DOCSLIB.ORG

Download Reprint (PDF)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Download Reprint (PDF) Biochemistry (Moscow), Vol. 65, No. 3, 2000, pp. 315-323. Translated from Biokhimiya, Vol. 65, No. 3, 2000, pp. 375-384. Original Russian Text Copyright © 2000 by Shiba, Tsutsumi, Ishige, Noguchi. REVIEW Inorganic Polyphosphate and Polyphosphate Kinase: Their Novel Biological Functions and Applications T. Shiba1*, K. Tsutsumi1, K. Ishige2, and T. Noguchi2 1Division of Molecular Chemistry, Graduate School of Engineering, Hokkaido University, Sapporo 060-8628, Japan; fax: +81-11-706-7816; E-mail: [email protected] 2Biochemical Divisions, YAMASA Corporation, Choshi, Chiba 288-0056, Japan Received October 4, 1999 AbstractIn this review, we discuss the following two subjects: 1) the physiological function of polyphosphate (poly(P)) as a regulatory factor for gene expression in Escherichia coli, and 2) novel functions of E. coli polyphosphate kinase (PPK) and their applications. With regard to the first subject, it has been shown that E. coli cells in which yeast exopolyphos- phatase (poly(P)ase), PPX1, was overproduced reduced resistance to H2O2 and heat shock as did a mutant whose polyphosphate kinase gene is disrupted. Sensitivity to H2O2 and heat shock evinced by cells that overproduce PPX1 is attributed to depressed levels of rpoS expression. Since rpoS is a central element in a regulatory network that governs the expression of stationary-phase-induced genes, poly(P) affects the expression of many genes through controlling rpoS expression. Furthermore, poly(P) is also involved in expression of other stress-inducible genes that are not directly regu- lated by rpoS. The second subject includes the application of novel functions of PPK for nucleoside triphosphate (NTP) regeneration. Recently E. coli PPK has been found to catalyze the kination of not only ADP but also other nucleoside diphosphates using poly(P) as a phospho-donor, yielding NTPs. This nucleoside diphosphate kinase-like activity of PPK was confirmed to be available for NTP regeneration essential for enzymatic oligosaccharide synthesis using the sugar nucleotide cycling method. PPK has also been found to express a poly(P):AMP phosphotransferase activity by coupling with adenylate kinase (ADK) in E. coli. The ATP-regeneration system consisting of ADK, PPK, and poly(P) was shown to be promising for practical utilization of poly(P) as ATP substitute. Key words: polyphosphate, polyphosphate kinase, exopolyphosphatase, rpoS, stress-inducible genes, NTP regeneration, nucleoside diphosphate kinase, adenylate kinase, glycosyltransferase, oligosaccharides, N-acetyllactosamine, poly(P):AMP phosphotransferase Inorganic polyphosphate (poly(P)) has been found ATP to a poly(P) in a freely reversible reaction [1-5] has to be widely distributed in every living thing so far exam- been most intensively studied. ined, from bacteria to mammals. Several biological Here, we describe novel biological functions of functions have been suggested for cellular poly(P), poly(P) and PPK in Escherichia coli and their applica- including a reservoir for phosphate and energy, a chela- tions. tor of metal ions, a buffer against alkali, and a channel for DNA entry [1]. However, the details of these poly(P) functions are still uncertain. 1. Poly(P)-DEPENDENT GENE EXPRESSION Several enzymes that contribute to the metabolism IN E. coli of poly(P) including polyphosphate kinase (PPK), exopoly(P)ase, poly(P):AMP phosphotransferase (PAP), 1.1. PPX1-overproducing cells show no cellular polyphosphate glucokinase, and endopolyphosphatase poly(P) accumulation and the same characteristics as have been identified [1]. PPK that is responsible for the those of a ppk mutant. An E. coli ppk mutant is deficient synthesis of poly(P) polymerizing terminal phosphate of in functions expressed in the stationary phase and fails to survive [6]. The mutant also showed a lack of resist- ance to an oxidant (H O ), to a redox-cycling agent Abbreviations: ADK) adenylate kinase; NDP) nucleoside 2 2 diphosphates; NTP) nucleoside triphosphates; PAP) polyphos- (menadione), to heat, and to an osmotic challenge [6, 7]. phate:AMP phosphotransferase; PPK) polyphosphate kinase; In stationary culture of the ppk mutant, small colony PPX1) yeast exopolyphosphatase. variants with improved viability and resistance to H2O2 * To whom correspondence should be addressed. frequently appeared [7]. Although survivors of the ppk 0006-2979/00/6503-0315$25.00 ©2000 MAIK Nauka/Interperiodica 316 SHIBA et al. mutant in the stationary phase are far fewer in number Second, it may be possible to remove short-chain after a week or so, the mutants are replaced by an out- poly(P), which suppresses the poly(P)-minus effect, growth of a small-colony-size variant with a stable geno- because the ppk mutant still makes short poly(P) chains type and with improved viability and resistance to H2O2 of about 60 residues in size by an alternative synthetic and heat [7]. Since neither PPK activity nor long-chain pathway [9]. Based on these advantages, we examined poly(P) was restored in the small-colony variant [7], the mechanism underlying the involvement of poly(P) in unknown mutations that suppress the poly(P)-minus H2O2 sensitivity. phenotype might occur during cultivation of the ppk To confirm that PPX1 overproduction can effi- mutant. ciently remove cellular poly(P), KT1008 cells (F, ∆(arg- To overcome these unstable features of the ppk lac)U169, araD139, rpsL150, ptsF25, flbB5301, rbsR, mutant, we employed the plasmid system that overpro- deoC1) were transformed by either a plasmid that car- duces recombinant yeast exopolyphosphatase (PPX1) [8] ries the PPX1 gene under the trc promoter (pTrcPPX1) to remove as much of the cellular poly(P) as possible. In or an original vector of pTrcPPX1 (pTrcHisB) [10]. this system, there are the following two advantages for Cells were cultured to the mid-logarithmic growth examining the poly(P)-minus phenotype. First, it is pos- phase (OD = 0.4) in LB and starved of nitrogen for 4 h sible to avoid the appearance of the small-colony-size in Mops minimal medium. Cellular poly(P) rapidly variant by using a fresh transformant carrying the PPX1 accumulated within 30 min after starvation and gradu- gene on plasmids, and it is also possible to observe the ally decreased thereafter in pTrcHisB transformants, poly(P)-minus features with good reproducibility. whereas no poly(P) accumulation was observed in a b 100 1300 4 1100 900 3 2 140 10 2 100 Viability, % 1 1 -Galactosidase activity β 50 1 0.1 0 0123456 0 100 200300 400 Incubation time, min Starvation time, min Fig. 1. a) Effect of PPX1 overproduction on heat sensitivity. The wild-type strain KT1008 harbored either the plasmid with the PPX1 gene (pTrcPPX1) (1) or the control vector (pTrcHisB) (2). After cells were incubated at 55°C, the viable cell number was determined by plating onto LB agar. b) Expression of the katE-lacZ operon fusion monitored by β-galactosidase activity [32]. KT1008EL cells (as KT1008 but λRS45 : katE-lacZ) [33] harbored a plasmid or pairs of plasmids as follows: PPX1 gene (pTrcPPX1) (1), control vector for PPX1 (pTrcHisB) (2), a pair of pTrcPPX1 and pBS-rpoS (carrying the rpoS gene) (3) [10] or a pair of pTrcHisB and pBS-rpoS (4). KatE expression was induced by nitrogen starvation with Mops minimal medium [10]. BIOCHEMISTRY (Moscow) Vol. 65 No. 3 2000 NOVEL FUNCTIONS AND APPLICATIONS OF Poly(P) AND PPK 317 pTrcPPX1 transformants [10]. This result clearly ally. First, the effect of poly(P) on rpoS transcription showed that PPX1 overproduction efficiently removes was examined using a lysogen carrying the rpoS-lacZ cellular poly(P). transcriptional fusion gene. KT1008SL (as KT1008 but It was also confirmed that pTrcPPX1 transfor- λRS45 : rpoS-lacZ), which was lysogenyzed by λ carry- mants have the same features as those of the ppk ing the rpoS-lacZ transcriptional fusion gene, harbor- mutant. H2O2 sensitivity of pTrcPPX1 transformants ing either pTrcPPX1 or pTrcHisB (vector) was grown in was almost 10-fold greater than that of control vector LB medium and rpoS transcription was monitored (pTrcHisB) transformants in the wild type. Also, the along the growth curve (Fig. 2) [10]. Vector transfor- heat shock sensitivity of pTrcPPX1 transformants was mants exhibited induction during entry into the station- much higher than that of the control vector transfor- ary phase, and the transcription increased by about 5- mants (Fig. 1a). These characteristics were the same as fold after 12 h of cultivation. In the pTrcPPX1 trans- those of the phenotype of the ppk mutant [7]. Moreover, formants, the transcription increased by only 3-fold in introduction of extra copies of the ppk gene by multiple- stationary phase (12 h of cultivation). These results sug- copy plasmid into PPX1-overproducing cells can over- gest that the induction of rpoS transcription is depend- come this high sensitivity to H2O2, almost restoring ent on cellular poly(P). them to the levels of vector transformants [10]. These The overproduction of certain proteins may have results suggested that the high sensitivity to these stress- unknown effects on such physiological activities of cells es caused by PPX1 overproduction is dependent on the as growth, transcription, and translation. To rule out poly(P) level in cells. the possibility that PPX1 overproduction itself inhibits Intriguingly, the H2O2 sensitivity of pTrcPPX1 gene expression nonspecifically, an inactive PPX1 gene transformants was approximately 1,000-fold greater was overproduced and the effect of the overproduction than that of vector transformants in the katG mutant, on rpoS transcription was examined. pTrc∆PPX1, which whereas, in the katE mutant, the sensitivity of carries a truncated PPX1 gene encoding a PPX1 deletion pTrcPPX1 transformants were only 10-fold greater (DPPX1) protein, was introduced into KT1008SL. than that of vector transformants like wild type cells Poly(P)ase activity of DPPX1 was not detected (data not [10]. This means that the high sensitivity of pTrcPPX1 shown) and both DPPX1 and PPX1 were shown by transformants is caused mainly by the deficiency of the Western blotting to be overproduced at the same levels katE gene products, HPII, since there are only two cata- (Fig.
Load more

Recommended publications
  • Polyphosphate-Dependent Synthesis of ATP and ADP by the Family-2 Polyphosphate Kinases in Bacteria
    Polyphosphate-dependent synthesis of ATP and ADP by the family-2 polyphosphate kinases in bacteria Boguslaw Noceka, Samvel Kochinyanb, Michael Proudfootb, Greg Brownb, Elena Evdokimovaa,b, Jerzy Osipiuka, Aled M. Edwardsa,b, Alexei Savchenkoa,b, Andrzej Joachimiaka,c,1, and Alexander F. Yakuninb,1 aMidwest Center for Structural Genomics and Structural Biology Center, Department of Biosciences, Argonne National Laboratory, 9700 South Cass Avenue, Building 202, Argonne, IL 60439; bBanting and Best Department of Medical Research, University of Toronto, Toronto, ON, Canada M5G 1L6; and cDepartment of Biochemistry and Molecular Biology, University of Chicago, 920 East 58th Street, Chicago, IL 60637 Edited by Robert Haselkorn, University of Chicago, Chicago, IL, and approved September 30, 2008 (received for review August 1, 2008) Inorganic polyphosphate (polyP) is a linear polymer of tens or hun- exopolysaccharide essential for the virulence of P. aeruginosa (12). dreds of phosphate residues linked by high-energy bonds. It is found In the social slime mold Dictyostelium discoideum, a different PPK in all organisms and has been proposed to serve as an energy source was found (DdPPK2) with sequence and properties similar to that in a pre-ATP world. This ubiquitous and abundant biopolymer plays of actin-related proteins (Arps) (14). DdPPK2 is a complex of 3 numerous and vital roles in metabolism and regulation in prokaryotes Arps (Arp1, Arp2, and Arpx) and resembles the actin family in and eukaryotes, but the underlying molecular mechanisms for most molecular weight, sequence, and filamentous structure. Remark- activities of polyP remain unknown. In prokaryotes, the synthesis and ably, DdPPK2 can polymerize into an actin-like filament concurrent utilization of polyP are catalyzed by 2 families of polyP kinases, PPK1 with the synthesis of polyP (14).
    [Show full text]
  • Nucleotide Sequence and Analysis of the 58.3 to 65.5-Kb Early Region of Bacteriophage T4
    Volume 14 Number 21 1986 Nucleic Acids Research Nucleotide sequence and analysis of the 58.3 to 65.5-kb early region of bacteriophage T4 Kristoffer Valerie 13.4, John Stevens', Mark Lynch'5, Earl E.Henderson12 and Jon K.de Riel1 'Fels Research Institute, and 2Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, PA 19140, USA and 3Department of Biochemistry and Biotechnology, Royal Institute of Technology, S-100 44 Stockholm, Sweden Received 21 July 1986; Revised and Accepted 30 September 1986 ABSTRACT The complete 7.2-kb nucleotide sequence from the 58.3 to 65.5-kb early region of bacteriophage T4 has been determined by Maxam and Gilbert sequencing. Computer analysis revealed at least 20 open reading frames (ORFs) within this sequence. All major ORFs are transcribed from the left strand, suggesting that they are expressed early during infection. Among the ORFs, we have identified the pIIII, II, denV and tk genes. The ORFs are very tightly spaced, even over Lapping in some instances, and when ORF interspacing occurs, promoter-like sequences can be implicated. Several of the sequences preceding the ORFs, in particular those at ipIII, ipII, denV, and orf6l.9, can potentially form stable stem-loop structures. INTRODUCTION Recently, considerable progress has been made studying the bacteriophage T4 genome at the molecular level due to the development of T4 strains with unmod- ified DNA suitable for digestion with restriction endonucleases (1). Many T4 genes have since been cloned, sequenced, and their gene products overproduced in Escherichia coli (for review see ref. 2). A majority of the T4 genes studied so far have been essential and non-essential genes with well-characterized pheno- types.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Electrophoretic Variation in Adenylate Kinase Ofneisseria
    Proc. Natl. Acad. Sci. USA Vol. 92, pp. 10535-10539, November 1995 Genetics Electrophoretic variation in adenylate kinase of Neisseria meningitidis is due to inter- and intraspecies recombination (natural transformation/linkage disequilibrium/mosaic genes/multilocus enzyme electrophoresis/nonclonal population structure) EDWARD FEIL, GILL CARPENTER, AND BRIAN G. SPRATT* Molecular Microbiology Group, School of Biological Sciences, University of Sussex, Falmer, Brighton BN1 9QG, United Kingdom Communicated by John Maynard Smith, University of Sussex, Falmer, Brighton, United Kingdom, August 7, 1995 ABSTRACT In prokaryotic and eukaryotic organisms, their growth cycles and the availability of this mechanism of the electrophoretic variation in housekeeping enzymes from genetic exchange appears to have a profound effect on their natural populations is assumed to have arisen by the accu- evolution and population biology (3, 13-17). mulation of stochastic predominantly neutral mutations. In Caugant et al. (18) carried out an extensive MLEE survey of the naturally transformable bacterium Neisseria meningitidis, meningococci, analyzing variation at 15 enzyme loci in 688 we show that variation in the electrophoretic mobility of isolates recovered predominantly from patients with invasive adenylate kinase is due to inter- and intraspecies recombina- disease. Although the results from this survey appeared to tion rather than mutation. The nucleotide sequences of the imply relatively high levels of linkage disequilibrium, it has adenylate kinase gene (adk) from isolates that express the been pointed out (3, 17) that artificially high levels of linkage predominant slow electrophoretic variant were rather uni- disequilibrium may result from sampling bias, in this case form, differing in sequence at an average of 1.1% of nucleotide through the disproportionately high frequency in the data set sites.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • B Number Gene Name Mrna Intensity Mrna
    sample) total list predicted B number Gene name assignment mRNA present mRNA intensity Gene description Protein detected - Membrane protein membrane sample detected (total list) Proteins detected - Functional category # of tryptic peptides # of tryptic peptides # of tryptic peptides detected (membrane b0002 thrA 13624 P 39 P 18 P(m) 2 aspartokinase I, homoserine dehydrogenase I Metabolism of small molecules b0003 thrB 6781 P 9 P 3 0 homoserine kinase Metabolism of small molecules b0004 thrC 15039 P 18 P 10 0 threonine synthase Metabolism of small molecules b0008 talB 20561 P 20 P 13 0 transaldolase B Metabolism of small molecules chaperone Hsp70; DNA biosynthesis; autoregulated heat shock b0014 dnaK 13283 P 32 P 23 0 proteins Cell processes b0015 dnaJ 4492 P 13 P 4 P(m) 1 chaperone with DnaK; heat shock protein Cell processes b0029 lytB 1331 P 16 P 2 0 control of stringent response; involved in penicillin tolerance Global functions b0032 carA 9312 P 14 P 8 0 carbamoyl-phosphate synthetase, glutamine (small) subunit Metabolism of small molecules b0033 carB 7656 P 48 P 17 0 carbamoyl-phosphate synthase large subunit Metabolism of small molecules b0048 folA 1588 P 7 P 1 0 dihydrofolate reductase type I; trimethoprim resistance Metabolism of small molecules peptidyl-prolyl cis-trans isomerase (PPIase), involved in maturation of b0053 surA 3825 P 19 P 4 P(m) 1 GenProt outer membrane proteins (1st module) Cell processes b0054 imp 2737 P 42 P 5 P(m) 5 GenProt organic solvent tolerance Cell processes b0071 leuD 4770 P 10 P 9 0 isopropylmalate
    [Show full text]
  • The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose
    Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota.
    [Show full text]
  • Blueprint Genetics ADK Single Gene Test
    ADK single gene test Test code: S02595 Phenotype information Hypermethioninemia due to adenosine kinase deficiency Alternative gene names AK Panels that include the ADK gene Comprehensive Metabolism Panel Organic Acidemia/Aciduria & Cobalamin Deficiency Panel Test Strengths The strengths of this test include: CAP accredited laboratory CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance Careful construction of clinically effective and scientifically justified gene panels Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level Our publicly available analytic validation demonstrating complete details of test performance ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this test’) Our rigorous variant classification scheme Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data Our comprehensive clinical statements Test Limitations This test does not detect the following: Complex inversions Gene conversions Balanced translocations Mitochondrial DNA variants Repeat expansion disorders unless specifically mentioned Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above non-coding variants covered by the test). This test may not reliably detect the following: Low level mosaicism (variant with a minor allele fraction of 14.6% is detected with 90% probability) Stretches of mononucleotide repeats Indels larger than 50bp Single exon deletions or duplications https://blueprintgenetics.com/ Variants within pseudogene regions/duplicated segments The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
    [Show full text]
  • Substrate Recognition and Mechanism Revealed by Ligand-Bound Polyphosphate Kinase 2 Structures
    Substrate recognition and mechanism revealed by ligand-bound polyphosphate kinase 2 structures Alice E. Parnella,1, Silja Mordhorstb,1, Florian Kemperc, Mariacarmela Giurrandinoa, Josh P. Princea, Nikola J. Schwarzerc, Alexandre Hoferd, Daniel Wohlwendc, Henning J. Jessend,e, Stefan Gerhardtc, Oliver Einslec,f, Petra C. F. Oystong,h, Jennifer N. Andexerb,2, and Peter L. Roacha,g,2 aChemistry, University of Southampton, Southampton, Hampshire SO17 1BJ, United Kingdom; bInstitute of Pharmaceutical Sciences, Albert-Ludwigs- University Freiburg, 79104 Freiburg, Germany; cInstitute of Biochemistry, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany; dOrganic Chemistry Institute, University of Zürich, 8057 Zürich, Switzerland; eInstitute of Organic Chemistry, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany; fBioss Centre for Biological Signalling Studies, Albert-Ludwigs-University Freiburg, 79104 Freiburg, Germany; gInstitute for Life Sciences, University of Southampton, Southampton, Hampshire SO17 1BJ, United Kingdom; and hBiomedical Sciences, Defence Science and Technology Laboratory Porton Down, SP4 0JQ Salisbury, United Kingdom Edited by David Avram Sanders, Purdue University, West Lafayette, IN, and accepted by Editorial Board Member Gregory A. Petsko February 13, 2018 (received for review June 20, 2017) Inorganic polyphosphate is a ubiquitous, linear biopolymer built of mechanism is proposed to proceed via a phosphorylated enzyme up to thousands of phosphate residues that are linked by energy- intermediate (8), which
    [Show full text]
  • The Metabolic Building Blocks of a Minimal Cell Supplementary
    The metabolic building blocks of a minimal cell Mariana Reyes-Prieto, Rosario Gil, Mercè Llabrés, Pere Palmer and Andrés Moya Supplementary material. Table S1. List of enzymes and reactions modified from Gabaldon et. al. (2007). n.i.: non identified. E.C. Name Reaction Gil et. al. 2004 Glass et. al. 2006 number 2.7.1.69 phosphotransferase system glc + pep → g6p + pyr PTS MG041, 069, 429 5.3.1.9 glucose-6-phosphate isomerase g6p ↔ f6p PGI MG111 2.7.1.11 6-phosphofructokinase f6p + atp → fbp + adp PFK MG215 4.1.2.13 fructose-1,6-bisphosphate aldolase fbp ↔ gdp + dhp FBA MG023 5.3.1.1 triose-phosphate isomerase gdp ↔ dhp TPI MG431 glyceraldehyde-3-phosphate gdp + nad + p ↔ bpg + 1.2.1.12 GAP MG301 dehydrogenase nadh 2.7.2.3 phosphoglycerate kinase bpg + adp ↔ 3pg + atp PGK MG300 5.4.2.1 phosphoglycerate mutase 3pg ↔ 2pg GPM MG430 4.2.1.11 enolase 2pg ↔ pep ENO MG407 2.7.1.40 pyruvate kinase pep + adp → pyr + atp PYK MG216 1.1.1.27 lactate dehydrogenase pyr + nadh ↔ lac + nad LDH MG460 1.1.1.94 sn-glycerol-3-phosphate dehydrogenase dhp + nadh → g3p + nad GPS n.i. 2.3.1.15 sn-glycerol-3-phosphate acyltransferase g3p + pal → mag PLSb n.i. 2.3.1.51 1-acyl-sn-glycerol-3-phosphate mag + pal → dag PLSc MG212 acyltransferase 2.7.7.41 phosphatidate cytidyltransferase dag + ctp → cdp-dag + pp CDS MG437 cdp-dag + ser → pser + 2.7.8.8 phosphatidylserine synthase PSS n.i. cmp 4.1.1.65 phosphatidylserine decarboxylase pser → peta PSD n.i.
    [Show full text]
  • The Target Landscape of N4-Hydroxycytidine Based on Its Chemical Neighborhood Jordi Mestres*
    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.30.016485; this version posted April 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. The target landscape of N4-hydroxycytidine based on its chemical neighborhood Jordi Mestres* Research Group on Systems Pharmacology, Research Program on Biomedical Informatics (GRIB), IMIM Hospital del Mar Medical Research Institute and University Pompeu Fabra, Parc de Recerca Biomedica (PRBB), Doctor Aiguader 88, 08003 Barcelona, Catalonia, Spain; and Chemotargets SL, Parc Cientific de Barcelona (PCB), Baldiri Reixac 4, 08028 Barcelona, Catalonia, Spain Abstract N4-hydroxycytidine (NHC) has been recently reported to have promising antiviral activity against SARS-CoV-2. To join worldwide efforts in identifying potential drug targets against this pandemic, the target landscape of NHC was defined by extracting all known targets of its chemical neighborhood, including drugs, analogues, and metabolites, and by performing target predictions from two independent platforms, following the recent Public Health Assessment via Structural Evaluation (PHASE) protocol. The analysis provides a list of over 30 protein targets that could be useful in future design activities of new COVID-19 antivirals. The relevance for existing drugs within the same chemical space, such as remdesivir, is also discussed. * Email: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.03.30.016485; this version posted April 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • NIPRO Enzymes
    Thermostable Enzymes for Clinical Chemistry NIPRO Enzymes From Zymomonas mobilis ALCOHOL DEHYDROGENASE (ZM-ADH) GLUCOKINASE (ZM-GlcK) GLUCOSE-6-PHOSPHATE DEHYDROGENASE (ZM-G6PDH) From Bacillus stearothermophilus ACETATE KINASE (AK) ADENYLATE KINASE (AdK) ALANINE DEHYDROGENASE (AlaDH) ALANINE RACEMASE (AlaR) DIAPHORASE Ⅰ [EC 1.6.99.-] (Di-1) GLUCOKINASE (GlcK) α-GLUCOSIDASE (α-Glu) LEUCINE DEHYDROGENASE (LeuDH) PHOSPHOFRUCTOKINASE (PFK) PHOSPHOGLUCOSE ISOMERASE (PGI) PHOSPHOTRANSACETYLASE (PTA) POLYNUCLEOTIDE PHOSPHORYLASE (PNPase) PYRUVATE KINASE (PK) SUPEROXIDE DISMUTASE (SOD) From Others DIAPHORASE22 (Di-22) GALACTOSE DEHYDROGENASE (GalDH) GLUCOKINASE2 (GlcK2) GLUCOSE DEHYDROGENASE (GlcDH2) D-LACTATE DEHYDROGENASE (D-LDH) MALATE DEHYDROGENASE (MDH) MUTAROTASE (MRO) PHENYLALANINE DEHYDROGENASE (PheDH) 6-PHOSPHOGLUCONATE DEHYDROGENASE (6PGDH) SORBITOL DEHYDROGENASE (SorDH) ご照会は下記へお願い申し上げます。 For more information, please contact ニプロ株式会社 NIPRO CORPORATION 本 社/〒531-8510 大阪市北区本庄西3丁目9番3号 3-9-3,Honjo-Nishi,Kita-ku Tel (06)6373-3168 Osaka 531-8510 Japan Phone +81 6 6373 3168 e-mail : [email protected] Fax +81 6 6373 8978 http://www.nipro.co.jp/ja/ Bacillus stearothermophilus is used as a synonym of Geobacillus stearothermophilus . 2016.04 Ｑｕａｌｉｔｙ The Quality Management System of Uji Factory, NIPRO Corp. has been certified as to meet the requirements of ISO9001 in the scope of The Development and Production of Enzymes for Analytical Reagents and Industrial Use by JAPAN CHEMICAL QUALITY ASSURANCE LTD. ISO9001 ニプロ株式会社 国内事業部 宇治工場 NIPRO ENZYMES ALCOHOL DEHYDROGENASE (ZM-ADH) [EC 1 .1 .1 .1] from Zymomonas mobilis Alcohol + NAD+ ↔ Aldehyde + NADH + H+ SPECIFICATION State : Lyophilized Specific activity : more than 400 U/mg protein Contaminants : (as ZM-ADH activity = 100 %) Glucose-6-phosphate dehydrogenase < 0.10 % Glucokinase < 0.02 % Pyruvate kinase < 0.02 % NADH oxidase < 0.01 % Lactate dehydrogenase < 0.01 % PROPERTIES Molecular weight : ca.
    [Show full text]