.49 and 92.85% in the spring and fall, respectively compared with the corresponding root controls in both seasons. Increase was the greatest (47.44 and 48.31) at 30 g plant-1 in the spring and fall (Table 7.4.14).
208
7.4.16. Effect of dry powder of Fumaria parviflora on fruit weight (kg per plant) Table 7.4.16 indicated significant increase in fruit weight of tomato plant-1 with application of plant powder, increasing doses and their interaction. The interaction of roots powder with the highest dose of 30 g resulted in the maximum fruit weight of 4.82 and 4.74 kg in the spring and fall, respectively. Fruit weight plant-1 was markedly increased with 10 (3.12 and 3.26), 20 (3.49 and 3.75) and 30 g plant-1 (4.25 and 4.35) doses in both seasons. All the plant parts significantly increased the fruit weight plant-1 with the greatest increase recorded for the roots (3.71 and 3.79) followed by the stem (3.38 and 3.65) in the spring and fall (Table 7.4.16).
209
Table 7.4.13. Effect of dry powder of Fumaria parviflora on branches plant-1 of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Doses
Mean Plant parts
0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
10.00 G† 15.00 BCDE 17.50 AB 20.00 A 15.63 A* Roots 10.25 gh‡ 18.75 bcd 19.75 b 22.50 a 17.81 a
11.00 FG 13.50 DEF 13.00 EF 16.00 BCD 13.38 BC Stem 10.00 h 17.50 de 17.75 cde 19.25 bcd 16.13 bc
9.75 G 14.50 CDE 12.75 EF 15.75 BCD 13.19 C Leaves 12.00 g 14.25 f 16.50 e 19.25 bcd 15.50 c
11.00 FG 15.25 CDE 15.00 BCDE 17.00 BC 14.56 AB Whole plant 11.50 gh 16.25 e 18.75 bcd 19.50 bc 16.50 b
10.44 C 14.56 B 14.56 B 17.19 A Mean 10.94 d 16.69 c 18.19 b 20.13 a
†LSD value for plant parts = 1.26 ‡LSD value for plant parts = 0.99 LSD value for application dose = 1.26 LSD value for application doses = 0.99 LSD value for interaction = 2.52 LSD value for interaction = 1.99
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
210
Table 7.4.14. Effect of dry powder of Fumaria parviflora on flowers plant-1of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Doses
Plant parts Mean 0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
34.75 GH† 48.00 CDE 51.75 BCD 65.00 A 49.88 A* Roots 34.75 h‡ 61.25 bc 65.50 ab 69.50 a 57.75 a
33.75 GH 42.25 EF 45.25 DEF 54.50 BC 43.94 BC Stem 30.00 i 46.50 ef 50.50 e 56.75 d 95.94 c
32.00 H 39.75 EFG 46.25 DEF 51.00 BCD 42.25 C Leaves 31.25 hi 40.25 g 42.00 g 44.25 fg 39.44 d
31.50 H 42.25 EF 54.25 BC 56.00 B 46.00 B Whole plant 30.50 hi 48.50 ef 56.25 d 57.75 cd 48.25 b
33.00 D 43.06 C 49.38 B 56.63 A Mean 31.63 d 49.13 c 53.56 b 57.06 a
†LSD value for plant parts = 3.31 ‡LSD value for plant parts = 2.20 LSD value for application = 3.31 LSD value for application doses = 2.20 LSD value for interaction = 6.62 LSD value for interaction = 4.42
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
211
Table 7.4.15. Effect of dry powder of Fumaria parviflora on fruits plant-1of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Doses
Plant parts Mean
0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
22.25 I† 41.75 CD 46.50 B 57.25 A 41.94 A* Roots 21.00 h‡ 39.75 d 46.00 bc 55.25 a 40.50 a
22.75 I 32.25 GH 37.50 EF 45.75 BC 34.56 B Stem 21.75 h 34.00 f 39.00 de 46.00 bc 35.19 c
22.50 I 29.25 H 36.00 FG 41.75 CD 32.38 C Leaves 21.00 h 29.00 g 36.50 ef 43.25 c 32.44 d
22.00 I 34.75 FG 40.50 DE 45.00 BC 35.56 B Whole plant 21.75 h 37.75 de 46.25 bc 48.75 b 38.63 b
22.38 D 34.50 C 40.13 B 47.44 A Mean 21.38 d 35.13 c 41.94 b 48.31 a
†LSD value for plant parts = 2.11 ‡LSD value for plant parts = 1.56 LSD value for application dose = 2.11 LSD value for application doses = 1.56 LSD value for interaction = 4.23 LSD value for interaction = 3.12
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
212
Table 7.4.16. Effect of dry powder of Fumaria parviflora on fruits weight (kg) plant-1 of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Doses
Plant parts Mean
0 g plant-1 10 g plant-1 20 g plant-1 30 g plant-1 (control)
2.62 GH† 3.47 CD 3.92 B 4.82 A 3.71 A* Roots 2.90 e‡ 3.57 bcd 3.95 b 4.75 a 3.79 a
2.50 H 3.07 EF 3.47 CD 4.47 A 3.38 B Stem 2.87 e 3.30 cde 3.70 bc 4.75 a 3.65 ab
2.52 H 2.95 FG 3.20 DEF 3.72 BC 3.10 C Leaves 2.90 e 2.97 e 3.65 bcd 3.90 b 3.35 c
2.70 GH 2.97 FG 3.37 CDE 4.00 B 3.26 BC Whole plant 2.92 e 3.20 de 3.70 bc 4.00 b 3.45 bc
2.58 D 3.12 C 3.49 B 4.25 A Mean 2.90 d 3.26 c 3.75 b 4.35 a
†LSD value for plant parts = 0.18 ‡LSD value for plant parts = 0.24 LSD value for application doses = 0.18 LSD value for application doses = 0.24 LSD value for interaction = 0.36 LSD value for interaction = 0.48
†Upper case values represent data recorded during spring 2010, ‡Lower case values represent data recorded during the fall, 2010
*Means in the same columns and rows followed by different letters are significantly different at P < 0.05 according to Fisher’s protected LSD test.
213
VIII. DISCUSSION
In the present studies, the major tomato growing areas of the Khyber Pakhtunkhwa province of Pakistan were surveyed. Root knot nematodes Meloidogyne spp., were collected from ten major tomato growing localities of this province and were identified using molecular and morphological tools. Three species of Meloidogyne viz., M. incognita, M. javanica and M. arenaria were identified at the James Hutton Institute (JHI), Dundee, Scotland, UK; M. incognita was used in further studies. Nematicidal potential of the plant extracts and pure compounds isolated from the roots of a medicinal annual herb (Fumaria parviflora) against M. incognita were studied. Phytochemical screening of the plant was done at the JHI, UK. Meloidogyne incognita was managed in tomatoes grown in screen house and farmer field using extracts and dry amendments from F. parviflora.
8.1. Occurrence and distribution of Meloidogyne species In our study the occurrence of M. incognita, M. javanica and M. arenaria alone or in mixtures from samples collected from 30 tomato production fields demonstrated the widespread distribution of these species in the Malakand divisions. All three most common species viz. M. javanica, M. incognita and M. arenaria were found associated with tomato crops (Gul and Saeed, 1990). Meloidogyne incognita has been graded first by these authors with respect to geographical distribution and host range (Taylor et al., 1982). However, in the present survey M. javanica was found to be more widely distributed than M. incognita. Meloidogyne incognita has been reported to constitute about the 64 % of the total RKN infestations (Sasser, 1979) on a global basis. In the present study this species was recovered in 56.66% of the samples whereas M. javanica was recovered in 70.33% of the samples. Gul and Saeed (1990) also reported similar results from their survey of root knot nematodes in the Khyber Pakhtunkhwa province formely called North West Frontier Province (NWFP). They reported M. javanica, two races of M. incognita (R-1 and R-2) and both races of M. arenaria. In addition, they also reported a 32% occurrence of M. incognita in their samples. More recently, Ateeq-ur-Rehman (2009) reported 80.7% and 46.15% frequencies of M.
214
incognita and M. javanica from Punjab province, respectively. This variability may be attributed to particular soil types and the environmental conditions of the study area. In other parts of the country for example Punjab, Sindh and Karachi, M. incognita has been found to be the dominate species (Ahmed and Saeed, 1981). These areas have sandy soil with sand consisting of more than 70% whereas in most parts of the Khyber Pakhtunkhwa the soil comprised of 50% sand (Gul, 1988). In Khyber Paktunkhwa, RKNs were isolated first time from cabbage (Brassica oleraceae L. cv. capitata) at the Agricultural Research Institute, Tarnab by the Brown (1962). However, he did not identify these nematodes to the species level. Kafi (1963) reported Meloidogyne species, however, he did not mention the species occurring in the Khyber Pakhtunkhwa. Ahmad and Saeed (1981) reported four species from this province including M. hapla from the cooler regions, whereas Hussain (1982) collected Meloidogyne populations from Peshawar, Mardan and adjacent areas which were identified as M. javanica and M. incognita. Khan et al. (1985) reported root knot nematodes from Pirsabak; however, more comprehensive information about the occurrence and distribution of root knot nematodes in the Khyber Pakhtunkhwa province were presented by Gul (1988). All the species of RKNs either singly or jointly are involved in yield losses of tomato ranging from 24-38% (Sikora and Fernandez, 2005). In our study the high prevalence and incidences of these nematodes suggest their importance as a potential threat to tomato production in the frost free zones of Malakand divisions. The major tomato growing areas particularly the Dargai and Jabban are surrounded by the Malakand hills which protect the winter tomato crops from frost and tomatoes are grown successfully. These areas supply tomatoes to two major districts (i.e Peshawar and Mardan) from November to January where there is no tomato production during winter are grown. Dargai and Jabban soil in particular have great quantity of sands and gravel (Gul, 1988) and is most suitable for the disease development. In our study the maximum incidence in Jabban, Dargai, Batkhela and Heroshah was due to the sandy loam soil and favourable environmental conditions prevailing in these areas (Gul, 1988). Soil type is a key edaphic factor that may affect the damage potential of RKN species (Jain, 1992; Siddiqui and Mahmood, 1998). Soil type or texture has strong
215
effect because it influences movement of nematodes for hosts searching (Prot and Van Gundy, 1981), root penetration (Koenning and Barker, 1995), reproduction (Robbins and Barker, 1974), increase in nematode population densities in fields (Sleeth and Reynolds, 1978), relationship between crop productivity and pre-plant population densities (Koenning and Barker, 1995) and magnitude of damage by nematodes (Zirakparvar, 1980). In our study, fields with minimum infestation of root-knot nematodes, located at Peshawar and Malakandher might be due to silt loam and clay soil type mostly found (Ogbuji, 2004). Clay soil has undesirable pore sizes and poor aeration which probably result in poor nematode multiplication and movement (Young and Heatherly, 1990). The low nematode population in the clay soils might be due to reduced reproduction due to minimal oxygen concentration (Van Gundy et al., 1962) and higher moisture level (Wallace, 1971); the climate of Peshawar and nearby areas is very tropical, hot and dry. Other possibilities for the low population of RKNs in these areas could be the long persistence of dry soil and hot weather conditions which adversely affect Meloidogyne spp. (Taylor et al., 1982). Meloidogyne incognita and M. javanica were found in greater numbers in tomato fields of Dragai and Jabban than other tested areas. Intensive cultivation of tomato on the same piece of land may have increased these pathogens in the areas. Ateeq-ur-Rehman (2009) reported that monoculture intensified nematode disease damage on tomato crops in Punjab. Another factor for higher nematode density and severe incidence might be the use of susceptible rotation crops like okra and egg plants by the growers. The information collected from growers revealed that most of the fields surveyed had been under intensive vegetable cultivation for several years, which increased the RKNs infestations (Stirling and Nikulin, 1998). Our findings agree with those of others who have reported that these nematodes are widely distributed in the vegetable growing regions of Pakistan (Khan et al., 2006; Anwar et al., 2007; Shahid et al., 2007).
216
8.2. Molecular and morphological identification of Meloidogyne species Meloidogyne spp. show extensive variations in morphology both among and within species, making their identification hard. The perineal pattern technique has been used to describe Meloidogyne spp., however, alterations in this trait at species and population level has been reported (Einsenback, 1982). For example, some Meloidogyne species can be identified by their host-specificity, such as M. carolinensis, which has only two host species (Hartman and Sasser, 1985), but identification cannot only be based on host specificity (Einsenback, 1982). Others factors that can make identification hard is high resemblance between eminent species such as M. incognita, M. javanica, M. arenaria and M. hapla (Hartman and Sasser, 1985). Although provisional identifications can be made using morphology (perineal patterns, head shape of males, stylet morphology of males), accurate identification of RKN should be based on combining both morphological data with differential host tests (Eisenback et al., 1981). Although morphological and morphometric data can be very helpful for tentative identification, however, it may not be enough to differentiate RKNs and their physiological/cytological races as they are closely related (Zijlstra, 2000). As more root knot nematode species can concurre in the same plant roots, rapid and accurate identification of RKNs is needed for management and breeding (Powers and Harris, 1993). Molecular information can complement morphological data in the identification process, particularly for Meloidogyne species (Moens et al., 2009). Species identification of plant parasitic nematodes is the most important step in monitoring their infections in order to develop strategies to control the nematodes in the field (Blok and Powers, 2009). In the present study, RKN species, M. incognita, M. javanica and M. arenaria from Khyber Pkhtunkhwa, Pakistan, were identified using rDNA primers, species-specific (SCAR primers), C2F3/1108 (mtDNA) primers and RAPD. Sequencing of the 28S rDNA of some selected RKN populations was performed using D2A and D3B primers. Moreover, PCR-RFLPs employing 4-bp and 6-bp restriction enzyme digestion of the COII/lrRNA gene of mtDNA from M. javanica, M. incognita and M. arenaria were performed. The molecular diagnostic key designed by Adam et al., (2007) for identification of seven Meloidogyne spp. was followed and various primer sets were used to identify
217
RKNs. The D2-D3 of 28S of rDNA gene and ITS2 region between 5S and 18S rDNA genes were amplified with D2-D3 and 194/195 primers respectively. The multi-copy basis of rDNA offers ample target for PCR amplification, and adequate variation and stability occurs within it for consistent discrimination of most species (Zijlstra et al., 1995; Hugall et al., 1999). These primers successfully amplified their corresponding fragment from single J2 or female of RKN from only 1/30 of the DNA extract. Similar results were reported by Adam et al. (2007). Blok et al. (1997) also reported the specificity of these primers with 22 isolates of M. javanica, M. arenaria, M. incognita and M. mayaguensis. Species-specific primers (SCARs) have been designed and used by many researchers (review by Blok and Powers, 2009) to PCR-amplify diagnostic repetitive regions of sequence: sequence characterized amplified regions (SCARs). The species- specific SCAR PCR is an easy method which amplifies a characteristic sequence from each species. Three pairs of species-specific SCAR primers, Finc/Rinc (M. incognita), Fjav/Rjav (M. javanica) and Far/Rar (M. arenaria) (Zijlstra, 2000) have been reported to give consistent results and produce successful PCR products. The species-specific SCAR primer (Finc/Rinc) intended for diagnosis of M. incognita efficiently produced the expected DNA product (1200 bp) in all M. incognita lines (L3, J2, J4, F1, F3 and F4). A 670 bp product typical of M. javanica was produced by 20 lines of M. javanica (M1, M2, M3, M4, J1, J3, F2, T1, T2, T3, W1, W2, W3, R1, R3, Q1, Q2, Q3, H2 and E1). Meloidogyne arenaria produced a typical product of 420 bp in lines R2, H1 and E2. The identification of lines L1 and L2 in population 1 remained unclear using SCAR primers. The specificity of these primers (Fjav/Rjav, Far/Rar and Finc/Rinc) have been reported for 15 populations of RKN belonging to seven species by Adam et al. (2007), 33 isolates of seven species of RKN by Zijlstra (2000), 95 populations of RKN belonging to three species by Devran and Mehmet (2009), four species of RKN by Keun-Oh (2009) and Meng et al. (2004) found with 42 isolates of five RKN species. In our study the 28S nuclear rDNA gene fragment from M. javanica, M. incognita and M. arenaria was amplified using DNA extracted from single females with primer-pair D2A and D3B (Chen et al., 2003; Tigano et al., 2005). Sequence analysis with D2A and D3B primer pairs showed the highest similarity between these
218
closely related species. The mitotically parthenogenetic root-knot nematodes M. arenaria, M. incognita, and M. javanica have relatively little sequence variation in their internal transcribed spacer (ITS) regions for species differentiation (Blok, 2005). De Ley et al. (1999) also studied ITS1, 5.8S, and ITS2 rDNA sequences from several Meloidogyne spp., including M. hispanica, and verified that a group of species (M. hispanica, M. incognita, M. javanica, M. morocciensis, and both races of M. arenaria) have nearly identical ITS region sequences. Diagnostic resolution of D2/D3 is insufficient to discriminate between some of the most closely related, most problematic and economically most damaging species. Although good phylogenetic resolution can be obtained for more distantly related species, relationships within species groups cannot always be resolved, and it may be more appropriate to analyze these with multiple loci and/or with longer sequence stretches. The mtDNA is an excellent source for genetic markers for population genetics and species identification (Hu and Gasser, 2006; review of Blok and Powers, 2009). Multiple copies of the circular mitochondrial genome are restricted to each cell which provide ample template for PCR assays. Amplification of the COII/lrRNA region of mtDNA with C2F3/1108 primers successfully discriminated important species of root- knot nematodes (Orui, 1998; Powers and Harris, 1993). Han et al. (2004) operated this diagnostic technique for the discrimination of three RKN species collected from Korea, USA and China. In the case of M. arenaria, the size of PCR product in the COII/lrRNA region was 1.1 kb for the USA and 1.7 kb for both the Korean and Japanese isolates, whereas the Chinese isolates showed both size of the PCR products, indicating that the Chinese isolates have both genotypes. The size variability of PCR products among M. arenaria isolates from these countries was suggestive of intraspecific variation. Our results with M. arenaria mtDNA are similar to those reported by other researchers (Haroon et al., 2003; Han et al., 2004; Jianhua et al., 2004; Powers et al., 2005; Keun- Oh et al., 2009). In this study we utilized C2F3 and 1108 primers with 31 lines from eleven populations/isolates of RKNs belonging to three different Meloidogyne spp. A 1.7 Kb fragment was amplified in all the tested populations of M. javanica, M. incognita and M. arenaria. The region (COII/lrRNA) of two lines L1 and L2 failed to amplify with C2F3/1108 primers and they were amplified with the RAPD primers.
219
Restriction fragment length polymorphism (RFLP) within nematodes was first discovered in the repetitive component of total cellular DNA prepared from two different strains of C. elegans and C. briggsae (Emmons et al., 1979). The restriction analysis of Steinernema and several Meloidogyne spp. (Curran et al, 1986; Curran and Webster, 1987) cellular DNA also revealed striking polymorphisms. Fragment length polymorphism within nematode mtDNA was first discovered in Meloidogyne spp. (Powers et al., 1986). In our study, PCR-RFLP of M. javanica with Hinf 1 revealed results differing from those of a previous study (Power and Harris, 1993) and this might be related to the emergence of a new regional subtype. The restriction enzyme Taq 1 did not cleave mtDNA and failed to generate any specific banding pattern for Meloidogyne species. The enzymes Mbo 1 and Eco R1 produced five and three-banded patterns for three Meloidogyne spp., respectively, however, did not distinguish all the three species, whereas Alu 1 recognized many restriction sites and produced multiple banded patterns in M. incognita. Hugall et al. (1994) screened mtDNAs of Meloidogyne spp.,with up to 16 restriction enzymes (Bam H1, BgZII, AvaII, BcZI, SpeI, HinPI, MspI AZuI, DdeI, DraI, HindIII, XbaI, MboI, TaqI, HinfI, EcoRI) to identify those revealing polymorphism and obtained consistent patterns and maximum polymorphism with Mbo1 and Hind III. Powers and Sandall (1988) found considerable variation in mtDNA restriction fragment patterns within and among 12 isolates representing different species and host races of Meloidogyne and this provided the basis for a subsequent assay using PCR and diagnostic Hinf I polymorphisms (Harris et al., 1990). The analysis and use of restriction fragment length polymorphisms (RFLPs) is greatly enhanced where the variable sites can be located, either by restriction site mapping (Dowling et al., 1990) or by reference to a sequence (Cann et al., 1984). The RAPD PCR technique was utilized to successfully differentiate among three important RKN species M. arenaria, M. incognita and M. javanica and was found as a valuable DNA fingerprinting technique to evaluate genetic variations among different populations of root-knot nematodes (Blok et al., 1997; Randig et al., 2002, Adam et al., 2007). This technique is particularly useful when one or more unknown RKNs are present in the same soil sample. In this study, the RAPD primer, SC10-30, OPG-13 and OPG-19 were used. Consistent RAPD patterns with these primers were obtained from a
220
single J2 or female. Adam et al. (2007) obtained consistent RAPD patterns with SC10- 30, OPG-13 and OPG-19, however, obtained inconsistent patterns with other RAPD primers. In the current study, the RAPD patterns of the lines L1 and L2 were different from those of M. incognita, M. javanica and M. arenaria. The DNA of these lines was probably degraded due to the presence of inhibitors or sample impurities. Williams et al. (1993) reported that inconsistent RAPD patterns or fluctuations in the pattern produced can result from differences in DNA concentration, sample impurities, Taq polymerase source, or differences in the operator techniques or themocycler. In the present study minimum variation between and within the RKN species were revealed using RAPD primers and in general they were closely related. That is why all the three mitotic species viz. M. incognita, M. javanica and M. arenaria were grouped together during cluster analysis. M. javanica and M. arenaria were grouped (50 %) more closely than M. incognita (42.8 %). Adam et al. (2005) reported that M. javanica and M. arenria grouped together with 62.5 % average similarity. Similar results have been reported by Blok et al. (1997) and Castagnone-Sereno et al. (1995). In general, we found no variations in M. incognita and M. arenaria populations; however, we observed low intraspecific variability in M. javanica populations. Semblat et al. (1998) and Dautova et al. (2001) also reported more variations in M. javanica than M. incognita but they also reported that M. arenaria was the most variable species. However, we observed low variability among M. javanica populations, indicating that M. javanica populations of the Khyber Pakhtunkhwa regions were homogenous. Tigano et al. (2010) demonstrated intraspecific variability in M. enterolobii using three different neutral markers viz. ISSR, AFLP and RAPD and reported that isolates of M. enterolobii were more homogenous. Randing et al. (2002) observed 67.5% similarity in populations of M. arenaria, M. exigua and M. hapla using RAPD markers. In contrast, Carneiro et al. (2004) observed only 8.6% genetic diversity between two isolates of M. exigua from coffee farms in Brazil, using RAPD markers. According to Anderson et al. (1998) different molecular markers may reveal different patterns of genetic structures within plant-parasitic nematodes. RADP markers that are different among different species can be developed into sequence characterized amplified region (SCAR) markers (see above) that can be effectively used for the diagnosis of important pests such as
221
Meloidogyne species (Blok and Powers, 2009). Their specificity and sensitivity varies and depends on the number of species and isolates evaluated. The three species, M. javanica, M. arenaria and M. incognita have a common mode of reproduction, which is mitotic parthenogenesis, and are polyploid, which is supported by their close similarity obtained with the RAPD results. Two of the temperate species M. chitwoodi and M. fallax in the RAPD experiments clustered together with low similarity. Similar results were found by Blok et al. (1997) and Adam et al. (2005). These two species are diploid and reproduce by facultative meiotic parthenogenesis (van der Beek and Karssen, 1997). As a whole the RAPD technique provides a further tool which can be applied to individuals from different life stages to aid in identification of this important group of plant parasitic nematodes (RKN) and has the capability to be applied to other groups of nematodes. The application with second stage J2 is especially useful as this stage is most readily available in field samples and can easily be obtained from eggs.
8.2.3. In vitro and in planta studies investigating the nematicidal potential of the crude extracts of Fumaria parviflora The objective of the present study was to explore the nematicidal properties of the root and stem extracts of F. parviflora against M. incognita. The results of our in vitro and in planta studies suggested that the root and stem extracts of F. parviflora at all concentrations studied had nematicidal activity. The various organic compounds from a single plant tissue can confer synergistic nematicidal properties, leading to high nematode mortality (Chitwood, 2002). The solvents used in our study (n-hexane,
EtOAC, CHCl3 and MeOH) have been observed by other for the isolation of nematicidal compounds from a number of plants, for example, Impatiens bicolor Royel against M. incognita and M. javanica (Qayum et al., 2011). Our results showed that the alkaloids, glycosides, phenolics, tannins and saponins were the active components of the roots and stem, whereas the roots had two additional constituents; viz., flavonoids and steroids. The nematicidal activity could be attributed to these bioactive compounds of F. parviflora jointly or separately. Our results agreed with those of Rao et al. (2007), who reported the presence of alkaloids, flavonoids, glycosides, tannins, saponins,
222
steroids and triterpenoids in F. parviflora. The main alkaloids of F. parviflora are protopine, fumarizine, papraine, papracine papracinine, paprafumicine and papraraine (Rao et al., 2007). Results of our in vitro study revealed that the solvent extracts of the roots and stem of the plant had strong nematicidal effects on J2s and eggs of M. incognita and these effects increased with increase in concentration and exposure time. These results are similar to those reported by other researchers, who reported 59 % mortality of J2s of M. javanica using crude ethanolic extracts from the leaves and shoots of F. indica (Abid et al., 1997). Results further revealed that the n-hexane extracts of the roots and stem were the most active, leading to 100% J2s mortality and hatch inhibition. Likewise, similar results were obtained by our in planta studies, where the application of n-hexane extracts at all concentrations reduced the disease and increased the growth parameters. This could be explained by the presence of active phytochemical constituents, mainly the tannins in the n-hexane extracts of the roots and stem, as demonstrated by phytochemical screening. Although, in the present study the steroids and flavonoids were not detected in the stem extracts, the combination of all the three compounds (viz., steroids, flavonoids and tannins) performed better in an in planta experiment. The tannins of the extracts of F. parviflora have previously been reported to possess anthelmintic activity against gastrointestinal nematodes (Athanasiadou et al., 2001). These authors suggested that tannins have the capacity to bind to proteins that could operate via several mechanisms. Condensed tannins may bind to the cuticle of the larvae, which is high in glycoproteins and cause their death. The nematostatic effects of tannins from chestnut (Castanea sativa) against the juveniles of M. javanica have been reported (Maistrello et al., 2010), as well as, the potential of flavonoids and steroids (found in our n-hexane fraction on Meloidogyne spp. (Chitwood, 2002). Tannins could have a synergistic effect in J2s mortality and hatch inhibition because the J2s and the eggs did not move or hatch after transfer them in water for 3 days. The MeOH extracts from the roots and stem were the second most effective in increasing J2s mortality and hatch inhibition at all the tested concentrations. This has been also shown in the methanolic extracts of Melia azedarach fruit against M. incognita by Ntalli et al. (2010). The CHCl3 extracts of the roots and stem at all concentrations revealed encouraging results. The phytochemical screening of these
223
extracts revealed the presence of alkaloids and saponins with the higher quantity being detected in the roots (0.9 ± 0.04 and 1.3 ± 0.07 % dry plant material, respectively) than in the stem (0.5 ± 0.03 and 0.9 ± 0.08 % dry plant material, respectively). The alkaloids of F. parviflora possessed anthelmintic activity, possibly by intercalating with DNA and inhibiting its synthesis (Maqbool et al., 2004). Our results revealed that the EtOAC extracts of the roots and stem have nematicidal activity and this could be attributed to the presence of glycosides, as was manifested by the phytochemical screening of the corresponding extracts of F. parviflora. The flavone-C-glycoside, lantanoside, exhibited 90 % mortality within 24 h at a concentration of 1 % against M. incognita (Chitwood, 2002). Two glycosides (schaftoside and isoschaftoside) isolated from the ethanolic extracts of Arisaema erubescensi (Wall.) Schott. tubers, possessed strong nematicidal activity against M. incognita (Du et al., 2011). Results of our in vitro study were further strengthened by equivalent data obtained from in planta experiments, where the application of root and stem extracts significantly influenced the parameters in nematode parasitism (number of galls, galling index, egg masses g-1, eggs g-1 and RF) and plant parameters (plant height, fresh and dry shoot weight and number of branches). These studies suggest that different plant extracts from the same plant species have varied nematicidal effects. These varied effects could be due to the presence of different classes and compositions of active compounds present in these extracts (Abid et al., 1997). For example, in our study the better efficacy of n-hexane extracts of the roots and stem could be related to the presence of the greater number of active compounds, as shown by the TLC analysis. As is clear from the TLC analysis the number of active compounds, for example the non alkaloids and the alkaloids, varied between the stem and roots. Kolapo et al. (2009) also reported that the concentration of phytochemicals (saponins, tannins, alkaloids phenols and steroids) varied greatly within different plant parts and this supports our results related to the concentration of total phenolic contents and saponins. It is hypothesized that these secondary metabolites contribute to the defense of the plants against pests and pathogens. Our results conclude that many naturally occurring plant derived compounds possess nematicidal activity. The beneficial effect of natural phytochemicals thus reveals a promising area of nematode management. Fumaria parviflora has a potential as a bio-nematicide because
224
of the richness and diversity of compounds effective against Meloidogyne spp. However, more intensive research is required on the mode of action, range of activities (structure activity relationship) and mechanisms involved in the nematode suppression with compounds found in F. parviflora.
8.2.4. In vitro nematicidal bioassays of the pure compounds isolated via activity- guided fractionation Many plant constituents and secondary metabolites have been investigated for activity against plant parasitic nematodes (Kim et al., 2008). A series of nematicidal substances of plant origin such as triglycerides, sesquiterpenes, alkaloids, steroids, diterpenes and flavonoids have been identified (Chitwood, 2002). In the present study the roots and stem extracts of F. parviflora prepared in four different solvent systems (viz., n-hexane, ethylacetate, chloroform and methanol) were screened for nematicidal activity against M. incognita. Based on bioassay-guided fractionation, the n-hexane and methanol roots fractions were subjected to silica gel column chromatography using solvent mixtures (n-hexane:ethyl acetate and chloroform:methanol) in increasing order of polarity. Similar solvent system (i.e n-hexane, ethylacetate, chloroform and n- butanol) has been used by others for the extraction of nematicidal compounds from Cinnamomum cassia bark and the n-hexane extract at 5mg ml-1 showed strongest nematicidal activity against pinewood nematode (Nguyen et al., 2009). In the present study as many as eleven sub-fractions (F1 to F11) obtained from root n-hexane fraction were evaluated for in vitro nematicidal bioassay at four increasing concentrations (100, 200, 300 and 400 μg mL-1). The nematicidal activity was augmented directly with increase in concentration. Results demonstrated effective nematicidal potential of all fractions whereas the two fractions (F3 and F4) showed strongest nematicidal activity at the highest concentration against J2s (98.75 and 90.25) and eggs (95.00 and 86.00) in comparison to distilled water used as negative control (8.25 and 9.25), respectively. Stem extracts of Inula viscosa (Asteraceae) has been found to possess nematicidal activity against M. javanica (Oka, 2001). Crude ethanol extracts of Evodia rutaecarpa unripe fruits exhibited toxicity against M. incognita (Liu et al., 2012) whereas more recently Pavaraj et al. (2012) measured nematicidal activity
225
against M. incognita under varying concentration (10-100 ppm) and exposure time (24, 48 and 72 hr) using methanol, chloroform and n-hexane extracts. In the present study the highest nematicidal activity of the fractions F3 and F4 was attributed to the presence of active compounds. The F3 and F4 fractions when purified through pencil column chromatography, yielded nonacosane-10-ol (ISH-3) and 23a-homostigmast-5-en-3ß-ol (ISH-34), respectively. The former compound was even more toxic than Carbofuran used as positive control, and showed 6.2 and 2.98% increase in J2s mortality and hatch inhibition. Nonacosane-10-ol (C29H60O) was white amorphous, opaque, waxy and odorless compound (n-hexane) with melting point of 81-82 ˚C (Choi et al., 1996). Nonacosane occurs naturally, however, can be prepared synthetically and has been identified in several essential oils (Bentley et al., 1995). This compound has been reported to be an integral part of a pheromone of Orgyia leucostigma and evidence suggested that it played role in the chemical communication of several insects including the female Anopheles stephensi mosquito (Brei et al., 2004). To our knowledge, this compound has not been evaluated previously for nematicidal activity. The highest activity of nonacosane-10-ol against larvae and eggs of M. incognita could be attributed to the presence of -OH group at C-10 position. These results agreed with previous findings that indicated that alcohols and aldehyde were more reactive than other hydrocarbons and ketones (Choi et al., 2007). The nematicidal and herbicidal activity of many trans- cinnamyl alcohol and allyl alcohols is well reported (Kim et al., 2008). Many research findings revealed that nematicidal activity of the compound with hydroxyl group (-OH) or methoxy group (OCH3) has shown stronger activity than acetyl group (Park et al., 2007). Many plant derived polyacetylenes occur as alcohols (C8 to C18) and have been shown to possess activity against bacteria, fungi, viruses, protozoa and many vertebrates and invertebrates (Chitwood, 2002). The other pure compound (23a-homostigmast-5-en-3ß-ol) yielded by F4 root fraction (n-hexane) ranked second in nematicidal activity. The 1H and 13C NMR spectral data of this compound was in close agreement with ß-sitosterol, (Ageta and Ageta., 1984) however, difference between the former compound and ß-sitosterol was the presence of one extra -CH2 group at δ 20.79 (CH2-23). Beta-sitosterol, stigmasterol, campesterol, organic acid such as caffeic acid and fumaric acid have been reported from
226
Fumaria indica, (Hausskn.) Pugsley; Fumariaceae (Rao and Mishra, 1997). In the present study the juvenile mortality and hatch inhibition recorded with this compound was 90.25 and 86.0% at 400 μg mL.-1 These results are in close agreement to those who reported 74.4% mortality against J2 of M. incognita by applying mixture of ß-sitosterol and stigmasterol of Mucuna aterrima at 5.0 μg ml-1 (Barbosa et al., 1999). The antimicrobial activity of ß-sitosterol and ß-sitosterol glucoside against Streptococci, Gram positive and Gram negative bacteria and antifungal activity is well documented (Ramya et al., 2008). The F11 root (n-hexane) from F. parviflora showed nematicidal activity against J2 (90.25) and hatch inhibition (88.25) in comparison to distilled water used as control (8.25 and 9.25). This compound was pale yellow in color with melting point of 210-215 oC. All other fractions (F2, F5, F6, F7, F8, F9, F10 and F11) showed good nematicidal potential. The gas chromatography-mass spectrometry (GC/MS) analysis revealed the presence of high molecular weight tannins (Data unpublished). Tannin solutions have been reported to possess nematicidal activity against M. javanica and Globodera rostochiensis (Renco et al., 2012). Tannins may be formed by polymerization of quinone units. Their mode of antimicrobial action may be related to their ability to inactivate microbial adhesions, enzymes, cell envelope transport proteins etc. At least two studies have shown tannins to be inhibitory to viral reverse transcriptase (Nonaka et al., 1990). Tannin natural products from many plants have been reported to possess anthelmintic activity for gastrointestinal nematodes in ruminants (Hoste et al., 2006). The methanol root fraction of F. parviflora yielded seven sub-fractions (FM2.1, FM2.2, FM2.3, FM2.4, FM2.5, FM2.6 and FM2.7) and an aqueous fraction (FM3). All fractions showed nematicidal activity, whereas FM2.1 and FM2.6 were excellent. The former fraction caused a significantly higher mortality than Carbofuran, and showed 100 and 99.75% juvenile mortality and hatch inhibition against M. incognita. TLC and GC/MS analysis of all these fractions confirmed the presence of one or a few alkaloids found all together (Data unpublished). Only FM2.1 was further characterized and its structure was elucidated using 1H and 13C NMR. This fraction yielded a known pure isoquinoline alkaloid in two isomeric forms i.e trans-protopinium and cis-protopinium,
227
both occurred in 2:1 at 25 oC. The former one was more stable than the later and occurred 100% at 80 oC (Tousek et al., 2005). Previously as many as 33 alkaloids including protopine, protoberberine, benzylisoquninoline have been isolated from Fumariaceae. Ioquinoline alkaloids of F. parviflora included protopine, sanguinarine, cryptopine, d-bicuculline, fumaridine, fumaramine, papraine, papracine, papracinine, paprafumicine and papraraine (Al- Shaibani et al., 2009). In addition, many other biogenetic precursors for example tetrahydroprotoberberine sinactine have been determined in F. parviflora (Sasu et al., 2002). Most of these alkaloids and their derivates have been evaluated for antibacterial, antifungal and antiviral activity (Orhan et al., 2007). However, there are no reports available in the literature about the nematicidal activity of pure alkaloids of F. parviflora. Study indicated that the anthelmintic activity of F. parviflora could be attributed to the presence of these alkaloids, particularly the protopine (Maqbool et al., 2004; Al-Shaibani et al., 2009). Nematicidal activity of two alkaloids viz., aloperine and Δ11-dehydroaloperine separated from extracts of Sophora alopecuroides has been reported (Xiao-Ping et al., 2000). Three alkaloids evodiamine, rutaecarpine and wuchuyamide I isolated from Evodia rutaecarpa fruits showed strongest nematicidal activity against M. incognita (Liu et al., 2012). Three isoquinoline alkaloids viz., chelerythrine, sanguinarine and bocconine from Bocconia cordata (Papaveraceae) showed nematotoxic effect at 50-100 μg ml-1 concentration against the free living nematodes Rhabditis sp. and Panagrolaimus sp. (Onda et al., 1970). In addition, three pyrrolizidine alkaloids i.e heliotrine, lasiocarpine and senecionine from Ageratum sp. (Compositae), Chromolaena odorata (Compositae) and Senecio jacobaea (Compositae) have nematicidal, ovicidal and repellent effects on different nematodes such as M. incognita and H. schachtii, Pratylenchus penetrans and Rhabditis sp. (Thoden et al., 2007, Thoden et al., 2009). Study has shown that the Pyrrolizidine alkaloid monocrotaline from Crotolaria spectabilis (Fabaceae) inhibited movement of M. incognita at 10 μg ml-1 (Fassuliotis and Skucas, 1969). Likewise a pantacyclic alkaloid serpentine separated from a medicinal plant (Catharanthus roseus, Apocynace) induced death and inhibited hatching of M. incognita at 0.2% (Chandravadana et al., 1994). In addition, the
228
alkaloids of Fumaria spp. have shown antioxidant, antiparasitic (Hordegen et al., 2003) and anticholinesterase activity (Orhan et al., 2004). In the present study the aqueous fraction of the methanol residue (FM3) showed significantly lower activity than the alkaloids fractions, thus justifying the safe use of aqueous solution of F. parviflora as an oral suspension. Leaf powder or extract of this medicinal weed is used locally as blood purifier (Maqbool et al., 2004). There are many reports which indicated that F. parviflora has shown promising biological and pharmacological properties such as antipyretic, hypoglycemic, hepatoprotective, analgesic and anthelmintic properties (Maqbool et al., 2004). Study revealed that transcuticular diffusion is a general way of entry of non- nutrient and non-electrolytes substances in nematodes or helminth parasites. It has been shown that this is a principal route for the uptake of anthelmintics and extracts by different nematodes, cestode and trematode parasites in comparison to oral ingestion (Geary et al., 1999). In our study,a possible explaination for better activity of methanol or n-hexane extracts compared to aqueous extracts on juveniles could be easier transcuticular absorption of these organic extracts into the body of nematodes than the aqueous extracts. Similar results were reported by Al-Shaibani et al. (2009). Phytochemicals separated from F. parviflora possessed high nematicidal activity. Further investigations on the mode of action and structure activity relationship of these compounds isolated from this medicinal weed plant should be carried out on root knot and other phytonematodes.
8.2.5. Effect of dry powder of Fumaria parviflora in the screen house trials The screen house study conducted in the spring and fall, 2010 aimed at to investigate the potential of Fumaria parviflora against root knot nematodes. Soil amendment with dry powder of the plant parts (roots, stem, leaves and the whole plant) applied in an increasing dose of 10, 20 and 30 g kg-1 showed nematicidal effect against M. incognita in tomato. Results of this study demonstrated that variation in reduction of number of galls per plant and galling indices (GI) was positively influenced by different application doses of the dry plant powder. Significanlty high reduction in number of galls per plant (46.63 and 61.13) and galling indices (2.33 and 2.96) were observed in
229
the treatments amended with the roots powder. Other plant parts (stem, foliage and the whole plant parts) effectively reduced number of galls per plant and GI. Tariq et al. (2007) achieved similar results amending the soil with 0.1, 1 and 5% (w/w) dry powder using leaves, stem of mangrove (Avincennia marina (Forsk) Vierh). They reported that all plant parts of A. marina were effective against M. javanica, however, maximum inhibition of knots were obtained on okra and mash bean at a 5% dose rate. Similar results were reported by Mehdi et al. (2001) in tomato. These researchers reported that A. marina rereleased some toxic compounds like phenols, tannins, azadirhtin and ricinine during decomposition in the soil which subsequently suppressed M. javanica. In another experiment soil amended with Datura fastuosa powder applied at 0.5, 1.0 and 3.0% dose rate significantly suppressed M. javanica in brinjal, tomato, chickpea, okra and mungbean (Abid et al., 1997). The highest dose rate of 3.0% was most effective in reducing root knot index under screen house conditions. Dry leaf tissues of several native Chilean plant species have been found effective in reducing GI and reproductive factor of M. hapla (Bohm et al., 2009). The application of dry plant parts of F. parviflora effectively reduced number of egg masses per gram of tomato roots, number of eggs per egg mass and number of adult females in one gram of tomato roots. Soil amended with the roots powder influenced all the parameters under reference. In addition, all other plant parts (stem, leaves and the whole plant) caused significant reduction in the nematode associated parameters. All doses were effective and showed no known phytotoxic effects, however the highest application dose of 30 g kg-1 was the best amongst all. Early studies indicated that soil treated with seasame, flax, cotton seed cake, dried plant material of wormwood, rosemary, asparagus, coleus, neem, demassisa, acasia seed and camphor leaves all caused reduction in egg masses of M. incognita on sunflowers (Ibrahim et al., 2007). In the present study the reduction in egg masses, eggs per egg mass and adult females could be due to the decomposition of plant material (stem, roots, leaves and the whole plant powder) into the soil which subsequently released secondary metabolites like alkaloids, saponins, tannins, glycosides, steroids, falvonoids and phenols as demonstrated by phytochemical screening of the stem and root of F. parviflora (Naz et al., 2013a). These phytochemicals either separately or jointly suppressed the larvae and
230
eggs of the nematode (Naz et al., 2013a). Most of these phytochemicals for example flavonoids and glycosides have been found to be effective antimicrobial substances against a wide array of microorganisms (Cowman, 1999). It has been suggested that their activity could be probably their ability to complex extracellular and soluble proteins and may disrupt microbial cell membrane (Tsuchiya et al., 1996). Nematicidal activity of saponins is well reported. In an in vitro and in planta study, 260-280 ppm solution of saponins reduced total populations, number of egg masses and viable juveniles of M. javanica (Omar et al., 1994). The mortality of M. incognita juveniles was significantly reduced by exposure to eight different steroids and triterpenoids saponins from plants related to garden asparagus (Chitwood, 2002). Biological effects of saponins were normally ascribed to their specific interaction with cell membrane (Tava and Avato, 2006). It was speculated that these saponins may interact with the collagen cuticle protein of the nematode and disrupt it (Argentieri et al., 2008). Results of our study corroborate the work of other researchers who indicated that some plant powder or their extracts contained nematicidal or nematotoxic compounds (Gommers and Bakkers 1988). Olabiyi (2004) reported that leaves of African marigold, nitta and basil plant contained saponins and flavonoids, nitta roots and rattle weed (leaves and roots) contained saponins, roots of African marigold and basil plant contained flavonoids. The leaf powder of Inula viscosa possessed nematicidal activity against M. javanica (Oka et al., 2001) which confirm our results. There are reports available that the leaves of F. parviflora contain kaemferol and quercetine glycosides (Tandon et al., 2011). The nematicidal activity of quercetine, kaemferol, from the aerial parts of Polygonaceae and Rumex spp. has been demonstrated against helminthes (Midiwo et al., 1994). Whereas quercetin and kaemferol from the pomegranate leaves has shown nematicidal activity against Ascaris lumbricoides (Rahmatullah et al., 2010). The results of in vivo study suggested that all the plant parts of F. parviflora played role in the nematicidal potential of the plant. The roots powder at all application doses significantly reduced the number of juveniles of M. incognita (122.1 and 250.7) as compared to control (195.0 and 471.7) in both spring and the fall trials. Moreover, pot soil amended with the plant materials other than roots powder showed promising
231
nematicidal effect at all doses and significantly reduced the number of infective juveniles. The decomposition of the plant material released several metabolites as discussed previously. These secondary compounds acted as a coat around the tomato roots, hence subsequently prevented the attack of juveniles of M. incognita by creating unfavorable environment for the nematode activity or by indirect effect of acquiring resistance or tolerance of plants against the nematode attack. Adekunle and Fawole (2003) reported that the application of water extracts of neem leaves, siam weeds roots and leaves at 20,000 mg Kg-1 and 40,000 mg kg-1 to potting tomato plants delayed the development and consequently reduced the population of M. incognita. Several researchers have used invasive weeds against M. incognita. Juvenile mortality (100%) of M. incognita in tomato was observed when the larvae were exposed to the dry powder of of Acorus calamus rhizome at 20, 10, 5, 1 and 0.5 g amendment with 100 g soil in potting mixture (Devi et al., 2011). The nematicidal potential of dry roots powder of weed (Chromolaena odorata) has been well demonstrated by Thoden et al. (2007). The results of in vivo experiments suggested that dry roots powder of C. odorata reduced the infection of lettuce by M. incognita. Mulching of C. odorata roots reduced the number of juveniles invading lettuce roots. Moreover, these authors proved that the Pyrrolizidine alkaloids (PA) present in the roots powder of C. odorata were responsible for its nematicidal potential, which agreed with our results of cis- and trans- protopinium (isoquinoline alkaloids) isolated from the roots of F. parviflora. The nematicidal properties of Tagetes and wild marigold (Toida and Moriyama, 1978), Emblica officinalis and Carrisa curandas (Haseeb et al., 1980) against root knot juveniles have been reported. The application of increasing plant doses of F. parviflora in the screen house stimulated the plant growth and influenced all the growth parameters such as root and shoots length, fresh and dry shoot weight, number of branches per plant and number of flowers per tomato plant. Incorporation of the plant materials improved the organic composition of the potting soil by providing a more nutritive and porous substrate in the tomato root zone leading to the promotion of plant growth parameters; however, these effects varied according to the treatments and parameters. Significant increase in the shoot (45.19 and 40.63 cm) and root length (18.75 and 20.0 cm) was observed in
232
treatments amended with the roots powder, whereas the stem and all other plant materials showed enhancement in the growth parameters at all application doses. These results agree with the work reported by other researchers who used dry leaves and stem powder of Rhizophora mucronata at 0.1, 1 and 5% (w/w) in the control of root knot nematode in mash bean and okra. Shoot length, root length, shoot and root weights were significantly increased at 5% application dose. In addition, they reported maximum root knot inhibition at 5% (w/w) application dose and stem powder were more effective than the leaves dry powder (Tariq et al., 2007), which agree our findings . In another study increase in the lettuce roots length were reported when the soil was amended with C.odorata roots powder (Thoden et al., 2007). Incorporation of neem derivates in the soil significantly reduced root knot index and improved plant growth in okra, tomato, brinjal and sponge gourds (Abid et al., 1997). Similar results were reported by Ibrahim et al. (2007) in sunflower inoculated with M. incognita. This study showed that dry amendments of F. parviflora were very effective in the management of M. incognita in the screen house. These plants are common and found in abundance in wheat fields of Pakistan. These findings are important for root knot nematodes management in affecting tomato crops in the Khyber Pakhtunkhwa province without the use of synthetic nematicides.
8.2.6. Effect of dry powder of Fumaria parviflora to M. Incognita under field conditions
The use of plants as nematicidal or nematostatic products has been regarded as effective, economical and eco-friendly by numerous researchers (Chitwood, 2002). Several studies involving the use of poultry manure, decomposed plant material (both fresh and dried), agro-industrial waste products, namely dry cork, dry olive marc, dry grape marc, and rice husk as soil amendment for the management of RKNs have been reported (Akhtar and Malik, 2000; Nico et al., 2004). The present study was designed to evaluate the in planta nematicidal activity of organic amendments of F. parviflora against M. incognita under naturally infested field conditions. Field experiments were conducted to further evaluate the nematicidal potential of dry amendments under natural nematode soil infestation. The main aim was to allocate a successful introduction and
233
practical information related to the use of plant materials, in order to manage RKNs in the field effectively and in order to convey them to the growers. Synthetic nematicides have been used by the local growers; however, they have been regarded as costly, and many such nematicides have shown toxic effects on the environment. Since Meloidogyne spp. are widely distributed in the agricultural fields, the use of F. parviflora as biopesticides, or organic amendments, could be a suitable option for the effective management of M. incognita and other plant-parasitic nematodes in an organic vegetable production system (Naz et al., 2013a). A study that was conducted under naturally-infested field conditions in the spring and autumn of 2010 revealed the promising effect of F. parviflora against M. incognita on tomato plants. A variety of preparations (using the root, stem, leaf, and whole plant powder) and doses (10, 20, and 30 g per kg) of F. parviflora effectively suppressed M. incognita on tomato plants, and promoted the plant growth parameters. The in planta study clearly demonstrated that the number of nematode galls on tomato roots, the GI, the number of egg masses, and the number of adult females per g of root were significantly reduced by means of the application of various preparations of F. parviflora. Nevertheless, the root doses gave very effective results in the the field trials. Under natural field conditions, the dry root powder application of F. parviflora exhibited maximum reduction in the number of galls per plant (31.00 and 39.25 galls per plant) and in terms of the GI (1.25 and 1.87), in comparison to the corresponding controls whose galls (99.25 and 86.00 galls per plant) and GI (4.95 and 4.92) were the highest, respectively. The stem powder ranked second in nematicidal effect at all doses. This study demonstrated that the variation in the reduction of the number of galls per plant, the GI, and the other parameters of parasitism was positively influenced by the different application doses used. The data for nematicidal activity of Fumariaceae agreed with the results of our previous studies, in which we found that n-hexane and methanol root extracts of the plant significantly reduced the number of nematode galls, the GI, the number of egg masses, and the number of adult females in the root tissues at 3000 ppm concentration (Naz et al., 2013a).
234
Fumaria parviflora quantity levels of amendments applied were lower than were the levels of other plants used in the biocontrol, as in the case of the dry powder of Acoruscalamus rhizome (Devi et al., 2011), Datura stramonium (Pariha et al., 2012), in the suppression of Meloidogyne spp. Similar studies were conducted by other researchers, who found that the combination of poultry refuse and Furadan 5G (@ 3 t per ha and at 2 kg per ha, respectively) effectively suppressed M. incognita on tomato plants under natural field conditions (Faruk et al., 2011). These comparisons showed the great potential of F. parviflora for the control of PPNs, even at low and targeted application dose. The researcher reported that one way of reducing the large amount of material needed for the broadcast application of amendments was to make targeted applications only in the immediate vicinity of the plants, so that the seedlings developed in a soil environment that was very rich in the amendment (Thoden et al., 2011). In the present study, the plant growth parameters of tomato plants were promoted significantly in all those treatments where F. parviflora amendments were applied at increasing doses both in the greenhouse and the field experiments. Even the low dose of 10 g per kg enhanced plant health, and increased the shoot and root lengths, the fresh shoot weight, the number of branches, and the number of flowers per plant in the spring and autumn experiments. The field study revealed that the number of fruits per plant increased with the amount of root powder (57.25 and 55.25 fruits per plant) used at the highest application dose. An increase was also observed in other treatments that were amended with the stem, the whole plant, and the foliage powder. Likewise, the fruit weights of tomato significantly increased (4.82 and 4.75 kg per plant) in treatments that were amended with roots powder of F. parviflora. A similar increase in the fruit weight of the tomato was also observed when stem amendments were used. These results agree with the work reported by other researchers, in which the use of amendments with nematicidal properties was found to enhance plant growth in tomato plants (Tariq et al., 2007; Pakeerathan et al., 2009; D’Addabbo et al., 2009). The combination of these amendments at lower doses could be combined with the use of nematicides, as in the case of Furadan. However, because of the inactivation of nematicides by means of high amounts of organic matter (Oka et al., 2013) these combinations should be used with caution, and after the conducting of preliminary
235
studies. Additionally, the application of amendments in combination with biological control agents has been proven to be effective, as in the case of neem leaves (Khan et al., 2011). Biological control agents could be integrated with other control measures in order to achieve long-lasting and favourable results (McSorley, 2011). The beneficial effect from F. parviflora on plant growth and yield could also be attributed to improvement in the physical, chemical and microbiological properties of the soil, after incorporation of the soil organic amendment. It has been shown that an increase in organic amendments can improve soil properties, and the decomposing plant materials can provide nitrogen and other nutrients that are needed by crops (Powers and McSorley, 2000). Several studies have revealed that microbial activities and biomass is higher in fields with organic amendments than they are in fields with conventional fertilizers (Drinkwater et al., 1995). Organic amendments stimulate a broad range of organisms in the soil food web, many of which act as potential predators or parasites of PPN (Oka, 2010). It has been suggested that increased crop yields observed with amendments are due to the activities of free-living nematodes, especially bacterivores (McSorley, 2011). The present study suggests that the reduction in nematode parasitism could be due to the decomposition of plant material (in the stem, root, leaf, and whole plant powder) in the potting mixtures, and the subsequent release of such secondary metabolites as alkaloids, saponins, tannins, glycosides, steroids, flavonoids, and phenols, as demonstrated by the phytochemical screening of the stem and root of F. parviflora (Naz et al., 2013a, 2013b). The low density /parasitism of M. incognita on tomato roots could also be due to the poor invasion of the nematode larvae into the roots, as affected by the application of dry plant amendments. In addition, the presence of other nematicidal compounds, namely nonacosane-10-ol and 23a-homostigmast-5- en-3β-ol (Naz et al., 2013b), and cis- and trans-protopinium, reported from the roots of F. parviflora, and the higher alkaloid (0.09 ± 0.04) and saponin (1.3 ± 0.07) contents could have synergistically contributed to the best nematicidal performance of the roots (Naz et al., 2013a, 2013b). Likewise, the higher phenolic contents of the stem (16.75 ± 0.07) could be attributed to the better nematicidal effect of stem, as had been evident in our previous findings (Naz et al., 2013a). The leaf powder of the plant also displayed
236
promising results in this respect. Reports of the leaves of F. parviflora containing kaemferol and quercetine glycosides are available (Tandon et al., 2011), and the nematicidal activity of these compounds from pomegranate leaves has been demonstrated against Ascaris lumbricoides (Rahmatullah et al., 2010). These secondary metabolites are structurally highly diverse, and are produced in a varied ecological environment (Hawa et al., 2012).
The efficacies of Fumaria powder were decreased when the plant doses were gradually reduced, which might be due to the differences in the concentration of toxic substances that were present in the plant material (Naz et al., 2013a). The exact mechanism of the action of these phytochemicals is not known, with toxicity to nematodes and hatching having been shown in a previous study (Naz et al., 2013a). Additionally, these secondary compounds in the plant parts acted as a coating around the tomato roots, hence subsequently preventing the attack of the juveniles of M. incognita by creating an unfavourable environment for the nematode activity, or by means of indirectly effecting the acquisition of resistance or tolerance by the plants against the nematode attack. This was evident in our previous findings, in which the two compounds that were contained in the roots, for example the nonacosane-10-ol and the 23-homostigmast-5-en-3β-ol, effectively suppressed M. incognita, and reduced the population density in tomato root tissues in greenhouse trials (Naz et al., 2013b). The use of dry preparations of the plant material could make the nematode management farmers friendly and more practicable in the field.
237
IX. SUMMARY
Root knot nematodes (RKNs) Meloidogyne spp. are the key obligate plant parasites widely distributed worldwide attacking vegetables, fruits and ornamentals and cause heavy economic losses particularly to high value crops including tomatoes (Solanum lycopersicum). Previously, all the four economically important RKN species i.e Meloidogyne incognita, M. javanica, M. arenaria and M. hapla were reported from the vegetables fields of the Khyber Pakhtunkhwa (Pakistan) with particular reference to Malakand division. These RKNs and their races were identified only on the basis of perineal pattern morphology and differential host tests. The presence of these nematodes parasites in the agricultural soil either alone or in the mixtures tempted many nematologists to accurately identify them through molecular tools before devising any management strategy against these parasites. Countless management practices were implemented in the past to reduce the hazards of these obligate parasites, of which the use of crude plant extracts, their nematicidal derivatives and amending the soil with dry and fresh plant material, appealed many researchers and nematologists in a sustainable and organic agriculture system. Keeping in view, field populations of RKNs from 30 commercial tomato production fields of Malakand divisions and Peshawar encompassing ten major localities were surveyed during 2010. Out of 300 roots and 150 soil samples, about 241 roots (80.3%) and 131 (87.3%) soil samples were found infested with Meloidogyne spp. Disease was prevalent 100% in the study area with an average of 52.0%. Three species of RKNs viz., M. incognita, M. arenaria and M. javanica collected from the Khyber Pakhtunkhwa were identified using the perineal pattern morphology and for the first time through molecular tools. The ribosomal DNA (rDNA) primers D2A/D3B and 194/195 were used for preliminary identification of nematodes species that amplified the D2 and D3 expansion region of the large subunit of rRNA and the intergenic spacer region between the 5S-18S ribosomal gene, respectively. These primer pairs amplified products of approximately 750 bp and 720 bp with the D2A/D3B and 194/195 primers, respectively. For species discrimination, highly specie-specific SCAR primers (Sequence characterized amplified regions i.e Finc/Rinc, Fjav/Rjav and Far/Rar) were
238
used against M. incognita, M. javanica and M. arenaria, respectively. The SCAR- products generated by all the three species were 1200 bp (M. incognita), 670 bp (M. javanica) and 420 bp (M. arenaria). Identification of the three species were further confirmed with the mitochondrial DNA (mtDNA) primers (C2F3/1108) that amplified the COII/lrRNA region of the mtDNA of the above mentioned three species and generated a product of 1700 bp common to all species. However, the positive control species i.e Meloidogyne chitwoodi and M. fallax produced 520 bp products, whereas M. enterolobii produced a 750 bp product. The mtDNA-PCR product was digested with different 4-bp (Hinf 1, Taq 1, Mbo1, Alu 1) and 6-bp (Eco R1) restriction enzymes. The restriction digestion of the 1.7 kb amplification products with Hinf I generated fragments of 1700, 1300 and 400 bp diagnostic patterns for M. incognita lines/or populations only. The Taq 1 enzyme did not produce any diagnostic pattern for either of the species tested. The enzymes Mbo 1 and Eco R1 generated five and three banded- patterns common to all the three Pakistani species, respectively and did not clearly distinguish the three species under reference. Whereas the Alu 1 produced frequent cuts in the mitochondrial genomes and clearly discriminated the three species among themselves as well as from those used as positive control. Genetic diversity among and within Meloidogyne species and populations were determined using the Randomly amplified polymorphic (RAPD) DNA method and three RAPD primers SC 10-30, OPG-13 and OPG-19 were used which successfully identified M. incognita, M. javanica and M. arenaria from the rest of the species used as control and revealed significant variation amongst the RKNs populations. eloidogyne incognita, M. javanica, M. hapla, M. arenaria, M. chitwoodi, M. fallax and M. enterolobii from the James Hutton Institute (JHI), Scotland, UK collection were all used as positive control. Sequencing of the 28S rDNA gene fragment of the three Pakistani Meloidogyne spp. i.e M. javanica, M. incognita and M. arenaria did not differentiate the three species. The DNA sequences of these three nematode species were deposited to the Genbank for the first time and accession numbers JQ317912-19 for eight nematode genotypes (T1, W2, M3, J3, F2, J4, R2 and H1) representing the Khyber Pakhtunkhwa province were obtained. Most of these sequences showed highest similarity with the
239
Genbank species i.e M. hispanica (98%) (EU443606.1), M. thialandica (97%) (EU364890.1) and M. paranensis (99%) (AF435799.1). Allelopathic management of the root knot nematode (M. incognita) was achieved both in the glass house and under naturally infested fields of Dargai using the crude plant extracts of the roots, stem and leaves of F. parviflora. Crude plant extracts of the plant was at first evaluated for nematicidal potential against M. incognita juveniles and eggs in an in vitro experiments. The roots and stem crude extracts influenced the hatching of M. incognita eggs with percent hatch inhibition of 74.42 and 64.33% at 12.5 mg mL-1 concentration of the crude extracts, respectively, whereas the J2s mortality was 78.83 and 65.58% at the same concentration, respectively. Based on good nematicidal activity, the roots and stem crude extracts were further fractionated with four different solvent systems viz., n-hexane, ethyl acetate, chloroform and methanol. The four extracts each from the roots and stem were first evaluated in an in vitro experiment against J2s and eggs of M. incognita at increasing concentrations of 3.12, 6.24, 12.5, 25.0 and 50.0 mg mL-1 at 24, 48 and 72 h of incubation. The n-hexane extracts of the roots and stem ranked first and showed the highest mortality (100%) and hatch inhibition (100 and 95.0%), respectively. Percent J2 mortality and hatch inhibition were directly related to the exposure time. The area under cumulative percentage mortality (AUCPM) and hatch inhibition (AUCPHI) were greatly influenced by all the four extracts of the roots and stem in both the spring and fall in vitro experiments. Based on bioactivity-guided fractionation, the n-hexane and methanol extracts of the roots were eluted with solvents at an increasing order of polarity via silica gel column chromatography. As many as eleven fractions (F1 to F11) were obtained and their in vitro nematicidal activity was done against J2 and eggs at a concentration of 100, 200, 300 and 400 µg mL-1. The hatch inhibition was the highest for F3 (98.77 %) followed by F4 and F11 which showed similar hatch inhibition (90.25 %) whereas the J2s mortality was 95.00, 88.25 and 68.0% by F3, F11 and F4, respectively at the highest concentration. Similarly, the methanol root fraction when eluted with solvents (Chloroform: methanol) at increasing polarity which afforded seven sub fractions (FM2.1 to FM2.7) and an aqueous fraction (FM3).
240
All these sub fractions were evaluated in in vitro experiments against J2s and eggs of M. incognita at four concentrations as mentioned before. The fraction FM2.1 exhibited the highest hatching inhibition (99.75%) and J2s mortality (100%) at a concentration of 400 µg mL-1 and was even more toxic than the standard Carbofuran. The n-hexane (F3 and F4) and the methanol root fraction (FM2.1) were further purified through pencil column chromatography and structures of the compounds were then determined using their spectroscopic (1H and 13C NMR) and the physical data (e.g melting point and colour). The fraction F3 yielded a known compound nonacosane-10- ol, F4 yielded a known compound 23a-homostigmast-5-en-3ß-ol, and FM2.1 yielded a known compound Protopinium. The nematicidal activities of these compounds were determined for the first time against M. incognita. In addition, many other compounds viz., heavy molecular weight tannins and many other alkaloids were detected in the n- hexane and methanol roots fractions through GC/MS analysis and thin layer chromatography. Phytochemical screening of the plant roots and stem powder and their extracts (n-hexane; ethyl acetate, chloroform and methanol) revealed the presence of seven classes of bioactive constituents viz., alkaloids, flavonoids, glycosides, steroids, tannins, saponnins and alcohols. Quantitative determination of the root and stem powder showed the highest concentrations of alkaloids (0.9 ± 0.04) and saponnins (1.3 ± 0.07) in the roots and total phenolic contents in the stem (16.75 ± 0.07 μg dry g-1). The nematicidal activities of plant were attributed to the presence of these different classes of active compounds which markedly affected the J2s and eggs of M. incognita either singly or jointly in an in vitro study. The four roots and stem extracts (n-hexane; ethyl acetate, chloroform and methanol) of the plant were further evaluated in an in planta studies at a concentration of 1000, 2000 and 3000 ppm in the spring and fall, 2010 at the screen house of the Plant Pathology Department. The application of roots and stem extracts significantly reduced the nematode parameters (number of galls, galling index, egg masses g-1 of roots, eggs per gram of roots , adults females, J2 populations and reproduction factor i.e Rf) and influenced the gplant rowth parameters (plant height, root length, fresh and dry shoot weight, fresh root weight, number of branches plant-1). All concentrations were effective, however, maximum reduction in the nematode parameters and improvement
241
in the growth parameters were attained at a concentration of 3000 ppm in both screen house trials, where equal concentration of the root and stem extracts were evaluated. In a second screen house experiment, powdered preparations from plant parts (roots, stem, foliage and the whole plant) of F. parviflora was evaluated over a range of application doses (10, 20 and 30 g kg-1) in the spring and fall, 2010. All the plant parts and their application doses significantly reduced the disease severity. The roots powder showed significant in terms of disease parameters.The plant growth parameters (plant height, fresh and dry shoot and root weights, number of branches and flowers per plant) were promoted when the pot soil was amended with the dry root and stem preparations of F. parviflora. We found that the roots and stem powder showed good nematicidal activity in an in planta study because of the presence of bioactive constituents in the roots and stem preparations. Field experiments were conducted under natural field infestations at Dargai using the application doses (10, 20 and 30 g plant-1) of F. parviflora plant parts (roots, stem, foliage and the whole plant) in the spring and fall, 2010. Increase in the application doses increased the efficacy of all the tested plant parts. Number of gall (31.00 and 39.25) and galling index (1.25 and 1.87) were siginificantly (P < 0.05) reduced with the roots powder. The fresh shoot weight (55.00 and 53.0 g), dry shoot weight (27.00 and 29.0 g), shoot length (48.0 and 55.0 cm), root length (21.50 and 26.75 cm), number of branches plant-1 (20.0 and 22.50 branches plant-1), number of flowers per plant (65.0 and 69.50 flowers per plant) and number of fruits plant-1 (57.25 and 55.25 fruits per plant) were the greatest in the field treatments amended with the roots powder at the highest application dose. Conversely, the disease was severe in the untreated control plots which negatively affected the plant growth parameters. Shoot and root length, fresh and dry plant weight, number of branches per plant and number of fruits per plant were significantly reduced in the un-amended soil. This research has significantly contributed to the management of root knot nematodes in an organic agriculture system. Among the novel natural strategies used for the root knot nematodes control, is the use of Fumaria parviflora as an organic amendment or as source of natural plant extracts or phytochemicals. The roots of the plant could serve the best option for the detection and extraction of nematicidal
242
phytochemicals. However, more research work is needed to develop formulations, improve the efficacy and stability of these compounds, and to reduce the cost incurred on the isolation and purification of compounds. Moreover, further research is also required to evaluate feasibility of these pure compounds for use under field or controlled conditions. In addition, akaloids-derived, sterol-derived and alcohol-derived agrochemicals should be carefully evaluated for their potential harmful effects on the environment.
243
X. CONCLUSIONS AND RECOMMENDATIONS
10.1 Conclusions
1. Root knot nematodes (RKNs) (Meloidogyne spp.) were prevalent (83.3%) in commercial production fields of tomato in Malakand division and Peshawar, Khyber Pakhtunkhwa. Three species of the RKNs viz., Meloidogyne javanica, M. incognita and M. arenaria were found in the Khyber Pakhtunkhwa soil either alone or in mixture. M. javanica occurred with the highest frequency (73.33%) in the soil. 2. The rDNA primers viz., D2A/D3B and 194/195 primers identified three species of RKNs and amplified 750 and 720 bp bands, respectively, common to all species. The species-specific SCAR primers (Finc/Rinc, Fjav/Rjav and Far/Rar) discriminated M. incognita, M. javanica and M. arenaria and generated SCAR products of 1200, 670 and 420 bp, respectively. 3. The C2F3/1108 primer amplifying COII/lRNA region of the mtDNA of the nematode identified the three RKNs species (M. incognita, M. javanica and M. arenaria) and amplified a 1.7 Kb product common to all. The primer pair discriminated the mitotically parthenogenetic species from those reproducing by facultative meiotic parthenogenesis on the basis of variation in the size products. 4. Restriction digestion of the mtDNA product of the three mentioned RKNs with five digestion enzymes (Hinf 1, Taq 1, Mbo 1, Eco R1 and Alu 1) produced characteristic diagnostic patterns in these species. Hinf 1 recognizing enzyme produced a three-banded characteristic pattern in case of M. incognita only. The enzyme Alu 1 produced a five-banded diagnostic pattern each in M. arenaria and M. javanica and an eight-banded pattern in M. incognita. The Taq 1 did not cleave the mtDNA in any of the three species, whereas the Eco R1 produced a three-banded pattern in all. However, none of the single enzymes clearly discriminated the three species, in general. 5. DNA sequencing of the M. incognita 28S rDNA gene fragment amplified with D2A/D3B primer did not discriminate the closely related three RKNs. The DNA
244
sequences of eight nematode genotypes (T1, W2, M3, J3, F2, J4, R2 and H1) belonging to three Pakistani RKNs were deposited to the Genbank for the first time. These sequences can be retrieved and are available on line as Genbank accession numbers (JQ317912-19). 6. Randomly amplified polymorphic DNA (RAPD) with the three oligonucleotide decamer primers SC-1030, OPG-13 and OPG-19 generated polymorphic bands in the three Meloidogyne spp. The primer SC-1030 amplified maximum number of bands (216) in all the tested populations. Genetic distance among the M. javanica populations ranged from 0 to 0.75. The cluster analysis of the data clearly formed three distinct groups i.e M. javanica, M. incognita and M. arenaia which were distinct from members (M. hapla, M. chitwoodi, M. fallax and M. eterolobii) of other groups. 7. In an in vitro study, roots and stem crude extracts of Fumaria parviflora possessed strong nematicidal activity against J2s and eggs of M. incognita. The n:hexane extracts of the roots and stem ranked first and exhibited 100% mortality and hatching inhibition at the highest concentration (50 mg mL-1) after 72 h of incubation. The methanol extracts of the roots and stem were graded as second. 8. Silica gel column chromatography of the n:hexane and the methanol extracts of the roots of F. parviflora afforded eleven sub-fractions for n:hexane (F1 to F11) and seven sub-fractions (FM2.1 to FM2.7) for methanol extracts. J2s mortality and hatching inhibition was the highest for F3, F4 and FM2.1 at 400 μg mL-1 concentration. 9. The fractions F3, F4 and FM2.1 of F. parviflora yielded pure and known compounds viz., nonacosane-10-ol, 23a-homostigmast-5-en-3ß-ol and the cis- and trans-protopinium, respectively. 10. Phytohemical analysis of the roots of F. parviflora (n:hexane, ethyl acetate, chloroform and methanol) and stem extracts (n:hexane, ethyl acetate, chloroform and methanol) revealed the presence of seven active classes of compounds i.e alkaloid, flavonoid, glycoside, steroids, tannins, saponins and phenols.
245
11. Quantitative determination of the plant extracts of F. parviflora showed the highest percentage of alkaloids (0.9 ± 0.04) and saponins (1.3 ± 0.07) in the roots and total phenolic contents (16.75 ± 0.07 μg dry g-1) in the stem. 12. In an in planta (screen house), the n:hexane extracts of roots and stem of F. parviflora showed the best nematicidal potential at 3000 ppm concentration and suppressed M. incognita thereby promoting plant growth parameters showing no phytotoxicity symptoms. 13. In a second screen house experiment, the application doses of the F. parviflora (roots, stem, leaves and foliage) curbed M. incognita. Roots powder at 30 g kg-1 dose presented best results in terms of disease reduction and improved the plant health both in the spring and fall trials. 14. In field trials conducted under natural field conditions of Dargai, the application doses of the plant parts (roots, stem, leaves and foliage) of F. parviflora suppressed M. incognita. The highest application dose of 30 g plant-1 of the roots and stem promoted the plant growth parameters and increased the yield. 15. Plant extracts, pure compounds and dry powder of F. parviflora can be used for the organic management of root knot nematodes. Extracts and pure compounds provide new insight for the development of environmentally safe and commercial nematicides. Fumaria parviflora has tremendous nematicidal potential because of richness and diversity of compounds effective against Meloidogyne spp.
10.2. Recommendations
Fumaria parviflora has potential in nematode management due to the richness and diversity of nematicidal phytochemicals. The use of dry preparations of the plant materials and the plant extracts could make the nematode management more eco- friendly and practicable in the field. The local application of the plant materials to tomato roots, prior to them being planted in the field, could protect tomato roots at the beginning of the crop cycle. Application of these amendments in the fields could be mainly enhanced in the vegetable growing areas of Malakand division especially when combined with plant-derived formulations or extracts of the active constituents and or
246
pure compounds. The beneficial potential of these amendments could further be strengthened by their economic convenience, due to the lower cost involved than with the use of chemicals, and also their easy availability. However, more studies should be done in order to test the viability of the seeds after the drying period, or the collection of the plant before seed production, in order to prevent F. parviflora as a weed in the field.
247
LITERATURE CITED
Abadir, S. K., A. E. Ismail and A. M. Kheir. 1994. Influence of preceding crops on the population densities of Hetrodera zeae on corn. Annals of Agricultural Sciences Moshotor 32: 1035-1041. Abid, M., M. J. Zakki and M. A. Maqbool. 1995. Neem derivatives for the control of root knot nematodes (Meloidogyne javancia) on Okra. Pakistan Journal of Phytopathology 7: 212-214. Abid, M., I. M. Choudhry., M. A. Maqbool and Atta-Ur-Rahman. 1997. Preliminary screening of some plants and their nematicidal activity against Meloidogyne javanica. Nematologia Mediterranen 25: 155-157. Abubakar, U and Q. Majeed. 2000. Use of Animal manure for the control of Root-knot Nematodes of Cowpea. Journal of Agriculture Environment 1: 29-33. Abubakar, U., T. Adamu and S. B. Manga. 2004. Control of Meloidogyne incognita (kofoid and white) chitwood (root-knot nematode) of Lycopersicon esculentum (tomato) using cowdung and urine. African Journal of Biotechnology 3: 379-381. Adam, M. M., M. S. Phillips and V. C. Blok. 2005. Identification of Meloidogyne species from North East Libya and comparison of inter- and intra-specific genetic variation using RAPDs. Nematology 7: 599-609. Adam, M. A. M., M. S. Phillips and V. C. Block. 2007. Molecular diagnostic key for identification of single juveniles of seven common and economically important species of root-knot nematode (Meloidogyne spp.). Plant Pathology 56: 190-197. Adegbite, A. A and S. O. Adesiyan. 2005. Root extracts of plants to control root-knot nematode on edible Soyabean. World Journal of Agricultural Sciences 1: 18-21. Adkunle, O. K and B. Fawole. 2003. Comparison of effect of extracts of siam weed, neem and carbofuran on generation and reproduction of Meloidogyne incognita race 2 on tomato. Environment and ecology 21: 720-726. Agbenin, N. O., A. M. Emechebe and A. D. Apka. 2005. Evaluation of Nematicidal action of some botanicals on Meloidogyne incognita in vivo and in vitro. Journal of Agriculture and Rural Development. Tropics and Subtropics 106: 29-40.
248 Ageta, H and T. Ageta. 1984. T. Ericaceous constituents: Seventeen triterpenoids isolated from the buds of Rhododendron macrocepalum. Chemical Pharmacology Bulletin 32: 369- 372. Ahmad, R., M. Z. Shahab., M. Inamul- Haq., N. Javed., M. A. Dogar and Y. Khan. 1996. Effect of soil amendments with Calatropis procera for the control of Meloidogyne javanica infection on egg plant. Pakistan Journal of Nematology 14: 55-59. Ahmad, M. M and M. Saeed. 1981. Studies on root knot nematodes in Pakistan. Proceedings of 3rd Research Plant Conference on root knot nematodes (IMP), Region VI, Jakarta, Indonesia, pp. 115. Akhtar, M.S and I. Javed. 1985. Comparative efficacy of Fumaria paviflora and morantel tartrate against gastrointestinal nematode infections in sheep. Pakistan Journal of Pharmacology 2: 31–35. Akhtar, M and M. M. Alam. 1990. Control of Plant Parasitic nematodes with agro-wastes soil amendments. Pakistan Journal of Nematology 8:25-28. Aktar, M and M.M. Alam. 1991. Integrated control of plant parasitic nematodes on potato with organic amendment of plant parastic nematodes. Nematicides and mixed cropping with mustard. Nematologia Meditteranea 19: 169–171. Akhtar, M and I. Mehmood. 1996. Organic soil amendments in relation to nematode management with particular reference to India. Integrated Pest Management Review 1 201-215. Akhtar, M and A. Malik. 2000. Roles of organic soil amendments and soil organisms in the biological control of plant-parasitic nematodes: A review. Bioresource Technology 74: 35-47. Akhtar, M and I. Mahmood. 2003. Potentiality of phytochemicals in nematode control: A review. Bioresource Technology 48: 189-201. Alam, M. M.. A. M. Khan and S. K. Saxena. 1982. Relative toxicity of decomposed and undecomposed oil cakes to plant parasitic nematodes. Acta Botanica Indica 10: 124- 127. Alam, M. M. 1990. Neem in nematode control. In: Nematode Biocontrol (Aspects and Prospects). (eds). M. S. Jairajpuri, M. M., Alam and I. Ahmed, CBS. Publisher and distributors. Pvt. Ltd. Delhi- 110032, India. Pp: 51- 55.
249 Al-Bana, L., R. M. Darwish and T. Aburjai. 2003. Effect of Plant extracts and essential oils on root knot nematodes. Phytopathologia Mediterranea 42: 123-128. Ali, N. I., I. A. Siddiqui., M. J. Zaki and S. S. Shaukat. 2001. Nematicidal potential of Lantana camara against Meloidogyne javanica in mungbean. Nematologia Mediterranea 29: 99-102. Allen, E. H and F. Feldmesser. 1970. Nematicidal effect of alpha-tomatine on Panagrellus redivivus. Phytopathology 60: 1013 (Abstr). Allen, E. H and F. Feldmesser. 1971. Nematicidal aactivity of α-chaconine: effect of hydrogen- ion concentration. Journal of Nematology 3: 58-61. Al-Obedi, J. F. W., A. R. Askari and Z. A. Stephan. 1987. Some plant extracts for the control of the root knot nematode Meloidogyne javanica. Nematologica Meditteranea 15: 149- 153. Al-Sayed, A. A., A. M. Kheir., H. I. El-Naggar and H. H. Kesba. 2007. Organic amendments of Meloidogyne incognita on grapes in relation to host biochemistry. International Journal of Agricultural Research 2: 776-785. Al-Shaibani, I. R. M., M. S. Phulan and M. Shiekh. 2009. Anthelmintic activity of Fumaria parviflora (Fumariaceae) against gastrointestinal nematodes of sheep. International Journal of Biological Sciences 11: 431–436. Anderson, T. J. C., M. S. Blouinn and R. N. Beech. 1998. Population biology of parasitic nematodes: applications of genetic markers. Advanced Parasitology 41:219–283. Anon.1997. DiTera: Controlling nematodes biologically. Methyl Bromide Alternatives Pp. 8 - 9. Anonymous. 2012. Agricultural Statistics of Pakistan. Government of Pakistan. Ministry of Food, Agriculture and Livestock. Islamabad. Anastasiadis, I. A., I. O. Giannakou, D. A. Prophetou-Athanasiadou and S. R. Gowen. 2008. The combined effect of the application of a biocontrol agent Paecilomyces lilacinus, with various practices for the control of root-knot nematodes. Crop Protection 27: 352- 361. Anwar, S. A. 1977. Nematodes and their host range in the Punjab (Pakistan). Journal of Agricultural Research 3:223-226.
250 Anwar, S. A., S. Gorsi., M. Anwarul-Huq., T. Rehman and P. Yousaf. 1991. Plant parasitic nematodes of some fields, vegetables, fruits and ornamental crops. Journal of Agricultural Research 29:233-249. Anwar, S. A., M. S. Akhtar and A. Tahir. 1992. Plant parasitic nematodes problems of some fields, vegetables, fruits and ornamentals crops in the Punjab, Pakistan-II. Proceedings of Parasitology 14:86-98. Anwar, S and M. M. Alam. 1992. Affect of latex seed dressing on interacting with root knot nematode. Afro-Asian Journal of Nematology 1: 182-185. Anwar, S. A., A. Zia., M. Hussain and M. Kamran. 2007. Host suitability of selected plants to Meloidogyne incognita in the Punjab, Pakistan. International Journal of Nematology 17:144-150. Anter, E. A., A. Y. El-Gandi., E. M. Ali and S. El-Eeraki. 1994. Nematicidal effect of garlic against Meloidogyne incognita infecting tomato. Proceedings of the 2nd International Symposium of the Afro-Asian Society of Nematology, Menoufiya Univeristy, Shebin- Elkom, Egypt. Argentieri, M. P., T. D’ Addaboo., A. Tava., A. Agostinelli., M. Jurzysta and P. Avato. 2008. Evaluation of nematicidal properties of Saponins from Medicago species. EJPP. 120: 189-197. Ateeq-ur-Rehman. 2009. Integration of Different Bio-Control Agents for the Management of Root-Knot Nematode (Meloidogyne spp.). Faisalabad, Plant Pathology Deptt, University of Agriculture, Pakistan, PhD thesis. Athanasiadou, S., I. Kyriazakis., F. Jackson and R. L. Coop. 2001. Direct antelmintic effects of condensed tannins towards different gastrointestinal nematodes of sheeps: In vitro and in vivo studies. Veterinary Parasitology 99: 205-219. Attaur-Rehman., A. Nasreen., F. Akhtar., M. S. Shekhani., J. Clardy., M. Parvez and M. I. Choudry. 1982. Antifungal diterpenoid alkaloids from Delphinium denodatum. Journal of Natural Products 60: 474-477. Attaur-ur-Rahman., M. K. Bhatti., F. Akhtar and M. I. Choudhary. 1992. Alkaloids of Fumaria indica. Phytochemistry 31: 2869. Attaur-ur-Rahman., M. K. Bhatti., M. I. Choudhary and S. K. Ahmad. 1995. Alkaloids constituents of Fumaria indica. Phytochemistry 40: 593.
251 Bai, C. Q., Z. L. Liu and Q. Z. Liu. 2011. Nematicidal constituents from essential oils of Chenopodium Ambrosioides Aerial parts. E-Journal of Chemistry 8: 143-148. Banso. A and S. O. Adeyemo. 2007. Evaluation of antimicrobial property of tannins isolated from Dichrostachys cineria. African Journal of Biotechnology 6: 1785-87. Baquar, S. R. 1989. Medicinal and poisonous plants of Pakistan, Printas, Karachi 209-210. Barbosa, L. C. A., F. F. Barcelos., A. J. Demuner and M. A. Santos. 1999. Chemical constituents from Mucuna aterrima with activity against Meloidogyne incognita and Heterodhera glycines. Nematropica 29: 81-88. Barbosa, P., A. S. Lima, P. Vieira, L. S. Dias, M. T. Tinoco, J. G. Barroso, L. G. Pedro, A. C. Figueiredo and M. Mota. 2010. Nematicidal activity of essential oils and volatiles derived from Portuguese aromatic flora against the pinewood nematode, Bursaphelenchus xylophilus. Journal of Nematology 42: 8–16 Baum, T.J., S. A. Lewis and R. A. Dean. 1994. Isolation, characterization and application of DNA probes specific to Meloidogyne arenaria. Phytopathology 84: 489–494. Bauske, E. M., R. Rodriguez-kabana., V. Estaun., J. W. Kloepper and D. G. Robertson. 1994. Management of Meloidogyne incognita on cotton by use of botanical aromatic compounds. Nematropica 24: 143-150. Begum, S., A. Wahab., B. S. Siddiqui and F. Qamar. 2000. Nematicidal constituents of aerial parts of Lantana camara. Journal of Natural Product 63: 765-767. Bentley, H. R., J. A. Henry., D. S. Irvine., D. Mukerji and F. S. Spring. 1995. Triterpenoids. Part XXXII. cyclolaudenol, a triterpenoid alcohol from opium. Journal of Chemical Society 596–602. DOI:10.1039/jr9550000596. Bijloo, J. D. 1965. The “Pisum” test, a method for screening of substances on their therapeutic nematicidal activity. Nematologica 11: 643-644. Blasko, G and M. Sharma. 1982. Taxilamine: a Pseudobenzylpryoquinoline alkaloids. Heterocycle 19: 257-259. Blok, V.C., M. S. Phillips., J. W. McNicol and M. Fargette. 1997. Genetic variation in tropical Meloidogyne spp. as shown by RAPDs. Fundamental and Applied Nematology 20:127–133. Blok, V.C., J. Wishart., M. Fargette., K. Berthier and M. S. Phillips, M.S. 2002. Mitochondrial differences distinguishing Meloidogyne mayaguensis from the major species of tropical root-knot nematodes. Nematology 4: 773–781.
252 Blok, V. C. 2005. Achievements in future prospects for molecular diagnostic of plant parasitic nematodes. Canadian Journal of Plant Pathology 27:176-185. Blok, V. C and T. O. Powers. 2009. Biochemical and Molecular identification. 2009. Root- knot Nematodes (eds R.N. Perry, M. Moens and J.L. Starr). 98-112. Bohm, L., N. Arismendi. and L. Ciampi. 2009. Nematicidal activity of leaves of common shrub and tree species from Souther Chile against Meloidogyne hapla. Ciencia e investigacion agrarian 36: 249-258. Brei, B., J. D. Edman., B. Gerade and J. M. Clark. 2004. Relative abundance of two cuticular hydrocarbons indicates whether a mosquito is old enough to transmit malaria parasites. Journal of Medittranean Entomology 41: 807-9. Brito, J., T. o. Powers., P. G. Mullin., R. N. Inserra and D. W. Dickson. 2004. Morphological and molecular characterization of Melidogyne mayaguensis isolates from Florida. Journal of Nematology 36:232-240. Brown, K. F. 1962. A survey of some plant parasitic nematode problems in Pakistan. Report of visiting nematologist, Shell International Chemical Co. Ltd. 9.pp. Brown, J. E., M. G. Patterson and M. C. Osborn. 1989. Effects of clear plastic solarization and chicken manure on weed control. P. 76-79. In: Proceedings of the 21st National Agricultural Plastic Congress. Nat. Ag. Plastics Assoc, Peoria, IL. Brown, J. E., M. G. Patterson, and M. C. Caldewell. 1991. Soil solarization/chicken manure: Possible alternative weed control. Auburn University Highlights of Agriculture. Brown, P. D and M. J. Morra. 1997. Control of soil-borne plant pests using gluco-sinolate containing plants. Advances in Nematology. Advances in Agronomy 61: 167-231. Campbell, C.L and L. V. Madden. 1990. Introduction to Plant Disease Epidemiology. New York, USA: John Wiley and Sons. Cann, R. L, W. M. Brown and A. C. Wilson. 1984. Polymorphic sites and the mechanism of evolution in human mitochondrial DNA. Genetics 106:479–499. Carneiro, R. M. D. G., M. S. Tigano, O. Randig., M. R. A. Almeida and J. L. Sarah. 2004 Identification and genetic diversity of Meloidogyne spp. (Tylenchida: Meloidogynidae) on coffee from Brazil, Central America and Hawaii. Nematology 6:287–298. Castagnone-Sereno, P., C. Piotte., P. Abad, M. Bongiovanni and A. Dalmasso. 1991. Isolation of a repeated DNA probe showing polymorphism among Meloidogyne incognita populations. Journal of Nematology 23:316–320.
253 Castagnone-Sereno, P., G. Esparrago., P. Abad., F. Leory and M. Bongiovanni. 1995. Satellite DNA as a target for PCR-detection of the plant parasitic nematode Meloiodogyne hapla. Curruent Genetics 28: 566-570. Cenis, J. L., C. H. Opperman and A. C. Triantaphyllou. 1992. Cytogenetic, enzymatic and restriction fragment length polymorphism variation of Meloidogyne spp. from Spain. Phytopathology 82: 527–531. Cenis, J. L. 1993. Identification of Four Major Meloidogyne spp. by Random Amplified Polymorphic DNA (RAPD-PCR). Phytopathology 83: 76-78. Chandravada, M. V., E. S. J. Nidiry., R. M. Khan and M. S. Rao. 1994. Nematicidal activity of serpentine against Meloidogyne incognita. Fundamental and applied Nematology 17: 185-192. Chandravadan, M. V., E. S. J. Nidiry., R. M. Khan and M. S. Rao. 1994. Nematicidal activity of serpentine against Meloidogyne incognita. Fundamental and Applied Nematology 17: 185-192. Chen, S.Y., D.W. Dickson and D.J. Mitchell. 2000. Viability of Heterodera glycines exposed to fungal filtrates. Journal of Nematology 32: 190 - 197. Chen, P., P. A. Roberts, A. E. Metcalf and B. C. Hyman. 2003. Nucleotide Substitution Patterning within the Meloidogyne rDNA D3 Region and Its Evolutionary Implications. Journal of Nematology 35:404-410. Chitwood, B. G. 1949. Root-Knot nematodes. A revesion of the genus Meloidogyne Goeldi 1887. Proceedings of Helminthology Society Washington 16: 90-104. Chitwood, D. J. 2002. Phytochemical based strategies for nematode control. Annuals Review of Phytopathology 40: 221-249. Choi, Y. H., J. Kim., M. J. Noh., M. E. Park., K. P. Yoo. 1996. Extraction of epicuticular wax and nonacosa-10-ol from Ephedra herb utilizing supercritical carbon dioxide. Korean Journal of Chemistry and Engineering 13: 216-219. Choi, I. H, J. Kim., S. C. Shin and I. K. Park. 2007. Nematicidal activity of monoterpenoid against the pine wood nematode (Bursaphelencus xylophilus). Russian Journal of Nematology 15: 53-40. Clayton, D. A., J. N. Doda and E. C. Friedberg. 1974. The absence of a pyrimidine dimer repair mechanism in mammalian mitochondria. Proc Natl Acad Sci USA 71:2777– 2781
254 Coolen, W. A. 1979. Methods for the extraction of Meloidogyne spp., and other nematodes from roots and soil. In: Lamberti, F., C. E. Taylor., eds. Root knot nematodes (Meloidogyne species) Systematics, biology and control. London, UK: Academic press. 317-29. Cowman, M. M. 1999. Plant products as antibacterial agents. Clinical Microbioly Review 12: 564-582. Crow, W. T., E. A. Guertal and R. Rodriguez-Kabana. 1996. Responses of Meloidogyne arenaria and Meloidogyne incognita to green manures and supplemental urea in glasshouse culture. Journal of Nematology 28: 648-654. Crow, W. T and R. A. Dunn. 2010. Soil organic matter, green manures and cover crops for nematode management. University of Florida, ENY-059 (VH037), Gainsville. Pp. 4. Curran, J., M. A. McClure and J. M. Webster. 1986. Genotypic differentiation of Meloidogyne populations by detection of restriction fragment length difference in total DNA. Journal of Nematology 18: 83-86. Curran, J. and J. M. Webster. 1987. Identification of nematodes using restriction fragment length differences and species-specific DNA probes. Canadian Journal of Plant Pathology 9:162–166. D’ Addabbo, T., P. Avato. and A. Tava. 2009. Nematicidal potential of materials from Medicago spp. European Journal of Plant Pathology 125: 29-39. Dautova, M., M. N. Rosso., P. Abad., F. J. Gommers., J. Bakker., G. Smart. 2001. Single pass cDNA sequencing- a powerful tool to analyse gene expression in preparasitic juveniles of the southern root knot nematode Meloidogyne incognita. 3: 129-139. De Ley, P., M. A. Félix, L. M. Frisse, S. A. Nadler P. W. Sternberg and W. K. Thomas. 1999. Molecular and morphological characterization of two reproductive species with mirror-image anatomy (Nematoda:Cephalobidae). Nematology 1:591-612. De Lannoy, G. 2001. Vegetables. In: Crop production in tropical Africa. Romain H. Raemaekers (ed.) DGIC, Brussels. pp. 467-75. Deng, M., X. Y. Song and B. Tiang. 2001. Effect of protopine on proliferation of cultured rabbit aortic vascular smoothe muscle cells. Chin. Pharmacological Bulletin 17: 306- 309.
255 Desjardins, A. E., S. P. McCormick., R. L. Plaisted and B. B. Brodie. 1997. Association between solavetivone production and resistance to Globodera rhosochiensis in potato. Journal of Agriculture and Food Chemistry 45: 2322-2326. Devran., Z., U. Gozel., M. A. Sogut., S. Yildiz and I. H. Eleckcioglu. 2002. Identification of root knot nematodes in the Mediterranean region of Turkey by using rDNA and mtDNA markers. Turkish Journal of Agriculture 26: 337-341. Devran, Z, and A. S. Mehmet. 2009. Distribution and identification of root knot nematodes from Turkey. Journal of Nematology 41:129-133. Devakumar, C., B. K. Goswami and S. K. Mukarjee. 1985. Nematicidal principles from neem (Azadarichta indica A. Juss). Part I. Screening of neem kernel fractions against Meloidogyne incognita. Indian Journal of Nematology 15:1121-124. Devi, N. R., K. S. Devi and N. J. Devi. 2011. Management of Meloidogyne incognita by using different extracts of Acorus calamus. Journal of Experimental Sciences 2: 07-09. Dias, C. R., A. V. Schwan., D. P. Ezequiel., M. C. Sarmento and S. Ferraz. 2000. Efeito de extractos aquosos de plantas medicinais na sobrevivenecia de juvenis de Meloidogyne avanica. Nematologia Barsieleira 24: 203-210. Di Masico, P., S. Kaiser and H. Sies. 1989. Lycopene as the most efficient biological carotenoid singlet oxygen quencher. Archive of Biochemal and Biophysics 274: 532- 528. Debprasad, R., D. Prasad., R. P Singh and D. Ray. 2000. Chemical examination and antinemic activity of marigold (Tagetes erecta L.) flowers. Annals of Plant Protection Sciences 8:212-217. Dong, K., R. A. Dean., B. A. Fortnum and S. A. Lewis. 2001. Development of PCR Primers to identify species of root-knot nematodes: Meloidogyne arenaria, M. hapla, M. incognita and M. javanica. Nematropica 31: 271-280. Dowling, T. E., C. Moritz., J. D. Palmer. 1990. Nucleic acid II: Restriction site analysis. In: Molecular systematics (Hilis DM and Moritz, C eds). Sunderland, MA: Sinauer Associates: 250-317. Drinkwater, L.E., D.K. Letourneau, F. Workneh, A.H.C. Van Bruggen, and C. Shennan, 1995. Fundamental differences between conventional and organic tomato agroecosystems in California. Ecological Applications. 5: 1098–1112.
256 Du, S. S., H. M. Zhang and C. O. Bai. 2011. Nematocidal flavones-C-glycosides against the root knot nematode (Meloidogyne incognita) from Arisaema erubescens tubers. Molecules 16: 5079-86. Egunjobi, O. A and S. O. Onayemi. 1981. The efficacy of water extracts of neem (Azadirachta indica) leaves as a systemic nematicides. Nigerian journal of Plant Protection 5:70- 74. Eisenback, J.D., H. Hirschmann, J.N. Sasser and A. C. Triantaphyllou. 1981. A guide to the four most common species of root knot nematodes, Meloidogyne species with pictorial keys. In The Department of Plant Pathology and Genetics, North Carolina State University and USAID, Raleigh, NC, USA. Pp. 47. Einsenback, J. 1982. Morphological comparisons of head shape and stylet morphology of second-stage juveniles of Meloidogyne species. Journal of Nematology. 14: 339-343. Eisenback, J.D. 1985a. Detailed morphology and anatomy of second- stage juveniles, males, and females of the genus Meloidogyne (Root knot nematodes). In J. N. Sasser and C. C. Carter, eds. An advanced treatise on Meloidogyne, vol. 1, Biology and control. Raleigh, NC: North Carolina State University Graphics. Pp. 47-77. Eisenback, J. D. 1985b. Diagnostic characters useful in the identification of the four most common species of root knot nematodes (Meloidogyne spp.). In: J. N. Sasser and C. C. Carter, Eds. An advanced treatise on Meloidogyne, vol. 1, Biology and control. Raleigh, NC: North Carolina State University Graphics. Pp. 95-112. Eisenback, J.D and H. H.Triantaphyllou. 1991. Root-knot nematodes: Meloidogyne species and races. In Manuel of Agricultural Nematology, W.R. Nickle, ed. Marcel Dekker, Inc. New York. pp. 191-274. El-Ghore, A. A., S. Haroon., M. A. El-Raheem and E. Abdella. 2004. Development of Specific SCAR-markers for Meloidogyne incognita and M. javanica. Arabian Journal of Biotechnology 7: 37-44. El-Hady, M. M. 2009. Discrimination among Meloidogyne Incognita Isolates by Cellulase Activity, Protein and DNA Finger printing. Australian Journal of Basic and Applied Sciences 3: 1552-1558. Ellenby, C. 1945. Influence of crucifers and mustard oils on the emergence of larvae of potato roots worms, Hetrodera rostochiensis. Wollenweber. Annals of Applied Biology 32: 67- 70.
257 Ellenby, C. 1951. Mustard oil and control of potato root worms, Hetrodera rostochiensis Wollenweber. Further field and laboratory experiments. Annals of Applied Biology 38: 859-875. El-Nagar, H. I., H. H. Hendy., S. H. Abdel-Hamed., A. A. Farahat and A. A. Osman. 1993. The role of dry green ground leaves of some plants in controlling the role of reniform nematodes Rotylenchulus reniformis infecting sunflower. Bulletin. Fac. Agric., Cairo University. 40: 205-216. Emmons, S. W., M. R. Klass and D. Hirsch. 1979. Analysis of the constancy of DNA sequences during development and evolution of the nematode Caenorhabditis elegans. Proceedings of National Academic Sciences 76: 1333-1337. Erdogan, T. F. 2009. Brine shrim letality bioassay of Fumaria Densiflora DC. and Fumaria Officinalis L. Extracts. Hacettepe University. Journal of the Faculty of Pharmacy 28: 125-132. Erum, Y. I., A. R. Musarrat and F. Shahina. 2005. Jatropha gossypifolia (Euphorbiaceae). A new host of Meloidogyne javanica in Pakistan. Pakistan Journal of Nematology 23:187-188. Faheem, A., M. A. Rather and M. A. Siddiqui. 2010. Nematicidal activity of Lantana camara L. against Meloilodogyne incognita (Kofoid and White) Chitwood and its use to manage roots infection of Solanum melogena L. Brazlian. Archive of Biology and Biotechnology 53: 543-548. Faruk, M. I., M. L. Rahman., M. R. Ali., M. M. Rahman and A. H. M. Mustafa. 2011. Efficacy of two organic amendments and a nematicide to managem root-knot nematode (Meloidogyne incognita) of tomato (Lycopersicon esculaentum L.). Bangladesh journal of Agricultural Research 36: 477-486. Fassuliotis, G and G. P. Skucas. 1969. The effect of pyrrolizidine alkaloid ester and plants containg pyrrolizidine alkaloids on Meloidogyne incognita acrita. Journal of Nematology 1: 287-288. Fatima, S and M. U. Ahmad. 2005. Comparative efficacy of some organic amendments and a nematicde (Furadan 3G) against root knot on two local varieties of groundnut. Plant Pathology Journal Pakistan 4: 54-57.
258 Fernandez, C., R. Rodriguez-Kabana, P. Warrior and J.W. Kloepper. 2001. Induced soil suppressiveness to a root knot nematode species by a nematicide. Biological Control 22: 103-114. Floyd, R., E. Abebe., A. Papert and M. Blaxter. 2002. Molecular barcodes for soil nematode identification. Molecular Ecology 11:839-850. Gárate, T., M. P. Robinson, M. R. Chacón and R. M. E. Parkhouse. 1991. Characterization of species and races of the genus Meloidogyne by DNA restriction enzyme analysis. Journal of Nematology 23:414–420. Garima, G., A. Singh and P. C. Trivedi. 2005. Bacteria: A Potential bioagent against Root knot nematode, Meloidogyne incognita. National Symposium on Recent Advances and Research Priorities in Indian Nematology, 9-10th December 2005, IARI, New Delhi. Pp 14. Geary, T. G., D. P. Thomson and R. D. Klein. 1999. Mechanism-based screening: discovery of the next generation of anthelmintics depends upon more basic research. International Journal of Parasitology 29: 105-112. Gerhardson, B. 2002. Biological substitutes for pesticides. Trends in Biotechnology 20: 338- 343. Gezer, K., E. Duru., Kivrak., A. Turkaglu., N. Mercan., H. Turkoglu and S. Gukan. 2006. Free radical scavanging activity and antimicrobial acitivity of wild-edible mushroom from Turkey. African Journal of Biotechnology 5: 1924-1928. Gheysen G., W. Van der Eycken., N. Barhels., M. Karimi and M. Van Montagu. 1996. The exploitation of nematode-responsive genes in novel nematode control methods. Pest Sciences 47: 95-101. Gilani, K. H., Janbaz and M. S. Akhtar. 1996. Selective protective effect of the extract from Fumaria parviflora on paracetamol-induced hepatotoxicity. General Pharmacology 27: 979-983. Gommers, F. J. 1973. Nematicidal principles in Compositae. Diss Agricultural University Wageningen. Netherland. 73. Pp. Gommers, F. J and D. J. M. voor-Holt. 1976. Chemotaxonomy of Compositae related to their suitability for Pratylenchus penetrans. Netherland Journal of Plant Pathology 82: 1- 8.
259 Gommers, F. J, J. Bakker. 1988. Physiological diseases induced by plant responses or products. In Diseases of Nematodes, ed. GO Poinar, H-B Jansson, 1:3– 22. Boca Raton, FL: CRC Press. Gomez, K. A and A. A. Gomez. 1984. Statistical Procedures for Agricultural Research. New York: John Wiley and Sons. Goswami, B. K and V. V. Chenulu. 1974. Interaction of root knot nematode Meloidogyne incognita and tobacco mosaic virus in tomato. Indian Journal of Nematology 4: 69- 80. Govindaiah, S., N. Sharma and D. D. Gargi. 1989. Effect of mulches of green leaves for the control of plant parasitic nematodes in mulberry. Indian Journal of Nematology 19:8- 25. Gul, A. 1988. Studies on root knot nematodes (Meloidosgyne spp.) in the North West Frontier Province of Pakistan with special reference to the association of M. javanica (Treub) Chitwood with peach (Prunus persica L Batsch). Karachi, Pakistan, University of Karachi, Karachi. PhD thesis. pp 250. Gul, A., Saifullah and S. F. A. Shah. 1990. Control of root knot nematodes (Meloidogyne spp.) of tomato through organic amendments. Sarhad Journal of Agriculture. 6:419-419. Gul, A and M. Saeed. 1990. A survey of root-knot nematode (Meloidogyne spp.) in North West Frontier Province (NWFP) of Pakistan. Sarhad Journal of Agriculture. 6: 495-502. Halbrendt. J. M. 1996. Allelopathy in the management of plant parasitic nematodes. Journal of Nematology 28: 8-14. Han, H. R., M. R. Cho., H. Y. Jeon., C. K. Kim and H. I. Yan. 2004. PCR-RFLP identification of three major Meloidogyne species in Korea. Journal of Asia-Pasific Entomology 7:171- 175. Harris, T. S., L. J. Sandall and T. O. Powers. 1990. Identification of single Meloidogyne juveniles by polymerase chain reaction amplification of mitochondrial DNA. Journal of Nematology 22: 518-524. Hartman, K. M and Sasser, J. N. 1985. Identification of Meloidogyne species on the basis of differential host test and perennial pattern morphology. In: An Advanced Treatise on Meloidogyne Vol II. Methodolgy (K. R. Barker, C. C. Carter and J. N. Sasser eds.) pp 69-77. North Caroloina State, University Graphics, Raleigh, NC.
260 Haroon, S., E. A. Akmal., A. E. R. Magdy and A. Ehab. 2003. Identification of different root knot nematodes and detection of intraspecific and intra population genetic variabilities between different nematodes samples using RAPD technique. Arabian Journal of Biotechnology 6: 247-266. Hassan, M. A., P. S. Chindo., P. S. Marley and M. D. Alegbejo. 2010. Management of root knot nematodes (Meloidogyne spp.) on tomato (Solanum lycopersicum) using organic wastes in Zaria, Nigeria. Plant Protection Sciences 46: 34-38. Haseeb, A., B. Singh., a. M. Khan and S. K. Saxena. 1980. Effect of watering on mode of application of oil cakes and nematodes on their efficiency in controlling root-knot nematodes on tomato. Acta Botanica Indica 8: 193-195. Hawa, Z.E.J., M.H. Ibrahim, N.R.M. Fakri, 2012. Impact of soil field water capacity on secondary metabolites, phenylalanine ammonia-lyase (PAL), malondialdehyde (MDA) and photosynthetic responses of Malaysian Kacip Fatimah (Labisia pumila Benth). Molecules 17: 7305–7322. Heidari, M.R., A. Mandgary and M. Enayati. 2004. Antinociceptive effects and toxicity of Fumaria parviflora Lam. in mice and rats. Daru. 12: 136-40. Hewlett, T. E., E. M. Hewlett and D. W. Dickson. 1997. Response of Meloidogyne spp, Heterodera glycines and Radopholous similis to tannic acid. Supplement to the Journal of Nematology 29: 737-741. Hiatt, E.E., L. Georgi, L., S. Huston., D. C. Harshman., S. A. Lewis and A. G. Abbott. 1995. Intra- and interpopulation genome variation in Meloidogyne arenaria. Journal of Nematology 27:143–152. Hobson, G. E and J. N. Davies. 1979. The Tomato. In: The biochemistry of fruits and their products. Acad. Press, NY 2: 437-482. Hoeh, W. R., K. H. Blakley and W. M. Brown. 1991. Heteroplasmy suggests limited biparental inheritance of Mytilus mitochondrial DNA. Science 215:1488. Hooper, D. J., K. Kuiper and P. A. A. Loof. 1963. Observations on the identity of Trichodorus teres, Hooper, 1962 and T. flavensis Kuiper and Loof 1962. Nematologica 9: 646. Holbrook, C. C., D. A. Knaufft and S. W. Dickson. 1983. A technique for screening peanut for resistance to Meloidogyn arenaria. Plant Disease 67: 957-958.
261 Hordegen, P., H. Hertzberg, J. Heilmann, W. Langhans and V. maurer. 2003. The anthelmintic efficacy of five plant products against gastrointestinal Trichostrongyloids in artificially infected lambs. Vetarinary Parasitology 117: 51–60. Hoste, H., F. Jackson., S. Athanassiadou., S. M. Thamsborg and S. O. Hoskin. 2006. The effects of tannins-rich plants on parasitic nematodes in ruminants. Trends in Parasitology 22: 253-2610. Hugall, A., C. Moritz., J. Stanton and D. R. Wolstenholme . 1994. Low, but strongly structured mitochondrial DNA diversity in root-knot nematodes (Meloidogyne). Genetics 136: 903–912. Hugall, A., J. Stanton and C. Moritz, C. 1997. Evolution of the AT-rich mitochondrial DNA of the root knot nematode, Meloidogyne hapla. Molecular and Biological Evolution 14: 40–48. Hugall, A., J. Stanton and C. Moritz. 1999. Reticulate evolution and the origins of ribosomal internal transcribed spacer diversity in apomictic Meloidogyne. Molecular and Biological Evolution 16:157–164. Hu, M. and R. B. Gasser. 2006. Mitochondrial genomes of parasitic nematodes-progress and perspectives. Trends in Parasitology 22: 78-84. Hussain, S. F, R. D. Minard., A. J. Freyer and M. Shamma. 1981. New Alkaloids from Fumaria-parviflora. Journal of Natural Products (Lloydia) 44: 169-78. Hussain, Z. 1982. In: Taylor, A. L; J. N. Sasser and L. A. Nelson. Relationship of climate and soil characteristics to geographical distribution of Meloidogyne spp., in agricultural soil. International Meloidogyne Project. Raleigh, North Carolina U.S.A. pp.48. Hussain, F., Sajjad-ur-Rehman and A. A. Dasti. 1985. Studies of weeds of wheat in Quetta. Pakistan Journal of Agricultural Research 6: 1-7. Husan-Bano, I. A. Siddiqui., W. Ahmed and S. Ehteshamul-Haq. 1999. Effect of some Pakistan Journal of Biological Sciences 2: 1364-1365. Hussey, R. S and R. R. Barker. 1973. A comparison of methods of collecting inocula of Meloidogyne spp., including a new technique. Plant Disease Reporter 57: 1025–8. Hyman, O. C. 1988. Nematode: anomalies and applications. Journal of Nematology 20:523. Hyman, B. C and L. E. Whipple. 1996. Application of mitochondrial DNA polymorphism to Meloidogyne molecular population biology. Journal of Nematology 28:268-276.
262 Ibrahim, I. K. A., M. A. M. Al-Saeedy and A. A. Mokbel. 2007. Control of root knot nematodes on Sunflower Plants with certain organic plant materials and biocontrol agents. Egyptian Journal of Phytopathology 35: 13-24. Iqbal, Z., M. Lateef., A. Jabbar., G. Muhammad and M. N. Khan. 2005. Anthelmintic acitivity of Calatropis procera (Ait.) flowers in sheep. Journal of Ethnopharmacology 102: 256-261. Iqbal, Z., M. Lateef, A. Jabbar, M. N. Ghayur and A.H. Gilani. 2006. In vitro and in vivo anthelmintic activity of Nicotiana tabacum L. leaves against gastrointestinal nematodes of sheep. Phytotherapy Research 20: 46–48. Jacquet, M., M. Bongiovanni., M. Martinez., P. Verschave., E. Wajnberg and P. Castagnone- Sereno. 2005. Variation in resistance to the root-knot nematode Meloidogyne incognita in tomato genotypes bearing the Mi gene. Plant Pathology 54: 93-99. Jaffree, B., A. E. Muldoon and E. C. Tedford. 1992. Trap production by nematophagous fungi growing from parasitized nematodes. Phytopathology 82: 615-620. Jafri, S. M. H. 1974. Fumariaceae. In: Flora of Pakistan (Eds.). E. Nasir and S. I. Ali. 73: 1-43. Jain, R K. 1992. Nematode pests of vegetable crops. 77-79 pp. In: Nematode pests of crops. (Eds.) Bhatti, D S, Walia, RK. CBS Publishers & Distributors, Delhi, India. Jansman, A. J. M. 1993. Tannins in feedstuffs for simple stomached animals. Nutrition Research review 6: 209-236. Jepson, S. B. 1987. Identification of root-knot nematodes. CAB International, Wallingford, U.K. Jeyaprakash, A., M. S. Tigano., J. Brito., R. M. D. G. Carneiro and D. W. Dickson. 2006. Differentiation of Meloidogyne floridensis from M. arenaria using high-fidelity PCR amplified mitochondrial AT-rich sequences. Nematropica 36: 1–12. Johnson, A. W. 1985. The role of nematicides in nematode management. In J. N. Sasser, and C. C. Carter, Eds. An advanced treatise in Meloidogyne, Vol. I Biology and Control, Raleigh: North Carolina State University Graphics. Pp. 249 - 267. Jhonson, A. W and J. Feldmesser. 1987. Nematicides-a historical review. In Vistas on Nematology, ed. J. A. Veech and D. W. Dickson. Pp. 448-454. Hyattsville, M. D: Society of Nematology.
263 Jianhu, X., P. Liu., Q. Meng and H. Long. 2004. Charaterization of Meloidogyne species from China using restriction length polymorphism. European Journal of Plant Paathology 110: 309-315. Jones, J.B., J. P. Jones., R. E. Stall, and T. A. Zitter. 1991. Compendium of tomato diseases. APS Press, St. Paul, 73pp. Kafi, A. 1963. Plant parasitic nematodes in Pakistan, Tech. Bull: 32 (FAO) pp. 12. Kaplan, M and J.P. Noe. 1993. Effect of chicken-excrement amendments on Meloidogyne arenaria. Journal of Nematology 25: 71-77. Kamal, A. M., Abo-Elyousr., M. E. Awad and M. A. Abdel-Gaid. 2009. Management of root knot nematode Meloidogyne incognita by plant extracts and essential oils. Journal of Plant Pathology 25: 189-192. Karssen, G and T. Van Hoenselaar. 1998. Revision of the genus Meloidogyne Goldi, 1892 (Nematoda: Heteroderidae) in Europe. Nematologica 44: 713-788. Karssen, G. 2002. The plant-parasitic nematode genus Melodidogyne Goldi 1892 (Tylenchida) in Europe. Brill, Leiden. 157 Pp. Kaskalvalci, G. 2007. Effect of soil solarization and organic amendment treatments for controlling Meloidogyne incognita in tomato cultivars in Western Antolia. Turkish Journal of Agriculture 31: 159-167. Kawazu, K., Y. Nishi and S. Nakajima. 1980. Two nematicidal substances from the roots of Cirsium japonicum. Agricultural and Biological Chemistry 44: 903-906. Keren-Zur., M. Antonov., J. Bercovitz., A. Feldman., A. Keram., G. Morcov and N. Rebhum. 2000. Bacillus firmus formulations for the safe control of root-knot nematodes. The BCPC conference. Pest and Disease, Brighton, UK 307-311. Kerry, B. R. 2000. Rhizosphere interactions and the exploitation of microbial agents for the biological control of nematodes. Phytopathology 38: 423 - 441. Keun-Oh, H., H. B. Chang., I. K. Man., W. Xinlong., H. O. Seung and S. H. Yeon. 2009. Molecular biological diagnosis of Meloidogyne species occurring in Korea. Journal of Plant Pathology 25: 247-255. Khan, A. A., Anjum and M. M. Alam. 1985. Control of Meloidogyne incognita on tomato by chemical dips. Pakistan Journal of Nematology 3: 105-109.
264 Khan, H. A., F. Qamar, M. Saeed and S. A. Khan. 1990. The nematicidal properties of compounds of plant origin with emphasis on polyphenol. Proceedings of Parasitology 9: 87-92. Khan, A and S. S. Shaukat. 2000. Effect of organic amendments and carbofuran on population density of four nematodes and growth and yield parameters of rice (Oryza sativa L.) var. IRRI-6. Pakistan Journal of Zoology 32: 145-150. Khan, H. U., T. Mukhtar and R. Ahmad. 2005. Geographical distribution of root knot nematodes (Meloidogyne spp,) in the Punjab province of Pakistan. Pakistan Journal of Nematology 23.133-140. Khan, H. U., T. Mukhtar., R. Ahmad and M. A. Iqbal. 2006. Studies on the distribution and control of Meloidogyne root knot nematodes in Faisalabad and Lahore Divisions, Pakistan. Pakistan Journal of Nematology 24: 57-64. Khan, S. A., N. Javed., M. A. Khan., I. U. Haq and A. Safdar. 2011. Use of plant extracts as a bare dip root treatment for the management of Meloidogyne incognita. Pakistan Journal of Phytopathology 23: 9-13. Khattak, S. G., S. N. Gillani and M. Ikram. 1985. Antipyretic studies on some indigenous Pakistani medicinal plants. Journal of Ethnopharmacology 14: 45-51. Khattak, B. 2008. Biological management of root knot nematode Meloidogyne javanica (Treub) with Trichoderma harzianum Rifai in Tomato. Ph.D Thesis (Nematology), Department of Plant Pathology, NWFP, Agricultural University, Peshawar. 157 Pp. Kim. J., S. M. Seo., S. G. Lee., S. C. Shin and I. K. Park. 2008. Nematicidal activity of plant essential oils and components from coriander (Coriandrum sativum), oriental sweetgum (Liquidambar orientalis), and valerian (Valeriana wallichii) essential oils against pinewood nematode (Bursaphelenchus xylophilus). Journal of Agricultural and Food Chemistry 56: 7316–7320. Kimura, Y., M. Mori., S. B. Hyeon., A. Suzuki and Y. Mitsui. 1981. A rapid and simple method for assay of nematicidal activity and its application to measuring the activities of diacarboxylic acid. Agricultural and Biological Chemistry 45: 249-251. Koenning, S. R and K. R. Barker. 1995. Soyabean photosynthesis and yield as influenced by Hetreodera glycines, soil type and irrigation. Journal of Nematology 27: 51-62.
265 Kogiso, S., K. Wada, and K. Monokata. 1976. Nematicidal polyacetylenes, 3Z, 11E, and 3E, 11E-trideca-1, 1, 3, 11 triene-5,7,9-triyne from Carthamus tinctorius L. Tetrahedron Letter 2: 109-110. Kolapo, A.L., M. B. Okunade., J. A. Adejumobi and M. O. Ogundiya. 2009. Phytochemical composition and antimicrobial activity of Prosopisafricana against some selected oral pathogens. World Journal of Agricultural Sciences 5: 90-3. Kopcke, B., D. Wolf, H. Anke and O. Sterner. 2001. New natural products with nematicidal activity from fungi. British Mycological Society International Symposium, Bioactive Fungal Metabolites- Impact and Exploitation. UW Swansea, UK. 22- 27. Pp. 72. Kumar, S and A.S. Khanna. 2006. Effect of neem-based products on the root knot nematode, Meloidogyne incognita, and growth of tomato. Nematologia Meditteranea. 34: 141-146. Landa, B. B., J. E. Palomares Rius., N. Vovlas ., R. M. D. G. Carneiro., C. M. N. Maleita and Abrantes, I.M. de O. 2008. Molecular characterization of Meloidogyne hispanica (Nematoda, Meloidogynidae) by phylogenetic analysis of genes within the rDNA in Meloidogyne spp. Plant Disease 92: 1104–1110. Larsen, M. 2000. Prospects for controlling animal parasitic nematodes by predacious microfungi. Parasitology 120: 121-131. Liu, Q. Z., H. Q. Li and Z. L. Liu. 2012. Nematocidal constituents from the ethanol extracts of Evodia rutecarpa Hort Unripe fruits. Journal of Chemistry (http://dx.doi.org/10.1155/2013/939215). Luc, M., A. R. Maggenti and R. Fortuner. 1988. A reappraisal of Tylenchina (Nemata). The family Hetroderidae, Filpijev and Schuurmans Stekhoven, 1941. Rev Nematology 11:169-176. Lunt, D.H., L. E. Whipple and B. C. Hyman. 2002. Mitochondrial DNA variable number tandem repeats (VNTRs): utility and problems in molecular ecology. Molecular Ecology 7: 1441–1455. Lysek, H., and D. Krajei. 1987. Penetration of ovicidal fungus Verticillium chlamydosporium through the Ascaris lumbricoides egg shells. Folia Parasitologia 34: 57- 60. Mabberely, D. I. 1987. The Plant Book. Cambridge University Press, Cambridge, New York. Mahajan, R., D. J. Kaur and K. L. Bajaj. 1992. Nematicidal activity of phenolic compounds against Meloidogyne incognita. Nematologia Mediterranea 20: 217-219.
266 Maheshwari, D. K and M. Anwar. 1990. Nematicidal activity of some phenolics on root knot growth and yield of Capsicum frutescens cv. Califonia Wonder. Journal of Phytopathology 129: 159-164. Mahajan, R., P. Singh., K. L. Bajab and P. S. Kalsi. 1986. Nematicidal activity of some sesquiterpenoids against root knot nematodes (Meloidogyne incognita). Nematologica 32: 119-123. Mafouz, M., Abd-Elgwad, E. A. Omer. 1995. Effect of essential oils of medicinal plants on phytonematodes. Journal of Pest Science 68: 82-84. Malik, M. S., B. S. Verma., N. K. Sangwan., D. S. Bhatti and K. S. Dindhsa. 1985. Phytochemical and Nematicidal studies on Chenopodium species. Plant Physiology and Biochemistry 12: 133-138. Mai, W. F. 1985. Plant Parasitic nematodes: their threat to agriculture. In: Sasser, J. N., Carter, C. C (eds.), An advanced treatise on Meloidogyne. Vol. I. Biology and Control. North Carolina State University Graphics, Raleigh 11-17. Pp. Maqbool, M. A., S. Hashmi and A. Ghaffar. 1986. Eleven new hosts of root-knot nematodes and identification of physiological races in Pakistan. Pakistan Journal of Nematology 4: 11-14. Maistrello, L., G. Vaccari and N. Sasanelli. 2010. Effect of chestnut tannins on the root-knot nematode Meloidogyne javanica. Helminthologia 47: 48-57. Maqbool, M. A and F. Shahina. 2001. Systematic and Distribution: Biodiversity of Nematode Fauna in Pakistan. National Nematological Research Centre, University of Karachi, Karachi-75270, Pakistan. 180 pp. Maqbool, A., C. S. Hayat and A. Tanveer. 2004. Comparative efficacy of various indigenous and allelopathic drugs against fascioliasis in buffaloes. Veterinary Archives 74: 107-14. Mariela, G., B. Guzman., R. Rudyk., E. Romano and M. A. A. Molina. 2003. Spectrophotometric determination of phenolics in Propolis. Lat. American Journal of Pharmacology 22: 243-8. Mateille, T., D. L. Trudgill., C. Trivino., G. Bala., A. Sawadogo and E. Vouyoukalou. 2002. Multisite survey of soil interactions with infestation of root-knot nematodes (Meloidogyne spp.) by Pasteuria penetrans. Soil Biology and Biochemistry 34: 1417– 1424.
267 Matsuda, K., K. Yamada., M. Kimura and M. Hamada. 1991. Nematicidal activity of matrine and its derivates against Pine wood nematodes. Journal of Agriculture and Food Chemistry 29:189-191. Maistrello, L., G. Vaccari., N. Sasanelli. 2010. Effect of chestnut tannins on the root-knot nematode Meloidogyne javanica. Helminthologia 47: 48-57. Mc Govern, R. J., L. E. Dattnoff and L. Tripp. 1992. Effect of mixed infection and irrigation method on colonization of tomato roots by Trichoderma harzianum and Glomus intraradices. Proceedings of the Florida State Horticultural Society. 105: 361-363. Mc Sorley, R. 1998. Alternative practices for managing plant-parasitic nematodes. American Journal of Alternative Agriculture 13:98-104. Mc Sorley, R. 1999. Host suitability of potential cover crops for root-knot nematodes. Supplementry Journal of Nematology 31:619-623. McSorley, R., 2011. Overview of organic amendments for management of plant-parasitic nematodes, with case studies from Florida. Journal of Nematology. 43: 69–81. Mehdi, F. S., I. A. Siddiqui., T. Zia and N. I. Ali. 2001. Use of mangrove for the control of Meloidogyne javanica in tomato. Nematologia Medittranea 29: 127-129. Meher, H. C., S. Walia and C. L. Sethi. 1988. Effect of steroidal and triterpenic saponnins on the mobility of juveniles of Meloidogyne incognita. Indian Journal of Nematology 18: 244-247. Meng, Q.-P., Long, H and J. H. Xu. 2004. PCR assays for rapid and sensitive identification of three major root-knot nematodes, Meloidogyne incognita, M. javanica and M. arenaria. Acta Phytopathologcia Sinica 34:204–210. Meyer, S.L.F., R.N. Huettel and R.M. Sayre. 1990. Isolation of fungi from Heterodera glycines and in vitro bioassays for their antagonism to eggs. Journal of Nematology 22: 532 - 537. Meyer, S. L. F., S. I. Massoud, D. J. Chitwood and D. P. Roberts. 2000. Evaluation of Trichoderma virens and Burkholderia cepacia for antagonistic activity against root- knot nematode, Meloidogyne incognita. Journal of Nematology 2: 871-879. Meyer, S. L. F., R. N. Huettel., X. Z. Liu., R. A. Humber., J. Juba and J. K. Nitao. 2004. Activity of fungal cultural filtrates against soyabean cyst nematodes and root knot nematodes egg hatch and juvenile mortality. Nematology 6: 23-32.
268 Meyer, S. L. F., I. A. Zasada., D. P. Roberts., B. T. Vinyard., D. K. Lakshman., J. K. Lee., D. J. Chitwood and L. K. Carta. 2006. Plantago lanceolata and plantago rugelii extracts are toxic to Meloidogyne incognita but not to certain microbes. Journal of Nematology 38: 333-338. Mian, I. H and R. Rodriguez-Kabana. 1982. Survey of the nematicidal properties of some organic materials available in Alabama as amendments to soil for control of Meloidogyne arenaria. Nematropica12:235-246. Midiwo, J. O., N. O. Owino and E. Dagne. 1994. Flavonoids of Polygonum senegalense. Part III: Isolation of dihydrochalcone glucoside and quercertin glycosides. Bulletin of chemical society. Ethiopia 8: 79-84. Moen, M., R. N. Perry and J. L. Starr. 2009. Meloidogyne species- a diverse novel group and important plant parasites. In: Perry, R. N. Moens, M and Starr, J. L. (Eds.). Root knot nematodes. Wallingford, UK, CAB International, pp. 1-17. Mojtahedi, H., G. S. Santo., J. H. Wilson and A. N. Hang. 1993. Managing Meloidogyne chitwoodi on potato with rapseed as green manure. Plant Disease 77: 42-46. Molan, A. L., A. J. Duncan., T. N. Barry and W C. Mcnaab. 2003. Effect of condensed tannins and crude sesquiterpenes lactones extracted from chicory on the mortality of larvae of deer lungworm and gastrointestinal nematodes. Parasitology International 52: 209- 218. Morris, J. B. and J. T. Walker. 2002. Non-traditional legumes as potential soil amendments for nematode control. Journal of Nematology 34: 358-361. Mukhtar, T., I. Pervaz., R. Ahmad and H. U. Khan. 2005. Management of Meloidogyne javanica by cropping sequence and effects on Pasteuria penetrans. Pakistan Journal of Nematology 23: 173-180. Munir, A and J. Bridge. 2003. Rice root-knot nematode Meloidogyne graminicola Golden and Birchfield, 1965 from rice in Pakistan. Pakistan Journal of Nematology 21: 133-135. Munakata, K. 1983. Nematocidal natural products: In natural products for innovative pest management. Eds, D. L. Whithead, and W. S. Bowers, pp. 299-310. Oxford: Pergamon. Nagnathan, T. G. 1984. Studies on yield loss in vegetable due to Meloidogyne incognita. South Indian Horticulture 32: 115-116.
269 Natarajan, N., A. Cork., N. Boomathi., R. Pandi., S. Velvan, and G. Dhakshnamoothy. 2006. Cold aqueous extracts of African marigold, Tagetes erecta for control of tomato root knot nematode, Meloidogyne incognita. Crop protection 25: 1210-1213. Ntalli, N.G., U. M. Spiroudi and I. Giannakou. 2010. Nematicidal activity of powder and Melia azadirach fruits against Meliodogyne incognita. Annals of Applied Biology 156: 309- 17. Naz, I., J. E. Palmo-Rius., Saifullah., V. Blok., S. R. Khan., S. Ali, S., and S. Ali. 2013a. In vitro and in planta nematicidal activity of Fumaria parviflora (Fumariacea) againt Southern Root knot nematode Meloidogyne incognita. (doi: 10.1111/j.1365- 3059.2012.02682.x). Naz, I., Saifullah, M.R. Khan, 2013b. Nematicidal activity of nonacosane-10-ol and 23a- homostigmast-5-en-3ß-ol isolated from the roots of Fumaria parviflora (Fumariaceae). Journal of Agriculture and Food Chemistry 61: 5689–5695. Nazli, R., M. Ahfter, S. Ambreen, A. H. Solangi and N. Sultana. 2008. Insecticidal, Nematicidal and Antibacterial Activities of Gliricidia sepium. Pakistan Journal of Botany 40: 2625-2629. Nei, M and W.H. Li. 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proceedings of National Academic Science USA 76: 5269- 5273. Netscher, C, and R. A. Sikora. 1990. Nematode parasites of vegetables. In: M. Luc, R. A. Sikora, and J. Bridge, eds. Plant parasitic nematodes in tropical and subtropical agriculture. CAB International, Wallingford, Oxon, UK. Pp. 237-283. Nguyen, D. M. Chanh., Nguyen, Van-Nam., S. Dong-Jun., P. Ro-Dong and J. W. Jin. 2009. Nematicidal activity of compounds extracted from medicinal plants against the pine wood nematode Bursaphelenchus xylophilus. Nematology 11: 835-845. Nico, A. I., R. M. Jimenez-Diaz and P. Castilla. 2004. Control of root knot nematodes by agro- industrial waste in potting mixtures. Crop Protection 23: 581-587. Nonaka, G. I., I. Nishioka., M. Nishizawa., T. Yamagishi., Y. Kashiwada., G. E. Dutschman., A.J. Bodner., R. E. Kilkuskie., Y. C. Cheng and K. H. Lee. 1990. Anti-Aids Agents, 2: Inhibitroy effect of Tannis on HIV Reverse Transcriptase and HIV Replication in H9 Lymphocyte cells. Journal of Natural Product Research 53: 587-595. (DOI: 10.1021/np50069a008)
270 Nordbring-Hertz, B., H.B. Jansson and A. Tunlid. 2000. Nematophagous fungi. In: Encyclopedia of life sciences. Macmillan Publishers, Basingstoke. Ntallit, N. G., F. Ferraris., I. Giannkou and U. M. Spiroudi. 2010. Phytochemistry and nematicidal activity of the essential oils from eight Greek Lamiaceae Aromatic plants and thirteen Terpenes components. Journal of Agriculture Food Chemistry 58: 7856- 7863. Ogbuji, R. O. 2004. Soil depth distribution of the root knot nematodes (Meloidogyne incognita) from two farmlands in a humid tropical environment. Geo Journal 5: 79-80. Oka, Y., S. Nacar, E. Putievsky, U. Ravid, Z. Yaniv and Y. Spiegel. 2000. Nematicidal activity of essential oils and their components against the root-knot nematode. Phytopathology 90: 710-715. Oka, Y. 2001. Nematicidal activity of essential oil components against the root-knot nematode Meloidogyne javanica. Nematology 3: 159-164. Oka, Y., N. Tkachi and M. Mor. 2007. Phosphite inhibits the development of nematodesHetrodera avenae and Meloidogyne marylandi in cereals. Phytopathology 97: 396-404. Oka, Y., 2010. Mechanisms of nematode suppression by organic soil amendments – a review.
Applied Soil Ecology. 44: 101–115.
Oka, Y., S. Shuker, and N. Tkachi, 2013. Influence of soil environments on nematicidal activity of fluensulfone against Meloidogyne javanica. Pest Management Science. DOI: 10.1002/ps.3487. Okimoto, R., H. M. Chamberlin., J. L. Macfarlane and D. R. Wolstenholme. 1991. Repeated sequence sets in mitochondrial DNA molecules of root knot nematodes (Meloidogyne): nucleotide sequences genome location and potential for host-race identification. Nucleic Acids Research 19: 1619–1626. Olabiyi, T. I. 2004. Assessments of the nematicidal properties of extracts from Tagetes erecta, Ocimim gratissimum, Hyptis suaveolens and Crotalaria retusa. PhD thesis submitted to the department of Crop Production, University of Ilorin. 177 pp. Omar, S. A., M. I. Abdel-Massih and B. E. Mohamed. 1994. Use of saponins to control the root knot nematode Meloidogyne javanica in tomato plants. Bulletins of faculty of Agriculture. Cairo. 45: 933-940.
271 Onda, M., K. Abe., K. Yonezawa., N. Esumi and T. Suzuki. 1970. Studies on the constituents of Bocconia cordata. II. Bocconine. Chemical Pharmacology Belletin 18: 435-439. Onyeyili, P. A., C. O. Nwosu and J. I. Jibike. 2001. Anthelmintic activity of crude aqueous extracts of Nauclea latifolia stem bark against ovine nematodiasis. Fitoterapia 72: 12- 21. Orui, Y. 1998. Identification of Japanese species of genus Meloidogyne (Nematoda: Meloidogynidae) by PCR-RFLP analysis. Applied Entomology and Zoology 33:43-51. Orui, Y. 1999. Species identification of Meloidogyne spp. (Nematoda: Meloidogynidae) in Japan by Random Amplified Polymorphic DNA (RAPD-PCR). Japanese Journal of Nematology 29: 7-15. Orhan, I., B. Sener., M. I. Choudhary and A. Khalid. 2004. Acetylcholinesterase and butyrylcholine esterase inhibitory activity of some Turkish medicinal plants. Journal of Ethnopharmacology 91: 57-60. Orhan, I., B. Ozcelik., T. Karagoglu and B. Sener. 2007. Antiviral and antimicrobial profiles of selected isoquinoline alkaloids from Fumaria and Corydalis species. Z. Naturforsch 62: 19-26. Osman, A. A and D. R. Vigileirchio. 1988. Efficacy of biologically active agents as nontraditional Nematicides for Meloidogyne javanica. Review of Nematology 11: 93- 98. Pakeerathan, K., G. Mountain and N. Trashing. 2009. Ecofriendly management of root knot nematodes Meloidogyne incognita (Kofoid and White) Chitwood using different green leaf manures on tomato under field conditions. American Eurasian Journal of Agricultural and Environmental Sciences 6: 494-497. Pandey, V. B., B. Das Gupta., S. K. Bhattacharya., R. Lal and P. K. Das. 1971. Chemistry and pharmacology of the major alkaloid of Fumaria indica. Current Science 40: 455-457. Pandey, M. B., K. S. Ashok., K. S. Anil and U. P. Singh. 2007. Inhibitive effect of Fuyuziphine isolated from plant Pittpapra (Fumaria indica) on spore germination of some fungi. Mycology 35: 157-158. Pathak, A. K., B. S. Yadav and J. S. Brar. 1988. Water hyacinth and neem leaves for the control of root knot nematode Meloidogyne incognita on brinjal. Plant Disease Research 3:74-76.
272 Paracer, S. M., A. C. Tarjan and L.K. Hodgson. 1987. Effective use of marine algal products in the management of plant parasitic nematodes. Journal Nematology 19: 194-200. Pariha, K., B. Rehman, and M.A. Siddiqui, 2012. Impact of organic additives for sustainable management of root knot nematodes in bottle gourd. Biosci. International. 1: 102–105. Park, I. K., J. Kim., S. G. Lee and S. C. Shin. 2007. Nematicidal Activity of Plant Essential Oils and Components From Ajowan (Trachyspermum ammi), Allspice (Pimenta dioica) and Litsea (Litsea cubeba) Essential Oils Against Pine Wood Nematode (Bursaphelenchus Xylophilus). Journal of Nematology 39: 275-279. Parveen, A and M. Qaiser. 2004. Pollen flora of Pakistan-XL. Fumariaceae. Pakistan Journal of Botany 36: 467-473. Pavaraj, M., G. A. Bakavathiapann and S. Baskaran. 2012. Evaluation of some plant extracts for some nematicidal properties against root knot nematode, Meloidgyne incognita. Journal of Biopesticide 5: 106-110. Pérez, M. P, J. A. Navas-Cortés, H. J. Pascual-Villalobos and P. Castillo. 2003. Nematicidal activity of essential oils and organic amendments from Asteraceae against root-knot nematodes. Plant Pathology 52: 395-401. Petersen, D. J and T. C. Vrain 1996. Rapid identification of Meloidogyne chitwoodi, M. hapla and M. fallax using primers to amlify their ribosomal intergenic sapacer. Fundamental and applied Nematology19:601-605. Petersen, D. J., C. Zijlstra., J. Wishart., V. Blok and T. C. Vrain. 1997. Specific probes efficiently distinguish root-knot nematode species using signature sequences in the ribosomal intergenic spacer. Fundamental and Applied Nematology 20: 619-626. Piotte, C., P. Castagnone-Sereno., J. Uijthof., P. Abad., M. Bongiovanni, M and A. Dalmasso. 1992. Molecular characterization of species and populations of Meloidogyne from various geographic origins with repeated-DNA homologous probes. Fundamental and Applied Nematology 15: 271–276. Piotte, C., P. Castagnone-Sereno., M. Bongiovanni., A. Dalmasso and P. Abad.1995. Analysis of a satellite DNA from Meloidogyne hapla and its use as a diagnostic probe. Phytopathology 85: 458–462. Pinto, S., E. Rosa, and S. Santos. 1998. Effet of 2-propenyl glucosinolate and derived isothiocyanate on the activity of nematode Globodera rostochiensis (Woll). Acta Horticulture 459: 323-327.
273 Popova, M. E., V. Simanek., L. Dolejs., B. Symsl and V. Preininger. 1982. Alkaloids from Fumaria parviflora and F. kralikii. Planta Meditteranean 4:120-122. Potter, M. J., V. A. Vanstone, K. A. Davies., J. A. Kirgegaard, and A. J. Rathjen. 1999. Reduced susceptibility of Brassica napus to Pratylenchus neglectus in plant with elevated roots level of 2-phenylethyl glucosionalte. Journal of Nematology 31: 291- 298. Powers, T. O., E. G. Platzer and B. C. Hyman. 1986. Species-specific restriction site polymorphism in root-knot nematode mitochondrial DNA. Journal of Nematology 18: 288-293. Powers, T. O and L. J. Sandall. 1988. Estimation of generic divergence in Meloidogyne mt DNA. Journal of Nematology 20: 505. Powers, T. O and T. S. Harris. 1993. A polymerase chain reaction method for identification of five major Meloidogyne species. Journal of Nematology 25: 1-6. Powers, T. O., T. G. Todd., A. M. Burnell., P. C. B. Murray., C. C. Fleming., A. L. Szalanski ., B. A. Adams and T. S. Harris. 1997. The rDNA internal transcribed spacer as a taxonomic marker for nematodes. Journal of Nematology 29: 441-450. Powers, L.E. and R. McSorley, 2000. Ecological principles of agriculture. Albany, NY: Delmar. Thomson Learning. http://www.agriscience.delamr.com/. Powers, T. 2004. Nematode molecular diagnostics: from bands to barcodes. Annual Review of Phytopathology 42: 367–383. Powers, T. O., P. G. Mullin., T. S. Harris., L. A. Sutton and R. S. Higgins. 2005. Incorporating molecular identification of Meloidogyne spp. into large scale regional nematode survey. Journal of Nematology 37: 226-235. Prot, J. C and S. D. Van Gundy. 1981. Effect of soil texture and clay component on migration on Meloidogyne incognita second stage juveniles. Journal of Nematology 12: 213- 217. Quarles, W. 1992. Botanical Pesticids from Chenopodium. IPM Practitioner. 14: 1-11. Qayum, M., M. Nisar., B. A. Khan., M. Akhtar., W. A. Kaleem., M. I. Khan., T. Mahmood., S. S. Ahmad and Zia-Ul-Haq. 2011. Nematicidal potential of Impatiens bicolor Royle. Journal of Medicinal Plants Research 5: 5138-41.
274 Qiu, J. J., B. B. Westerdhal., C. Anderson and V. M. Williamson. 2006. Sensitive PCR Detection of Meloidogyne arenaria, M. incognita and M. javanica extracted from Soil. Journal of Nematology 38: 434–441. Radewald, J. D., M. V. Mckenry., P. A. Roberts and B. B. Westerdahl. 1987. The importance of soil fumigation for nematode control. California Agriculture 16-17. Rahmatullah, M., R. Jahan., M. H. Hassan., S. Seraj., M. M. Rehman., A. R. Chowdhry., Z. U. M. Emad Ullah Maijee., D. Nasrin., Z. Khatun., F. I. Jahan and M. A. Khatun. 2010. A comparative analysis of medicinal plants used by several tribes of Chittagong Hill tracts regions, Bangladesh to treat helminthic infections. Advances in natural and applied sciences 4: 105-111. Randing, O., F. Leory., M. Bongiovanni and P. Castagnone-Sereno. 2001. RAPD characterization of single females of the root-knot nematodes, Meloidogyne spp. European Journal of Plant Pathology 107: 639-643. Randig, O., M. Bongiovanni, R. M. D. G. Carneiro and P. Castagnone-Sereno. 2002. Genetic diversity of root-knot nematodes from Brazil and development of SCAR markers specific for the coffee-damaging species. Genome 45: 862-870. Rao, Y. S., Jayaprakash and J. K. Mohanthy. 1988. Nutritional disorders in rice due to infestation by Heterodera oryzicola and Meloidogyne graminicola. Review of Nematology 11: 375-380. Rao, M. S., P. P. Reddy., A. Mittal., M. V. Chandravadana and M. Nagesh. 1996. Effect of some secondary plant metabolites as seed treatment agents against Meloidogyne incognita on tomato. Nematalogia Mediterranea 24: 49-51. Rao, K.S and S. H. Mishra. 1997. Hepatoprotective activity of the whole plant extracts of Fumaria Indica. Indian Journal of Pharmacological Science 59: 165-170. Rao, C.V., A.R. Verma, P.K. Gupta and M. Vijayakumar. 2007. Anti-inflammatory and anti- nociceptive activities of Fumaria indica whole plant extract in experimental animals. Acta Pharmacology 57: 491–498. Ram, K and D. C. Gupta. 1980. A note on the efficacy of fresh neem extracts in the control of Meloidogyne javanica infesting chickpea (Cicer arietinum). Indian Journal of Nematology 10:96-98.
275 Ram, K and D. C. Gupta. 1982. Efficacy of plant leaves, nematicides and fertilizers alone and in combination against Meloidogyne javanica infecting chickpea (Cicer arietinum L.). Indian Journal of Nematology 12: 221-5. Ramya, S., T. Kalaivani., C. Rajasekaran., P. Jepachanderamohan., N. Alaguchamy., M. Kalyansundaram and R. Jayakuraraj. 2008. Antimicrobial activity of aqueous extracts of bark, root, leaves and fruits of Terminalia arjuna Wight and Arn. Ethnobotanical leaflets12: 1192-1197. Randig, O., M. Bongiovanni, R. M. D. G. Carneiro and P. Castagnone-Sereno. 2002. Genetic diversity of root-knot nematodes from Brazil and development of SCAR markers specific for the coffee-damaging species. Genome 45: 862-870. Reddy, D .R. 1985. Analysis of crop losses in tomato due to Meloidogyne incognita. India Journal of Nematology 15: 55-59. Renco, M., N. Sasanelli., I. Papajova, and L. Maistrello. 2012. Nematicidal effect of chestnut tannin solutions on the potato cyst nematode Globodera rostochiensis (Woll.) Barhens. Helminthologia 49: 108–114. Reshmi, B and M. Vijalakshmi. 1998. Effect of aqueous extracts of neem based pesticides on the mortality of second stage juveniles of Meloidogyne incognita. Annals of Plant Protection Sciences 6: 53-55. Reynolds, l. B., R. Bonnie., Ball-Coelho and J. W. Potter. 2000. Rotation with Tagtes spp. for the control of root-lesion nematodes affects flue-cured tobacco growth, tiled, quality and cost of production. Tobacco Science Pp. 11-18 (doi: http://dx.doi.org/10.3381/0082-4623-44.1.11). Riga, E., H. Mojtahedi, R. E. Ingham and A. M. McGuire. 2003. Green manure amendments and management of root knot nematodes on potato in the Pacific Northwest of USA. Nematology Monographs and Perspectives 2: 151–158. Riga, E. 2011. The effects of Brassica green manures on plant parasitic and free living nematodes used in combination with reduced rates. Journal of Nematology 43(2):119– 121. 2011. Rivoal, R and R. Cook. 1993. Nematode pests of cereals. In: Evans, K., D. L. Trudgill and J. M. Webster. (eds) Plant-parasitic Nematodes in Temperate Agriculture. CAB International, Wallingford, UK 259–303.
276 Rizvi, M. A. and M. Shameel. 2006. In vitro nematicidal activities of seaweed extracts from karachi coast. Pakistan Journal of Botany 38: 1245-1248. Robbins, R. T and K. R. Barker. 1974. The effect of soil type, particle size, temperature and moisture on the reproduction of Belonolaimus longicaudatus. Journal of Nematology 6: 1-6. Roberts, P. A. 1992. Resistance in nematodes: Definition, concepts and consequences. In: Starr JL, editor. Methods for Evaluating Plant Species for Resistance to Plant Parasitic Nematodes. Hyattsville, MD: Society of Nematologists 1–15 Pp. Roy, D., S. P. Sinhababu., N. C. Sukul and S. B. Mahato. 1993. Nematicidal principles of funicles of Acacia auriculiformis. Indian Journal of Nematology 23: 152-157. Rubinof, D and B. S. Holland. 2005. Between two extremes: mitochondrial DNA is neither the panacea nor the nemesis of phylogenetic and taxonomic inference. Systematic Biology 54: 952-961. Safowra, A. 1993. Medicinal plant and traditional medicines in Africa. Chichester John Wiley and Sons New York. Pp. 97-145. Salawu, E. O. 1992. Effect of neem leaves extracts and ethoprop singly and in combination on Meloidogyne incognita and growth of Sugarcane. Pakistan Journal of Nematology 10: 51-56. Sanchez, de Viala S., B. B. Brodie., E. Rodriguez and D. M. Gibson. 1998. The potential of thiarubine C as a nematicidal agent against plant parasitic nematodes. Journal of Nematology 30: 192-200. S-dos S. D R. Costa, M. S. N. de-A. Santos and M. F. Ryan. 2003. Effect of Artemisia vulgaris Rhizome Extracts on Hatching, Mortality, and Plant Infectivity of Meloidogyne megadora. Journal of Nematology 35: 437-442. Santhosh, J. E., B. Beena and K. V. Ramana. 2005. Tropical soil microflora of spice-based cropping systems as potential antagonists of root-knot nematodes. Journal of Invertebrate Pathology 88: 218-225. Sasser, J. N. 1979. Economic importance of Meloidogyne in tropical countries. Pp. 359-374. In: Root knot nematodes (Meloidogyne spp), systematic, biology and control (Eds. F. Lamberti and C. E. Taylor). Academic Press London. Sasser, J. N. 1980. Root-knot nematodes: a global menace to crop production. Plant Disease 64: 36-41.
277 Sasser, J. N and C. C. Carter. 1982. Overview of the International Meloidogyne Project- Rationale,Goals, Implementation and Progress to date. Proc. 3rd Res. Plan. Conf. On root-knot nematodes Meloidogyne spp. Panama 1-7. Sasser, J. N and C. C. Carter. 1985. Overview of International Meloidogyne Project. In: Advanced Treatise on Meloidogyne. Volume 1. Biology and Control. Pp. 19-24. Ed. J. N. Sasser and C. E. Taylor. Raleigh. USA. North Carolina State University, Graphics. Sasser, J. N and D. W. Freckman. 1987. A world perspective on Nematology. The role of society. Pages 7-14 in Vistas on Nematology, J. A. Veech and D. W. Dickson, eds. SON. Inc., Hyattsville, MD, USA. Sasser, J. N. 1990. Plant parasitic nematodes: The farmer’s hidden enemy. North Carolina State University, Raliegh, NC. Pp. 47-48. Sasu, R., B. Cabeduzo, R. Rico., F. Najera and J. M. L. Pez-Romero. 2002. Direct determination of alkaloid contents in Fumaria species by GC-MS. Phytochemistry Annual 13: 363 Pp. Schmitz, B., W. Burgermeister and H. Braasch. 1998. Molecular genetic classification of Central European Meloidogyne Chitwoodi and M. fallax. Nachrichtenblatt des Deutschen Pflanzenschutzdienstea 50: 310-317. Semblat, J. P, E. Wajnberg., A. Dalmasso., P. Abad and Castagnone-Sereno P. 1998. High- resolution DNA fingerprinting of parthenogenetic root-knot nematodes using AFLP analysis. Molecular Echology 7: 119-125. Sener, B., F. Bingol., I. Erdogan, W. S. Bowers and P. H. Evans. 1998. Biological activities of some Turkish medicinal plants. Pure and Applied Chemistry 70: 403-406. Shahid, M., A. U. Rehman., A. U. Khan and A. Mehmood. 2007. Geohraphical distribution and infestation of plant parasitic nematodes on vegetables and fruits in the Punjab province of Pakistan. Pakistan Journal of Nematology 25:59-67. Shakeel, A., M. Akhter., M. Z. Haq., Mehjabeen and S. Ahmed. 2010. Antifungal and nematicidal activity of selected legumes of Pakistan. Pakistan Journal of Botany 42: 1327-1331. Shaukat, S. S and I. A. Siddiqui. 2001. Nematicidal activity of some weed extracts against Meloidogyne javanica (Treub.) Chitwood. Pakistan Journal of Biological Sciences 4: 1251-1252.
278 Shu Shan, D., Z Hai Ming., B. Chun Qi., W. Cheng Fang., L. Qi Zhi and L. Zhi. 2011. Nematocidal flavone-C-glycosides against the root-knot nematode (Meloidogyne incognita) from Arisaema erubescens tubers. 16: 5059-5086. Shurtleff, M. C and C. W. Averre (III). 2000. Diagnosing Plant Diseases Caused by Nematodes. APS Press, The American Phytopathological Society, St. Paul, Minnesota. 138: 459-461. Siddiqui, I. A., S. Ehteshamul-Haque, M. J. Zaki and A. Ghaffar. 1998. Effect of brown seaweeds (Stoechospermum morginatum and Sargassum tenerrium) and Rhizobia in control of root-knot disease and control of mung bean. Pakistan Journal of Nematology 16: 145–149. Siddiqui, M. A and M. M. Alam. 1990. Control of root knot, reniform and stunt nematodes by nimbin seed dressing. Nematologia Meditrranea 18: 19-22. Siddiqui, Z. A and I. Mehmood. 1998. Effect of a plant growth promoting bacterium, an AM fungus and soil types on morphometrics and reproduction of Meloidogyne javanica on tomato. Applied Soil Ecology 8: 77-84. Siddiqui, S. A., A. D. Dwivedi., P. K. Singh., T. Hassan., S. Jain., O. Parsad and N. Mishra. 2009. Molecular structure, vibrational spectra and potential energy distribution of protopine using AB initio and density fuctional theory. Journal of Structural Chemistry 50: 411-420. Sikora, R. A. 1992. Management of the antagonistic potential in agricultural ecosystems for the biological control of plant-parasitic nematodes. Annual Review of Phytopathology 30: 245-270. Sikora, R. A and E. Fernandez. 2005. Nematodes parasites of vegetables. In: Plant parasitic nematodes in Tropical and Subtropical Agriculture (Eds. Luc, M., R. A. Sikora and J. Bridge) Second Ed. CAB International, Wallingford, Oxford, OX10 8DE, UK. Pp. 319- 392. Sleeth, B and M. H. Reynold. 1978. Root knot nematode infestation as influenced by soil texture. Soil Science 80: 459-461. Slinkard, K and V. L. Singleton. 1977. Total phenol analyses: automation and comparison with manual methods. American Journal of Enol Viticul 28: 49-55. Smedley, E. M. 1939. Exepriments on the use of isothiocyanates in the control of potato strains of Hetrodera schachtii (Schmidt). Journal of Helminthology 17: 31-38.
279 Spaull, V. W. 1977. Meloidogyne propora n. sp (Nematoda: Heteroderidae) a new genus and species of plant parasitic nematodes. Proceedings of Helminthological Society Washington 31: 83-88. Sofowora A, 1993. Medicinal Plants and Traditional Medicines in Africa. Chichester John Wiley and Sons New York. pp 97-145. Stanton, J., A. Hugall and C. Moritz. 1997. Nucleotide polymorphisms and an improved PCR- based mtDNA diagnostic for pathenogenetic root-knot nematodes (Meloidogyne spp.). Fundamental and Applied Nematology 20: 261–268. Stevens, C., V. A. Khan and A. Y. Tang. 1990. Solar heating of soil with double plastic layers: a potential method of pest control. p. 163-168. In: Proceedings of the 22nd National Agricultural Plastics Congress. Nat. Ag. Plastics Assoc., Peoria, IL. Stirling, G. R and A. Nikulin. 1998. Crop rotation, organic amendments and nematicides for control of root knot nematodes (Meloidogyne incognita) on ginger. Australian Plant Pathology 27: 234-243. Stone, A. G., G. E. Vallad., L. R. Cooperband., W. R. Stevenson and R. M. Goodman. 2000. Impact of animal organic amendment on disease incidence in a three vegetable rotation. Soil Science Abstarcts pp. 85. Suga, T., S. Ohta., K. Munesada., N. Ide and M. Kurikawa. 1993. Enogenous pinewood Nematicidal substances in pines, Pinus massioniana, P. strobus and P. palastrus. Phytochemistry 33: 1395-1401. Subbotin, S. A and M. Moens. 2006. Molecular Taxonomy and Phylogeny. In book: Plant Nematology edited by R. Perry and M. Moens. CABI, UK. Sullivan, P. 2003. Applying the principles of sustainable farmings. ATTRA (www.attra.ncat.org/attra-pub/). Syed., R. S., M. Qasim., I. A. Khan and S. A. Shah. 2006. Study of medicinal plants among weeds of wheat and maize in Peshawar region. Pakistan Journal of Weed Sciences Research 12: 191-197. Taba, S., Sawada, J and Z. Moromizato. 2008. Nematicidal activity of Okinawa island on the root knot nematode, Meloidogyne incognita (Kofoid and White) Chitwood. Plant Science 303: 207-216. Tandon, V., A. K. Yadav., B. Roy and B. Das. 2011. Phytochemicals as cure of worm infections in traditional medicide systems. Emerging trends in Zoology 11: 351-358.
280 Tariq, M., S. Dawar., M. S. Mehdi and M. J. Zakki. 2007. Use of Avicennia marina (Forsk.) Vierh in the control of root knot nematode Meloidogyne javanica (Treub) Chitwood on okra and mash bean. Turkish Journal of Biology 31: 225-230. Tava, A and P. Avato. 2006. Chemical and biological activity of triterpene saponins from Medicago species. Natural Product Communication 1: 1159-1180. Taylor, A. L and J. N. Sasser. 1978. Biology, Identification and Control of Root-knot ode Nematodes (Meloidogyne species). North Carolina State University Graphics, Raleigh, North Carolina, USA, 111Pp . Taylor, L. R., J. N. Sasser and L. A. Nelson. 1982. Relationships of climate and soil characteristics to geographical distribution of Meloidogyne species in agricultural soils. Cooperative Publication, Department of Plant Pathology, North Carolina State University and US Agency for International Development, Raleigh, North Carolina. Thistlethawayte, B. 1970. Reproduction of Pratylenchus penetrans (Nematoda: Tylenchida). Journal of Nematology 38: 83-89. Thoden, T. C., M. Boppre and J. Hallmann. 2007. Pyrrolizidine alkaloids of Chromolaena odorata act as nematicidal agent and reduce infection of lettuce roots by Meloidogyne incognita. Nematology 9: 343-349. Thoden, T.C., M. Boppré and J. Hallmann. 2009. Effects of pyrrolizidine alkaloids on the performance of plant-parasitic and free-living nematodes. Pest Management Science 65: 823-830. Thoden, T.C., G.W. Korthals, A.J. Termorshuizen, 2011. Organic amendments and their influences on plant-parasitic and free-living nematodes: a promising method for nematode management. Nematology., 13: 133–153. Thomas, W. K and A. C. Wilson. 1991. Mode and tempo of molecular evolution in the nematode Caenorhabditis: cytochrome oxidase II and calmodulin sequences. Genetics 128:269-279. Thomas, W. B. 1996. Methyl bromide: effective pest management tool and environmental threat.Supplementary Journal of Nematology 28: 586–90. Tigano, M. S., R. M. D. G. Carneiro., A. Jeyaprakash ., D. W. Dickson and B. J. Adams. 2005. Phylogeny of Meloidogyne spp. based on 18S rDNA and the intergenic region of motochondrial DNA sequences. Nematology 7: 851–862.
281 Tigano, M., K. De-Siqueira., P. Castagnone-Sereno., K. Mulet., P. Queiroz. and M. Dos. 2010. Genetic diversity of root knot nematodes Meloidogyne enterolobii and development of SCAR marker for this guava damaging species. Plant Pathology 59: 1054-1061. Timchenko, L. S., and T. K. Maiko. 1989. Nematicidal properties of plant antagonoists- nematodes of decorative plants. Byulletin’ Vsesoyuznogo Instituta Gel’ mintologii im. K. I. Skryabina No. 50: 81-84. Toida, Y and H. Moriyama. 1978. Effects of marigold on the control of nematodes in mulberry. 2. Nematicidal effect of Mexican marigold by application. Helminthological abstracts series B. 49; Abstracts 696. Tousek, J., . Malinakova., J. Dostal. and R. Marek. 2005. Theoretical and experimental NMR study of protopine hydrochloride isomers. Magnetic resonance in chemistry 43: 578- 581. Treadwell D.D. and M. Alligood. 2008. Sunn hemp (Crotalaria juncea L.): A summer cover crop for Florida vegetable producers. Horticultural Sciences Department, Florida Cooperative Extension ervice, Institute of Food and Agricultural Sciences, University of Florida. Tripathi, V. K, and V. B. Pandey. 1992. Stem alkaloids of Fumaria indica. Phytochemistry 31: 2188-2189. Trudgill, D. L, and V. C. Blok. 2001. Apomictic, polyphagous root-knot nematodes: exceptionally successful and damaging root pathogens. Annual Review of Phytopathology 39: 53-77. Tsuchiya, H., M. Masto., T. Miyazaki., S. Fujiwara., S. Tanigaki., M. Ohyama., T. Tanaka., M. Linumma. 1996. Comparative study on the antibacterial activity of phytochemical flavones against methicillin-resistant Staphylococcus areus. Journal of Ethnophrmacology 50: 27-34. Tyagi, S. A. and M. M. Alam. 1995. Efficacy of oil seed cakes against plant parasitic nematodes and soil inhabiting fungi on mung bean and chickpea. Biosource Technology 5: 233-239. Van der Beek, J. G., G. Karssen. 1997. Interspecific hybridization of meiotic parthenogenetic Meloidogyne chitwoodi and M. fallax. Phytopathology 87: 1061-1066. Vahabi, S., E. Najafi., and S. Alizadeh. 2011. In vitro antimicrobial effects of some herbal essences against oral pathogens. Journal of Medicinal Plant Research 5: 4870-4878.
282 Van Gundy, S. D., L. H. Stolzy., T. E. Szuksiewicz. And R. L. Rakham. 1962. Influence of Oxygen supply on survival of plant parasitic nematodes in soil. Phytopathology 52: 628-632. Veech, J. A. 1979. Histochemical localization and nematotoxicity of terpenoids aldehydes in cotton. Journal of Nematology 11: 240-246. Verma, A. C. and A. Anwar. 1999. Studies on Meloidogyne incognita on pointed gourd (Trichocanthes dioica Roxb.) in Eastern U. P. India. International Journal of Nematology 29: 190-191. Young, L. D. and L. G. Heatherly. 1990. Hetrodera glycine investigation and reproduction of soyabean grown in clay and silt loam soil. Journal of Nematology 22: 618-619. Wachira, P., P. R. Mibey., S. Okoth., J. Kimenju, and J. Kiarie. 2009. Diversity of nematode destroying fungi in Taita Taveta Kenya. Fungal Ecology 2: 60-65. Wallace, H. R. 1971. Abiotic influences in the oil environment. 250-280 pp. In: Plant parasitic nematodes Vol. 1. (Eds.) Zuckerman, B. M., W. F. Mai., and R. A. Rhode. Academic Press, New York. Wang, K. H., B. S. Sipes and D. P. Schmitt. 2002. Crotalaria as a cover crop for nematode management: a review. Nematropica 32: 35-57. Wang, K. H., R. Cerruti., R. Hooks, and A. Ploeg. 2007. Protecting crops from nematodes pests: Using marigold as an alternative to chemical nematicides. Plant Disease 35: 1-6. Wani, A. M., A. P. Ansari., M. M. Alam. 1994. Nematicidal potential of latex extracts of Calatropis procera and Euphorbia cadusifloia on root knot nematodes infecting Okra. Annals of Plant Protection Sciences 2: 72-74. Wani, A. H and M. Y. Bhat. 2012. Control of root knot nematode Meloidogyne incognita by urea coate with Nimin or other natural products on mung, Vigna radiata (L.) R. Wilzeck. Journal of Biopesticide (Supplementry) :255-258. Widmer, T. L., Abawi, G. S. 2000. Mechanism of suppression of Meloidogyne hapla and its damage by green manure of Sudan grass. Plant Disease 84: 562-568. Whitehead, A. G. 1968. Taxonomy of Meloidogyne (Nematoda: Heteroderidae) with description of four new species. Transactions of the Zoological Society of London 31: 263-401. Whitehead, A.G. 1998. Plant Nematode control. CAB international, Wallingford, UK. Pp.384.
283 Williams, J. G. K., M. K. Hanafey., J. A. Rafalski. And S. V. Tingey. 1993. Genetic analysis using random amplified polymorphic DNA markers, p. 704-740. In: R. Wu (ed.). Methods in Enzymology. vol. 218. Academic Press, New York. Williamson, V. M, and R. S. Hussey. 1996. Nematode pathogenesis and resistance in plants. Plant Cell 8: 1735-1745. Williamson, V. M., E. P. Caswell-Chen, B. B. Westerdahl., F. F. Wu and G. Caryl. 1997. A PCR assay to identify and distinguish single juveniles of Meloidogyne hapla and M. chitwoodi. Journal of Nematology 29: 9-15. Wolstenhome , D. R. 1993. Animal and mitochondrial DNA: Structure and Evolution, Int. Rew of Cytology. 141:173. Yukio, O. 1999. Species identification of Meloidogyne spp. (Nematoda: Meloidogynidae) in Japan by Random Amplified Polymorphic DNA (RAPD-PCR). Japanese Journal of Nematology 29: 7-15. Xu, L. F., W. J. Chun., X. Y. Qing., S. Li., X. S. Wang., G. W. Qing., J. Fei amd L. H. Guo. 2006. Protopine inhibits serotonine transporter and nonadrenalinine transporter and has the antidepressant-like effect in mice models. Neuropharmacology 50: 934-940. Xue B., D. L. Baillie., K. Beckenbach, and J. M. Webster. 1992. DNA hybridization probes for studying the affinities of three Meloidogyne populations. Fundamental and Applied Nematology 15: 35–41. Xioaping, L., W. RuQi., X. MinZhou., Z. Bogung., 2000. Relationship between molecular structure and nematicidal activity of two alkaloids, aloperine and Δ11-dehydroaloperine. Journal of Nanjing Forestry University 24: 78-81. Zakki, F. A. and D. S. Bhatti. 1989. Effect of castor leaves in combination with different fertilizer dosages on Meloidogyne javanica infecting tomato. Indian Journal of Nematology 19:171-176. Zaki, M. J. 2000. Biomanagement of root-knot nematodes problem of vegetables. DFID, UK, Research Proj. Report. Deptt. Of Botany, Univ. of Karachi, Karachi. 131 Pp. Zarina, B., A. Ghaffar and M. A. Maqbool. 2003. Effect of plant extracts in the control of Meloidogyne javanica root-knot nematode on Brinjal. Pakistan. Journal of Nematology 21: 31-35. Zia ul Haq, M., M. Ahmad and M. Akhtater. 2010. Nematicidal activity of selected flora of Pakistan. Pakistan Journal of Botany 42: 2119-2123.
284 Zirakparvar, M. E. 1980. Host range of Pratylenchus hexincisus and its pathogenicity on corn, soyabean and tomato. Phytopathology 70: 749-753. Zijlstra, C., A. E. M. Lever., B. J. Uenk, and C. H. van Silfhout. 1995. Differences between ITS regions of isolates of root-knot nematodes Meloidogyne hapla and M. chitwoodi. Phytopathology 85: 1231–1237. Zijlstra, C., B. J. Uenk, B.J. and van Silfhout. 1997. A reliable, precise method to differentiate species of root-knot nematodes in mixtures on the basis of ITS-RFLPs. Fundamental and Applied Nematology 20: 59–63. Zijlistra, C. 2000. Identification of Meloidogyne Chitwoodi, M. fallax and M. hapla based on SCAR-PCR: A powerful way of enabling reliable identification of populations or individuals that share common traits. European Journal of Plant Pathology 106: 283-290. Zijlstra, C., R. Van hoof and D. Donkers Venne. 2004. A PCR test to detect the cereal root- knot nematode Meloidogyne naasi. European Journal of Plant Pathology 110: 855- 860.
285 APPENDICES (SPECTRA)
Appendix 01. Infrared spectra of Nonacosane-10-ol (ISH-03)
286 Appendix 02. EIMS spectra of Nonacosane-10-ol (ISH-03).
287 Appendix 03. 13C-NMR spectra of Nonacosane-10-ol (ISH-03).
288 Appendix 04. 1H-NMR spectra of Nonacosane-10-ol (ISH-03)
289 Appendix 05. HMBC spectra of Nonacosane-10-ol (ISH-03)
290 Appendix 06. COSY spectra of Nonacosane-10-ol (ISH-03).
291 Appendix 07. Infra Red spectrum of 23a-Homostigmast-5-en-3ß-ol (ISH-034).
292 Appendix 08. UV spectra of 23a-Homostigmast-5-en-3ß-ol (ISH-034).
293 Appendix 09. EIMS spectra of 23a-Homostigmast-5-en-3ß-ol (ISH-034).
294 Appendix 10. 13C-NMR spectra of 23a-Homostigmast-5-en-3ß-ol (ISH-034).
295 Appendix 11. 1H-NMR spectra of 23a-Homostigmast-5-en-3ß-ol (ISH-034).
296 Appendix 12. HMBC spectra of 23a-homostigmast-5-en-3ß-ol (ISH-034).
297 Appendix 13. COSY spectra of 23a-homostigmast-5-en-3ß-ol (ISH-034).
298 Appendix 14. UV spectrum of trans-protopinium (ISH-02) in CHCl3.
299 Appendix 15. ESI spectrum of trans-protopinium (ISH-02).
300 Appendix 16. EIMS spectra of trans-protopinium (ISH-02).
301 Appendix 17. HSQC correlation of ISH-02 at 80oC in DMSO.
302 Appendix 18. 13C-NMR spectra of ISH-02 at 80oC in DMSO.
303 Appendix 19. 1H-NMR spectra of ISH-02 at 80oC in DMSO.
304 Appendix 20. HMBC spectra of ISH-02 at 80oC in DMSO.
305 Appendix 21. 13C-NMR spectra of ISH-02 in DMSO at 25oC.
306 Appendix 22. 1H-NMR spectra of ISH-02 in DMSO at 25 0C.
25oC
307 ANALYSES OF VARIANCE OF IN VITRO STUDIES
Appendix 23. Analysis of variance for crude extracts of Fumaria parviflora on hatch inhibition of M. incognita eggs.
Source DF SS MS F P Fractions (F) 3 33092.8 11030.96 318.26 0.00 Concentrations(C) 2 1725.87 862.93 24.89 0.00 F X C 6 557.29 92.88 2.67 0.029 Error 36 1247.75 34.66 Total 47 36623.81
Coefficient of Variation: 12.15%
Appendix 24. Analysis of variance for crude extracts of Fumaria parviflora on J2s mortality of M. incognita. Source DF SS MS F P Fractions (F) 3 36831.50 12277.16 866.63 0.00 Concentrations(C) 2 2227.79 1113.89 78.62 0.00 F X C 6 538.37 89.72 6.33 0.001 Error 36 510.37 14.16 Total 47 40107.66
Coefficient of Variation: 7.54%
Appendix 25. Analysis of variance of Area under cumulative percentage hatch inhibition (AUCPHI) of root n-hexane extracts (Experiment 1). Source DF SS MS F P Concentrations 5 222556 44511.2 284.10 0.0000 Error 18 2820 156.7 Total 23
Coefficient of Variation: 5.23%
Appendix 26. Analysis of variance of Area under cumulative percentage hatch inhibition (AUCPHI) of root n-hexane extracts (Experiment 2). Source DF SS MS F P Concentrations 5 195632 39126.4 130.23 0.0000 Error 18 5408 300.4 Total 23
Coefficient of Variation: 8.43%
308 Appendix 27. Analysis of variance for Area under cumulative percentage hatch inhibition (AUCPHI) of root EtOAC extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 138508 27701.6 12.44 0.0000 Error 18 40094 2227.5 Total 23
Coefficient of Variation: 25.89%
Appendix 28. Analysis of variance of Area under cumulative percentage hatch inhibition (AUCPHI) of root EtOAC extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 135724 27144.8 51.51 0.0000 Error 18 9486 527.0 Total 23
Coefficient of Variation: 13.64%
Appendix 29. Analysis of variance for Area under cumulative percentage hatch inhibition (AUCPHI) of root CHCl3 extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 181050 36210.0 83.45 0.0000 Error 18 7811 433.9 Total 23
Coefficient of Variation: 9.55%
Appendix 30. Analysis of variance for Area under cumulative percentage hatch inhibition (AUCPHI) of root CHCl3 extracts (Experiment 2).
Source DF SS MS F P Concentrations 5 165409 33081.9 20.56 0.0000 Error 18 28966 1609.2 Total 23
Coefficient of Variation: 20.97 %
Appendix 31. Analysis of variance for Area under cumulative percentage hatch inhibition (AUCPHI) of root MeOH extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 257067 51413.3 468.78 0.0000 Error 18 1974 109.7 Total 23
Coefficient of Variation: 4.11%
309 Appendix 32. Analysis of variance for Area under cumulative percentage hatch inhibition (AUCPHI) of root MeOH extracts (Experiment 2).
Source DF SS MS F P Concentrations 5 225990 45198.0 368.79 0.0000 Error 18 2206 122.6 Total 23
Coefficient of Variation: 4.78%
Appendix 33. Analysis of variance for Area under cumulative percentage hatch inhibition (AUCPHI) of stem n-hexane extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 183701 36740.2 172.21 0.0000 Error 18 3840 213.4 Total 23
Coefficient of Variation: 6.85%
Appendix 34. Analysis of variance for Area under cumulative percentage hatch inhibition (AUCPHI) of stem n-hexane extracts (Experiment 2).
Source DF SS MS F P Concentrations 5 s167115 33423.1 125.13 0.0000 Error 18 4808 267.1 Total 23
Coefficient of Variation: 8.29%
Appendix 35. Analysis of variance for Area under cumulative percentage hatch inhibition (AUCPHI) of stem EtOAC extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 187290 37458.1 175.13 0.0000 Error 18 3850 213.9 Total 23
Coefficient of Variation: 6.58%
Appendix 36. Analysis of variance for Area under cumulative percentage hatch inhibition (AUCPHI) of stem EtOAC extracts (Experiment 2).
Source DF SS MS F P Concentrations 5 140582 28116.5 60.79 0.0000 Error 18 8325 462.5 Total 23
Coefficient of Variation: 11.96%
310 Appendix 37. Analysis of variance for Area under cumulative percentage hatch inhibition (AUCPHI) of stem CHCl3 extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 284280 56855.9 370.52 0.0000 Error 18 2762 153.4 Total 23
Coefficient of Variation: 4.70%
Appendix 38. Analysis of variance for Area under cumulative percentage hatch inhibition (AUCPHI) of stem CHCl3 extracts (Experiment 2).
Source DF SS MS F P Concentrations 5 154233 30846.6 46.15 0.0000 Error 18 12030 668.4 Total 23
Coefficient of Variation: 13.59%
Appendix 39. Analysis of variance for Area under cumulative percentage hatch inhibition (AUCPHI) of stem MeOH extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 257067 51413.4 145.10 0.0000 Error 18 6378 354.3 Total 23
Coefficient of Variation: 7.30%
Appendix 40. Analysis of variance for Area under cumulative percentage hatch inhibition (AUCPHI) of stem MeOH extracts (Experiment 2).
Source DF SS MS F P Concentrations 5 173606 34721.1 104.39 0.0000 Error 18 5987 332.6 Total 23
Coefficient of Variation: 8.93%
Appendix 41. Analysis of variance for Area under cumulative percentage mortality of root n-hexane extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 298652 59730.4 387.75 0.0000 Error 18 2773 154.0 Total 23
Coefficient of Variation: 4.73%
311 Appendix 42. Analysis of variance for Area under cumulative percentage mortality of root n- hexane extracts (Experiment 2).
Source DF SS MS F P Concentrations 5 172706 34541.2 51.65 0.0000 Error 18 12037 668.7 Total 23
Coefficient of Variation: 12.76%
Appendix 43. Analysis of variance for Area under cumulative percentage mortality of root EtOAC extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 195018 39003.7 182.31 0.0000 Error 18 3851 213.9 Total 23
Coefficient of Variation: 6.90%
Appendix 44. Analysis of variance for Area under cumulative percentage mortality of root EtOAC extracts (Experiment 2).
Source DF SS MS F P Concentrations 5 130059 26011.7 35.10 0.0000 Error 18 13338 741.0 Total 23
Coefficient of Variation: 15.73%
Appendix 45. Analysis of variance for Area under cumulative percentage mortality of root CHCl3 extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 199154 39830.8 185.70 0.0000 Error 18 3861 214.5 Total 23
Coefficient of Variation: 6.63%
Appendix 46. Analysis of variance for Area under cumulative percentage mortality of root CHCl3 extracts (Experiment 2).
Source DF SS MS F P Concentrations 5 150801 30160.3 54.46 0.0000 Error 18 9968 553.8 Total 23
Coefficient of Variation: 11.97%
312 Appendix 47. Analysis of variance for Area under cumulative percentage mortality of root MeOH extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 271107 54221.3 152.77 0.0000 Error 18 6389 354.9 Total 23
Coefficient of Variation: 7.34%
Appendix 48. Analysis of variance for Area under cumulative percentage mortality of root MeOH extracts (Experiment 2).
Source DF SS MS F P Concentrations 5 169967 33993.5 10.20 0.0001 Error 18 60002 3333.4 Total 23
Coefficient of Variation: 27.61%
Appendix 49. Analysis of variance for Area under cumulative percentage mortality of stem n- hexane extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 257645 51529.1 396.58 0.0000 Error 18 2339 129.9 Total 23
Coefficient of Variation: 4.74%
Appendix 50. Analysis of variance for Area under cumulative percentage mortality of stem n- hexane extracts (Experiment 2).
Source DF SS MS F P Concentrations 5 166214 33242.8 55.17 0.0000 Error 18 10846 602.6 Total 23
Coefficient of Variation: 12.82%
Appendix 51. Analysis of variance for Area under cumulative percentage mortality of stem EtOAC extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 173872 34774.4 51.52 0.0000 Error 18 12150 675.0 Total 23
Coefficient of Variation: 12.68%
313 Appendix 52. Analysis of variance for Area under cumulative percentage mortality of stem EtOAC extracts (Experiment 2).
Source DF SS MS F P Concentrations 5 108116 21623.1 44.56 0.0000 Error 18 8734 485.2 Total 23
Coefficient of Variation: 14.27%
Appendix 53. Analysis of variance for Area under cumulative percentage mortality of stem CHCl3 extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 187117 37423.4 75.45 0.0000 Error 18 8928 496.0 Total 23
Coefficient of Variation: 10.31%
Appendix 54. Analysis of variance for Area under cumulative percentage mortality of stem CHCl3 extracts (Experiment 2).
Source DF SS MS F P Concentrations 5 150177 30035.4 65.15 0.0000 Error 18 8298 461.0 Total 23
Coefficient of Variation: 11.61%
Appendix 55. Analysis of variance for Area under cumulative percentage mortality of stem MeOH extracts (Experiment 1).
Source DF SS MS F P Concentrations 5 229327 45865.5 189.14 0.0000 Error 18 4365 242.5 Total 23
Coefficient of Variation: 6.69%
Appendix 56. Analysis of variance for Area under cumulative percentage mortality of stem MeOH extracts (Experiment 2).
Source DF SS MS F P Concentrations 5 162025 32405.0 22.92 0.0000 Error 18 25444 1413.6 Total 23
Coefficient of Variation: 19.34%
314 Appendix 57. Analysis of variance showing in vitro effect of the root n-hexane fractions of F. parviflora on the hatch inhibition (%) of M. incognita.
Degrees of Sum of Mean F P Source Freedom Squares Square Value Fractions (F) 12 59097.423 4924.785 108.1647 0.00 Concentration(C) 3 27428.361 9142.787 200.8060 0.00 F X C 36 2896.077 80.447 1.7669 0.01 Error 156 7102.750 45.530 Total 207
Coefficient of Variation: 10.96%
Appendix 58. Analysis of variance showing in vitro effect of the root n-hexane fractions of F. parviflora on J2s mortality (%) of M. incognita.
Degrees of Sum of Mean F P Source Freedom Squares Square Value Fractions (F) 12 53603.423 4466.952 93.0398 0.00 Concentration(C) 3 23976.476 7992.159 166.4644 0.00 F X C 36 2565.462 71.263 1.4843 0.00 Error 156 7489.750 48.011 Total 207 87635.111
Coefficient of Variation: 11.69%
Appendix 59. Analysis of variance showing in vitro effect of the methanol fractions of the roots of F. parviflora on egg hatch inhibition (%) of M. incognita
Degrees of Sum of Mean F P Source Freedom Squares Square Value Fractions (F) 9 60204.406 6689.378 188.7988 0.00 Concentration (C) 3 17457.969 5819.323 164.2427 0.001 F X C 27 2215.719 82.064 2.3161 0.001 Error 120 4251.750 35.431 Total 159 84129.844
Coefficient of Variation: 10.01%
Appendix 60. Analysis of variance showing in vitro effect of the methanol fractions of the roots of F. parviflora on J2s mortality (%) of M. incognita
Degrees of Sum of Mean F P Source Freedom Squares Square Value Fractions(F) 9 62243.850 6915.983 215.7593 0.00 Concentration(C) 3 17717.225 5905.742 184.2426 0.00 F X C 27 2565.400 95.015 2.9642 0.001 Error 120 3846.500 32.054 Total 159 86372.975
Coefficient of Variation: 9.63%
315 ANALYSES OF VARIANCE OF SCREEN HOUSE STUDIES USING ROOT EXTRACTS OF FUMARIA PARVIFOLRA (SPRING, 2010) (EXPERIMENT-1)
Appendix 61. Analysis of variance of root n-hexane extracts for number of branches per plant (spring, 2010).
Source DF SS MS F P Fractions 3 807.600 269.200 26.33 0.0000 Error 16 163.600 10.225 Total 19
Coefficient of Variation: 17.57%
Appendix 62. Analysis of variance of root n-hexane extracts for dry shoot weight (spring, 2010).
Source DF SS MS F P Fractions 3 900.950 300.317 35.97 0.0000 Error 16 133.600 8.350 Total 19
Coefficient of Variation: 14.71%
Appendix 63. Analysis of variance of root n-hexane extracts for egg masses g-1 of roots (spring, 2010).
Source DF SS MS F P Fractions 3 14323.4 4774.47 92.62 0.0000 Error 16 824.8 51.55 Total 19
Coefficient of Variation: 18.09%
Appendix 64. Analysis of variance of root n-hexane extracts for eggs per gram of roots (spring, 2010).
Source DF SS MS F P Fractions 3 5.111 1.704 432.72 0.0000 Error 16 6300000 393750 Total 19
Coefficient of Variation: 15.51%
Appendix 65. Analysis of variance of root n-hexane extracts for number of females (spring, 2010).
Source DF SS MS F P Fractions 3 11814.9 3938.32 138.31 0.0000 Error 16 455.6 28.48 Total 19
Coefficient of Variation: 10.10%
316
Appendix 66. Analysis of variance of root n-hexane extracts for fresh shoot weight (spring, 2010).
Source DF SS MS F P Fractions 3 510.150 170.050 25.01 0.0000 Error 16 108.800 6.800 Total 19
Coefficient of Variation: 11.36%
Appendix 67. Analysis of variance of root n-hexane extracts for fresh shoot weight (spring, 2010).
Source DF SS MS F P Fractions 3 1246.00 415.333 16.73 0.0000 Error 16 397.20 24.825 Total 19
Coefficient of Variation: 11.53%
Appendix 68. Analysis of variance of root n-hexane extracts for number of galls per plant (spring, 2010).
Source DF SS MS F P Fractions 3 11402.5 3800.85 88.86 0.0000 Error 16 684.4 42.77 Total 19
Coefficient of Variation: 9.47%
Appendix 69. Analysis of variance of root n-hexane extracts for plant height (spring, 2010).
Source DF SS MS F P Fractions 3 1790.80 596.933 25.79 0.0000 Error 16 370.40 23.150 Total 19
Coefficient of Variation: 10.74%
Appendix 70. Analysis of variance of root n-hexane extracts for galling index (spring, 2010).
Source DF SS MS F P Fractions 3 0.44811 0.14937 74.05 0.0000 Error 16 0.03227 0.00202 Total 19
Coefficient of Variation: 8.18%
317 Appendix 71. Analysis of variance of root n-hexane extracts for nematode reproduction factor (spring, 2010).
Source DF SS MS F P Fractions 3 1.06121 0.35374 218.30 0.0000 Error 16 0.02593 0.00162 Total 19
Coefficient of Variation: 16.93%
Appendix 72. Analysis of variance of root EtOAC extracts for nematode number of branches per plant (spring, 2010).
Source DF SS MS F P Fractions 3 155.400 51.8000 3.47 0.0411 Error 16 238.800 14.9250 Total 19
Coefficient of Variation: 29.05%
Appendix 73. Analysis of variance of root EtOAC extracts for dry shoot weight (spring, 2010).
Source DF SS MS F P Fractions 3 227.750 75.9167 24.89 0.0000 Error 16 48.800 3.0500 Total 19
Coefficient of Variation: 13.08%
Appendix 74. Analysis of variance of root EtOAC extracts for egg masses g-1 of roots (spring, 2010).
Source DF SS MS F P Fractions 3 6295.75 2098.58 15.63 0.0001 Error 16 2148.80 134.30 Total 19
Coefficient of Variation: 21.93%
Appendix 75. Analysis of variance of root EtOAC extracts for eggs g-1 of roots (spring, 2010).
Source DF SS MS F P Fractions 3 4.172 1.391 327.97 0.0000 Error 16 6784000 424000 Total 19
Coefficient of Variation: 13.29%
318 Appendix 76. Analysis of variance of root EtOAC extracts for females g-1 of roots (spring, 2010).
Source DF SS MS F P Fractions 3 4680.55 1560.18 40.76 0.0000 Error 16 612.40 38.27 Total 19
Coefficient of Variation: 9.16%
Appendix 77. Analysis of variance of root EtOAC extracts for fresh root weight (spring, 2010)
Source DF SS MS F P Fractions 3 103.000 34.3333 10.33 0.0005 Error 16 53.200 3.3250 Total 19
Coefficient of Variation: 7.10%
Appendix 78. Analysis of variance of root EtOAC extracts for fresh shoot weight (spring, 2010)
Source DF SS MS F P Fractions 3 241.000 80.3333 7.14 0.0029 Error 16 180.000 11.2500 Total 19
Coefficient of Variation: 8.94%
Appendix 78. Analysis of variance of root EtOAC extracts for galls per plant (spring, 2010).
Source DF SS MS F P Fractions 3 4290.95 1430.32 50.01 0.0000 Error 16 457.60 28.60 Total 19
Coefficient of Variation: 6.32%
Appendix 79. Analysis of variance of root EtOAC extracts for plant height (spring, 2010).
Source DF SS MS F P Fractions 3 288.550 96.1833 5.28 0.0101 Error 16 291.200 18.2000 Total 19
Coefficient of Variation: 11.93%
Appendix 80. Analysis of variance of root EtOAC extracts for galling index (spring, 2010)
Source DF SS MS F P Fractions 3 0.13206 0.04402 37.92 0.0000 Error 16 0.01857 0.00116 Total 19
Coefficient of Variation: 5.23%
319 Appendix 81. Analysis of variance of root EtOAC extracts for reproduction factor (spring, 2010).
Source DF SS MS F P Fractions 3 0.74424 0.24808 168.53 0.0000 Error 16 0.02355 0.00147 Total 19
Coefficient of Variation: 12.65%
Appendix 82. Analysis of variance of root CHCl3 extracts for number of branches per plant (spring, 2010).
Source DF SS MS F P Fractions 3 276.400 92.1333 10.07 0.0006 Error 16 146.400 9.1500 Total 19
Coefficient of Variation: 21.01%
Appendix 83. Analysis of variance of root CHCl3 extracts for dry shoot weight (spring, 2010).
Source DF SS MS F P Fractions 3 172.800 57.6000 10.92 0.0004 Error 16 84.400 5.2750 Total 19
Coefficient of Variation: 17.94%
Appendix 84. Analysis of variance of root CHCl3 extracts for egg masses (spring, 2010).
Source DF SS MS F P Fractions 3 5468.40 1822.80 35.41 0.0000 Error 16 823.60 51.47 Total 19
Coefficient of Variation: 12.81%
-1 Appendix 85. Analysis of variance of root CHCl3 extracts for eggs g of roots (spring, 2010).
Source DF SS MS F P Fractions 3 4.214E+08 1.405E+08 359.73 0.0000 Error 16 6248000 390500 Total 19
Coefficient of Variation: 12.86%
320 -1 Appendix 86. Analysis of variance of root CHCl3 extracts for females g of roots (spring, 2010).
Source DF SS MS F P Fractions 3 3631.60 1210.53 54.84 0.0000 Error 16 353.20 22.07 Total 19
Coefficient of Variation: 6.58%
Appendix 87. Analysis of variance of root CHCl3 extracts for fresh root weight (spring, 2010).
Source DF SS MS F P Fractions 3 93.3500 31.1167 17.05 0.0000 Error 16 29.2000 1.8250 Total 19
Coefficient of Variation: 5.13%
Appendix 88. Analysis of variance of root CHCl3 extracts for fresh shoot weight (spring, 2010).
Source DF SS MS F P Fractions 3 322.000 107.333 21.79 0.0000 Error 16 78.800 4.925 Total 19
Coefficient of Variation: 5.93%
Appendix 89. Analysis of variance of root CHCl3 extracts for galls per plant (spring, 2010).
Source DF SS MS F P Fractions 3 3165.75 1055.25 30.65 0.0000 Error 16 550.80 34.42 Total 19
Coefficient of Variation: 6.58%
Appendix 90. Analysis of variance of root CHCl3 extracts for plant height (spring, 2010).
Source DF SS MS F P Fractions 3 334.800 111.600 11.51 0.0003 Error 16 155.200 9.700 Total 19
Coefficient of Variation: 8.42%
Appendix 91. Analysis of variance of root CHCl3 extracts for galling index (spring, 2010).
Source DF SS MS F P Fractions 3 0.44786 0.14929 25.34 0.0000 Error 16 0.09427 0.00589 Total 19
Coefficient of Variation: 15.82%
321 Appendix 92. Analysis of variance of root CHCl3 extracts for reproduction factor (spring, 2010).
Source DF SS MS F P Fractions 3 2.36912 0.78971 159.47 0.0000 Error 16 0.07923 0.00495 Total 19
Coefficient of Variation: 10.89%
Appendix 93. Analysis of variance of root MeOH extracts for number of branches per plant (spring, 2010).
Source DF SS MS F P Fractions 3 330.800 110.600 11.50 0.0002 Error 16 155.200 9.700 Total 19
Coefficient of Variation: 8.20%
Appendix 94. Analysis of variance of root MeOH extracts for dry shoot weight (spring, 2010).
Source DF SS MS F P Fractions 3 170.800 57.6000 10.92 0.0004 Error 16 83.400 5.2750 Total 19
Coefficient of Variation: 17.7%
Appendix 95. Analysis of variance of root MeOH extracts for egg masses g-1 of roots (spring, 2010).
Source DF SS MS F P Fractions 3 5477.40 1820.80 35.41 0.0000 Error 16 820.60 50.47 Total 19
Coefficient of Variation: 11.81%
Appendix 96. Analysis of variance of root MeOH extracts for eggs g-1 of roots (spring, 2010).
Source DF SS MS F P Fractions 3 4.214 1.405 359.73 0.0000 Error 16 6248000 390500 Total 19
Coefficient of Variation: 12.00%
Appendix 97. Analysis of variance of MeOH extracts for females g-1 of roots (spring, 2010).
Source DF SS MS F P Fractions 3 3631.60 1212.53 54.84 0.0000 Error 16 353.20 22.07 Total 19
Coefficient of Variation: 7.5%
322
Appendix 98. Analysis of variance of MeOH CHCl3 extracts for fresh root weight (spring, 2010).
Source DF SS MS F P Fractions 3 92.350 31.1167 17.65 0.0000 Error 16 29.7000 1.8250 Total 19
Coefficient of Variation: 6.13%
Appendix 99. Analysis of variance of MeOH extracts for fresh shoot weight (spring, 2010).
Source DF SS MS F P Fractions 3 322.000 109.333 21.9 0.0000 Error 16 78.800 4.925 Total 19
Coefficient of Variation: 7.00%
Appendix 100. Analysis of variance of root MeOH extracts for galls per plant (spring, 2010).
Source DF SS MS F P Fractions 3 0.133 0.04402 37.92 0.0000 Error 16 0.019 0.00116 Total 19
Coefficient of Variation: 5.37%
Appendix 101. Analysis of variance of roots MeOH extracts for plant height (spring, 2010).
Source DF SS MS F P Fractions 3 1477.80 496.600 40.13 0.0000 Error 16 197.00 12.375 Total 19
Coefficient of Variation: 7.98%
Appendix 102. Analysis of variance of root MeOH extracts for galling index (spring, 2010).
Source DF SS MS F P Fractions 3 0.66570 0.22190 48.19 0.0000 Error 16 0.07367 0.00460 Total 19
Coefficient of Variation: 15.69%
Appendix 103. Analysis of variance of root MeOH extracts for reproduction factor (spring, 2010).
Source DF SS MS F P Fractions 3 3.10153 1.03384 102.06 0.0000 Error 16 0.16208 0.01013 Total 19
Coefficient of Variation: 63.51%
323
ANALYSES OF VARIANCE (ANOVA) OF SCREEN HOUSE STUDIES USING STEM EXTRACTS OF FUMARIA PARVIFLORA (SPRING, 2010) (EXPERIMENT 1) Appendix 104. Analysis of variance of stem n-hexane extracts for number of branches per plant (spring, 2010).
Source DF SS MS F P Fractions 3 846.550 282.183 47.03 0.0000 Error 16 96.000 6.000 Total 19
Coefficient of Variation: 13.88 %
Appendix 105. Analysis of variance of stem n-hexane extracts for dry shoot weight (spring, 2010).
Source DF SS MS F P Fractions 3 783.350 261.117 21.19 0.0000 Error 16 197.200 12.325 Total 19
Coefficient of Variation: 18.82%
Appendix 106. Analysis of variance of stem n-hexane extracts for egg masses g-1 of roots (spring, 2010).
Source DF SS MS F P Fractions 3 16270.1 5423.38 117.64 0.0000 Error 16 737.6 46.10 Total 19
Coefficient of Variation: 16.26%
Appendix 107. Analysis of variance of stem n-hexane extracts for eggs g-1 of roots (spring, 2010).
Source DF SS MS F P Fractions 3 4.343E+08 1.448E+08 36.45 0.0000 Error 16 6.355E+07 3971750 Total 19
Coefficient of Variation: 45.35%
Appendix 108. Analysis of variance of stem n-hexane extracts for females g-1 of roots (spring, 2010).
Source DF SS MS F P Fractions 3 10210.8 3403.60 101.37 0.0000 Error 16 537.2 33.58 Total 19
Coefficient of Variation: 10.54%
324
Appendix 109. Analysis of variance of stem n-hexane extracts for fresh root weight (spring, 2010).
Source DF SS MS F P Fractions 3 670.600 223.533 42.38 0.0000 Error 16 84.400 5.275 Total 19
Coefficient of Variation: 10.68 %
Appendix 110. Analysis of variance of stem n-hexane extracts for fresh shoot weight (spring, 2010).
Source DF SS MS F P Fractions 3 1147.40 382.467 22.97 0.0000 Error 16 266.40 16.650 Total 19
Coefficient of Variation: 9.98%
Appendix 111. Analysis of variance of stem n-hexane extracts for galls per plant (spring, 2010).
Source DF SS MS F P Fractions 3 14318.5 4772.85 141.42 0.0000 Error 16 540.0 33.75 Total 19
Coefficient of Variation: 8.09%
Appendix 112. Analysis of variance of stem n-hexane extracts for plant height (spring, 2010).
Source DF SS MS F P Fractions 3 1489.80 496.600 40.13 0.0000 Error 16 198.00 12.375 Total 19
Coefficient of Variation: 7.98%
Appendix 113. Analysis of variance of stem n-hexane extracts for galling index (spring, 2010).
Source DF SS MS F P Fractions 3 0.41366 0.13789 32.80 0.0000 Error 16 0.06727 0.00420 Total 19
Coefficient of Variation: 11.63%
Appendix 114. Analysis of variance of stem n-hexane extracts for reproduction factor (spring, 2010).
Source DF SS MS F P Fractions 3 1.04604 0.34868 194.67 0.0000 Error 16 0.02866 0.00179 Total 19
Coefficient of Variation: 17.57%
325 Appendix 115. Analysis of variance of stem ETOAC extracts for number of branches per plant (spring, 2010).
Source DF SS MS F P Fractions 3 177.350 59.1167 4.69 0.0155 Error 16 201.600 12.6000 Total 19
Coefficient of Variation: 27.41%
Appendix 116. Analysis of variance of stem ETOAC extracts for dry shoot weight (spring, 2010). Source DF SS MS F P Fractions 3 215.200 71.7333 15.10 0.0001 Error 16 76.000 4.7500 Total 19
Coefficient of Variation: 16.51%
Appendix 117. Analysis of variance of stem ETOAC extracts for egg masses g-1 of roots (spring, 2010). Source DF SS MS F P Fractions 3 7616.55 2538.85 21.64 0.0000 Error 16 1877.20 117.32 Total 19
Coefficient of Variation: 19.78%
Appendix 118. Analysis of variance of stem ETOAC extracts for eggs g-1 of roots (spring, 2010).
Source DF SS MS F P Fractions 3 3.861 1.286 283.78 0.0000 Error 16 7256000 453500 Total 19
Coefficient of Variation: 14.03%
Appendix 119. Analysis of variance of stem ETOAC extracts for females g-1 of roots (spring, 2010).
Source DF SS MS F P Fractions 3 3967.75 1322.58 46.49 0.0000 Error 16 455.20 28.45 Total 19
Coefficient of Variation: 7.61%
Appendix 120. Analysis of variance of stem ETOAC extracts for fresh root weight (spring, 2010).
Source DF SS MS F P Fractions 3 128.400 42.8000 10.90 0.0004 Error 16 62.800 3.9250 Total 19
Coefficient of Variation: 7.86%
326 Appendix 121. Analysis of variance of stem ETOAC extracts for fresh shoot weight (spring, 2010).
Source DF SS MS F P Fractions 3 338.000 112.667 11.41 0.0003 Error 16 158.000 9.875 Total 19
Coefficient of Variation: 8.49%
Appendix 122. Analysis of variance of stem ETOAC extracts for number of galls per plant (spring, 2010). Source DF SS MS F P Fractions 3 6329.20 2109.73 80.60 0.0000 Error 16 418.80 26.18 Total 19
Coefficient of Variation: 5.88%
Appendix 123. Analysis of variance of stem ETOAC extracts for plant height (spring, 2010).
Source DF SS MS F P Fractions 3 434.800 144.933 13.77 0.0001 Error 16 168.400 10.525 Total 19
Coefficient of Variation: 8.82%
Appendix 124. Analysis of variance of stem ETOAC extracts for plant galling index (spring, 2010).
Source DF SS MS F P Fractions 3 0.11140 0.03713 38.73 0.0000 Error 16 0.01534 0.00096 Total 19
Coefficient of Variation: 4.67%
Appendix 125. Analysis of variance of stem ETOAC extracts for reproduction factor (spring, 2010)
Source DF SS MS F P Fractions 3 0.72005 0.24002 232.01 0.0000 Error 16 0.01655 0.00103 Total 19
Coefficient of Variation: 10.42%
Appendix 126. Analysis of variance of stem CHCl3 extracts for number of branches per plant (spring, 2010). Source DF SS MS F P Fractions 3 306.550 102.183 13.58 0.0001 Error 16 120.400 7.525 Total 19
Coefficient of Variation: 19.66%
327 Appendix 127. Analysis of variance of stem CHCl3 extracts for dry shoot weight (spring, 2010).
Source DF SS MS F P Fractions 3 106.550 35.5167 6.15 0.0055 Error 16 92.400 5.7750 Total 19
Coefficient of Variation: 18.41%
-1 Appendix 128. Analysis of variance of stem CHCl3 extracts for egg masses g of roots (spring, 2010).
Source DF SS MS F P Fractions 3 6605.35 2201.78 38.16 0.0000 Error 16 923.20 57.70 Total 19
Coefficient of Variation: 13.02%
-1 Appendix 129. Analysis of variance of stem CHCl3 extracts for eggs g of roots (spring, 2010).
Source DF SS MS F P Fractions 3 3.912 1.304 306.48 0.0000 Error 16 6808000 425500 Total 19
Coefficient of Variation: 13.73%
-1 Appendix 130. Analysis of variance of stem CHCl3 extracts for females g of roots (spring, 2010).
Source DF SS MS F P Fractions 3 3337.75 1112.58 73.20 0.0000 Error 16 243.20 15.20 Total 19
Coefficient of Variation: 5.37%
Appendix 131. Analysis of variance of stem CHCl3 extracts for fresh root weight (spring, 2010).
Source DF SS MS F P Fractions 3 116.550 38.8500 14.80 0.0001 Error 16 42.000 2.6250 Total 19
Coefficient of Variation: 6.20%
Appendix 132. Analysis of variance of stem CHCl3 extracts for fresh shoot weight (spring, 2010).
Source DF SS MS F P Fractions 3 445.750 148.583 30.79 0.0000 Error 16 77.200 4.825 Total 19
Coefficient of Variation: 5.93%
328
Appendix 133. Analysis of variance of stem CHCl3 extracts for galls per plant (spring, 2010).
Source DF SS MS F P Fractions 3 5075.80 1691.93 72.00 0.0000 Error 16 376.00 23.50 Total 19
Coefficient of Variation: 5.33%
Appendix 134. Analysis of variance of stem CHCl3 extracts for plant height (spring, 2010).
Source DF SS MS F P Fractions 3 336.150 112.050 15.40 0.0001 Error 16 116.400 7.275 Total 19
Coefficient of Variation: 7.22%
Appendix 135. Analysis of variance of stem CHCl3 extracts for galling index (spring, 2010).
Source DF SS MS F P Fractions 3 0.21896 0.07299 29.01 0.0000 Error 16 0.04025 0.00252 Total 19
Coefficient of Variation: 7.91%
Appendix 136. Analysis of variance of stem CHCl3 extracts for reproduction factor (spring, 2010).
Source DF SS MS F P Fractions 3 0.75070 0.25023 192.25 0.0000 Error 16 0.02083 0.00130 Total 19
Coefficient of Variation: 11.95%
Appendix 137. Analysis of variance of stem MeOH extracts for branches per plant (spring, 2010).
Source DF SS MS F P Fractions 3 535.750 178.583 70.03 0.0000 Error 16 40.800 2.550 Total 19
Coefficient of Variation: 9.31%
Apendix 138. Analysis of variance of stem MeOH extracts for dry shoot weight (spring, 2010).
Source DF SS MS F P Fractions 3 216.400 72.1333 13.06 0.0001 Error 16 88.400 5.5250 Total 19
Coefficient of Variation: 16.10%
329
Appendix 139. Analysis of variance of stem MeOH extracts for egg masses g-1 of roots (spring, 2010).
Source DF SS MS F P Fractions 3 10102.6 3367.53 59.52 0.0000 Error 16 905.2 56.57 Total 19
Coefficient of Variation: 14.49%
Appendix 140. Analysis of variance of stem MeOH extracts for eggs g-1 of roots (spring, 2010).
Source DF SS MS F P Fractions 3 4.291 1.430 344.65 0.0000 Error 16 6640000 415000 Total 19
Coefficient of Variation: 14.71%
Appendix 141. Analysis of variance of stem MeOH extracts for females g-1 of roots (spring, 2010).
Source DF SS MS F P Fractions 3 5490.15 1830.05 103.69 0.0000 Error 16 282.40 17.65 Total 19
Coefficient of Variation: 6.55%
Appendix 142. Analysis of variance of stem MeOH extracts for fresh root weight (spring, 2010).
Source DF SS MS F P Fractions 3 202.000 67.3333 21.21 0.0000 Error 16 50.800 3.1750 Total 19
Coefficient of Variation: 7.24%
Appendix 143. Analysis of variance of stem MeOH extracts for fresh shoot weight (spring, 2010).
Source DF SS MS F P Fractions 3 754.950 251.650 16.64 0.0000 Error 16 242.000 15.125 Total 19
Coefficient of Variation: 9.83%
Appendix 144. Analysis of variance of stem MeOH extracts for galls per plant (spring, 2010).
Source DF SS MS F P Fractions 3 10277.2 3425.73 152.42 0.0000 Error 16 359.6 22.48 Total 19
Coefficient of Variation: 5.96%
330
Appendix 145. Analysis of variance of stem MeOH extracts for plant height (spring, 2010).
Source DF SS MS F P Fractions 3 952.600 317.533 17.42 0.0000 Error 16 291.600 18.225 Total 19
Coefficient of Variation: 10.09%
Appendix 146. Analysis of variance of stem MeOH extracts for galling index (spring, 2010).
Source DF SS MS F P Fractions 3 0.33346 0.11115 42.77 0.0000 Error 16 0.04158 0.00260 Total 19
Coefficient of Variation: 8.66%
Appendix 147. Analysis of variance of stem MeOH extracts for reproduction factor (spring, 2010).
Source DF SS MS F P Fractions 3 0.87709 0.29236 192.97 0.0000 Error 16 0.02424 0.00152 Total 19
Coefficient of Variation: 10.0%
331
ANALYSES OF VARIANCE (ANOVA) OF SCREEN HOUSE STUDIES USING ROOT EXTRACTS OF FUMARIA PARVIFLORA (FALL, 2010) (EXPERIMENT 2)
Appendix 148. Analysis of variance of root n-hexane extracts for number branches per plant (fall, 2010) Source DF SS MS F P Fractions 3 535.350 178.450 17.04 0.0000 Error 16 167.600 10.475 Total 19
Coefficient of Variation: 17.08%
Appendix 149. Analysis of variance of root n-hexane extracts for dry shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 811.750 270.583 28.71 0.0000 Error 16 150.800 9.425 Total 19
Coefficient of Variation: 15.09%
Appendix 150. Analysis of variance of root n-hexane extracts for eggs g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 4.114 1.371 273.07 0.0000 Error 16 8034000 502125 Total 19
Coefficient of variation: 17.94%
Appendix 151. Analysis of variance of root n-hexane extracts for eggs masses g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 12546.0 4182.00 104.42 0.0000 Error 16 640.8 40.05 Total 19
Coefficient of variation: 14.51%
Appendix 152. Analysis of variance of root n-hexane extracts for females g-1 of roots (fall, 2010)
Source DF SS MS F P Fractions 3 12025.3 4008.45 241.84 0.0000 Error 16 265.2 16.57 Total 19
Coefficient of variation: 7.45%
332 Appendix 153. Analysis of variance of root n-hexane extracts for fresh root weight (fall, 2010).
Source DF SS MS F P Fractions 3 567.000 189.000 34.68 0.0000 Error 16 87.200 5.450 Total 19
Coefficient of variation: 10.28%
Appendix 154. Analysis of variance of root n-hexane extracts for fresh shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 1576.00 525.333 22.89 0.0000 Error 16 367.20 22.950 Total 19 Coefficient of variation: 10.84%
Appendix 155. Analysis of variance of root n-hexane extracts for galls g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 13498.9 4499.65 346.79 0.0000 Error 16 207.6 12.98 Total 19
Coefficient of variation: 6.02%
Appendix 156. Analysis of variance of root n-hexane extracts for plant height (fall, 2010).
Source DF SS MS F P Fractions 3 1142.95 380.983 28.22 0.0000 Error 16 216.00 13.500 Total 19
Coefficient of variation: 7.81%
Appendix 157. Analysis of variance of root n-hexane extracts reproduction factor (fall, 2010).
Source DF SS MS F P Fractions 3 0.81483 0.27161 498.07 0.0000 Error 16 0.00873 0.00055 Total 19
Coefficient of variation: 9.79%
Appendix 158. Analysis of variance of root n-hexane extracts for galling index (fall, 2010).
Source DF SS MS F P Fractions 3 0.43642 0.14547 16.56 0.0000 Error 16 0.14053 0.00878 Total 19
Coefficient of variation: 17.51%
333
Appendix 159. Analysis of variance of root ETOAC extracts for branches per plant (fall, 2010).
Source DF SS MS F P Fractions 3 145.600 48.5333 3.86 0.0298 Error 16 201.200 12.5750 Total 19
Coefficient of variation: 24.29%
Appendix 160. Analysis of variance of root ETOAC extracts for dry shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 197.350 65.7833 28.92 0.0000 Error 16 36.400 2.2750 Total 19
Coefficient of variation: 10.97%
Appendix 161. Analysis of variance of root ETOAC extracts for eggs g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 3.365 1.121 228.70 0.0000 Error 16 7848000 490500 Total 19
Coefficient of variation: 14.87%
Appendix 162. Analysis of variance of root ETOAC extracts for egg masses g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 5546.95 1848.98 47.75 0.0000 Error 16 619.60 38.73 Total 19
Coefficient of variation: 10.89%
Appendix 163. Analysis of variance of root ETOAC extracts for females g-1 of roots (fall, 2010)
Source DF SS MS F P Fractions 3 5209.00 1736.33 21.21 0.0000 Error 16 1310.00 81.88 Total 19 Coefficient of variation: 13.02%
Appendix 164. Analysis of variance of root ETOAC extracts for fresh root weight (fall, 2010).
Source DF SS MS F P Fractions 3 153.200 51.0667 7.71 0.0021 Error 16 106.000 6.6250 Total 19
Coefficient of variation: 10.21%
334 Appendix 165. Analysis of variance of root ETOAC extracts for fresh shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 315.750 105.250 6.88 0.0035 Error 16 244.800 15.300 Total 19
Coefficient of variation: 10.39%
Appendix 166. Analysis of variance of root ETOAC extracts for galls per plant (fall, 2010).
Source DF SS MS F P Fractions 3 4069.75 1356.58 48.75 0.0000 Error 16 445.20 27.83 Total 19
Coefficient of variation: 6.72%
Appendix 167. Analysis of variance of root ETOAC extracts for plant height (fall, 2010).
Source DF SS MS F P Fractions 3 85.7500 28.5833 5.37 0.0095 Error 16 85.2000 5.3250 Total 19
Coefficient of variation: 5.92%
Appendix 168. Analysis of variance of root ETOAC extracts for galling index (fall, 2010).
Source DF SS MS F P Fractions 3 0.14698 0.04899 53.59 0.0000 Error 16 0.01463 0.00091 Total 19
Coefficient of variation: 4.68%
Appendix 169. Analysis of variance of root ETOAC extracts for reproduction factor (fall, 2010).
Source DF SS MS F P Fractions 3 0.57292 0.19097 431.27 0.0000 Error 16 0.00709 0.00044 Total 19 Coefficient of variation: 7.12%
Appendix 170. Analysis of variance of root CHCl3 extracts for branches per plant (fall, 2010).
Source DF SS MS F P Fractions 3 186.200 62.0667 8.42 0.0014 Error 16 118.000 7.3750 Total 19
Coefficient of variation: 17.75%
335 Appendix 171. Analysis of variance of root CHCl3 extracts for dry shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 163.750 54.5833 9.70 0.0007 Error 16 90.000 5.6250 Total 19
Coefficient of variation: 17.25%
-1 Appendix 172. Analysis of variance of root CHCl3 extracts for eggs g of roots (fall, 2010).
Source DF SS MS F P Fractions 3 3.419 1.139 228.42 0.0000 Error 16 7984000 499000 Total 19
Coefficient of variation: 15.21%
-1 Appendix 173. Analysis of variance of root CHCl3 extracts for egg masses g of roots (fall, 2010).
Source DF SS MS F P Fractions 3 7134.00 2378.00 22.08 0.0000 Error 16 1722.80 107.67 Total 19
Coefficient of variation: 19.07%
-1 Appendix 174. Analysis of variance of root CHCl3 extracts for female g of roots (fall, 2010).
Source DF SS MS F P Fractions 3 4901.80 1633.93 54.33 0.0000 Error 16 481.20 30.07 Total 19
Coefficient of variation: 7.67%
Appendix 175. Analysis of variance of root CHCl3 extracts for fresh root weight (fall, 2010).
Source DF SS MS F P Fractions 3 148.400 49.4667 10.31 0.0005 Error 16 76.800 4.8000 Total 19
Coefficient of variation: 8.36%
Appendix 176. Analysis of variance of root CHCl3 extracts for fresh shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 358.600 119.533 18.46 0.0000 Error 16 103.600 6.475 Total 19
Coefficient of variation: 6.75%
336 Appendix 177. Analysis of variance of root CHCl3 extracts for galls per plant (fall, 2010).
Source DF SS MS F P Fractions 3 2773.00 924.333 53.05 0.0000 Error 16 278.80 17.425 Total 19
Coefficient of variation: 4.98%
Appendix 178. Analysis of variance of root CHCl3 extracts for plant height (fall, 2010).
Source DF SS MS F P Fractions 3 137.350 45.7833 5.76 0.0072 Error 16 127.200 7.9500 Total 19
Coefficient of variation: 7.11%
Appendix 179. Analysis of variance of root CHCl3 extracts for galling index (fall, 2010).
Source DF SS MS F P Fractions 3 0.23566 0.07855 22.05 0.0000 Error 16 0.05700 0.00356 Total 19
Coefficient of variation: 9.55%
Appendix 180. Analysis of variance of root CHCl3 extracts for reproduction factor (fall, 2010).
Source DF SS MS F P Fractions 3 0.58685 0.19562 479.71 0.0000 Error 16 0.00652 0.00041 Total 19
Coefficient of variation: 6.92%
Appendix 181. Analysis of variance of root MeOH extracts for branches per plant (fall, 2010).
Source DF SS MS F P Fractions 3 301.000 100.333 14.75 0.0001 Error 16 108.800 6.800 Total 19
Coefficient of variation: 14.41%
Appendix 182. Analysis of variance of root MeOH extracts for dry shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 286.550 95.5167 17.37 0.0000 Error 16 88.000 5.5000 Total 19
Coefficient of variation: 14.99%
337 Appendix 183. Analysis of variance of root MeOH extracts for eggs g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 3.773 1.257 251.26 0.0000 Error 16 8008000 500500 Total 19
Coefficient of variation: 16.53%
Appendix 184. Analysis of variance of root MeOH extracts for egg masses g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 8090.95 2696.98 70.74 0.0000 Error 16 610.00 38.12 Total 19
Coefficient of variation: 11.66%
Appendix 185. Analysis of variance of root MeOH extracts for females g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 9570.95 3190.32 35.50 0.0000 Error 16 1438.00 89.88 Total 19
Coefficient of variation: 15.66%
Appendix 186. Analysis of variance of root MeOH extracts for fresh root weight (fall, 2010).
Source DF SS MS F P Fractions 3 177.200 59.0667 18.60 0.0000 Error 16 50.800 3.1750 Total 19
Coefficient of variation: 7.13%
Appendix 187. Analysis of variance of root MeOH extracts for fresh shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 766.800 255.600 16.03 0.0000 Error 16 255.200 15.950 Total 19 Coefficient of variation: 9.74%
Appendix 188. Analysis of variance of root MeOH extracts for galls per plant (fall, 2010).
Source DF SS MS F P Fractions 3 6647.60 2215.87 181.63 0.0000 Error 16 195.20 12.20 Total 19
Coefficient of variation: 4.82%
338 Appendix 189. Analysis of variance of root MeOH extracts for plant height (fall, 2010).
Source DF SS MS F P Fractions 3 396.150 132.050 11.84 0.0002 Error 16 178.400 11.150 Total 19 Coefficient of variation: 7.79%
Appendix 190. Analysis of variance of root MeOH extracts for galling index (fall, 2010).
Source DF SS MS F P Fractions 3 0.32527 0.10842 89.83 0.0000 Error 16 0.01931 0.00121 Total 19 Coefficient of variation: 5.92%
Appendix 191. Analysis of variance of root MeOH extracts for reproduction factor (fall, 2010).
Source DF SS MS F P Fractions 3 0.68905 0.22968 443.54 0.0000 Error 16 0.00829 0.00052 Total 19
Coefficient of variation: 8.55%
339 ANALYSES OF VARIANCE (ANOVA) OF SCREEN HOUSE STUDIES USING STEM EXTRACTS OF FUMARIA PARVIFLORA (FALL, 2010) (EXPERIMENT 2)
Appendix 192. Analysis of variance of stem n-hexane extracts for branches per plant (fall, 2010).
Source DF SS MS F P Fractions 3 477.000 159.000 12.67 0.0002 Error 16 200.800 12.550 Total 19
Coefficient of variation: 20.72%
Appendix 193. Analysis of variance of stem n-hexane extracts for dry shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 296.800 98.9333 4.23 0.0221 Error 16 374.000 23.3750 Total 19
Coefficient of variation: 30.99%
Appendix 194. Analysis of variance of stem n-hexane extracts for egg mass g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 10805.3 3601.78 57.65 0.0000 Error 16 999.6 62.48 Total 19
Coefficient of variation: 15.19%
Appendix 195. Analysis of variance of stem n-hexane extracts for eggs g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 3.083E+08 1.027E+08 327.26 0.0000 Error 16 5024000 314000 Total 19
Coefficient of variation: 13.91%
Appendix 196. Analysis of variance of stem n-hexane extracts for females g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 5654.95 1884.98 37.07 0.0000 Error 16 813.60 50.85 Total 19
Coefficient of variation: 11.20%
340 Appendix 197. Analysis of variance of stem n-hexane extracts for fresh shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 422.550 140.850 14.60 0.0001 Error 16 154.400 9.650 Total 19
Coefficient of variation: 13.48%
Appendix 198. Analysis of variance of stem n-hexane extracts for fresh root weight (fall, 2010).
Source DF SS MS F P Fractions 3 517.350 172.450 21.62 0.0000 Error 16 127.600 7.975 Total 19
Coefficient of variation: 7.33%
Appendix 199. Analysis of variance of stem n-hexane extracts for galls per plant (fall, 2010).
Source DF SS MS F P Fractions 3 6728.00 2242.67 24.10 0.0000 Error 16 1489.20 93.08 Total 19
Coefficient of variation: 12.83%
Appendix 200. Analysis of variance of stem n-hexane extracts for plant height (fall, 2010).
Source DF SS MS F P Fractions 3 856.400 285.467 17.51 0.0000 Error 16 260.800 16.300 Total 19
Coefficient of variation: 9.57%
Appendix 201. Analysis of variance of stem n-hexane extracts for galling index (fall, 2010).
Source DF SS MS F P Fractions 3 0.24060 0.08020 40.03 0.0000 Error 16 0.03206 0.00200 Total 19
Coefficient of variation: 7.15%
Appendix 202. Analysis of variance of stem n-hexane extracts for reproduction factor (fall, 2010).
Source DF SS MS F P Fractions 3 0.70165 0.23388 158.09 0.0000 Error 16 0.02367 0.00148 Total 19
Coefficient of variation: 14.78%
341 Appendix 203. Analysis of variance of stem ETOAC extracts for branches per plant (fall, 2010).
Source DF SS MS F P Fractions 3 289.800 96.6000 8.97 0.0010 Error 16 172.400 10.7750 Total 19
Coefficient of variation: 20.14%
Appendix 204. Analysis of variance of stem ETOAC extracts for dry shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 221.800 73.9333 7.21 0.0028 Error 16 164.000 10.2500 Total 19
Coefficient of variation: 21.20%
Appendix 205. Analysis of variance of stem ETOAC extracts for egg mass g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 9713.75 3237.92 75.74 0.0000 Error 16 684.00 42.75 Total 19
Coefficient of variation: 12.05%
Appendix 206. Analysis of variance of stem ETOAC extracts for eggs g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 2.910 9.700 309.15 0.0000 Error 16 5020000 313750 Total 19
Coefficient of variation: 13.29%
Appendix 207. Analysis of variance of stem ETOAC extracts for females g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 4879.60 1626.53 18.31 0.0000 Error 16 1421.20 88.83 Total 19
Coefficient of variation: 14.19%
Appendix 208. Analysis of variance of stem ETOAC extracts for fresh root weight (fall, 2010).
Source DF SS MS F P Fractions 3 376.000 125.333 10.38 0.0005 Error 16 193.200 12.075 Total 19
Coefficient of variation: 14.60%
342 Appendix 209. Analysis of variance of stem ETOAC extracts for fresh shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 785.200 261.733 11.29 0.0003 Error 16 370.800 23.175 Total 19
Coefficient of variation: 12.34%
Appendix 210. Analysis of variance of stem ETOAC extracts for galls per plant (fall, 2010).
Source DF SS MS F P Fractions 3 6864.15 2288.05 15.37 0.0001 Error 16 2381.60 148.85 Total 19
Coefficient of variation: 15.79%
Appendix 211. Analysis of variance of stem ETOAC extracts for plant height (fall, 2010).
Source DF SS MS F P Fractions 3 592.200 197.400 12.30 0.0002 Error 16 256.800 16.050 Total 19
Coefficient of variation: 9.89%
Appendix 212. Analysis of variance of stem ETOAC extracts for galling index (fall, 2010).
Source DF SS MS F P Fractions 3 0.16406 0.05469 17.69 0.0000 Error 16 0.04946 0.00309 Total 19
Coefficient of variation: 8.64%
Appendix 213. Analysis of variance of stem ETOAC extracts for reproduction factor (fall, 2010).
Source DF SS MS F P Fractions 3 0.63089 0.21030 227.22 0.0000 Error 16 0.01481 0.00093 Total 19
Coefficient of variation: 10.99%
Appendix 214. Analysis of variance of stem CHCl3 extracts for branches per plant (fall, 2010).
Source DF SS MS F P Fractions 3 350.150 116.717 11.41 0.0003 Error 16 163.600 10.225 Total 19
Coefficient of variation: 19.68%
343 Appendix 215. Analysis of variance of stem CHCl3 extracts for dry shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 161.350 53.7833 7.10 0.0030 Error 16 121.200 7.5750 Total 19
Coefficient of variation: 18.53%
-1 Appendix 216. Analysis of variance of stem CHCl3 extracts for egg masses g of roots (fall, 2010).
Source DF SS MS F P Fractions 3 9690.60 3230.20 35.56 0.0000 Error 16 1453.60 90.85 Total 19
Coefficient of variation: 17.88%
-1 Appendix 217. Analysis of variance of stem CHCl3 extracts for egg roots g of roots (fall, 2010).
Source DF SS MS F P Fractions 3 2.527 8.424 6.41 0.0047 Error 16 2.10 1.315 Total 19
Coefficient of variation: 73.43%
-1 Appendix 218. Analysis of variance of stem CHCl3 extracts for females g of roots (fall, 2010).
Source DF SS MS F P Fractions 3 5516.40 1838.80 22.08 0.0000 Error 16 1332.40 83.28 Total 19
Coefficient of variation: 13.95%
Appendix 219. Analysis of variance of stem CHCl3 extracts for fresh root weight (fall, 2010).
Source DF SS MS F P Fractions 3 154.550 51.5167 7.28 0.0027 Error 16 113.200 7.0750 Total 19
Coefficient of variation: 10.33%
Appendix 220. Analysis of variance of stem CHCl3 extracts for fresh shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 570.150 190.050 18.50 0.0000 Error 16 164.400 10.275 Total 19
Coefficient of variation: 8.29%
344 Appendix 221. Analysis of variance of stem CHCl3 extracts for galls per plant (fall, 2010).
Source DF SS MS F P Fractions 3 4648.20 1549.40 21.60 0.0000 Error 16 1147.60 71.73 Total 19
Coefficient of variation: 10.57%
Appendix 222. Analysis of variance of stem CHCl3 extracts for plant height (fall, 2010).
Source DF SS MS F P Fractions 3 384.400 128.133 9.01 0.0010 Error 16 227.600 14.225 Total 19
Coefficient of variation: 9.67%
Appendix 223. Analysis of variance of stem CHCl3 extracts for galling index (fall, 2010).
Source DF SS MS F P Fractions 3 0.22536 0.07512 15.58 0.0001 Error 16 0.07715 0.00482 Total 19
Coefficient of variation: 10.94%
Appendix 224. Analysis of variance of stem CHCl3 extracts for reproduction factor (fall, 2010).
Source DF SS MS F P Fractions 3 0.64274 0.21425 174.48 0.0000 Error 16 0.01965 0.00123 Total 19
Coefficient of variation: 12.77%
Appendix 225. Analysis of variance of stem MeOH extracts for branches per plant (fall, 2010).
Source DF SS MS F P Fractions 3 289.800 96.6000 6.22 0.0053 Error 16 248.400 15.5250 Total 19
Coefficient of variation: 23.59%
Appendix 226. Analysis of variance of stem MEOH extracts for dry shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 247.000 82.3333 5.12 0.0113 Error 16 257.200 16.0750 Total 19
Coefficient of variation: 24.60%
345 Appendix 227. Analysis of variance of stem MEOH extracts for egg mass g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 10091.2 3363.73 37.18 0.0000 Error 16 1447.6 90.48 Total 19
Coefficient of variation: 17.17%
Appendix 228. Analysis of variance of stem MEOH extracts for egg g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 2.961 9.869 316.37 0.0000 Error 16 4991000 311938 Total 19
Coefficient of variation: 13.40%
Appendix 229.Analysis of variance of stem MEOH extracts for females g-1 of roots (fall, 2010).
Source DF SS MS F P Fractions 3 4977.20 1659.07 20.28 0.0000 Error 16 1308.80 81.80 Total 19 Coefficient of variation: 13.70%
Appendix 230. Analysis of variance of stem MEOH extracts for fresh root weight (fall, 2010).
Source DF SS MS F P Fractions 3 371.400 123.800 7.14 0.0029 Error 16 277.600 17.350 Total 19
Coefficient of variation: 17.00%
Appendix 231. Analysis of variance of stem MEOH extracts for fresh shoot weight (fall, 2010).
Source DF SS MS F P Fractions 3 432.150 144.050 7.77 0.0020 Error 16 296.800 18.550 Total 19
Coefficient of variation: 11.20%
Appendix 232. Analysis of variance of stem MEOH extracts for galls per plant (fall, 2010).
Source DF SS MS F P Fractions 3 6287.40 2095.80 29.27 0.0000 Error 16 1145.60 71.60 Total 19
Coefficient of variation: 10.92%
346 Appendix 233.Analysis of variance of stem MEOH extracts for plant height (fall, 2010).
Source DF SS MS F P Fractions 3 531.750 177.250 6.87 0.0035 Error 16 412.800 25.800 Total 19
Coefficient of variation: 12.43%
Appendix 234.Analysis of variance of stem MEOH extracts for galling index (fall, 2010).
Source DF SS MS F P Fractions 3 0.30442 0.10147 22.93 0.0000 Error 16 0.07082 0.00443 Total 19
Coefficient of variation: 10.85%
Appendix 235. Analysis of variance of stem MEOH extracts for Reproduction factor (fall, 2010).
Source DF SS MS F P Fractions 3 0.66674 0.22225 197.05 0.0000 Error 16 0.01805 0.00113 Total 19
Coefficient of variation: 12.49%
347 ANALYSES OF VARIANCE (ANOVA) OF SCREEN HOUSE STUDIES USING DRY POWDER OF FUMARIA PARVIFLORA (SPRING & FALL, 2010)
Appendix 236. Effect of dry powder of Fumaria parviflora on number of galls plant-1 of tomato infected with Meloidogyne incognita under screen house conditions (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts (P) 3 4126.750 1375.583 44.1659 0.0000 Doses (D) 3 14947.250 4982.417 159.9706 0.0000 P X D 9 1556.750 172.972 5.5536 0.0000 Error 48 1495.000 31.146 Total 63 22125.750
Coefficient of variation: 10.25%
Appendix 237. Effect of dry powder of Fumaria parviflora on number of galls plant-1 of tomato infected with Meloidogyne incognita under screen house conditions (fall, 2010).
Source Freedom Squares Square F Prob Degrees of Sum of Mean Value Plant parts (P) 3 3226.625 1075.542 35.3240 0.0000 Doses (D) 3 22194.125 7398.042 242.9737 0.0000 P X D 9 1611.750 179.083 5.8816 0.0000 Error 48 1461.500 30.448 Total 63 28494.000
Coefficient of variation: 7.58%
Appendix 238. Effect of dry powder of Fumaria parviflora on galling index of tomato infected with Meloidogyne incognita under screen house conditions (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts(P) 3 20.995 6.998 44.6861 0.0000 Doses (D) 3 57.152 19.051 121.6398 0.0000 P X D 9 6.671 0.741 4.7331 0.0002 Error 48 7.518 0.157 Total 63 92.336
Coefficient of variation: 12.21%
348 Appendix 239. Effect of dry powder of Fumaria parviflora on galling index of tomato infected with Meloidogyne incognita under screen house conditions (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob
Plant parts (P) 3 8.891 2.964 21.7341 0.0000 Doses (D) 3 50.933 16.978 124.5118 0.0000 P X D 9 4.481 0.498 3.6511 0.0015 Error 48 6.545 0.136 Total 63 70.849
Coefficient of variation: 10.32%
Appendix 240. Effect of dry powder of Fumaria parviflora on egg masses g-1 of tomato roots infected with Meloidogyne incognita under screen house conditions (spring, 2010). Degrees of Sum of Mean F Source Freedom Squares Square Value Prob
Plant parts (P) 3 1931.297 643.766 23.0045 0.0000 Doses (D) 3 14344.172 4781.391 170.8593 0.0000 P X D 9 354.391 39.377 1.4071 0.2117 Error 48 1343.250 27.984 Total 63 17973.109
Coefficient of variation: 12.85%
Appendix 241. Effect of dry powder of Fumaria parviflora on egg masses g-1 of tomato roots infected with Meloidogyne incognita under screen house conditions (fall, 2010). Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts (P) 3 5458.297 1819.432 45.9223 0.0000 Doses (D) 3 20738.297 6912.766 174.4776 0.0000 P X D 9 2147.016 238.557 6.0212 0.0000 Error 48 1901.750 39.620 Total 63 30245.359
Coefficient of variation: 9.35%
Appendix 242. Effect of dry powder of Fumaria parviflora on eggs per egg mass of tomato infected with Meloidogyne incognita under screen house conditions (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob
Plant parts(P) 3 2105.563 701.854 10.7341 0.0000 Doses (D) 3 4883.188 1627.729 24.8944 0.0000 P X D 9 804.688 89.410 1.3674 0.2293 Error 48 3138.500 65.385 Total 63 10931.938
Coefficient of variation: 2.82%
349 Appendix 243. Effect of dry powder of Fumaria parviflora on eggs per egg mass of tomato infected with Meloidogyne incognita under screen house conditions (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts(P) 3 305.063 101.688 3.5811 0.0204 Doses (D) 3 2013.313 671.104 23.6339 0.0000 P X D 9 276.063 30.674 1.0802 0.3945 Error 48 1363.000 28.396 Total 63 3957.438
Coefficient of variation: 10.89%
Appendix 243. Effect of dry powder of Fumaria parviflora on number of adult female g-1 of tomato infected with Meloidogyne incognita under screen house conditions (spring, 2010). Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts(P) 3 1295.297 431.766 19.0441 0.0000 Doses (D) 3 11726.297 3908.766 172.4059 0.0000 P X D 9 298.766 33.196 1.4642 0.1886 Error 48 1088.250 22.672 Total 63 14408.609
Coefficient of variation: 16.46%
Appendix 244. Effect of dry powder of Fumaria parviflora on number of adult female g-1 of tomato infected with Meloidogyne incognita under screen house conditions (fall, 2010)
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts(P) 3 4862.797 1620.932 104.4710 0.0000 Doses (D) 3 22515.297 7505.099 483.7123 0.0000 P X D 9 1199.891 133.321 8.5927 0.0000 Error 48 744.750 15.516 Total 63 29322.734
Coefficient of variation: 9.52%
Appendix 245. Effect of dry powder of Fumaria parviflora on number of juveniles in 100 cm3 soil of tomato plant infected with Meloidogyne incognita under screen house conditions (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts(P) 3 41903.422 13967.807 50.3883 0.0000 Doses (D) 3 53336.047 17778.682 64.1359 0.0000 P X D 9 14073.766 1563.752 5.6412 0.0000 Error 48 13305.750 277.203 Total 63 122618.984
Coefficient of variation: 10.74%
350 Appendix 246. Effect of dry powder of Fumaria parviflora on number of juveniles in 100 cm3 soil of tomato plant infected with Meloidogyne incognita under screen house conditions (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts(P) 3 103127.188 34375.729 18.4044 0.0000 Doses (D) 3 950576.563 316858.854 169.6426 0.0000 P X D 9 3203.188 355.910 0.1906 Error 48 89654.500 1867.802 Total 63 1146561.438
Coefficient of variation: 14.48%
Appendix 247. Effect of dry powder of Fumaria parviflora on shoot length of tomato infected with Meloidogyne incognita under screen house conditions (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts (P) 3 1245.563 415.188 47.3373 0.0000 Doses (D) 3 2299.813 766.604 87.4038 0.0000 P X D 9 600.563 66.729 7.6081 0.0000 Error 48 421.000 8.771 Total 63 4566.938
Coefficient of variation: 7.85%
Appendix 248. Effect of dry powder of Fumaria parviflora on shoot length of tomato infected with Meloidogyne incognita under screen house conditions (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts(P) 3 1259.047 419.682 36.3132 0.0000 Doses (D) 3 599.422 199.807 17.2884 0.0000 P X D 9 739.766 82.196 7.1121 0.0000 Error 48 554.750 11.557 Total 63 3152.984
Coefficient of variation: 10.30%
Appendix 249. Effect of dry powder of Fumaria parviflora on number of branches plant-1 of tomato infected with Meloidogyne incognita under screen house conditions (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts(P) 3 24.237 8.079 88.4961 0.0000 Doses (D) 3 25.992 8.664 94.9013 0.0000 P X D 9 13.629 1.514 16.5875 0.0000 Error 48 4.382 0.091 Total 63 68.240
Coefficient of variation: 21.66%
351
Appendix 250. Effect of dry powder of Fumaria parviflora on number of branches plant-1 of tomato infected with Meloidogyne incognita under screen house conditions (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts (P) 3 117.422 39.141 13.5405 0.0000 Doses (D) 3 155.047 51.682 17.8793 0.0000 P X D 9 87.391 9.710 3.3592 0.0029 Error 48 138.750 2.891 Total 63 498.609 Coefficient of variation: 15.57%
Appendix 251. Effect of dry powder of Fumaria parviflora on fresh shoot weight of tomato infected with Meloidogyne incognita under screen house conditions (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts (P) 3 1633.654 544.551 95.7514 0.0000 Doses (D) 3 2621.322 873.774 153.6404 0.0000 P X D 9 1106.029 122.892 21.6088 0.0000 Error 48 272.983 5.687 Total 63 5633.987
Coefficient of variation: 8.51%
Appendix 252. Effect of dry powder of Fumaria parviflora on fresh shoot weight of tomato infected with Meloidogyne incognita under screen house conditions (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts (P) 3 1148.963 382.988 29.6395 0.0000 Doses (D) 3 3006.094 1002.031 77.5475 0.0000 P X D 9 2465.211 273.912 21.1982 0.0000 Error 48 620.233 12.922 Total 63 7240.501
Coefficient of variation: 13.86%
Appendix 253. Effect of dry powder of Fumaria parviflora on shoot dry weight of tomato infected with Meloidogyne incognita under screen house conditions (spring, 2010). Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts (P) 3 131.854 43.951 66.0561 0.0000 Doses (D) 3 435.567 145.189 218.2096 0.0000 P X D 9 87.341 9.705 14.5854 0.0000 Error 48 31.937 0.665 Total 63 686.700
Coefficient of variation: 7.19%
352 Appendix 254. Effect of dry powder of Fumaria parviflora on shoot dry weight of tomato infected with Meloidogyne incognita under screen house conditions (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts (P) 3 5.447 1.816 66.9057 0.0000 Doses (D) 3 10.429 3.476 128.0940 0.0000 P X D 9 7.938 0.882 32.5012 0.0000 Error 48 1.303 0.027 Total 63 25.117
Coefficient of variation: 21.40%
Appendix 255. Effect of dry powder of Fumaria parviflora on number of flowers plant-1 of tomato infected with Meloidogyne incognita under screen house conditions (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts (P) 3 273.297 91.099 8.2156 0.0002 Doses (D) 3 1398.922 466.307 42.0531 0.0000 P X D 9 118.516 13.168 1.1876 0.3245 Error 48 532.250 11.089 Total 63 2322.984
Coefficient of variation: 10.09%
Appendix 256. Effect of dry powder of Fumaria parviflora on number of flowers plant-1 of tomato infected with Meloidogyne incognita under screen house conditions (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts (P) 3 583.922 194.641 12.7677 0.0000 Doses (D) 3 2060.297 686.766 45.0492 0.0000 P X D 9 602.766 66.974 4.3932 0.0003 Error 48 731.750 15.245 Total 63 3978.734
Coefficient of variation: 13.30%
Appendix 257. Effect of dry powder of Fumaria parviflora on root length of tomato infected with Meloidogyne incognita under screen house conditions (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts (P) 3 175.521 58.507 27.1546 0.0000 Doses (D) 3 509.246 169.749 78.7849 0.0000 P X D 9 95.283 10.587 4.9137 0.0001 Error 48 103.420 2.155 Total 63 883.469
Coefficient of variation: 14.71%
353
Appendix 258. Effect of dry powder of Fumaria parviflora on root length of tomato infected with Meloidogyne incognita under screen house conditions (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts (P) 3 141.849 47.283 42.6212 0.0000 Doses (D) 3 498.771 166.257 149.8655 0.0000 P X D 9 108.980 12.109 10.9151 0.0000 Error 48 53.250 1.109 Total 63 802.850
Coefficient of variation: 9.83%
354 ANALYSES OF VARIANCE OF FIELD STUDIES USING DRY POWDER OF FUMARIA PARVIFLORA (SPRING & FALL, 2010)
Appendix 259. Effect of dry powder of Fumaria parviflora on number of galls per root system of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 89.000 29.667 0.9727 Plant parts (P) 3 3226.625 1075.542 35.2637 0.0000 Doses (D) 3 22194.125 7398.042 242.5587 0.0000 P X D 9 1611.750 179.083 5.8716 0.0000 Error 45 1372.500 30.500 Total 63 28494.000
Coefficient of variation: 7.59%
Appendix 260. Effect of dry powder of Fumaria parviflora on number of galls per root system of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Plant parts (P) 3 1620.625 540.208 20.7219 0.0000 Doses (D) 3 13248.250 4416.083 169.3969 0.0000 P X D 9 1065.625 118.403 4.5418 0.0003 Error 45 1173.125 26.069 Total 63 17123.000
Coefficient of variation: 7.69%
Appendix 261. Effect of dry powder of Fumaria parviflora on galling index (GI) of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 0.286 0.095 0.6241 Plant parts (P) 3 14.021 4.674 30.6378 0.0000 Doses (D) 3 67.237 22.412 146.9257 0.0000 P X D 9 6.727 0.747 4.8998 0.0001 Error 45 6.864 0.153 Total 63 95.134
Coefficient of variation: 11.69%
355 Appendix 262. Effect of dry powder of Fumaria parviflora on galling index (GI) of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (fall, 2010). Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 1.316 0.439 1.1491 0.3397 Plant parts (P) 3 7.776 2.592 6.7912 0.0007 Doses (D) 3 64.141 21.380 56.0201 0.0000 P X D 9 4.883 0.543 1.4216 0.2076 Error 45 17.174 0.382 Total 63 95.289
Coefficient of variation: 18.56%
Appendix 263. Effect of dry powder of Fumaria parviflora on egg masses g-1 of tomato roots infected with Meloidogyne incognita under natural field conditions of Dargai (fall, 2010). Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 155.563 51.854 2.1587 0.1061 Plant parts (P) 3 1645.313 548.438 22.8317 0.0000 Doses (D) 3 18304.313 6101.438 254.0061 0.0000 P X D 9 1062.813 118.090 4.9162 0.0001 Error 45 1080.938 24.021 Total 63 22248.938
Coefficient of variation: 8.49%
Appendix 264. Effect of dry powder of Fumaria parviflora on eggs per egg mass of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (fall, 2010). Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 554.688 184.896 1.0784 0.3678 Plant parts (P) 3 269.563 89.854 0.5241 Doses (D) 3 6927.188 2309.063 13.4677 0.0000 P X D 9 335.188 37.243 0.2172 Error 45 7715.313 171.451 Total 63 15801.938
Coefficient of variation: 4.21%
Appendix 265. Effect of dry powder of Fumaria parviflora on number of adult females g-1 of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring, 2010). Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 302.188 100.729 3.3236 0.0279 Plant parts (P) 3 1711.688 570.563 18.8261 0.0000 Doses (D) 3 15430.063 5143.354 169.7088 0.0000 P X D 9 1259.188 139.910 4.6164 0.0002 Error 45 1363.813 30.307 Total 63 20066.938
Coefficient of variation: 8.19%
356
Appendix 266. Effect of dry powder of Fumaria parviflora on number of adult females g-1 of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 4.922 1.641 0.8552 Plant parts (P) 3 36.047 12.016 6.2633 0.0012 Doses (D) 3 75.672 25.224 13.1484 0.0000 P X D 9 36.391 4.043 2.1077 0.0487 Error 45 86.328 1.918 Total 63 239.359
Coefficient of variation: 12.94%
Appendix 267. Effect of dry powder of Fumaria parviflora on initial nematode populations per 100 g of soil in tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 139.547 46.516 0.1508 Plant parts (P) 3 38839.672 12946.557 41.9595 0.0000 Doses (D) 3 235088.547 78362.849 253.9722 0.0000 P X D 9 60091.766 6676.863 21.6396 0.0000 Error 45 13884.703 308.549 Total 63 348044.234
Coefficient of variation: 9.59%
Appendix 268. Effect of dry powder of Fumaria parviflora on initial nematode populations per 100 g of soil in tomato infected with Meloidogyne incognita under natural field conditions of Dargai (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 998.422 332.807 1.3040 0.2848 Plant parts (P) 3 8832.172 2944.057 11.5349 0.0000 Doses (D) 3 57964.422 19321.474 75.7023 0.0000 P X D 9 1534.141 170.460 0.6679 Error 45 11485.328 255.230 Total 63 80814.484
Coefficient of variation: 6.79%
357
Appendix 269. Effect of dry powder of Fumaria parviflora on final nematode populations per 100 g of soil in tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 443.688 147.896 0.6952 Plant parts (P) 3 33321.813 11107.271 52.2132 0.0000 Doses (D) 3 260581.813 86860.604 408.3154 0.0000 P X D 9 50738.813 5637.646 26.5015 0.0000 Error 45 9572.813 212.729 Total 63 354658.938
Coefficient of variation: 8.05%
Appendix 270. Effect of dry powder of Fumaria parviflora on final nematode populations per 100 g of soil in tomato infected with Meloidogyne incognita under natural field conditions of Dargai (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 2729.172 909.724 1.5354 0.2183 Plant parts (P) 3 17651.297 5883.766 9.9302 0.0000 Doses (D) 3 129805.547 43268.516 73.0254 0.0000 AB 9 6350.266 705.585 1.1908 0.3242 Error 45 26663.078 592.513 Total 63 183199.359
Coefficient of variation: 11.03%
Appendix 271. Effect of dry powder of Fumaria parviflora on fresh shoot weight (g) of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 29.125 9.708 1.1120 0.3542 Plant parts (P) 3 928.250 309.417 35.4407 0.0000 Doses (D) 3 2563.875 854.625 97.8890 0.0000 P X D 9 977.625 108.625 12.4419 0.0000 Error 45 392.875 8.731 Total 63 4891.750
Coefficient of variation: 9.63%
358
Appendix 272. Effect of dry powder of Fumaria parviflora on fresh shoot weight (g) of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 6.625 2.208 0.2464 Plant parts (P) 3 325.875 108.625 12.1181 0.0000 Doses (D) 3 4529.375 1509.792 168.4304 0.0000 P X D 9 80.500 8.944 0.9978 Error 45 403.375 8.964 Total 63 5345.750
Coefficient of variation: 7.01%
Appendix 273. Effect of dry powder of Fumaria parviflora on shoot dry weight (g) of tomato infected with Meloidogyne incognita under natural filed conditions of Dargai (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 5.585 1.862 0.7151 Plant parts (P) 3 303.748 101.249 38.8899 0.0000 Doses (D) 3 795.173 265.058 101.8086 0.0000 P X D 9 200.431 22.270 8.5540 0.0000 Error 45 117.157 2.603 Total 63 1422.095
Coefficient of variation: 10.96%
Appendix 274. Effect of dry powder of Fumaria parviflora on shoot dry weight (g) of tomato infected with Meloidogyne incognita under natural filed conditions of Dargai (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 25.875 8.625 0.9885 Plant parts (P) 3 134.875 44.958 5.1528 0.0038 Doses (D) 3 1265.625 421.875 48.3524 0.0000 P X D 9 39.000 4.333 0.4967 Error 45 392.625 8.725 Total 63 1858.000
Coefficient of variation: 13.58%
359 Appendix 275. Effect of dry powder of Fumaria parviflora on fresh root weight (g) of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 29.125 9.708 1.1120 0.3542 Plant parts (P) 3 928.250 309.417 35.4407 0.0000 Doses (D) 3 2563.875 854.625 97.8890 0.0000 P X D 9 977.625 108.625 12.4419 0.0000 Error 45 392.875 8.731 Total 63 4891.750
Coefficient of variation: 9.63%
Appendix 276. Effect of dry powder of Fumaria parviflora on fresh root weight (g) of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (fall, 2010). Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 21.047 7.016 1.6555 0.1900 Plant parts (P) 3 214.047 71.349 16.8361 0.0000 Doses (D) 3 994.672 331.557 78.2372 0.0000 P X D 9 125.266 13.918 3.2843 0.0037 Error 45 190.703 4.238 Total 63 1545.734
Coefficient of variation: 12.21%
Appendix 277. Effect of dry powder of Fumaria parviflora on shoot length (cm) of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 38.797 12.932 1.4698 0.2355 Plant parts (P) 3 546.547 182.182 20.7050 0.0000 Doses (D) 3 2175.172 725.057 82.4026 0.0000 P X D 9 160.516 17.835 2.0270 0.0581 Error 45 395.953 8.799 Total 63 3316.984
Coefficient of variation: 7.80%
360 Appendix 278. Effect of dry powder of Fumaria parviflora on shoot length (cm) of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 13.547 4.516 1.2451 0.3046 Plant parts (P) 3 934.297 311.432 85.8712 0.0000 Doses (D) 3 2729.047 909.682 250.8267 0.0000 P X D 9 300.266 33.363 9.1991 0.0000 Error 45 163.203 3.627 Total 63 4140.359
Coefficient of variation: 4.74%
Appendix 279. Effect of dry powder of Fumaria parviflora on root length (cm) of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 10.625 3.542 0.5271 Plant parts (P) 3 40.125 13.375 1.9905 0.1289 Doses (D) 3 407.125 135.708 20.1964 0.0000 P X D 9 85.500 9.500 1.4138 0.2109 Error 45 302.375 6.719 Total 63 845.750
Coefficient of variation: 16.14%
Appendix 280. Effect of dry powder of Fumaria parviflora on root length (cm) of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring and fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 23.422 7.807 2.3064 0.0894 Plant parts (P) 3 244.047 81.349 24.0317 0.0000 Doses (D) 3 1137.172 379.057 111.9792 0.0000 P X D 9 83.391 9.266 2.7372 0.0123 Error 45 152.328 3.385 Total 63 1640.359
Coefficient of variation: 10.69%
361 Appendix 281. Effect of dry powder of Fumaria parviflora on number of branches plant-1 of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 6.125 2.042 0.6476 Plant parts (P) 3 61.875 20.625 6.5419 0.0009 Doses (D) 3 373.500 124.500 39.4890 0.0000 P X D 9 54.375 6.042 1.9163 0.0738 Error 45 141.875 3.153 Total 63 637.750
Coefficient of variation: 12.52%
Appendix 282. Effect of dry powder of Fumaria parviflora on number of branches plant-1 of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 3.547 1.182 0.6032 Plant parts (P) 3 45.797 15.266 7.7883 0.0003 Doses (D) 3 751.422 250.474 127.7883 0.0000 P X D 9 63.016 7.002 3.5722 0.0020 Error 45 88.203 1.960 Total 63 951.984
Coefficient of variation: 8.49%
Appendix 283. Effect of dry powder of Fumaria parviflora on number of flowers plant-1 of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 141.797 47.266 2.1816 0.1033 Plant parts (P) 3 518.297 172.766 7.9742 0.0002 Doses (D) 3 4815.547 1605.182 74.0889 0.0000 P X D 9 307.391 34.155 1.5764 0.1515 Error 45 974.953 21.666 Total 63 6757.984
Coefficient of variation: 10.23%
362 Appendix 284. Effect of dry powder of Fumaria parviflora on number of flowers plant-1 of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 75.188 25.063 2.6058 0.0633 Plant parts (P) 3 2761.563 920.521 95.7076 0.0000 Doses (D) 3 6118.063 2039.354 212.0339 0.0000 P X D 9 674.813 74.979 7.7957 0.0000 Error 45 432.813 9.618 Total 63 10062.438
Coefficient of variation: 6.48%
Appendix 285. Effect of dry powder of Fumaria parviflora on number of fruits plant-1 of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (spring, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 14.250 4.750 0.9862 Plant parts (P) 3 617.625 205.875 42.7422 0.0000 Doses (D) 3 6393.875 2131.292 442.4827 0.0000 P X D 9 263.250 29.250 6.0727 0.0000 Error 45 216.750 4.817 Total 63 7505.750
Coefficient of variation: 5.98%
Appendix 286. Effect of dry powder of Fumaria parviflora on number of fruits plant-1 of tomato infected with Meloidogyne incognita under natural field conditions of Dargai (fall, 2010).
Degrees of Sum of Mean F Source Freedom Squares Square Value Prob Replication 3 144.922 48.307 5.4642 0.0027 Plant parts (P) 3 809.672 269.891 30.5285 0.0000 Doses (D) 3 5370.797 1790.266 202.5044 0.0000 P X D 9 341.016 37.891 4.2860 0.0005 Error 45 397.828 8.841 Total 63 7064.234
Coefficient of variation: 8.23%
363