Differential Processing of Leading- and Lagging-Strand Ends at Saccharomyces Cerevisiae Telomeres Revealed by the Absence of Rad27p Nuclease

Home , Okazaki fragments

Differential Processing of Leading- and Lagging-Strand Ends at Saccharomyces cerevisiae Telomeres Revealed by the Absence of Rad27p Nuclease

Julie Parenteau and Raymund J. Wellinger1 De´partement de Microbiologie et Infectiologie, Faculte´ de Me´decine, Universite´ de Sherbooke, Sherbooke, Quebec J1H 5N4, Canada Manuscript received May 28, 2002 Accepted for publication September 16, 2002

ABSTRACT Saccharomyces cerevisiae strains lacking the Rad27p nuclease, a homolog of the mammalian FEN-1 protein, display an accumulation of extensive single-stranded G-tails at telomeres. Furthermore, the lengths of telomeric repeats become very heterogeneous. These phenotypes could be the result of aberrant Okazaki fragment processing of the C-rich strand, elongation of the G-rich strand by telomerase, or an abnormally high activity of the nucleolytic activities required to process leading-strand ends. To distinguish among these possibilities, we analyzed strains carrying a deletion of the RAD27 gene and also lacking genes required for in vivo telomerase activity. The results show that double-mutant strains died more rapidly than strains lacking only telomerase components. Furthermore, in such strains there is a signiﬁcant reduction in the signals for G-tails as compared to those detected in rad27⌬ cells. The results from studies of the replication intermediates of a linear plasmid in rad27⌬ cells are consistent with the idea that only one end of the plasmid acquires extensive G-tails, presumably the end made by lagging-strand synthesis. These data further support the notion that chromosome ends have differential requirements for end processing, depending on whether the ends were replicated by leading- or lagging-strand synthesis.

ELOMERES, the complex nucleoprotein struc- species, G-tails are much shorter (14–16 bases) and in Ttures at the ends of eukaryotic chromosomes, are yeast, a similarly short overhang is suspected to be pres- essential for chromosome integrity: they protect chro- ent (Wellinger and Sen 1997). However, the length mosome ends from degradation and random fusion of the G-tails is subject to variation during the cell cycle. events (McClintock 1941; Sandell and Zakian 1993), For example, yeast telomeres acquire a transient Ն30- and they ensure the complete replication of the chromo- base G-tail speciﬁcally during S-phase, when the telo- somal DNA (Watson 1972; Greider 1996; Zakian meres are replicated (Wellinger et al. 1993b, 1996). 1996). Telomeric DNA is composed of short, direct re- Although there is mounting evidence that conven- peats in the majority of eukaryotic species (Wellinger tional DNA replication and the specialized replication and Sen 1997). For example, vertebrate telomeric re- to maintain telomeric repeats are interrelated, little is peats can be abbreviated as C3TA2/T2AG3 and, in Saccha- known about mechanistic details of how this coordina- romyces cerevisiae, chromosomes end in 300 bp of a het- tion is achieved (Price 1997; Diede and Gottschling erogeneous repeat sequence that can be abbreviated as 1999; Adams Martin et al. 2000). All conventional DNA C1–3A/TG1–3 (Shampay et al. 1984; Moyzis et al. 1988). polymerases need a primer, usually in the form of RNA, Virtually all telomeric-repeat sequences are similar in and synthesize DNA in the 5Ј → 3Ј direction (reviewed that they contain clusters of G residues in the strand in Waga and Stillman 1998). Given these properties, Ј Ј running 5 –3 from the centromere toward the physical conventional replication is expected to leave at least end of the DNA molecule (the G-rich strand; Wel- primer-sized gaps on the 5Ј end of the new strands that linger and Sen 1997). Most of the telomeric-repeat were made by lagging-strand synthesis, but also to be DNA is duplex and, in general, at the very ends of the able to completely copy the C-rich strands on the lead- chromosomes the G-rich strand protrudes into the C-rich ing-strand ends (Olovnikov 1973; reviewed in Zakian strand by a variable number of nucleotides, depending 1995). The incurring losses of terminal sequences are on the species. For vertebrate chromosomes, this G-rich counteracted by telomerase, a telomere-speciﬁc reverse strand overhang (hereafter called G-tail) may span 50– transcriptase, which uses its RNA component as a tem- 150 bases (Makarov et al. 1997; McElligott and Wel- plate for addition of new telomeric repeats of the G-rich linger 1997; Wright et al. 1997). In certain ciliate strand onto chromosome ends (reviewed in Greider 1995; Lingner and Cech 1998; Nakamura and Cech 1998). Thus, the particularities of chromosome end rep- 1Corresponding author: De´partement de Microbiologie et Infectiolo- lication entail a specialized enzyme for new leading- gie, Faculte´ de Me´decine, Universite´ de Sherbooke, 3001 12 Ave. Nord, Sherbooke, Quebec J1H 5N4, Canada. strand synthesis (telomerase) and for continued lag- E-mail: [email protected] ging-strand synthesis and a mechanism to convert the

Genetics 162: 1583–1594 (December 2002) 1584 J. Parenteau and R. J. Wellinger blunt ends created at the leading-strand ends into ends Rad27p in yeast cells should result in an accelerated with a G-tail. Previous evidence suggested a model in loss of telomeric repeats. Indeed, we observe that cells which a strand-specific 5Ј–3Ј exonuclease generated a with a deletion of RAD27 and lacking telomerase compo- G-tail, at least at the leading-strand ends (Wellinger nents are not able to grow for the same number of et al. 1996; Makarov et al. 1997), and this exonuclease generations as cells lacking only telomerase. In addition, could be associated directly with the DNA replication the relative signals for G-tails on telomeres derived from machinery (Dionne and Wellinger 1998). In light of the double-mutant strains were significantly higher than all of the above, it is not surprising that some compo- those from wild type or telomerase-lacking strains. nents of the conventional replication machinery appear These data suggest that in telomeric DNA, an absence to be involved in the control of telomere length (Car- of Rad27p results primarily in incomplete synthesis of son and Hartwell 1985; Adams and Holm 1996; the C-rich strands, generating an excess of G-tails. These Diede and Gottschling 1999; Parenteau and Wel- G-tails may then be further elongated in a telomerase- linger 1999; Adams Martin et al. 2000). Among them dependent fashion. The analyses of replication interme- is the yeast Rad27p protein, a homolog of the mamma- diates of a linear plasmid derived from rad27⌬ cells lian FEN-1 protein (flap endonuclease 1, or 5Ј-exo- further corroborate this conclusion in that they suggest nuclease 1; Harrington and Lieber 1994a,b). Deletion that excess G-tails occur on only one end of the plasmid, of RAD27 in yeast results in several distinct phenotypes, presumably the end replicated by lagging-strand synthe- including a temperature-sensitive growth defect (Reagan sis. We interpret these data to support the notion that et al. 1995; Sommers et al. 1995), an elevated spontane- chromosomal ends are processed differently, depending ous mutation rate (Tishkoff et al. 1997), high levels of on whether the newly synthesized strand on a particular instability of micro- and minisatellite sequences (John- end was generated by leading- or lagging-strand synthe- son et al. 1995; Freudenreich et al. 1998; Kokoska et al. sis (Bailey et al. 2001). 1998; Schweitzer and Livingston 1998; Spiro et al. 1999), and sensitivity to alkylating agents like methyl methanesulfonate (Reagan et al. 1995). These identi- MATERIALS AND METHODS fied phenotypes suggest functions for Rad27p in DNA Strains and plasmids: Yeast strains used in this study are replication and repair (Tishkoff et al. 1997; Kokoska listed in Table 1. UCC3535 (gift of M. Singer and D. Gottsch- et al. 1998), and in particular, they are consistent with a ling; Wellinger et al. 1996) was transformed with the 2.3-kb ⌬ proposed role of Rad27p in the removal of RNA primers EcoRI-SphI fragment of pMRrad27 ::URA3 (obtained from E. Friedberg and M. Reagan; Reagan et al. 1995) to delete the during the processing of Okazaki fragments (Bae et al. RAD27 gene. The resulting strain was named RWY20. The 2001). Moreover, yeast cells carrying a deletion of haploids JPY204c and JPY206b were obtained after sporulation RAD27 also display a high degree of telomeric-repeat and dissection of spore tetrads of RWY20. RWY25 diploid instability (Parenteau and Wellinger 1999). How- strain was obtained by mating JPY204c and JPY206b. RWY26 ever, at the telomeres, not only overall telomere repeat was generated by transformation of the RWY25 strain with the 2.7-kb BamHI-SphI fragment of pVL152 (Lundblad and length, but also the particular DNA end structure is Szostak 1989; kindly provided by V. Lundblad) to delete the affected (Parenteau and Wellinger 1999). When cul- EST1 gene. The entire coding region of the EST3 gene was tures are incubated at the nonpermissive temperature replaced by the HIS3 gene in strain RWY25 to yield strain for rad27⌬ cells, an appearance of an abnormally large RWY27. The est3 deletion fragment was generated by using amount of G-tails can be detected (Parenteau and plasmid pRS303 (Sikorski and Hieter 1989) and the follow- ing PCR deletion primers: EST3D-F, 5Ј-ATGCCGAAAGTAAT Wellinger 1999). Since the C1–3A strand at the end of TCTGGAGTCTCATTCAAAGCCAACAGAGATTGTACTGAG chromosomes is synthesized by lagging-strand synthesis AGTGCAC-3Ј and EST3D-R, 5Ј-GTCATAAATATTTATATAC (reviewed in Price 1997), these results suggested a spe- AAATGGGAAAGTACTTAACGACTGTGCGGTATTTCACA cific defect for synthesizing the C-rich strand in rad27⌬ CCG-3Ј (the underlined bases are complementary to pRS plas- cells. Alternatively, it remained possible that the genera- mids). The resulting colonies of these three transformations ⌬ were monitored for deletion on one allele by Southern analysis tion of the excess G-tails in rad27 cells was due to an (data not shown). RWY28 was constructed by mating JPY204c interference with the coordination of telomerase activity with MVL26A (obtained from V. Lundblad; Lendvay et al. with the lagging-strand machinery or an abnormally 1996). The yeast strains used for two-dimensional agarose gel high activity of the nucleolytic activities required to pro- electrophoresis were SX46A and SX46A rad27⌬::URA3 (a gift cess leading-strand ends. from E. Friedberg and M. Reagan; Reagan et al. 1995). The linear plasmid YLpFAT10 was derived from the circular plas- To distinguish between these possibilities and to fur- mid YEpFAT10 (Conrad et al. 1990) as described previously ther examine the participation of telomerase in the (Wellinger et al. 1993b). appearance of single-stranded DNA in rad27⌬ cells, we Yeast cells were transformed by a modification (Gietz et al. have constructed several haploid yeast strains that carry 1995) of the lithium acetate method (Ito et al. 1983) and a rad27⌬ mutation and mutations in genes implicated grown in standard yeast media (Zakian and Scott 1982; Rose et al. 1990). Plasmid constructions were propagated in bacteria in telomerase activity. One of the predictions was that using standard Escherichia coli strains and growth conditions if Rad27p functions in lagging-strand DNA synthesis (Sambrook et al. 1989). alone, the combined absence of telomerase activity and Media, senescent phenotype, and survivors: Indicated het- RAD27 and Telomere Replication 1585

TABLE 1 S. cerevisiae strains used in this study

Strain Genotype Reference UCC3535 MATa/␣ ura3-52/ura3-52 lys2-801/lys2-801 ade2-101/ade2-101 Wellinger et al. (1996); his3-⌬200/his3-⌬200 trp1-⌬1/trp1-⌬1 leu2-⌬1/leu2-⌬1 M. Singer and D. Gottschling TLC1/tlc1⌬::LEU2 VR-ADE2-T/VR-ADE2-T (unpublished results) RWY20 MATa/␣ ura3-52/ura3-52 lys2-801/lys2-801 ade2-101/ade2-101 This study his3-⌬200/his3-⌬200 trp1-⌬1/trp1-⌬1 leu2-⌬1/leu2-⌬1 TLC1/tlc1⌬::LEU2 RAD27/rad27⌬::URA3 VR-ADE2-T/VR-ADE2-T RWY25 MATa/␣ ura3-52/ura3-52 lys2-801/lys2-801 ade2-101/ade2-101 This study his3-⌬200/his3-⌬200 trp1-⌬1/trp1-⌬1 leu2-⌬1/leu2-⌬1 RAD27/rad27⌬::URA3 VR-ADE2-T/VR-ADE2-T RWY26 MATa/␣ ura3-52/ura3-52 lys2-801/lys2-801 ade2-101/ade2-101 This study his3-⌬200/his3-⌬200 trp1-⌬1/trp1-⌬1 leu2-⌬1/leu2-⌬1 RAD27/rad27⌬::URA3 EST1/est1⌬::HIS3 VR-ADE2-T/VR-ADE2-T RWY27 MATa/␣ ura3-52/ura3-52 lys2-801/lys2-801 ade2-101/ade2-101 This study his3-⌬200/his3-⌬200 trp1-⌬1/trp1-⌬1 leu2-⌬1/leu2-⌬1 DIA5-1/DIA5-1 RAD27/rad27⌬::URA3 EST3/est3⌬::HIS3 RWY28 MATa/␣ ura3-52/ura3-52 lys2-801/lys2-801 ade2-101/ade2-101 This study his3-⌬200/his3-⌬200 trp1-⌬1/trp1-⌬63 leu2-⌬1/leu2-⌬1 RAD27/rad27⌬::URA3 CDC13/cdc13-2 est JPY204c MAT␣ ura3-52 lys2-801 ade2-101 his3-⌬200 trp1-⌬1 leu2-⌬1 This study rad27⌬::URA3 VR-ADE2-T JPY206b MATa ura3-52 lys2-801 ade2-101 his3-⌬200 trp1-⌬1 leu2-⌬1 This study rad27⌬::URA3 VR-ADE2-T MVL26A MATa ura3-52 lys2-801 ade2-101 his3-⌬200 trp1-⌬1 leu2-⌬1 cdc13-2 est Lendvay et al. (1996) SX46A MATa ade2 his3-532 trp1-289 ura3-52 Reagan et al. (1995) SX46Arad27⌬::URA3 MATa ade2 his3-532 trp1-289 ura3-52 rad27⌬::URA3 Reagan et al. (1995)

ϭ erozygous diploids that have the same nonsenescent pheno- (OD660) 0.4–0.6] and then shifted to semipermissive temper- type as a wild-type diploid were grown at 30Њ and sporulated ature (30Њ) or to restrictive temperature (37Њ) for 12 hr. Total at room temperature. After tetrad dissection, only tetratypes genomic DNA from these cells was isolated using a modified were selected for study by growth on SC-Leu (tlc1⌬::LEU2), SC- glass bead procedure (Huberman et al. 1987; Wellinger et His (est1⌬::HIS3 and est3⌬::HIS3), or SC-Ura (rad27⌬::URA3) al. 1993b). For Figure 4, the SX46A and SX46A rad27⌬::URA3 plates. The cdc13-2 est mutant was selected by its senescence pheno- cells containing YLpFAT10 were grown in SC-Trp medium at type. The apparent senescence phenotype (Lundblad and 23Њ to midlogarithmic phase and shifted to restrictive tempera- Szostak 1989) was examined for tetratype spore cultures de- ture (37Њ) for 8 hr. DNA was isolated by a “Hirt” extraction rived from RWY20, RWY26, RWY27, and RWY28 by streaking that enriched for low-molecular-weight DNA (Livingston .(generations) and Kupfer 1977 20ف) spore colonies from the dissection plates onto rich growth medium (YPD) in quarter-plate sectors for Southern blot analysis, in-gel hybridization, and two-dimen- single colonies (Figure 1). After this first restreak, cells were sional agarose gel: Agarose gel techniques, Southern blot generations. After 4 days of transfers to nylon membranes, and hybridization conditions 40ف estimated to have grown for growth at the permissive temperature for rad27⌬::URA3 cells were as described previously (Wellinger et al. 1993b). For (23Њ), single colonies derived from the first streak were re- the nondenaturing in-gel hybridization, the technique de- streaked on a second YPD plate for single colonies (60 genera- scribed in Dionne and Wellinger (1996) was used. Two- tions). This procedure was repeated a third time to allow the dimensional (2D) agarose gel electrophoresis was carried out .(generations. At this stage, essentially as described in Brewer and Fangman (1987 80ف population to have grown for hr in 42ف the vast majority of cells were unable to form normal colonies Briefly, the first dimension was run at 0.7 V/cm for (senescence), but a few normal-looking colonies did emerge. 0.37% agarose. For the second dimension, lanes were excised Such colonies are termed survivors (Lundblad and Black- from the first dimension gel, rotated 90Њ, imbedded in 1.1% burn 1993) and maintain their telomeres by telomerase-inde- agarose containing 1 ␮g/ml ethidium bromide, and run at pendent mechanisms (see below and Lundblad and Black- 10 V/cm for 4 hr in the presence of 1 ␮g/ml of ethidium burn 1993; Lendvay et al. 1996; Le et al. 1999; Teng and bromide at 4Њ. DNA used as probes were pVZ1 (Henikoff Zakian 1999; Teng et al. 2000; Chen et al. 2001). To analyze and Eghtedarzadeh 1987) and a 22-mer of the sequence 5Ј- the survivors obtained in our experiments, five more successive CCCACCACACACACCCACACCC-3Ј (referred to as CA-oligo- restreakings were performed on such healthy looking colonies nucleotide; Dionne and Wellinger 1996). A heat-denatured generations after germination. 0.6-kb KpnI-KpnI fragment of YЈ sequences (Louis and 160ف to obtain colonies of Single colonies were grown in liquid media at 23Њ for 10 Haber 1990) cloned in the KpnI site of pVZ1 (Henikoff and additional generations for DNA analysis. Eghtedarzadeh 1987) was used as a YЈ control or as a YЈ probe. DNA isolation: For Figures 2 and 3, yeast cultures were Single-stranded DNA from pGT75 (Wellinger et al. 1993b) was grown in YPD at the permissive temperature for rad27⌬::URA3 obtained by standard procedures using a helper phage (Sam- strains to midlogarithmic phase [optical density at 660 nm brook et al. 1989) and served as the single-stranded G-rich strand 1586 J. Parenteau and R. J. Wellinger

Figure 1.—Accelerated senescence phenotype in rad27⌬ telomerase-minus double-mutant strains. (A) Viability of EST1 RAD27, est1⌬ RAD27, EST1 rad27⌬, and est1⌬ rad27⌬ cells. (B) CDC13 RAD27, cdc13-2 est RAD27, CDC13 rad27⌬, and cdc13-2 est rad27⌬ cells 20ف shown as three consecutive streak outs of a typical tetratype on YPD plates. Each streak corresponds to an increase of generations of population growth. control DNA (labeled GT). The double-stranded control was the ends of short DNA primers (Cohn and Blackburn obtained by linearization of pMW55 with BamHI. The pMW55 1995; Lingner et al. 1997), suggesting regulatory and/ plasmid was made by inserting 55 bp of duplex telomeric- repeat DNA into the EcoRV site of pRS303 (Sikorski and or comediator functions for Est1p, Est3p, and Cdc13p Hieter 1989). (Lingner et al. 1997). Cells lacking TLC1, EST1, EST2, Quantification for all signals was obtained by storage phos- or EST3 or cells containing the cdc13-2 est allele progres- phorimaging with a Storm and ImageQuant software. In the sively lose telomeric sequences from their telomeres at -genera 80ف native gel, the integrated volume used comprised the entire the rate of 3–5 bp/division and die after lane, background values derived from an area lacking a signal were subtracted, and the resulting value was divided by the tions (Lundblad and Szostak 1989; Lendvay et al. corrected volume integrated of the same lane in the denatured 1996). This delayed cell death phenotype has been gel. For 2D gels, the area described for each experiment was called replicative senescence and is caused by the losses integrated, a background was subtracted, and the resulting of terminal sequences due to telomerase inactivity and value was divided by an internal standard value as indicated. thus a lack in the ability to generate leading-strand G-rich The values obtained for the wild-type strains were set as 1; values of the indicated mutant strains are expressed relative telomeric repeats. To examine whether Rad27p contri- to this wild-type value. Care was taken to ensure that the signals butes to telomeric-repeat maintenance via the genetic never exceeded the capacity of the storage phosphor plates. pathway defined by telomerase components or via an independent pathway, four diploid strains heterozygous for mutations in RAD27 and mutations in the four genes RESULTS implicated in telomerase activity were constructed and Enhancement of senescence phenotype in rad27 telo- sporulated, and tetrads were dissected. After tetratypes merase-minus strains: In vivo telomerase activity in yeast were identified (see materials and methods), individ- requires at least five genes: TLC1, encoding the RNA ual spores of such tetratypes were restreaked at least component of telomerase, as well as EST1, EST2, EST3, three times onto YPD plates to compare the senescence and CDC13 (for review see Nugent and Lundblad phenotype of double-mutant strains with that of each 1998; Evans and Lundblad 2000; McEachern et al. single-mutant strain. As shown in Figure 1 and Table 2, 2000). However, in vitro only Est2p and TLC1 are neces- at 23Њ, the permissive temperature for cells carrying sary to perform addition of telomeric sequences onto rad27⌬, the wild type and rad27⌬ segregants grow nor- RAD27 and Telomere Replication 1587

TABLE 2 Accelerated death phenotype of rad27⌬ telomerase-minus double-mutant strains

Average no. of generations on plates (range) No. of individual Double mutants Single mutants Genotype of haploid tetratypes analyzed (rad27⌬ telomerase minus) (telomerase minus) est1⌬ rad27⌬ 8 40 (25–50) 70 (55–80) tlc1⌬ rad27⌬ 10 35 (25–40) 75 (60–80) cdc13-2 est rad27⌬ 9 40 (35–60) 80 (70–100) est3⌬ rad27⌬ 3 50 (40–60) 85 (80–90) Diploids heterozygous for rad27 and a mutation in any of four genes implicated in telomerase activity (i.e., est1, tlc1, cdc13-2 est,orest3) were sporulated and tetrads were dissected. After tetratypes were identified, the apparent senescence phenotype was examined for individual spore colonies by streaking consecutively on YPD plates (Figure 1). mally without any senescence phenotype. However, cul- conserved site in the subtelomeric YЈ element that is tures derived from spores with mutations in the genes present on most telomeres (YЈ TRFs; Chan and Tye encoding telomerase components (i.e., tlc1⌬, est1⌬, 1983). Depending on the strain background, about one- est3⌬,orcdc13-2 est) died at an average of 70–85 genera- third of the telomeres do not harbor a YЈ element, and tions after germination. The double-mutant strains (i.e., the TRFs derived from these telomeres (non-YЈ TRFs) strains harboring rad27⌬ and one of the above muta- will be longer. In addition, the overall terminal DNA tions affecting telomerase components) died more rap- configuration can be determined using a nondenatur- idly than strains carrying only the mutations in telo- ing in-gel hybridization technique (Dionne and Wel- merase: our analysis determined senescence to occur linger 1996). In this technique, native DNA is hybrid- in these strains between 35 and 50 generations after ized directly to end-labeled oligonucleotides in dried germination (Table 2). For example, rad27⌬ est1⌬ dou- agarose gels, allowing for the detection of single- ble-mutant cells already yielded colonies of variable sizes stranded regions in the DNA. An example of such an with predominantly small colonies upon the first streak- analysis of all four haploid spores of a tetratype derived ing (40G) after the dissection plate (Figure 1A). These from the RAD27/rad27⌬ EST1/est1⌬ heterozygous dip- small rad27⌬ est1⌬ colonies did not grow further loid is shown in Figure 2. Spore cultures of the indicated whereas est1⌬ single mutants began to lose viability after genotype were pregrown at 23Њ and then split and incu- only 60 divisions (Figure 1A). We obtained essentially bated at the indicated temperatures (see materials the same results for the rad27⌬ cdc13-2 est double-mutant and methods). Note that rad27⌬ strains will grow only strain (Figure 1B), as well as for the rad27⌬ est3⌬ and a few generations at 37Њ and then will stop growing rad27⌬ tlc1⌬ strains (Table 2 and data not shown). As (Reagan et al. 1995). Also, the phenotype of excess anticipated, even in the single telomerase mutants, the G-tails in rad27⌬ cells is vastly enhanced when cells are number of generations required for the senescence phe- grown at 37Њ, allowing for a more quantitative determi- notype to appear is variable within a certain range (see nation of the amount of G-tails occurring (Figure 2C). the ranges in Table 2). While we find a similar variation On the native gel (Figure 2A), only a very faint signal for the occurrence of senescence in the double mutants, for single-stranded telomeric G-strands was detected for it is clear that overall senescence onset is earlier. Thus, the wild type (Figure 2A, lanes 2–4) and the est1⌬ strains the rad27⌬ mutation caused an accelerated senescence (Figure 2A, lanes 8–10) as expected and shown pre- phenotype in strains also lacking components required viously (Wellinger et al. 1992, 1993a,b, 1996). The for in vivo telomerase activity. G-tails in yeast may be too short to yield a significant Additive contribution to the generation of G-tails by signal in such nonsynchronous cultures. In addition, Rad27p and telomerase: To establish the contribution the fraction of cells in late S-phase, which would have of telomerase in the abnormally high levels of G-tails telomeres with long and detectable G-tails in such cul- detected in rad27⌬ cells grown at the restrictive temperatures, is small. However, signals for single-stranded G-tails ture (Parenteau and Wellinger 1999), terminal re- were detectable in rad27⌬ cells grown at 23Њ, and these striction fragments derived from individual spores of signals are vastly augmented when the cells are grown some of the same tetratype segregants as above were at 37Њ (Figure 2A, compare lanes 5 and 7; Parenteau analyzed. Telomeric-repeat length in yeast can be as- and Wellinger 1999). On DNA derived from rad27⌬ sessed by digesting genomic DNA with the restriction est1⌬ double-mutant cells (Figure 2A, lanes 11–13) a endonuclease XhoI, which generates diagnostic terminal similar effect was observed, yet the signals for the G-tails restriction fragments (TRFs). On DNA derived from did not reach the same level as those observed for the kb is due to a rad27⌬ cells at the same temperatures. Rehybridization 1.3ف wild-type strains, a major band of 1588 J. Parenteau and R. J. Wellinger kb in strains 1ف of the very same gel after DNA denaturation showed est1⌬ strains: the length of YЈ TRFs was kb in the wild type 1.3ف about equal amounts of DNA in each lane. In addition lacking Est1p, whereas it was and as expected, telomere shortening could be seen in and rad27⌬ cells (Figure 2B, arrows). Finally, as reported previously, TRFs became very heterogeneous in both strains lacking Rad27p and incubated at 37Њ (Figure 2B, lanes 7 and 13; Parenteau and Wellinger 1999). The relative signals for single-stranded DNA observed on DNA derived from cells incubated at 23Њ and 37Њ in the native gels (Figure 2A) were quantified using a PhosphorImager and corrected for DNA loading using the denatured gel (Figure 2B; see materials and methods). Compared to the values obtained for the wild- type strain at the same temperature, it is clear that there is significantly more single-stranded G-rich telomeric DNA in rad27⌬ strains (Figure 2C). However, we consis- fold less signal for G-tails in the-1.7ف tently observed rad27⌬ est1⌬ double-mutant cells as compared to the rad27⌬ strains (Figure 2C). For example, the mean values for rad27⌬ cells were 12.2 (23Њ) and 58 (37Њ), whereas those for rad27⌬ est1⌬ cells were 7.3 (23Њ) and 32.1 (37Њ). DNA derived from cells with a deletion of EST1 alone scored indistinguishably from wild type at all temperatures. Virtually identical results were obtained with individual spore cultures of a tetratype derived from the RAD27/rad27⌬ TLC1/tlc1⌬ heterozygous diploid (data not shown). These data suggest that telomerase and the defects of lagging-strand DNA synthesis occurring in yeast cells carrying a deletion of RAD27 each contribute a significant portion to the induction of the extensive G-tails. Rad27p is not required to produce survivors in telomerase-minus cells: The accelerated death phenotype observed in the rad27⌬ telomerase-minus double-mutant

Figure 2.—Contribution of telomerase in the appearance of G-tails in rad27⌬ cells. (A) Genomic DNA derived from the individual spores of a tetratype derived from the heterozygous diploid strain RWY26 (RAD27/rad27⌬ EST1/est1⌬). This strain was grown at the indicated temperature, digested with XhoI, and analyzed by a nondenaturing in-gel hybridization procedure (Dionne and Wellinger 1996). An end-labeled CA oligonucleotide served as a probe. Linearized double- stranded pMW55 served as a negative control (labeled ds), and single-stranded phagemid DNA containing yeast telomeric repeats of the G-rich strand served as a positive control (labeled GT; see materials and methods). M, end-labeled 1-kb ladder DNA serving as a size standard. Relevant genotypes of the cells are indicated at the top. (B) The DNA in the gel shown in A was denatured, and the same gel was rehybridized to the CA probe to show all the telomeric-repeat-containing fragments (top). Arrows indicate the YЈ TRFs. For clarity, a longer exposition of the same area of the gel (YЈ TRFs) is also shown (bottom). Some of the other bands correspond to non- YЈ TRFs. (C) The amount of single-stranded DNA in native gels for the indicated strains grown at 23Њ or 37Њ was quantified in relation to the loading observed in denatured gels using a Storm and Image Quant software. The values obtained for the wild-type strains were set as 1; values obtained for the mutant strains are expressed relative to the wild-type value. The average of six measurements for each strain is presented. RAD27 and Telomere Replication 1589 strains is reminiscent of the situation observed for rad52⌬ telomerase-minus double-mutant cells (Lund- blad and Blackburn 1993; Lendvay et al. 1996; Le et al. 1999). As mentioned above, cells lacking telomerase generations. However, RAD52- 80ف activity die after dependent rearrangements and amplifications of telomere regions can result in the generation of cells that maintain functional telomeres (survivors, Figure 3A; Lundblad and Blackburn 1993; Lendvay et al. 1996; Le et al. 1999; Teng and Zakian 1999; Teng et al. 2000; Chen et al. 2001). Two types of rearrangements that can lead to survivors have been characterized: type I survivors are generated by an amplification of YЈ subtelomeric elements and have very short telomeric-repeat tracts, and type II survivors contain long and very heterogeneous telomeric-repeat lengths (Lundblad and Black- burn 1993; Teng and Zakian 1999). These two types of rearrangements result in characteristic patterns of TRFs derived from DNA of the respective survivors (Fig- ure 3B; compare lane 1, wild-type pattern, with lane 5, survivor type II pattern, and with lane 6, survivor type I pattern). In addition to a general dependence of survivors on RAD52, type I survivors are dependent on RAD51, RAD54, and RAD57 (Le et al. 1999), whereas type II survivors depend on RAD50, RAD59, MRE11, XRS2, and SGS1 (Le et al. 1999; Chen et al. 2001; Cohen and Sinclair 2001; Huang et al. 2001). Since rad27⌬ telomerase-minus mutant cells had the same accelerated death phenotype as rad52⌬ telomerase-minus cells, we wanted to know whether Rad27p is also required for the mechanisms to generate survivors. Thus, RAD27 TLC1, rad27⌬ TLC1, RAD27 tlc1⌬, and rad27⌬ tlc1⌬ cells were streaked onto solid media past the senescence point Figure 3.—Rad27p is not required to produce survivors in ⌬ telomerase-minus cells. (A) The viability of TLC1 RAD27, tlc1 160ف generations; Figures 1 and 3A), and after 80ف) RAD27, TLC1 rad27⌬, and tlc1⌬ rad27⌬ cells and the aspect generations, single colonies were grown in liquid media Њ of survivors in telomerase-minus cells at 40, 60, and 160 genera- at 23 for 10 additional generations for DNA analysis. tions on YPD plates. (B) Southern blot of XhoI-digested geno- Genomic DNA was extracted and telomeric DNA pat- mic DNA from cells that were continuously grown to 170 tern was assessed by digesting DNA with XhoI. Occa- generations was hybridized to a randomly labeled YЈ subtelo- sional occurrence of healthy looking colonies (survi- meric DNA. The genotypes and approximate number of cell ⌬ ⌬ ⌬ generations are indicated at the top. Molecular size standards vors) was very similar in streaks of tlc1 and rad27 tlc1 are as in Figure 2. cells (Figure 3A). Moreover, type I as well as type II survivors can arise in strains lacking Rad27p and telomerase (Figure 3B, lane 8: type I; lane 9: type II). Conse- Figure 4, and the circular form of the plasmid (CFP) quently, Rad27p is not required to produce survivors in can be identified by its distinct position in the 2D gel yeast cells lacking telomerase activity. (Wellinger et al. 1993a,b, 1996). Using in vitro-gener- 100ف Accumulation of single-stranded DNA in rad27⌬ oc- ated molecules, it was also shown that for up to curs at only one end of a linear plasmid: Rad27p was nucleotides, the fraction of DNA molecules with telo- proposed to be among the candidate exonucleases re- mere-telomere interactions depends on the length of sponsible for the processing of the blunt-ended telo- the TG1–3-tails: the longer the G-tails are, the higher the meres left after leading-strand DNA synthesis. Using signal of circular plasmids (Wellinger et al. 1996). We two-dimensional agarose gel electrophoresis, it was pre- used this system to assess whether an absence of Rad27p viously shown that the linear plasmid YLpFAT10 can caused extensive G-tails on one or on both ends of the form telomere-telomere interactions that are depen- linear plasmid YLpFAT10 (Figure 4). The prediction dent on the presence of G-rich tails on both ends of was that if the leading- and lagging-strand ends were to the plasmid (Wellinger et al. 1993b, 1996). In this acquire the extensive G-tails, the fraction of CFP ob- system, circular and branched plasmid replication inter- served on the 2D gels should be significantly higher in mediates yield a characteristic pattern, as outlined in rad27⌬ cells. However, quantitation of the signals for 1590 J. Parenteau and R. J. Wellinger

Figure 4.—No signiﬁcant difference in CFP formation in wild- type and rad27⌬ cells. (Top) The migration patterns of replication intermediates of the linear plasmid YLpFAT10 in two-dimensional agarose gels (Wellinger et al. 1993b, 1996). RI1 and RI2 de- note the areas used for standard- ization of the signal obtained for the CFP. 1N indicates the position of the linear, double-stranded, and nonreplicating form of YLp- FAT10. (Bottom) DNA of the wild- type or rad27⌬ cells containing YLpFAT10 and grown at the indicated temperature was analyzed using 2D gels. Arrows indicate the gel migration directions. Ran- domly labeled pVZ1 plasmid DNA was used as a probe. Molecular size standards are as in Figure 2.

CFP with respect to either the signals for replication cessed at one end, presumably the one synthesized by intermediates (RI1 and RI2 in Figure 4) or the linear leading-strand DNA synthesis, and abnormally pro- form of the plasmid (1N in Figure 4) showed no signifi- cessed at the other end, the one made by lagging-strand cant difference in CFP formation, even if the rad27⌬ DNA synthesis. Hence, Rad27p would not be the 5Ј–3Ј cells were incubated at 37Њ and extensive G-tails were exonuclease responsible for the processing of the blunt observed on telomeres (Table 3). This result suggests end at leading-strand telomeres. that in rad27⌬ cells, the generation of G-tails was con- fined to one end of the plasmid, which we presume is DISCUSSION the lagging-strand end. In addition, if Rad27p was the exonuclease processing the leading-strand ends, its ab- Some components of the replication machinery ap- sence could have created a situation in which the lead- pear to be involved in the control of telomere length. ing-strand ends remained blunt ended after replication. For example, cells carrying temperature-sensitive (Ts) In this case, we expected a decrease in the signal for alleles of DNA polymerase ␣ (CDC17/POL1) harbor very CFP in rad27⌬ cells as compared to wild-type cells, since long telomeres (Carson and Hartwell 1985; Adams G-tailed ends will not interact with a double-stranded and Holm 1996). In addition, mutations in the gene and blunt-ended tract of telomeric repeats, at least in encoding the large subunit of replication factor C vitro (Wellinger et al. 1996). Within the limits of the (CDC44/RFC1) and specific mutations in DNA2 result experiment, this also was not the case (Table 3). How- in an elongation of telomeres (Adams and Holm 1996; ever, all the data are consistent with the hypothesis that Formosa and Nittis 1999). Dna2p is an essential yeast chromosome ends in rad27⌬ cells are normally pro- replicative endonuclease/helicase that may act together RAD27 and Telomere Replication 1591

TABLE 3 Formation of G-tails at only one end in rad27⌬ cells grown at the permissive and restrictive temperatures

Average Ϯ standard Strains (temperature) CFP/RI1 CFP/RI2 CFP/1N deviation Wild type 1 1 1 1 rad27⌬ (23Њ) 0.875 0.85 1.105 0.94 Ϯ 0.14 rad27⌬ (37Њ) 1.18 0.80 0.965 0.98 Ϯ 0.19 The signal in 2D gels for the circular form of the plasmid YLpFAT10 (CFP) was quantified for wild-type and rad27⌬ cells. The resulting value was divided by an internal standard value as indicated (i.e., RI1, RI2, or 1N; see Figure 4). The ratios obtained in this manner for the wild-type strain were set as 1; values for rad27⌬ strains grown at 23Њ or 37Њ are expressed relative to this wild-type value. The average of four measurements for each ratio is presented. with Rad27p to remove RNA-DNA hybrids during Oka- merase complex for telomerase-mediated elongation at zaki fragment maturation (Bae et al. 1998; Parenteau the ends does occur in these strains, yet the absence of and Wellinger 1999; Bae and Seo 2000). Rad27p may cause the newly generated Okazaki frag- We have previously shown that, like a strain harboring ments to be incomplete or partially degraded (Figure Ts alleles of the CDC17 gene (pol1-17), strains with a 5). This would explain the significant contribution of RAD27 deletion display an accumulation of G-tails when both telomerase and deficient C-strand (lagging-strand) grown at a semipermissive temperature (Parenteau synthesis to G-tail generation in these strains (Figure and Wellinger 1999; Adams Martin et al. 2000). The 2). We also attempted to determine whether the abnor- generation of these abnormally high levels of G-tails in mally high levels of G-tails observed in rad27 cells were pol1-17 cells occurs similarly in the presence or absence transient, as in pol1-17 cells, or were constitutive. How- of telomerase (Adams Martin et al. 2000). This suggests ever, despite numerous attempts using different strain that in this mutant most of the G-tails are the result of backgrounds and various arrest procedures, we were a defect in the synthesis of the C-rich strand only, i.e., unable to obtain arrested rad27 cells in any phase of in the synthesis of lagging-strand DNA, with only a minor the cell cycle (data not shown). While we do not know contribution of telomerase (Adams Martin et al. 2000). the precise reason(s) for this effect, we suspect that the The data presented here strongly suggest that in cells high genetic instability and a previously reported link lacking Rad27p and grown at restrictive or semirestric- between Rad27p and the regulation of cell-cycle pro- tive temperatures, it is also only the ends replicated by gression (Vallen and Cross 1995) may preclude effi- the lagging-strand machinery that are affected (Figure cient cell-cycle arrest in such strains. 4 and Table 3). However, the generation of a significant Consistent with our model described above, the over- and measurable portion of the increased amounts of all length of the telomeric-repeat tracts in rad27 cells G-tails observed in these cells was dependent on telo- becomes very heterogeneous (Parenteau and Wel- merase (Figure 2C). These results may reflect the spe- linger 1999; Figure 2). This heterogeneity would be cific and different contributions of these two proteins caused by the combined effects of shortening via the to lagging-strand synthesis. In the pol1-17 mutants, the incomplete C-strands and single-stranded DNA breaks lagging-strand synthesis may be inefficient at the very and lengthening mediated by telomerase. Such a model ends of chromosomes. Since DNA polymerase ␣ as well would also predict that in the combined absence of as DNA polymerase ␦ are required in vivo for telomerase- telomerase and Rad27p, telomere shortening should be Ј mediated elongation of the 3 TG1–3 strand (Diede and accelerated such that these strains senesce earlier than Gottschling 1999), and DNA polymerase ␣ appears cells lacking only telomerase. As shown in Figure 1, to at least temporarily interact with components of telo- the results are consistent with this hypothesis: double- ,generations after germination 50–35ف merase (Qi and Zakian 2000), the detected G-tails in mutant cells die pol1-17 mutants would be primarily the result of incom- while telomerase-lacking cells die after 70–85 genera- plete C-strand synthesis. Consistent with this hypothesis, tions (see also Table 2). However, this accelerated death the G-tails in the pol1-17 mutants are transient in nature phenotype is not specific for rad27⌬ telomerase-minus and occur only in S-phase, and chromosome ends dis- cells. rad52⌬ telomerase-minus double mutants display play a normal DNA end structure in the next G1 phase a comparable accelerated senescence (Lundblad and (Adams Martin et al. 2000). In the rad27 cells, on the Blackburn 1993; Lendvay et al. 1996; Le et al. 1999). other hand, DNA synthesis on the lagging-strand ends Such rad52⌬ telomerase-minus cells have the additional may be initiated properly, but the maturation of the 5Ј property of being unable to generate survivors, that is, ends of the Okazaki fragments could be deficient. We cells that can maintain telomeric repeats in the absence envision that the required presence of the DNA poly- of telomerase (Lundblad and Blackburn 1993; Lend- 1592 J. Parenteau and R. J. Wellinger

Figure 5.—Model of DNA end structures generated in wild-type and rad27⌬ strains. In wild-type strains, the lagging-strand machinery may synthesize the new C-rich strand to very near the end of the chromosome. This could activate telomerase-mediated elongation of the G-rich strand and con- comitant synthesis of the C-strand, leading to elongation of both strands. In Rad27p-lacking cells, the generation of Okazaki fragments is impaired and the fragments may be degraded due to a maturation defect. However, attempts at resynthesis may occur near or at the very ends, activating telomerase-mediated elongation of the G-rich strand and subsequent failure of maturation of the Okazaki fragment. This would yield very elongated G-tails (right bottom), which would be the combined result of the failure of Okazaki-fragment maturation and telomerase-mediated elongation of the G-rich strand. G, G-rich strand; C, C-rich strand; solid arrows, wild-type Okazaki fragments; stippled arrows, Okazaki fragments in rad27⌬ strains; thin lines, template strands; thick lines, newly synthesized strands; dashed line, telomerase-dependent elongation of the G-strand.

vay et al. 1996; Le et al. 1999; Teng and Zakian 1999; noncovalent telomere-telomere interactions. At least in Teng et al. 2000; Chen et al. 2001). Moreover, RAD27 vitro, these end-to-end interactions are dependent on is required for dsDNA break repair (Holmes and Haber G-tails being present on both ends of the plasmid, and 1999) and rad27⌬ rad52⌬ cells display a synthetic lethal- increases in the lengths of G-tails increased the effi- ity (Tishkoff et al. 1997). Formally, it was thus possible ciency of circularization (Wellinger et al. 1996). There- that both Rad27p and Rad52p were required for the fore, we surmised that if the extensive G-tails observed recombinatorial mechanisms that allow telomerase-lack- on telomeres in rad27 cells were present on both ends ing cells to replenish the terminal telomeric repeats of YLpFAT10, then increased amounts of circularized in survivors. However, we were readily able to recover forms of the plasmid should be recovered. However, survivors from rad27⌬ telomerase-minus cells (Figure the amounts of circular YLpFAT10 DNA recovered from 3A) and after analysis of the chromosome terminal re- rad27 cells were very comparable to those recovered from striction fragments recovered from such survivors, pat- a wild-type strain (Figure 4 and Table 3). This inability terns typical for both type I and type II events can be to observe increased amounts of the circular form was documented (Figure 3B). We conclude that Rad27p not due to technical limitations of the assay, as increased is not required for the establishment of survivors in amounts of circular forms could be recovered from telomerase-lacking cells and that the reasons for the yku70 cells, in which constitutive long G-tails are present accelerated senescence in rad27⌬ telomerase-minus on telomeres throughout the cell cycle (Gravel et al. cells may be different from those for rad52⌬ telomerase- 1998; M. Larriveé and R. J. Wellinger, unpublished minus cells. data). These results then suggest that on the linear All the data are most consistent with a defect in rad27⌬ YLpFAT10 molecule, only one of the two telomeres is cells of the generation and/or processing of lagging affected by the absence of Rad27p. This is consistent strands on telomeric repeats, as described above. On with our hypothesis of a lagging-strand-specific defect any linear DNA molecule, only one telomere, the one and further suggests that the two ends are processed replicated by lagging-strand synthesis, would thus be differently in rad27 cells. While the leading-strand ends predicted to be affected by this defect. To test this hy- may be processed normally, the lagging-strand ends in- pothesis, the replication intermediates (RIs) of a short cur losses of the newly synthesized C-rich strand and linear plasmid called YLpFAT10 were analyzed by two- a telomerase-dependent over-elongation of the G-rich dimensional gel electrophoresis. Extensive analyses of strand, leading to the excessive G-tails. Such a differen- the RIs of this linear plasmid isolated from wild-type tial requirement of proper processing for the two differ- cells have shown that replication initiated in the pre- ent types of chromosome ends is not unprecedented: dicted area of the plasmid and that its telomeres ac- a recent study of mammalian telomeres demonstrated quired long G-tails in late S-phase, as chromosomal telo- that in the absence of TRF2, a telomeric DNA-binding meres do (Wellinger et al. 1993a,b). Furthermore, the protein (Broccoli et al. 1997), virtually only leading- isolated plasmid DNA displayed a cell-cycle-regulated strand ends were involved in telomere-telomere fusions propensity to form a circular DNA held together by with other leading-strand ends. Lagging-strand ends ap- RAD27 and Telomere Replication 1593 peared not to be involved at all in such fusions in this Chan, C. S., and B. K. Tye, 1983 Organization of DNA sequences and replication origins at yeast telomeres. Cell 33: 563–573. situation (Bailey et al. 2001). Chen, Q., A. Ijpma and C. W. Greider, 2001 Two survivor pathways The study presented here thus underscores the differ- that allow growth in the absence of telomerase are generated ential requirements for telomere maintenance on ends by distinct telomere recombination events. Mol. Cell. Biol. 21: 1819–1827. replicated by leading- vs. lagging-strand synthesis. The Cohen, H., and D. A. Sinclair, 2001 Recombination-mediated data demonstrate that interfering with components of lengthening of terminal telomeric repeats requires the Sgs1 DNA the lagging-strand machinery causes defects in telo- helicase. Proc. Natl. Acad. Sci. USA 98: 3174–3179. Cohn, M., and E. H. Blackburn, 1995 Telomerase in yeast. Science meric DNA end structures, which can result in increased 269: 396–400. losses of telomeric repeats. Furthermore, the results Conrad, M. N., J. H. Wright, A. J. Wolf and V. A. Zakian, 1990 suggest that in the particular case of Rad27p, only the RAP1 protein interacts with yeast telomeres in vivo: overproduc- tion alters telomere structure and decreases chromosome stabil- ends replicated by lagging-strand synthesis are affected. ity. Cell 63: 739–750. This implies that the leading-strand ends may be pro- Diede, S. J., and D. E. Gottschling, 1999 Telomerase-mediated cessed normally in the absence of Rad27p and suggests telomere addition in vivo requires DNA primase and DNA polymerases alpha and delta. Cell 99: 723–733. that Rad27p is not part of the nucleases that act on such Diede, S. J., and D. E. Gottschling, 2001 Exonuclease activity is ends to generate short G-tails. The enzymatic activities required for sequence addition and Cdc13p loading at a de novo responsible for this processing remain enigmatic, even telomere. Curr. Biol. 11: 1336–1340. Dionne, I., and R. J. Wellinger, 1996 Cell cycle-regulated genera- if in one case the MRE11/RAD50/XRS2 complex has tion of single-stranded G-rich DNA in the absence of telomerase. been proposed to fulfill this function (Diede and Proc. Natl. Acad. Sci. USA 93: 13902–13907. Gottschling 2001). Thus, an absence of proper pro- Dionne, I., and R. J. Wellinger, 1998 Processing of telomeric DNA ends requires the passage of a replication fork. Nucleic Acids cessing at leading-strand ends can lead to increased Res. 26: 5365–5371. telomere-telomere fusions (Bailey et al. 2001), and in- Evans, S. K., and V. Lundblad, 2000 Positive and negative regula- terfering with the machinery to generate lagging-strand tion of telomerase access to the telomere. J. Cell Sci. 113: 3357– 3364. ends can lead to aberrant end structures and telomeric Formosa, T., and T. Nittis, 1999 Dna2 mutants reveal interactions sequence losses. with Dna polymerase ␣ and Ctf4, a Pol ␣ accessory factor, and show that full Dna2 helicase activity is not essential for growth. We thank V. Lundblad, M. Singer, D. Gottschling, E. Friedberg, Genetics 151: 1459–1470. and M. Reagan for providing strains and plasmids used in these studies. Freudenreich, C. H., S. M. Kantrow and V. A. Zakian, The members of the Wellinger lab are thanked for helpful discussions 1998 Expansion and length-dependent fragility of CTG repeats throughout this project. This research was supported by a grant (no. in yeast. Science 279: 853–856. MOP 12616) from the Canadian Institutes of Health Research (CIHR) Gietz, R. D., R. H. Schiestl, A. R. Willems and R. A. Woods, 1995 to R.J.W. J.P. was a recipient of a studentship of the Fonds pour la Studies on the transformation of intact yeast cells by the LiAc/ Formation des Chercheurs et l’Aide a` la Recherche (FCAR) and R.J.W. SS-DNA/PEG procedure. Yeast 11: 355–360. Gravel, S., M. Larrivee, P. Labrecque and R. J. Wellinger, 1998 is a Chercheur National supported by the Fonds de la Recherche en Yeast Ku as a regulator of chromosomal DNA end structure. Sante´ du Que´bec (FRSQ). Science 280: 741–744. Greider, C. W., 1995 Telomerase biochemistry and regulation, pp. 35–68 in Telomeres, edited by E. H. Blackburn and C. W. Greider. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. LITERATURE CITED Greider, C. W., 1996 Telomere length regulation. Annu. Rev. Bio- chem. 65: 337–365. Adams, A. K., and C. Holm, 1996 Specific DNA replication muta- Harrington, J. J., and M. R. Lieber, 1994a Functional domains tions affect telomere length in Saccharomyces cerevisiae. Mol. within FEN-1 and RAD2 define a family of structure-specific endo- Cell. Biol. 16: 4614–4620. nucleases: implications for nucleotide excision repair. Genes Dev. Adams Martin, A., I. Dionne, R. J. Wellinger and C. Holm, 2000 8: 1344–1355. The function of DNA polymerase alpha at telomeric G tails is Harrington, J. J., and M. R. Lieber, 1994b The characterization important for telomere homeostasis. Mol. Cell. Biol. 20: 786–796. of a mammalian DNA structure-specific endonuclease. EMBO J. Bae, S. H., and Y. S. Seo, 2000 Characterization of the enzymatic 13: 1235–1246. properties of the yeast dna2 helicase/endonuclease suggests a Henikoff, S., and M. K. Eghtedarzadeh, 1987 Conserved arrange- new model for Okazaki fragment processing. J. Biol. Chem. 275: ment of nested genes at the Drosophila Gart locus. Genetics 117: 38022–38031. 711–725. Bae, S. H., E. Choi, K. H. Lee, J. S. Park, S. H. Lee et al., 1998 Dna2 Holmes, A. M., and J. E. Haber, 1999 Double-strand break repair in of Saccharomyces cerevisiae possesses a single-stranded DNA- yeast requires both leading and lagging strand DNA polymerases. specific endonuclease activity that is able to act on double- Cell 96: 415–424. stranded DNA in the presence of ATP. J. Biol. Chem. 273: 26880– Huang, P., F. E. Pryde,D.Lester,R.L.Maddison,R.H.Borts et al., 26890. 2001 SGS1 is required for telomere elongation in the absence of Bae, S. H., K. H. Bae, J. A. Kim and Y. S. Seo, 2001 RPA governs telomerase. Curr. Biol. 11: 125–129. endonuclease switching during processing of Okazaki fragments Huberman, J. A., L. D. Spotila, K. A. Nawotka, S. M. El-Assouli in eukaryotes. Nature 412: 456–461. and L. R. Davis, 1987 The in vivo replication origin of the yeast Bailey, S. M., M. N. Cornforth, A. Kurimasa, D. J. Chen and E. H. 2 microns plasmid. Cell 51: 473–481. Goodwin, 2001 Strand-specific postreplicative processing of Ito, H., Y. Fukuda, K. Murata and A. Kimura, 1983 Transformation mammalian telomeres. Science 293: 2462–2465. of intact yeast cells treated with alkali cations. J. Bacteriol. 153: Brewer, B. J., and W. L. Fangman, 1987 The localization of replica- 163–168. tion origins on ARS plasmids in S. cerevisiae. Cell 51: 463–471. Johnson, R. E., G. K. Kovvali, L. Prakash and S. Prakash, 1995 Broccoli, D., A. Smogorzewska, L. Chong and T. De Lange, 1997 Requirement of the yeast RTH1 5Ј to 3Ј exonuclease for the Human telomeres contain two distinct Myb-related proteins, stability of simple repetitive DNA. Science 269: 238–240. TRF1 and TRF2. Nat. Genet. 17: 231–235. Kokoska, R. J., L. Stefanovic, H. T. Tran, M. A. Resnick, D. A. Carson, M. J., and L. Hartwell, 1985 CDC17: an essential gene Gordenin et al., 1998 Destabilization of yeast micro- and minisa- that prevents telomere elongation in yeast. Cell 42: 249–257. tellite DNA sequences by mutations affecting a nuclease involved 1594 J. Parenteau and R. J. Wellinger

in Okazaki fragment processing (rad27) and DNA polymerase ing: A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory delta (pol3-t). Mol. Cell. Biol. 18: 2779–2788. Press, Cold Spring Harbor, NY. Le, S., J. K. Moore, J. E. Haber and C. W. Greider, 1999 RAD50 Sandell, L. L., and V. A. Zakian, 1993 Loss of a yeast telomere: and RAD51 define two pathways that collaborate to maintain arrest, recovery, and chromosome loss. Cell 75: 729–739. telomeres in the absence of telomerase. Genetics 152: 143–152. Schweitzer, J. K., and D. M. Livingston, 1998 Expansions of CAG Lendvay, T. S., D. K. Morris, J. Sah, B. Balasubramanian and V. repeat tracts are frequent in a yeast mutant defective in Okazaki Lundblad, 1996 Senescence mutants of Saccharomyces cerevisiae fragment maturation. Hum. Mol. Genet. 7: 69–74. with a defect in telomere replication identify three additional Shampay, J., J. W. Szostak and E. H. Blackburn, 1984 DNA se- EST genes. Genetics 144: 1399–1412. quences of telomeres maintained in yeast. Nature 310: 154–157. Lingner, J., and T. R. Cech, 1998 Telomerase and chromosome Sikorski, R. S., and P. Hieter, 1989 A system of shuttle vectors and end maintenance. Curr. Opin. Genet. Dev. 8: 226–232. yeast host strains designed for efficient manipulation of DNA in Lingner, J., T. R. Cech, T. R. Hughes and V. Lundblad, 1997 Saccharomyces cerevisiae. Genetics 122: 19–27. Three ever shorter telomere (EST) genes are dispensable for in Sommers, C. H., E. J. Miller, B. Dujon, S. Prakash and L. Prakash, vitro yeast telomerase activity. Proc. Natl. Acad. Sci. USA 94: 1995 Conditional lethality of null mutations in RTH1 that en- 11190–11195. codes the yeast counterpart of a mammalian 5Ј-to3Ј-exonuclease Livingston, D. M., and D. M. Kupfer, 1977 Control of Saccharo- required for lagging strand DNA synthesis in reconstituted sys- myces cerevisiae 2microN DNA replication by cell division cycle tems. J. Biol. Chem. 270: 4193–4196. genes that control nuclear DNA replication. J. Mol. Biol. 116: Spiro, C., R. Pelletier, M. L. Rolfsmeier, M. J. Dixon, R. S. Lahue 249–260. et al., 1999 Inhibition of FEN-1 processing by DNA secondary Louis, E. J., and J. E. Haber, 1990 The subtelomeric YЈ repeat family structure at trinucleotide repeats. Mol. Cell 4: 1079–1085. in Saccharomyces cerevisiae: an experimental system for repeated Teng, S. C., and V. A. Zakian, 1999 Telomere-telomere recombina- sequence evolution. Genetics 124: 533–545. tion is an efficient bypass pathway for telomere maintenance in Lundblad, V., and E. H. Blackburn, 1993 An alternative pathway Saccharomyces cerevisiae. Mol. Cell. Biol. 19: 8083–8093. for yeast telomere maintenance rescues est1-senescence. Cell 73: Teng, S. C., J. Chang, B. McCowan and V. A. Zakian, 2000 Telo- 347–360. merase-independent lengthening of yeast telomeres occurs by an Lundblad, V., and J. W. Szostak, 1989 A mutant with a defect abrupt Rad50p-dependent, Rif-inhibited recombinational pro- in telomere elongation leads to senescence in yeast. Cell 57: cess. Mol. Cell 6: 947–952. 633–643. Tishkoff, D. X., N. Filosi, G. M. Gaida and R. D. Kolodner, 1997 Makarov, V. L., Y. Hirose and J. P. Langmore, 1997 Long G tails at A novel mutation avoidance mechanism dependent on S. cerevis- both ends of human chromosomes suggest a C strand degradation iae RAD27 is distinct from DNA mismatch repair. Cell 88: 253– mechanism for telomere shortening. Cell 88: 657–666. 263. McClintock, B., 1941 The stability of broken ends of chromosomes Vallen, E. A., and F. R. Cross, 1995 Mutations in RAD27 define a in Zea mays. Genetics 26: 234–282. potential link between G1 cyclins and DNA replication. Mol. Cell. McEachern, M. J., A. Krauskopf and E. H. Blackburn, 2000 Telo- Biol. 15: 4291–4302. meres and their control. Annu. Rev. Genet. 34: 331–358. Waga, S., and B. Stillman, 1998 The DNA replication fork in eukar- McElligott, R., and R. J. Wellinger, 1997 The terminal DNA yotic cells. Annu. Rev. Biochem. 67: 721–751. structure of mammalian chromosomes. EMBO J. 16: 3705–3714. Watson, J. D., 1972 Origin of concatemeric T7 DNA. Nat. New Biol. Moyzis, R. K., J. M. Buckingham, L. S. Cram, M. Dani, L. L. Deaven 239: 197–201. et al., 1988 A highly conserved repetitive DNA sequence, Wellinger, R. J., and D. Sen, 1997 The DNA structures at the ends (TTAGGG)n, present at the telomeres of human chromosomes. of eukaryotic chromosomes. Eur. J. Cancer 33: 735–749. Proc. Natl. Acad. Sci. USA 85: 6622–6626. Wellinger, R. J., A. J. Wolf and V. A. Zakian, 1992 Use of non- Nakamura, T. M., and T. R. Cech, 1998 Reversing time: origin of denaturing Southern hybridization and two dimensional agarose telomerase. Cell 92: 587–590. gels to detect putative intermediates in telomere replication in Nugent, C. I., and V. Lundblad, 1998 The telomerase reverse tran- Saccharomyces cerevisiae. Chromosoma 102: S150–S156. scriptase: components and regulation. Genes Dev. 12: 1073–1085. Wellinger, R. J., A. J. Wolf and V. A. Zakian, 1993a Origin activation Olovnikov, A. M., 1973 A theory of marginotomy. J. Theor. Biol. and formation of single-strand TG1-3 tails occur sequentially in late 41: 181–190. S phase on a yeast linear plasmid. Mol. Cell. Biol. 13: 4057–4065. Parenteau, J., and R. J. Wellinger, 1999 Accumulation of single- Wellinger, R. J., A. J. Wolf and V. A. Zakian, 1993b Saccharomyces stranded DNA and destabilization of telomeric repeats in yeast telomeres acquire single-strand TG1-3 tails late in S phase. Cell 72: mutant strains carrying a deletion of RAD27. Mol. Cell. Biol. 19: 51–60. Wellinger, R. J., K. Ethier, P. Labrecque and V. A. Zakian, 1996 4143–4152. Evidence for a new step in telomere maintenance. Cell 85: 423– Price, C. M., 1997 Synthesis of the telomeric C-strand. A review. 433. Biochemistry 62: 1216–1223. Wright, W. E., V. M. Tesmer, K. E. Huffman, S. D. Levene and Qi, H., and V. A. Zakian, 2000 The Saccharomyces telomere-binding J. W. Shay, 1997 Normal human chromosomes have long G-rich protein Cdc13p interacts with both the catalytic subunit of DNA telomeric overhangs at one end. Genes Dev. 11: 2801–2809. polymerase alpha and the telomerase-associated est1 protein. Zakian, V. A., 1995 Telomeres: beginning to understand the end. Genes Dev. 14: 1777–1788. Science 270: 1601–1607. Reagan, M. S., C. Pittenger, W. Siede and E. C. Friedberg, 1995 Zakian, V. A., 1996 Structure, function, and replication of Saccharo- Characterization of a mutant strain of Saccharomyces cerevisiae myces cerevisiae telomeres. Annu. Rev. Genet. 30: 141–172. with a deletion of the RAD27 gene, a structural homolog of the Zakian, V. A., and J. F. Scott, 1982 Construction, replication, and RAD2 nucleotide excision repair gene. J. Bacteriol. 177: 364–371. chromatin structure of TRP1 RI circle, a multiple-copy synthetic Rose, M. D., F. Winston and P. Hieter, 1990 Methods in Yeast Genet- plasmid derived from Saccharomyces cerevisiae chromosomal ics: A Laboratory Course Manual. Cold Spring Harbor Laboratory DNA. Mol. Cell. Biol. 2: 221–232. Press, Cold Spring Harbor, NY. Sambrook, J., E. F. Fritsch and T. Maniatis, 1989 Molecular Clon- Communicating editor: L. Pillus