Copyright 2002 by the Genetics Society of America Differential Processing of Leading- and Lagging-Strand Ends at Saccharomyces cerevisiae Telomeres Revealed by the Absence of Rad27p Nuclease Julie Parenteau and Raymund J. Wellinger1 De´partement de Microbiologie et Infectiologie, Faculte´ de Me´decine, Universite´ de Sherbooke, Sherbooke, Quebec J1H 5N4, Canada Manuscript received May 28, 2002 Accepted for publication September 16, 2002 ABSTRACT Saccharomyces cerevisiae strains lacking the Rad27p nuclease, a homolog of the mammalian FEN-1 protein, display an accumulation of extensive single-stranded G-tails at telomeres. Furthermore, the lengths of telomeric repeats become very heterogeneous. These phenotypes could be the result of aberrant Okazaki fragment processing of the C-rich strand, elongation of the G-rich strand by telomerase, or an abnormally high activity of the nucleolytic activities required to process leading-strand ends. To distinguish among these possibilities, we analyzed strains carrying a deletion of the RAD27 gene and also lacking genes required for in vivo telomerase activity. The results show that double-mutant strains died more rapidly than strains lacking only telomerase components. Furthermore, in such strains there is a significant reduction in the signals for G-tails as compared to those detected in rad27⌬ cells. The results from studies of the replication intermediates of a linear plasmid in rad27⌬ cells are consistent with the idea that only one end of the plasmid acquires extensive G-tails, presumably the end made by lagging-strand synthesis. These data further support the notion that chromosome ends have differential requirements for end processing, depending on whether the ends were replicated by leading- or lagging-strand synthesis. ELOMERES, the complex nucleoprotein struc- species, G-tails are much shorter (14–16 bases) and in Ttures at the ends of eukaryotic chromosomes, are yeast, a similarly short overhang is suspected to be pres- essential for chromosome integrity: they protect chro- ent (Wellinger and Sen 1997). However, the length mosome ends from degradation and random fusion of the G-tails is subject to variation during the cell cycle. events (McClintock 1941; Sandell and Zakian 1993), For example, yeast telomeres acquire a transient Ն30- and they ensure the complete replication of the chromo- base G-tail specifically during S-phase, when the telo- somal DNA (Watson 1972; Greider 1996; Zakian meres are replicated (Wellinger et al. 1993b, 1996). 1996). Telomeric DNA is composed of short, direct re- Although there is mounting evidence that conven- peats in the majority of eukaryotic species (Wellinger tional DNA replication and the specialized replication and Sen 1997). For example, vertebrate telomeric re- to maintain telomeric repeats are interrelated, little is peats can be abbreviated as C3TA2/T2AG3 and, in Saccha- known about mechanistic details of how this coordina- romyces cerevisiae, chromosomes end in 300 bp of a het- tion is achieved (Price 1997; Diede and Gottschling erogeneous repeat sequence that can be abbreviated as 1999; Adams Martin et al. 2000). All conventional DNA C1–3A/TG1–3 (Shampay et al. 1984; Moyzis et al. 1988). polymerases need a primer, usually in the form of RNA, Virtually all telomeric-repeat sequences are similar in and synthesize DNA in the 5Ј → 3Ј direction (reviewed that they contain clusters of G residues in the strand in Waga and Stillman 1998). Given these properties, Ј Ј running 5 –3 from the centromere toward the physical conventional replication is expected to leave at least end of the DNA molecule (the G-rich strand; Wel- primer-sized gaps on the 5Ј end of the new strands that linger and Sen 1997). Most of the telomeric-repeat were made by lagging-strand synthesis, but also to be DNA is duplex and, in general, at the very ends of the able to completely copy the C-rich strands on the lead- chromosomes the G-rich strand protrudes into the C-rich ing-strand ends (Olovnikov 1973; reviewed in Zakian strand by a variable number of nucleotides, depending 1995). The incurring losses of terminal sequences are on the species. For vertebrate chromosomes, this G-rich counteracted by telomerase, a telomere-specific reverse strand overhang (hereafter called G-tail) may span 50– transcriptase, which uses its RNA component as a tem- 150 bases (Makarov et al. 1997; McElligott and Wel- plate for addition of new telomeric repeats of the G-rich linger 1997; Wright et al. 1997). In certain ciliate strand onto chromosome ends (reviewed in Greider 1995; Lingner and Cech 1998; Nakamura and Cech 1998). Thus, the particularities of chromosome end rep- 1Corresponding author: De´partement de Microbiologie et Infectiolo- lication entail a specialized enzyme for new leading- gie, Faculte´ de Me´decine, Universite´ de Sherbooke, 3001 12 Ave. Nord, Sherbooke, Quebec J1H 5N4, Canada. strand synthesis (telomerase) and for continued lag- E-mail: [email protected] ging-strand synthesis and a mechanism to convert the Genetics 162: 1583–1594 (December 2002) 1584 J. Parenteau and R. J. Wellinger blunt ends created at the leading-strand ends into ends Rad27p in yeast cells should result in an accelerated with a G-tail. Previous evidence suggested a model in loss of telomeric repeats. Indeed, we observe that cells which a strand-specific 5Ј–3Ј exonuclease generated a with a deletion of RAD27 and lacking telomerase compo- G-tail, at least at the leading-strand ends (Wellinger nents are not able to grow for the same number of et al. 1996; Makarov et al. 1997), and this exonuclease generations as cells lacking only telomerase. In addition, could be associated directly with the DNA replication the relative signals for G-tails on telomeres derived from machinery (Dionne and Wellinger 1998). In light of the double-mutant strains were significantly higher than all of the above, it is not surprising that some compo- those from wild type or telomerase-lacking strains. nents of the conventional replication machinery appear These data suggest that in telomeric DNA, an absence to be involved in the control of telomere length (Car- of Rad27p results primarily in incomplete synthesis of son and Hartwell 1985; Adams and Holm 1996; the C-rich strands, generating an excess of G-tails. These Diede and Gottschling 1999; Parenteau and Wel- G-tails may then be further elongated in a telomerase- linger 1999; Adams Martin et al. 2000). Among them dependent fashion. The analyses of replication interme- is the yeast Rad27p protein, a homolog of the mamma- diates of a linear plasmid derived from rad27⌬ cells lian FEN-1 protein (flap endonuclease 1, or 5Ј-exo- further corroborate this conclusion in that they suggest nuclease 1; Harrington and Lieber 1994a,b). Deletion that excess G-tails occur on only one end of the plasmid, of RAD27 in yeast results in several distinct phenotypes, presumably the end replicated by lagging-strand synthe- including a temperature-sensitive growth defect (Reagan sis. We interpret these data to support the notion that et al. 1995; Sommers et al. 1995), an elevated spontane- chromosomal ends are processed differently, depending ous mutation rate (Tishkoff et al. 1997), high levels of on whether the newly synthesized strand on a particular instability of micro- and minisatellite sequences (John- end was generated by leading- or lagging-strand synthe- son et al. 1995; Freudenreich et al. 1998; Kokoska et al. sis (Bailey et al. 2001). 1998; Schweitzer and Livingston 1998; Spiro et al. 1999), and sensitivity to alkylating agents like methyl methanesulfonate (Reagan et al. 1995). These identi- MATERIALS AND METHODS fied phenotypes suggest functions for Rad27p in DNA Strains and plasmids: Yeast strains used in this study are replication and repair (Tishkoff et al. 1997; Kokoska listed in Table 1. UCC3535 (gift of M. Singer and D. Gottsch- et al. 1998), and in particular, they are consistent with a ling; Wellinger et al. 1996) was transformed with the 2.3-kb ⌬ proposed role of Rad27p in the removal of RNA primers EcoRI-SphI fragment of pMRrad27 ::URA3 (obtained from E. Friedberg and M. Reagan; Reagan et al. 1995) to delete the during the processing of Okazaki fragments (Bae et al. RAD27 gene. The resulting strain was named RWY20. The 2001). Moreover, yeast cells carrying a deletion of haploids JPY204c and JPY206b were obtained after sporulation RAD27 also display a high degree of telomeric-repeat and dissection of spore tetrads of RWY20. RWY25 diploid instability (Parenteau and Wellinger 1999). How- strain was obtained by mating JPY204c and JPY206b. RWY26 ever, at the telomeres, not only overall telomere repeat was generated by transformation of the RWY25 strain with the 2.7-kb BamHI-SphI fragment of pVL152 (Lundblad and length, but also the particular DNA end structure is Szostak 1989; kindly provided by V. Lundblad) to delete the affected (Parenteau and Wellinger 1999). When cul- EST1 gene. The entire coding region of the EST3 gene was tures are incubated at the nonpermissive temperature replaced by the HIS3 gene in strain RWY25 to yield strain for rad27⌬ cells, an appearance of an abnormally large RWY27. The est3 deletion fragment was generated by using amount of G-tails can be detected (Parenteau and plasmid pRS303 (Sikorski and Hieter 1989) and the follow- ing PCR deletion primers: EST3D-F, 5Ј-ATGCCGAAAGTAAT Wellinger 1999). Since the C1–3A strand at the end of TCTGGAGTCTCATTCAAAGCCAACAGAGATTGTACTGAG chromosomes is synthesized by lagging-strand synthesis AGTGCAC-3Ј and EST3D-R, 5Ј-GTCATAAATATTTATATAC (reviewed in Price 1997), these results suggested a spe- AAATGGGAAAGTACTTAACGACTGTGCGGTATTTCACA cific defect for synthesizing the C-rich strand in rad27⌬ CCG-3Ј (the underlined bases are complementary to pRS plas- cells. Alternatively, it remained possible that the genera- mids). The resulting colonies of these three transformations ⌬ were monitored for deletion on one allele by Southern analysis tion of the excess G-tails in rad27 cells was due to an (data not shown).