DOCSLIB.ORG

Differential Processing of Leading- and Lagging-Strand Ends at Saccharomyces Cerevisiae Telomeres Revealed by the Absence of Rad27p Nuclease

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Differential Processing of Leading- and Lagging-Strand Ends at Saccharomyces Cerevisiae Telomeres Revealed by the Absence of Rad27p Nuclease Copyright 2002 by the Genetics Society of America Differential Processing of Leading- and Lagging-Strand Ends at Saccharomyces cerevisiae Telomeres Revealed by the Absence of Rad27p Nuclease Julie Parenteau and Raymund J. Wellinger1 De´partement de Microbiologie et Infectiologie, Faculte´ de Me´decine, Universite´ de Sherbooke, Sherbooke, Quebec J1H 5N4, Canada Manuscript received May 28, 2002 Accepted for publication September 16, 2002 ABSTRACT Saccharomyces cerevisiae strains lacking the Rad27p nuclease, a homolog of the mammalian FEN-1 protein, display an accumulation of extensive single-stranded G-tails at telomeres. Furthermore, the lengths of telomeric repeats become very heterogeneous. These phenotypes could be the result of aberrant Okazaki fragment processing of the C-rich strand, elongation of the G-rich strand by telomerase, or an abnormally high activity of the nucleolytic activities required to process leading-strand ends. To distinguish among these possibilities, we analyzed strains carrying a deletion of the RAD27 gene and also lacking genes required for in vivo telomerase activity. The results show that double-mutant strains died more rapidly than strains lacking only telomerase components. Furthermore, in such strains there is a significant reduction in the signals for G-tails as compared to those detected in rad27⌬ cells. The results from studies of the replication intermediates of a linear plasmid in rad27⌬ cells are consistent with the idea that only one end of the plasmid acquires extensive G-tails, presumably the end made by lagging-strand synthesis. These data further support the notion that chromosome ends have differential requirements for end processing, depending on whether the ends were replicated by leading- or lagging-strand synthesis. ELOMERES, the complex nucleoprotein struc- species, G-tails are much shorter (14–16 bases) and in Ttures at the ends of eukaryotic chromosomes, are yeast, a similarly short overhang is suspected to be pres- essential for chromosome integrity: they protect chro- ent (Wellinger and Sen 1997). However, the length mosome ends from degradation and random fusion of the G-tails is subject to variation during the cell cycle. events (McClintock 1941; Sandell and Zakian 1993), For example, yeast telomeres acquire a transient Ն30- and they ensure the complete replication of the chromo- base G-tail specifically during S-phase, when the telo- somal DNA (Watson 1972; Greider 1996; Zakian meres are replicated (Wellinger et al. 1993b, 1996). 1996). Telomeric DNA is composed of short, direct re- Although there is mounting evidence that conven- peats in the majority of eukaryotic species (Wellinger tional DNA replication and the specialized replication and Sen 1997). For example, vertebrate telomeric re- to maintain telomeric repeats are interrelated, little is peats can be abbreviated as C3TA2/T2AG3 and, in Saccha- known about mechanistic details of how this coordina- romyces cerevisiae, chromosomes end in 300 bp of a het- tion is achieved (Price 1997; Diede and Gottschling erogeneous repeat sequence that can be abbreviated as 1999; Adams Martin et al. 2000). All conventional DNA C1–3A/TG1–3 (Shampay et al. 1984; Moyzis et al. 1988). polymerases need a primer, usually in the form of RNA, Virtually all telomeric-repeat sequences are similar in and synthesize DNA in the 5Ј → 3Ј direction (reviewed that they contain clusters of G residues in the strand in Waga and Stillman 1998). Given these properties, Ј Ј running 5 –3 from the centromere toward the physical conventional replication is expected to leave at least end of the DNA molecule (the G-rich strand; Wel- primer-sized gaps on the 5Ј end of the new strands that linger and Sen 1997). Most of the telomeric-repeat were made by lagging-strand synthesis, but also to be DNA is duplex and, in general, at the very ends of the able to completely copy the C-rich strands on the lead- chromosomes the G-rich strand protrudes into the C-rich ing-strand ends (Olovnikov 1973; reviewed in Zakian strand by a variable number of nucleotides, depending 1995). The incurring losses of terminal sequences are on the species. For vertebrate chromosomes, this G-rich counteracted by telomerase, a telomere-specific reverse strand overhang (hereafter called G-tail) may span 50– transcriptase, which uses its RNA component as a tem- 150 bases (Makarov et al. 1997; McElligott and Wel- plate for addition of new telomeric repeats of the G-rich linger 1997; Wright et al. 1997). In certain ciliate strand onto chromosome ends (reviewed in Greider 1995; Lingner and Cech 1998; Nakamura and Cech 1998). Thus, the particularities of chromosome end rep- 1Corresponding author: De´partement de Microbiologie et Infectiolo- lication entail a specialized enzyme for new leading- gie, Faculte´ de Me´decine, Universite´ de Sherbooke, 3001 12 Ave. Nord, Sherbooke, Quebec J1H 5N4, Canada. strand synthesis (telomerase) and for continued lag- E-mail: [email protected] ging-strand synthesis and a mechanism to convert the Genetics 162: 1583–1594 (December 2002) 1584 J. Parenteau and R. J. Wellinger blunt ends created at the leading-strand ends into ends Rad27p in yeast cells should result in an accelerated with a G-tail. Previous evidence suggested a model in loss of telomeric repeats. Indeed, we observe that cells which a strand-specific 5Ј–3Ј exonuclease generated a with a deletion of RAD27 and lacking telomerase compo- G-tail, at least at the leading-strand ends (Wellinger nents are not able to grow for the same number of et al. 1996; Makarov et al. 1997), and this exonuclease generations as cells lacking only telomerase. In addition, could be associated directly with the DNA replication the relative signals for G-tails on telomeres derived from machinery (Dionne and Wellinger 1998). In light of the double-mutant strains were significantly higher than all of the above, it is not surprising that some compo- those from wild type or telomerase-lacking strains. nents of the conventional replication machinery appear These data suggest that in telomeric DNA, an absence to be involved in the control of telomere length (Car- of Rad27p results primarily in incomplete synthesis of son and Hartwell 1985; Adams and Holm 1996; the C-rich strands, generating an excess of G-tails. These Diede and Gottschling 1999; Parenteau and Wel- G-tails may then be further elongated in a telomerase- linger 1999; Adams Martin et al. 2000). Among them dependent fashion. The analyses of replication interme- is the yeast Rad27p protein, a homolog of the mamma- diates of a linear plasmid derived from rad27⌬ cells lian FEN-1 protein (flap endonuclease 1, or 5Ј-exo- further corroborate this conclusion in that they suggest nuclease 1; Harrington and Lieber 1994a,b). Deletion that excess G-tails occur on only one end of the plasmid, of RAD27 in yeast results in several distinct phenotypes, presumably the end replicated by lagging-strand synthe- including a temperature-sensitive growth defect (Reagan sis. We interpret these data to support the notion that et al. 1995; Sommers et al. 1995), an elevated spontane- chromosomal ends are processed differently, depending ous mutation rate (Tishkoff et al. 1997), high levels of on whether the newly synthesized strand on a particular instability of micro- and minisatellite sequences (John- end was generated by leading- or lagging-strand synthe- son et al. 1995; Freudenreich et al. 1998; Kokoska et al. sis (Bailey et al. 2001). 1998; Schweitzer and Livingston 1998; Spiro et al. 1999), and sensitivity to alkylating agents like methyl methanesulfonate (Reagan et al. 1995). These identi- MATERIALS AND METHODS fied phenotypes suggest functions for Rad27p in DNA Strains and plasmids: Yeast strains used in this study are replication and repair (Tishkoff et al. 1997; Kokoska listed in Table 1. UCC3535 (gift of M. Singer and D. Gottsch- et al. 1998), and in particular, they are consistent with a ling; Wellinger et al. 1996) was transformed with the 2.3-kb ⌬ proposed role of Rad27p in the removal of RNA primers EcoRI-SphI fragment of pMRrad27 ::URA3 (obtained from E. Friedberg and M. Reagan; Reagan et al. 1995) to delete the during the processing of Okazaki fragments (Bae et al. RAD27 gene. The resulting strain was named RWY20. The 2001). Moreover, yeast cells carrying a deletion of haploids JPY204c and JPY206b were obtained after sporulation RAD27 also display a high degree of telomeric-repeat and dissection of spore tetrads of RWY20. RWY25 diploid instability (Parenteau and Wellinger 1999). How- strain was obtained by mating JPY204c and JPY206b. RWY26 ever, at the telomeres, not only overall telomere repeat was generated by transformation of the RWY25 strain with the 2.7-kb BamHI-SphI fragment of pVL152 (Lundblad and length, but also the particular DNA end structure is Szostak 1989; kindly provided by V. Lundblad) to delete the affected (Parenteau and Wellinger 1999). When cul- EST1 gene. The entire coding region of the EST3 gene was tures are incubated at the nonpermissive temperature replaced by the HIS3 gene in strain RWY25 to yield strain for rad27⌬ cells, an appearance of an abnormally large RWY27. The est3 deletion fragment was generated by using amount of G-tails can be detected (Parenteau and plasmid pRS303 (Sikorski and Hieter 1989) and the follow- ing PCR deletion primers: EST3D-F, 5Ј-ATGCCGAAAGTAAT Wellinger 1999). Since the C1–3A strand at the end of TCTGGAGTCTCATTCAAAGCCAACAGAGATTGTACTGAG chromosomes is synthesized by lagging-strand synthesis AGTGCAC-3Ј and EST3D-R, 5Ј-GTCATAAATATTTATATAC (reviewed in Price 1997), these results suggested a spe- AAATGGGAAAGTACTTAACGACTGTGCGGTATTTCACA cific defect for synthesizing the C-rich strand in rad27⌬ CCG-3Ј (the underlined bases are complementary to pRS plas- cells. Alternatively, it remained possible that the genera- mids). The resulting colonies of these three transformations ⌬ were monitored for deletion on one allele by Southern analysis tion of the excess G-tails in rad27 cells was due to an (data not shown).
Load more

Recommended publications
  • Teacher Notes Science Nspired
    DNA Replication TEACHER NOTES SCIENCE NSPIRED Science Objectives In this lesson, students will • Explore how the structure of DNA supports its semi-conservative replication • Identify the name and function of several key enzymes in DNA replication • Recognize the function of Okazaki fragments in DNA replication Vocabulary TI-Nspire™ Technology Skills: • Double helix • Leading strand • Download a TI-Nspire • Lagging strand • Polymerase I • Polymerase III • Helicase document • Base pairs • Okazaki Fragments • Open a document • Primase • Move between pages • Open Directions Box About the Lesson • Explore ‘Hot Spots’ • Using three simulations, students will interact with DNA replication to explore semi-conservative replication and identify Tech Tips: specific enzymes and their roles in replication. Assessments are Make sure that students know embedded in the activity to engage discussion and gauge how to move between pages by learning. pressing /¡ (left arrow) and • As a result, students will: /¢ (right arrow). • Learn the basic functions of the following DNA replication enzymes: helicase, primase, ligase, polymerase I and III. Lesson Materials: • Learn how the double helix reproduces in a semi- Student Activity • DNA_Replication_Student.do conservative fashion c • Learn the role and function of Okazaki fragments in • DNA_Replication_Student.pd replication of the lagging strand. f TI-Nspire document TI-Nspire™ Navigator™ • DNA_Replication.tns Not required. If using Navigator: • Send out the DNA_Replication.tns file. • Monitor student progress
    [Show full text]
  • DNA Structure and Replication Three Key Features Needed for Any Model
    DNA structure and replication What was known? 1) Hereditary factors were associated with specific traits 2) One-gene-one-protein model - from mapping genes for biosynthetic pathways 3) Genes are on chromosomes 4) Chromosomes are made up of DNA and protein Three key features needed for any model of DNA structure 1) Must allow for faithful replication 2) Must have information content 3) Must be able to change in order to explain mutations 1 Rosalind Franklin James Watson Francis Crick X-ray diffraction Maurice Wilkins Photograph of B-DNA Linus Pauling Nature 171, 737-738 (1953) © Macmillan Publishers Ltd. Molecular structure of Nucleic Acids WATSON, J. D. & CRICK, F. H. C. Features of the double helix A Structure for Deoxyribose Nucleic Acid 1) Two parallel strands We wish to suggest a structure for the salt of deoxyribose nucleic acid (D.N.A.). This structure has novel features which are of considerable biological interest………… 2) Bases held together by H-bonds 3) Phosphodiester backbone 4) The base is attached to the position 1 on the sugar 5) Base pair stack - provides Figure 1. This figure is purely diagrammatic. The two ribbons symbolize the two phophate-sugar chains, and the horizonal rods stability the pairs of bases holding the chains together. The vertical line marks the fibre axis. 6) Contains a major and …………….It has not escaped our notice that the specific pairing we minor groove have postulated immediately suggests a possible copying mechanism for the genetic material. Three key features needed for any model of DNA structure
    [Show full text]
  • Processivity of DNA Polymerases: Two Mechanisms, One Goal Zvi Kelman1*, Jerard Hurwitz1 and Mike O’Donnell2
    Minireview 121 Processivity of DNA polymerases: two mechanisms, one goal Zvi Kelman1*, Jerard Hurwitz1 and Mike O’Donnell2 Replicative DNA polymerases are highly processive Processive DNA synthesis by cellular replicases and the enzymes that polymerize thousands of nucleotides without bacteriophage T4 replicase dissociating from the DNA template. The recently Until recently, the only mechanism for high processivity determined structure of the Escherichia coli bacteriophage that was understood in detail was that utilized by cellular T7 DNA polymerase suggests a unique mechanism that replicases and the replicase of bacteriophage T4. This underlies processivity, and this mechanism may generalize mechanism involves a ring-shaped protein called a ‘DNA to other replicative polymerases. sliding clamp’ that encircles the DNA and tethers the polymerase catalytic unit to the DNA [3,4]. The three- Addresses: 1Department of Molecular Biology, Memorial Sloan- dimensional structures of several sliding clamps have been Kettering Cancer Center, 1275 York Avenue, New York, NY 10021, 2 determined: the eukaryotic proliferating cell nuclear USA and Laboratory of DNA Replication, Howard Hughes Medical β Institute, The Rockefeller University, 1230 York Avenue, New York, NY antigen (PCNA) [5,6]; the subunit of the prokaryotic 10021, USA. DNA polymerase III [7]; and the bacteriophage T4 gene 45 protein (gp45) (J Kuriyan, personal communication) *Corresponding author. (Figure 1). The overall structure of these clamps is very E-mail: [email protected] similar; the PCNA, β subunit and gp45 rings are super- Structure 15 February 1998, 6:121–125 imposable [8]. Each ring has similar dimensions and a http://biomednet.com/elecref/0969212600600121 central cavity large enough to accommodate duplex DNA (Figure 1).
    [Show full text]
  • Primer Release Is the Rate-Limiting Event in Lagging-Strand Synthesis
    Primer release is the rate-limiting event in lagging- strand synthesis mediated by the T7 replisome Alfredo J. Hernandeza, Seung-Joo Leea, and Charles C. Richardsona,1 aDepartment of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115 Contributed by Charles C. Richardson, April 18, 2016 (sent for review December 30, 2015; reviewed by Nicholas E. Dixon and I. Robert Lehman) DNA replication occurs semidiscontinuously due to the antiparallel but also for enabling the use of short oligoribonucleotides by T7 DNA strands and polarity of enzymatic DNA synthesis. Although DNA polymerase. Critically, the primase domain also fulfills two the leading strand is synthesized continuously, the lagging strand additional roles apart from primer synthesis: it prevents disso- is synthesized in small segments designated Okazaki fragments. ciation of the extremely short tetramer, stabilizing it with the Lagging-strand synthesis is a complex event requiring repeated template, and it secures it in the polymerase active site (10, 12). cycles of RNA primer synthesis, transfer to the lagging-strand Here we show that the rate-limiting step in initiation of Okazaki polymerase, and extension effected by cooperation between DNA fragments by the T7 replisome is primer release from the primase primase and the lagging-strand polymerase. We examined events domain of gp4. In the absence of gp2.5, an additional step, distinct controlling Okazaki fragment initiation using the bacteriophage from primer release, also limits primer extension. The presence of T7 replication system. Primer utilization by T7 DNA polymerase is gp2.5 promotes efficient primer formation and primer utilization. slower than primer formation.
    [Show full text]
  • Junction Ribonuclease: an Activity in Okazaki Fragment Processing
    Proc. Natl. Acad. Sci. USA Vol. 95, pp. 2244–2249, March 1998 Biochemistry Junction ribonuclease: An activity in Okazaki fragment processing RICHARD S. MURANTE,LEIGH A. HENRICKSEN, AND ROBERT A. BAMBARA* Department of Biochemistry and Biophysics, and Cancer Center, Box 712, University of Rochester School of Medicine and Dentistry, 601 Elmwood Avenue, Rochester, NY 14642 Communicated by I. Robert Lehman, Stanford University School of Medicine, Stanford, CA, December 29, 1997 (received for review September 15, 1997) ABSTRACT The initiator RNAs of mammalian Okazaki and removal of RNA primers. Reconstitution assays with both fragments are thought to be removed by RNase HI and the mouse cell and SV40 replication proteins require RNase HI for 5*-3* flap endonuclease (FEN1). Earlier evidence indicated the maturation of lagging strands in vitro (12, 13). that the cleavage site of RNase HI is 5* of the last ribonucle- Although cleavage of long RNAyDNA hybrids is random, otide at the RNA-DNA junction on an Okazaki substrate. In cleavage of certain substrates is clearly structure specific. Eder current work, highly purified calf RNase HI makes this exact et al. (16) found that when a series of ribonucleotides were cleavage in Okazaki fragments containing mismatches that followed by a 39 DNA segment and annealed to DNA to form distort the hybrid structure of the heteroduplex. Furthermore, a duplex, human RNase HI preferentially cleaved to leave a even fully unannealed Okazaki fragments were cleaved. DNA segment with a 59 monoribonucleotide. In reactions Clearly, the enzyme recognizes the transition from RNA to reconstituting Okazaki fragment processing, RNase HI from DNA on a single-stranded substrate and not the RNAyDNA calf thymus similarly cleaved the RNA-DNA strand 59 to the heteroduplex structure.
    [Show full text]
  • DNA Polymerases at the Eukaryotic Replication Fork Thirty Years After: Connection to Cancer
    cancers Review DNA Polymerases at the Eukaryotic Replication Fork Thirty Years after: Connection to Cancer Youri I. Pavlov 1,2,* , Anna S. Zhuk 3 and Elena I. Stepchenkova 2,4 1 Eppley Institute for Research in Cancer and Allied Diseases and Buffett Cancer Center, University of Nebraska Medical Center, Omaha, NE 68198, USA 2 Department of Genetics and Biotechnology, Saint-Petersburg State University, 199034 Saint Petersburg, Russia; [email protected] 3 International Laboratory of Computer Technologies, ITMO University, 197101 Saint Petersburg, Russia; [email protected] 4 Laboratory of Mutagenesis and Genetic Toxicology, Vavilov Institute of General Genetics, Saint-Petersburg Branch, Russian Academy of Sciences, 199034 Saint Petersburg, Russia * Correspondence: [email protected] Received: 30 September 2020; Accepted: 13 November 2020; Published: 24 November 2020 Simple Summary: The etiology of cancer is linked to the occurrence of mutations during the reduplication of genetic material. Mutations leading to low replication fidelity are the culprits of many hereditary and sporadic cancers. The archetype of the current model of replication fork was proposed 30 years ago. In the sequel to our 2010 review with the words “years after” in the title inspired by A. Dumas’s novels, we go over new developments in the DNA replication field and analyze how they help elucidate the effects of the genetic variants of DNA polymerases on cancer. Abstract: Recent studies on tumor genomes revealed that mutations in genes of replicative DNA polymerases cause a predisposition for cancer by increasing genome instability. The past 10 years have uncovered exciting details about the structure and function of replicative DNA polymerases and the replication fork organization.
    [Show full text]
  • Plasmid Replication-Associated Single-Strand-Specific
    12858–12873 Nucleic Acids Research, 2020, Vol. 48, No. 22 Published online 3 December 2020 doi: 10.1093/nar/gkaa1163 Plasmid replication-associated single-strand-specific methyltransferases Alexey Fomenkov 1,*, Zhiyi Sun1, Iain A. Murray 1, Cristian Ruse1, Colleen McClung1, Yoshiharu Yamaichi 2, Elisabeth A. Raleigh 1,* and Richard J. Roberts1,* 1New England Biolabs Inc., 240 County Road, Ipswich, MA, USA and 2Universite´ Paris-Saclay, CEA, CNRS, Institute for Integrative Biology of the Cell (I2BC), Gif-sur-Yvette, France Downloaded from https://academic.oup.com/nar/article/48/22/12858/6018438 by guest on 24 September 2021 Received August 06, 2020; Revised November 10, 2020; Editorial Decision November 11, 2020; Accepted November 12, 2020 ABSTRACT RM-associated modification and the diversity of associ- ated functions remains incompletely understood (3). Long- Analysis of genomic DNA from pathogenic strains read, modification-sensitive SMRT sequencing technology of Burkholderia cenocepacia J2315 and Escherichia has facilitated sequencing and assembly of a wide variety coli O104:H4 revealed the presence of two unusual of genomes and also clarified the modification repertoire. MTase genes. Both are plasmid-borne ORFs, carried Detection of the modification status of bases is possible by pBCA072 for B. cenocepacia J2315 and pESBL for for m6A, m4C and oxidized forms of m5C modified bases E. coli O104:H4. Pacific Biosciences SMRT sequenc- (m5hC and 5caC) (4). Recently, high throughput analy- ing was used to investigate DNA methyltransferases sis of 230 diverse bacterial and archaeal methylomes strik- M.BceJIII and M.EcoGIX, using artificial constructs. ingly revealed that almost 50% of organisms harbor Type Mating properties of engineered pESBL derivatives II DNA methyltransferases (MTase) homologs with no ap- were also investigated.
    [Show full text]
  • Review Questions DNA Replication
    Review Questions DNA Replication 1. Explain semi-conservative replication. Prior to cell division, a cell must make a copy of its DNA to pass along to the next generation. Copying DNA is called “replication”. Rather than build a DNA molecule from scratch, the new DNA is composed of one old DNA strand (used as the template) and one brand new strand. “Semi-conservative” means that half of the new DNA molecule is old DNA. 2. How can the speed of DNA replication increase while the rate of replication remains constant? The conundrum of DNA replication is that in humans the replication enzymes can copy at a rate of 50 base pairs per second. That may seem like a fast rate but there are 3.1 billion base pairs in the human genome. At that rate, if the machinery started at one end of the DNA and replicated all the way down to the other end, it would take ~ 2 years to copy one DNA molecule. Replication occurs much faster than that. How? Well, the answer is that DNA replication starts at many places along the molecule. These separate “origins of replication” form “replication bubbles”. Once a bubble forms, replication moves in both directions. These expanding bubbles of replication will eventually meet and the whole genome will be copied in a matter of hours rather than years. 3. Explain the process of DNA replication. Unwinding and Unzipping the Double Helix. The two strands in a DNA molecule are connected by hydrogen bonds between the complementary bases. An enzyme called “helicase” travels along the DNA unwinding and breaking the hydrogen bonds between the two strands.
    [Show full text]
  • Bt6504 – Molecular Biology Question Bank
    JEPPIAAR ENGINEERING COLLEGE B.TECH – BIOTECHNOLOGY (R- 2013) BT6504 – MOLECULAR BIOLOGY III YEAR & V SEM BATCH: 2016-2020 QUESTION BANK PREPARED BY Mr. G. GOMATHI SANKAR G. Gomathi Sankar S.N TOPIC REFER PAGE O ENCE NO UNIT I – CHEMISTRY OF NUCLEIC ACIDS 1 Introduction to nucleic acids TB1 79 2 Nucleic acids as genetic material TB1 79 3 Structure and physicochemical properties of elements in DNA and RNA TB1 80-82 4 Biological significance of differences in DNA and RNA TB1 84-92 5 Primary structure of DNA: Chemical and structural qualities of 3’,5’- TB1 94-96 Phosphodiester bond 6 Secondary Structure of DNA: Watson & Crick model TB1 97-100 7 Chargaff’s rule TB1 109 8 X–ray diffraction analysis of DNA, Forces stabilizes DNA structure TB1 110-112 9 Conformational variants of double helical DNA, Hogsteen base pairing TB1 114 10 Triple helix, Quadruple helix, Reversible denaturation and hyperchromic effect TB1 112-114 11 Tertiary structure of DNA: DNA supercoiling. TB1 148 UNIT II – DNA REPLICATION & REPAIR 1 Overview of Central dogma TB1 208 2 Organization of prokaryotic and eukaryotic chromosomes DNA replication: TB1 209 Meselson & Stahl experiment, bi–directional DNA replication 3 Okazaki fragments TB1 210 4 Proteomics of DNA replication, Fidelity of DNA replication TB1 224-231 5 Inhibitors of DNA replication TB1 232-235 6 Overview of differences in prokaryotic and eukaryotic DNA replication TB1 271-273 7 Telomere replication in eukaryotes TB1 239-246 8 D-loop and rolling circle mode of replication TB1 255-258 9 Mutagens, DNA mutations
    [Show full text]
  • DNA Replication
    DNA replication: • Copying genetic information for transmission to the next generation • Occurs in S phase of cell cycle • Process of DNA duplicating itself • Begins with the unwinding of the double helix to expose the bases in each strand of DNA • Each unpaired nucleotide will attract a complementary nucleotide from the medium – will form base pairing via hydrogen bonding. • Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand. 1 DNA replication: – First question asked was whether duplication was semiconservative or conservative • Meselson and Stahl expt • Semiconservative - – one strand from parent in each new strand • Conservative- – both strands from parent and other is all new strands 2 DNA replication: • Complementary base pairing produces semiconservative replication – Double helix unwinds – Each strand acts as template – Complementary base pairing ensures that T signals addition of A on new strand, and G signals addition of C – Two daughter helices produced after replication 3 4 Experimental proof of semiconservative replication – three possible models • Semiconservative replication – – Watson and Crick model • Conservative replication: – The parental double helix remains intact; – both strands of the daughter double helix are newly synthesized • Dispersive replication: – At completion, both strands of both double helices contain both original and newly synthesized material. 5 6 Meselson-Stahl experiments confirm semiconservative replication • Experiment allowed differentiation of parental and newly formed DNA. • Bacteria were grown in media containing either normal isotope of nitrogen (14N) or the heavy isotope (15N). • DNA banded after equilibrium density gradient centrifugation at a position which matched the density of the DNA: – heavy DNA was at a higher density than normal DNA.
    [Show full text]
  • Single-Molecule Analysis Reveals That the Lagging Strand Increases Replisome Processivity but Slows Replication Fork Progression
    Single-molecule analysis reveals that the lagging strand increases replisome processivity but slows replication fork progression Nina Y. Yao1, Roxana E. Georgescu1, Jeff Finkelstein, and Michael E. O’Donnell2 Howard Hughes Medical Institute, Rockefeller University, 1230 York Avenue, New York, NY 10021 Contributed by Michael E. O’Donnell, June 3, 2009 (sent for review May 14, 2009) Single-molecule techniques are developed to examine mechanistic The current report examines the rate and processivity of the features of individual E. coli replisomes during synthesis of long E. coli replisome. The E. coli replisome consists of the ring DNA molecules. We find that single replisomes exhibit constant shaped hexameric DnaB helicase, DnaG primase, the DNA rates of fork movement, but the rates of different replisomes vary polymerase III* replicase (Pol III*), and ␤ sliding clamps. over a surprisingly wide range. Interestingly, lagging strand syn- Processivity estimates of the E. coli replisome from ensemble thesis decreases the rate of the leading strand, suggesting that studies indicate a lower limit of 50 kb, and an average bulk rate lagging strand operations exert a drag on replication fork progres- of Ϸ500–700 nt/s at 37 °C (6, 7). Processivity measurements from sion. The opposite is true for processivity. The lagging strand other recent single-molecule studies differ over a wide range, significantly increases the processivity of the replisome, possibly from3kbtoϾ80 kb (8, 9). In each of these previous studies reflecting the increased grip to DNA provided by 2 DNA poly- replication was performed in the presence of excess proteins that merases anchored to sliding clamps on both the leading and could replace a replisome protein that dissociates from DNA, lagging strands.
    [Show full text]
  • DNA Replication in Prokaryotes
    392 Chapter 14 | DNA Structure and Function 14.4 | DNA Replication in Prokaryotes By the end of this section, you will be able to do the following: • Explain the process of DNA replication in prokaryotes • Discuss the role of different enzymes and proteins in supporting this process DNA replication has been well studied in prokaryotes primarily because of the small size of the genome and because of the large variety of mutants that are available. E. coli has 4.6 million base pairs in a single circular chromosome and all of it gets replicated in approximately 42 minutes, starting from a single site along the chromosome and proceeding around the circle in both directions. This means that approximately 1000 nucleotides are added per second. Thus, the process is quite rapid and occurs without many mistakes. DNA replication employs a large number of structural proteins and enzymes, each of which plays a critical role during the process. One of the key players is the enzyme DNA polymerase, also known as DNA pol, which adds nucleotides one-by-one to the growing DNA chain that is complementary to the template strand. The addition of nucleotides requires energy; this energy is obtained from the nucleoside triphosphates ATP, GTP, TTP and CTP. Like ATP, the other NTPs (nucleoside triphosphates) are high-energy molecules that can serve both as the source of DNA nucleotides and the source of energy to drive the polymerization. When the bond between the phosphates is “broken,” the energy released is used to form the phosphodiester bond between the incoming nucleotide and the growing chain.
    [Show full text]