The Molecular Biology of Toroviruses

CHAPTER 11

ERle J. SNIJDER AND MARIAN C. HORZINEK

I. INTRODUCTION

Recently, the International Committee on the Taxonomy of Viruses has in cluded the toroviruses as a new genus in the previously monogeneric family of the Coronaviridae (Pringle, 1992 j Cavanagh et al., 1994). Toroviruses and corona virus es share some similarities in their structure and biology (see Chapter 18, this volumeh however, it was the molecular characterization of the torovirus prototype, Berne virus (BEV), that produced the evidence for an evolutionary link between the two virus groups. After the recognition of the link between toroviruses and coronaviruses, the genome organization and replication strategy of a third virus group, the arteriviruses, were found to be strikingly similar to both genera of the Corona viridae (Den Boon et al., 1991b). However, it is evident that the arteriviruses are more distantly related than toroviruses and coronaviruses, and the inclusion of the arteriviruses as a third genus in the Coronaviridae was deemed inappropri ate. Nevertheless, to indicate the ties between coronaviruses, toroviruses, and arteriviruses the unofficial term "coronaviruslike superfamily" has been put forward (Den Boon et al., 1991b). The similarities and differences between the members of this superfamily will be discussed elsewhere (Chapter 12, this

ERIC J. SNIJDER • Department of Virology, Institute of Medical Microbiology, Leiden Univer sity, 2300 AH Leiden, The Netherlands. MARIAN C. HORZINEK • Virology Division, De partment of Infectious Diseases and Immunology, University of Utrecht, 3584 CL Utrecht, The Netherlands. The Coronaviridae, edited by Stuart G. Siddell, Plenum Press, New York, 1995.

219 220 ERle J. SNIJDER AND MARIAN C. HORZINEK volume). In this chapter, we will focus on the molecular analysis of the torovirus particle, genome, mRNAs, and structural and nonstructural proteins.

11. THE TOROVIRION

The equine torovirus BEV was isolated from a diarrheic horse in 1972 at the University of Berne, Switzerland. However, the virus was not studied in detail until particles with the same morphology were observed in the feces of diar rheic cattle in Breda, Iowa, in 1979 (Weiss et a1., 1983; Woode et a1., 1982). Similar pleiomorphic virus es were also found in human feces collected in Birmingham, UK, and Bordeaux, France (Beards et a1., 1984, 1986) and, more recently, in Toronto, Canada (Tellier and Petric, 1993). To date, BEV is the only torovirus that can be propagated in cultured cells. As a result, it is the best-studied member of the genus. The unique structure of the torovirus particle initially led to the proposal of a new family of enveloped animal viruses, the Toroviridae (Horzinek and Weiss, 1984; Horzinek et a1., 1987). As illustrated in Figs. 1 and 2, toroviruses are enveloped pleiomorphic particles measuring 120 to 140 nm in their largest axis. Spherical, oval, elon gated, and kidney-shaped viruses are observed (Weiss et a1., 1983). Drumstick shaped projections, very similar to the spikes of coronaviruses, decorate the virion surface. However, as illustrated in Fig. 2A, the nucleocapsid structure of the toroviruses is very different from that of coronaviruses: the core of the torovirion is formed by an electron-dense, tubular structure, which may be straight or may display the typical toro-shape, that is prevalent in mature virions. The straight form is observed especially prior to the process of budding, which takes place at intracellular membranes, predominantly those of the Golgi system (Weiss and Horzinek, 1986; Fagerland et a1., 1986). The current structural model of BEV, based on electron micrographs and the molecular data described below, is shown in Fig. 2B.

FIGURE 1. Negative staining of Beme virus particles. Magnification: approximately 150,000x (Weiss et al., 1983). MOLECULAR BIOLOGY OF TOROVIRUSES 221

III. THE TOROVIRUS GENOME

The BEV genome is a single molecule of infectious, polyadenylated RNA (Snijder et a1., 1988) with an estimated size of 25-30 kb. This size estimate is based on the sequence analysis of a substantial part of the genome (about 16 kb) and the paralleis between the genome organization of BEV and other members of the Coronaviridae. The BEV genome probably contains six open reading frames (ORFs) (Fig. 3). As for all other coronaviruses, the two most 5' reading frames (ORF 1a and 1b) are translated from the genomic RNA and constitute the viral replicase gene. The four remaining reading frames, of which ORFs 2, 3, and 5 have been identified as structural genes, are expressed by generation of a 3' -co terminal nested set of mRNAs (see Section IV). The two parts of the BEV genome that have been sequenced are separated by a gap in the ORF 1a region. About 1.5 kb of the 5' end sequence of the BEV genome was determined from cDNA clones derived from genomic RNA and defective interfering (DI) RNAs (Snijder et a1., 1991b). A sequence of about 14.5 kb, starting 1 kb upstream of the ORF 1ajORF 1b ribosomal frameshift site and ending at the 3' poly(A) tail, was obtained by analysis of a cDNA library prepared from poly(A)-containing RNA from BEV-infected cells (Snijder et a1., 1990a,c). Assuming that the 5' ends of the BEV genome and BEV DI RNAs are colinear, the ORF 1a initiation codon is located at nucleotide (nt) position 825- 827 in the genome. The region upstream of ORF 1a is probably untranslated since it contains only one other AUG codon (nt 22-24) that is followed by a UGA termination co don three triplets downstream (Snijder et a1., 1991b). The 3' nontranslated region (NTR) of the BEV genome encompasses 200 nt, excluding the po1y(A) tail (Snijder et a1., 1989). Interesting1y, a computer anal ysis of this region reveals a large potential stem-Ioop structure that may be one of the signals for viral RNA replication (Snijder et a1., 1989). The 3' NTR is the on1y region of the genome for which the sequence of a second torovirus, the bovine Breda virus (BRV), is available. A short 269-nt sequence upstream of the BRV poly(A) tail was obtained from the analysis of a cDNA library prepared from genomic RNA purified from the fe ces of an infected anima1 (Koopmans et a1., 1991). This sequence, comprising the 3' end of the BRV nucleocapsid (N) pro tein gene and the 3' NTR, is 93% identical to the BEV sequence. Hybridiza tion experiments suggest that there is a high degree of sequence similarity between equine and bovine toroviruses, with the possible exception of the 5' part of the spike (S) pro tein gene (Koopmans et a1., 1991).

IV. BERNE VIRUS TRANSCRIPTION AND TRANSLATION

A 3' -coterminal nested set of 5 mRNAs (including the genome) is generated during BEV replication (Snijder et a1., 1990c) (Fig. 3). The estimated sizes of these RNAs and their relative abundance late in infection (Snijder et al., 1988) are listed in Table I. A

B s

M---E- 26K N ---r 18K ss+ RNA 25- 30 kb MOLECULAR BIOLOGY OF TOROVIRUSES 223

The analysis of BEV subgenomic (sg) RNA synthesis by UV transcription mapping (Snijder et a1., 1990c) indicates that (late in infection) the BEV mRNAs are transcribed independently, i.e., from separate transcription units. In com mon with other coronaviruses, the BEV genomic sequence contains conserved intergenic sequences that are probably involved in mRNA transcription. For some coronaviruses, these intergenie motifs [e.g., 5' AAUCuAuAC 3' for mu rine hepatitis virus (MHV)] have been identified as the site where the common 5' leader sequence is fused to the mRNA bodies (Spaan et a1., 1988; Lai, 1990). Although the torovirus genome contains conserved AU-rieh intergenic se quences (5' uaUcUUUAGa 3') (Fig. 4), there appears to be an important differ ence, since in the case of torovirus RNAs no evidence for fusion of a common leader to mRNA bodies at this position has been obtained. Thus, none of the clones from a cDNA library prepared from poly(A)-selected intracellular RNA contained a candidate leader sequence. In addition, primer extension analyses of RNA 5 and 01 RNAs indieated that BEV mRNAs terminate at, or just upstream of, the conserved intergenic sequence (Snijder et a1., 1990c, 1991b). In terms of transcription, however, the consequences of this dissimilarity be tween toro- and coronaviruses could be limited: direct binding of the poly merase to the various BEV "core promoters" on a negative-stranded template could simply replace a leader-priming mechanism. In addition to the products of ORFs 2, 3, 4, and 5, which are assumed to be synthesized by monocistronie translation of a nested set of structurally poly cistronic mRNAs, the 3' part of the BEV genome may encode one more protein: ORF 5 completely overlaps with a 264-nt ORF that potentially encodes a hydro phobie lO-kDa protein. Although no such pro tein has been observed in virions or BEV-infected cells, it is remarkable that a similar situation, a small hydro phobie protein expressed from an ORF that completely overlaps with the N pro tein gene, has been reported for the bovine coronavirus (BCV) (Senanayake et a1., 1992). BEV ORF 1b is expressed from the genomic RNA by a -1 ribosomal frame shift (Snijder et a1., 1990a), which apparently is one of the hallmarks of the coronaviruslike supergroup. As a result, two proteins are produced from the replicase region: the ORF 1a protein and an ORF 1a/1b fusion protein. BEV ORF 1a ends with the nucleotide sequence 5' U UUA AAC UGU UGA 3', in whieh the UGA codon terminates ORF 1a translation. The heptanucleotide sequence 5' U UUA AAC 3' is one of the typieal"shifty sequences," which have been described to be present at ribosomal frameshift sites of an increasing number of virus es (Jacks et a1., 1988; Brierley et a1., 1989; Ten Dam et a1., 1990). Two versions of the downstream RNA pseudoknot (PK), which usually accompanies a shifty heptanucleotide and which is thought to promote frameshifting by

FIGURE 2. (A) Different forms of BEV particles visualized in ultrathin seetions of BEV-infeeted equine dermis eells. On the right, eleetron micrographs of BEV particles are shown; on the left, sehematie interpretations of the viral struetures seen in the eorresponding photographs are pre sented. Seetion planes "1" and "2/1 cut the nucleoeapsid twiee and onee, respeetively (Weiss and Horzinek, 1987). (B) Sehematie representation of the arehiteeture of BEV, the torovirus prototype. The loealization and sizes of the struetural proteins and genome are indieated (Snijder and Horzinek, 1993). 224 ERIC J. SNIJDER AND MARIAN C. HORZINEK

replicase S MN H 5,LHH.·.·.·.H·.·.·.·.·. ····ll---l ~o 3' ORF 18 1b 2 345 RNA ------1 2 3 4 5 FIGURE 3. Genome organization and expression of BEV. The loeation of the 6 ORFs is indieated. The dashed Hnes indicate the ORF la region that remains to be sequenced (estimated size: 10 to 12 kb). The lower part of the figure shows the relationship of the genome and the nested set of mRNAs generated in infeeted eells (Snijder and Horzinek, 1993).

stalling the ribosome at the frameshift site, ean be predieted for BEV (Eg. 5). They differ in the size of loop 2 (L2), whieh is either 11 (PK1) or 69 nt (PK2). The BEV frameshift signal was tested in vitra and in viva using a reporter gene eonstruet. Frameshift effieieneies between 20 and 30% were observed. A dele tion mutation whieh obviates the posibility of a PK2 strueture in the tran seribed RNA did not influenee the frameshift efficieney, suggesting that it, in fact, is PK1 that is involvedin the regulation of ORF 1b expression (Snijder et a1., 1990a).

V. DI PARTICLES AND RNAs OF BEV

DI RNAs were readily generated during undiluted passage of BEV in embry onic mule skin eells (Snijder et a1., 1991b). The sequenee of two small BEV DI genomes, which arose and interfered strongly with viral replieation within five undiluted passages, has been determined. A DI RNA of about 1 kb was found to eontain about 600 nt from the 5' end of the viral genome and 242 nt [excluding the poly(A) tail] from the 3' end. A somewhat larger DI RNA (1.4 kb) eontained larger parts from the same segments of the genome (about 700 and 441 nt, respeetively) and an additional eentral part of 100 nt, which is thought to be

TABLE I. Characteristics of BEV RNAs and ORFs Relative Position Number Calculated Size molarity Encoded upstream of of aa size RNA Ikb) 1%) ORF 3' end encoded IkDa) Protein 25-301 2 la 1-13,468 Replicase 1b 13,477-M04 2291 261 Replicase 2 6.9 3 2 6,684-1,941 1581 178 Spike 3 2.1 30 3 1,909-1,210 233 26 Membrane 4 1.4 13 4 1,150-724 142 16 Pseudogenel 5 0.8 52 5 680-200 160 18 Nucleocapsid MOLECULAR BIOLOGY OF TOROVIRUSES 225

******************* MA2 GUGCCUAAUUUUUAAAGUGUUUAGUACUAGUUUUA MA3 AGAAAAGUUAGUCACUUUCUUUAGAAGAAGGUUGC MA4 GUUUGAGUAGCCACUUAUCUUUAGAAGAUGUUGAU MA5 GUUAGUGAGAGACACUAUCUUUAGAGAAAGAGCCA CI N N A A C G U A U C U U U AGA A G U U U A U G U U

*******************

FIGURE 4. Alignment of putative BEV "eore promoterlll sequenees (indieated with asterisksl and their flanking eontext. Fully eonserved nucleotides are boxed. The sequenees are derived from sequenee analysis of the genome (Snijder et a1. , 1990el and of DI RNAs (Snijder et a1. , 1991bl of BEV (Snijder and Horzinek, 19931.

derived from the ORFla region, since it does not match any of the known BEV sequences. The composition of the l-kb DI genome suggests that the minimal se quences required for BEV RNA replication land probably also packaging) are located in two small domains present at the termini of the genomic RNA. This suggests a difference with members of the genus coronavirus. The generation and construction lat the cDNA level) of MHV DI genomes that are both repli cated and packaged has been described, and DI-based systems are currently being used to study viral transcription and replication IMakino 1990, 1991; van der Most et al., 1991, 1992). However, all viable MHV DI RNAs contain at least three segments from the viral genome. In addition to 5' and 3' sequences, sequences from ORFlb, which are assumed to contain a packaging signal, are required for efficient propagation of MHV DI genomes IMakino et al., 1990, 1991; Van der Most et al., 1991). Although BEV DI genomes and particles were initially generated and used as a tool to study viral replication, they also provide information on the previ ously decribed heterogeneous nature of BEV preparations IWeiss et al., 1983; Snijder et al., 1988). A second peak of virus-specific material, sometimes re ferred to as 50S particles, has been observed in both isokinetic and isodensity gradients. Ultracentrifugation experiments, using virus stocks containing the l-kb DI RNA, confirmed that this second peak represented particles that con tained the DI genome and displayed both smaller S values ISO-lOOS instead of 400S) and lower densities 11.07-1.11 gjml vs.1.16 gjml in sucrose) than standard virions. However, the protein composition of BEV DI particles remains to be studied in detail, especially since preliminary data suggested that both the S protein and the N protein were absent, or present only in very small quantities ISnijder et al., 199Ib).

VI. THE BERNE VIRUS REPLICASE GENE

In addition to the discovery that the genome organization and expression strategy of toroviruses are very similar to those of coronaviruses, sequence t-> ~

AUUGUGAAAG ACCAGUCU G C i U ""- C C G c G C G 3' A A U A G G C G ------C G U --_. A U 'nIli":' A pg~1 G C C-G A A IA AC U UA A U C-G G-C UAU G GUCA GGUU AGUU A U G G A G-C U-A I I I I I I I I I I I I I I I I U A G-U AUACCAGU UCAA UCAA A A U-A C cu GG AC C-G G-C C 5' A-U G C-G C G-C U t G-C U-A AUUUAAACUGUUGA-U G U ------G u G G-U Uu U U G-C U A tT1 5' CA A A A-U U ~ t G-C L1 n ':""' A.';J ~u!,~A_CUGU~-UG S1 05' 3' L1 S2 i~ L2 B •••• "" S2 5' L2 ~ ~3 ~ ~ FIGURE 5. Predicted secondary and tertiary RNA structure of the BEV ORF la/lb overlap region. (AI Predicted structure of the RNA pseudoknot PKl. The "slippery" sequence U UUA AAC is indicated by a dashed line. The ORF la termination co don is underlined. (BI § Schematic representation of PKl. The basepaired stern structures SI and S2 and the connecting loops LI and L2 are indicated. (CI Alternative model of the RNA pseudoknot PK2. (D) Schematic representation of PK2. The 49-nt box indicates the possible internal stem o ::r: loop structure in L2 as shown in panel C (Snijder et al., 1990al. o z~ ~ MOLECULAR BIOLOGY OF TOROVIRUSES 227 analysis of the BEV ORFlb region also provides conc1usive evidence for an ancestral relationship between the two virus groups (Snijder et a1., 1990a). Two of the three basic enzymatic activities that are usually encountered in the replicase pro teins of positive-stranded RNA viruses (polymerase, helicase, and protease) are encoded by the ORFlb sequence of toro- and coronaviruses (Figs. 6 and 7), namely, the polymerase (or SDD) domain (Poch et a1., 1989) and the NTP-dependent helicase domain (Gorbalenya and Koonin, 1993). On the basis of the sequence analysis shown in Fig. 7, the percentage of identical amino acids (aa) in toro- and coronavirus polymerase and helicase domains can be calculated at 40 to 45% (70-90% between members of the genus coronavirus). This analysis c1early separates the toro- and coronavirus sequences from the corresponding domains of other virus (super)groups and also illustrates the relatively large evolutionary distance between the two genera of the family Coronaviridae. In addition to the "universal" domains described above, a number of less striking sequence similarities, which nevertheless appear to be Coronaviridae specific, have been detected. The most remarkable example of such a domain is found at the C-terminus of the ORF 1b protein (Snijder et a1., 1990a) (Figs. 6 and 7). The last 300 aa of the ORF 1b product are approximate1y 40% identical when toroviruses and coronaviruses are compared. Additional smaller conserved mo tifs are a cysteine/histidine-rich domain, located between the polymerase and helicase regions, and a short region of the ORFla protein, just upstream of the ribosomal frameshift site (Snijder et a1., 1990a, 1991a). Several putative protease domains, be10nging to different protease super groups, have been identified in the ORFla proteins of the coronaviruses avian infectious bronchitis virus (IBV), MHV, and human coronavirus (HCV) 229E (Gorba1enya et a1., 1989; Lee et a1., 1991; Herold et a1., 1993). Unfortunately, only short sequences from both ends of the BEV ORFla protein are available and these do not contain any obvious protease domains. Therefore, it remains to be seen whether the proteolytic processing pattern of the torovirus replicase fol- 10ws the examp1es provided hy the corresponding proteins of coronaviruses and arteriviruses (Snijder and Horzinek, 1993). For these two virus groups, a pro tease be10nging to the chymotrypsin/3C-like supergroup is predicted to be the main protease, responsible for the processing of the C-terminal part of the ORFla protein and the ORFlh polypeptide. Additional protease domains, he longing to the papainlike family of proteolytic enzymes, direct the processing of the N-terminal part of the ORFla product (Snijder et a1., 1992; Baker et a1., 1993).

VII. THE STRUCTURAL PROTEINS OF TOROVIRUSES

Torovirus proteins were initially analyzed by metabolic labeling of BEV infected cells (Horzinek et a1., 1984). Subsequent sequence analysis of the structural genes and characterization of their products identified three struc tural proteins: a 19-kDa nuc1eocapsid (N) pro tein, a 26-kDa integral membrane protein, and a 180-kDa spike pro tein (which is posttranslationally c1eaved into 228 ERIC J. SNIJDER AND MARIAN C. HORZINEK A

o 500 1000 1500 2000

• 2500 / .'

2000

IBV 1500 ,. " , .

1000

/ . 500

. , o

BEV FIGURE 6.

two subunits). These proteins were assigned to ORFs 5, 3, and 2, respectively, in the BEV genomic sequence (Fig. 3) (Den Boon et al., 1991aj Snijder et al., 1989, 1990b). Although the small-membrane protein and the spike protein were ini tially termed E (for envelope) and P (for peplomerJ, they have now been renamed to M and S to follow the coronavirus protein nomenclature (Snijder and Horzinek, 1993). Since BRV cannot be grown in cultured cells, its protein composition was studied by means of surface radioiodination of purified virus (Koopmans et a1., 1986). Possible virus-speciflc polypeptide species of 20, 37, 85, and 105-kDa were identifled in this manner. MOLECULAR BIOLOGY OF TOROVIRUSES 229

B [··········iä·HH·······l ...... c d e f 1b BEV ••• 11 a b I 1a I c d e f T 1b 11 IBV ••• a a b I I 1a 111 c d e f T 1b 11 HCV229E ••• a a b I I 1a c d e f • T 1b 11 MHV ••• FIGURE 6. (A) Proportional dot matrix comparison of the amino acid sequences of the predicted ORF Ib products of the torovirus BEV and the coronavirus mv (Snijder et a1., 1990a). (B) Position of conserved domains in the replicases of the torovirus BEV and the coronaviruses IBV (Beaudette M42), MHV (strain A59), and HCV 229E: a, papainlike protease; b, 3C-like protease; c, polymerase; d, cysteinejhistidine-rich domain; e, helicase; f, C-terminallb domain. Sequence comparisons of domains c, e, and f are presented in Fig. 7.

A. The N Protein

A 19-kDa protein was present in purified BEV nucleocapsids that were obtained by detergent treatment of purified virus particles (Horzinek et al., 1985). This N protein is the most abundant structural protein of the BEV particle, accounting for about 80% of its protein mass. It is a phosphorylated protein with RNA-binding properties (Horzinek et al., 1985). By in vitra transla tion studies using BEV RNA 5 (Snijder et al., 1988) and sequence analysis af the region upstream of the poly(A) tail (Snijder et al., 1989) the N protein gene was identified as the 3/-terminal gene in the BEV genome. The N protein consists of 160 aa. It contains 7 (4 %) acidic and 22 (14 %) basic amino acid residues. The latter are especially clustered in a central domain of the N protein sequence: 15 basic residues are found between aa 34 and 80 (Snijder et al., 1989). The size of the BEV N protein (18.3kDa) is noticeably smaller than that of the corresponding pro tein of coronaviruses (45-55kDa) (Spaan et al., 1988). ApparentlYI the different architecture of the torovirus nucleocapsid, which is s; o

Polymerase domain

BEV 513 lIGvsKyglkfskfLkd-9-vfGsDYtKCDRtfPlsfR-17-Y-L-NE-1Z-GmllnKPGGTsSGDATTAhsNtfyN-51-yflnfLSODsfi-fs-37-eEFCSaH-10-L--PsrgRll ** * * * .* **** * * * • ** * ***** ******* * * **** **** * * * * IIV 582 vIGttKfyggwdnaLrn-9-lmGwDYpKCDRaMPnllR-Z1-YrLyNE-12-GgiyvKPGGTsSGDATTAyaNsvfN-57-fslmiLSODgvvcyn-4Z-hEFCSqH-1Z-LpyPdpsRl MHV 576 vIGttKfY9IWddMLrr-9-lmGwDYpKCDRamPnilR-Z1-YrLaNE-1Z-GcyyvKPGGTsSGDATTAfaNsvfN-57-fsmmiLSODgvvcyn-4Z-hEFCSqH-1Z-LpyPdpsRl MCV 515 vIGttKfyggwdnmLkn-9-lmGwDYpKCDRamPsmiR-Z1-YrLsNE-1Z-GgfyfKPGGTtSGDATTAyaNsvfN-57-fsmmiLSODsvvcyn-4Z-hEFCSqH-12-LpyPdpsRi

Helicase domain

BEV1097 v.GPPGtGKttf-61-cThNtLPfiksavliaoevsli-15-VVllGDPfQL-sP--v-23-yLtaCYRCPpqll-67-gLG-dvtTiDSsQGt-18-vNRviVgcsRst-thlv **** ** * * ** **** * *** ** • * ****. * ** * ** *. ** * * IIV 1206 vqGPPGsGKshf-66-sTiNaLPevscdillvOEVSml-16-VVyvGDPaQLpaPrtl-Z4-fLakCYRCPkelv-78-mLGlnyqTvOSsQGs-18-iNRfnValtRakrgilv trf MHV1199 vqGPPGtGKshl-66-tTiNaLPelvtdiivvOEVSml-16-yVyiGDPaQLpaPrvl-25-fLgtCYRCPkelv-75-vLGlqtqTvDSaQGs-18-vNRfnVaitRakkgilc MCV1Z00 iqGPPGsGKshc-66-sTvNaLPevnadivvvOEVSmc-16-iVyvGDPqQlpaPrvl-25-fLhkCYRCPaelv-75-lLGlqtqTvDSaQGs-18-aNRfnVaitRakkgifc ~ ~ '"z C-tenninal ORF Ib domain Btrf :;c BEV 1933 GGvH-31-Krt-TlvO-Z1-SKVifVniD-17-TfYP-Z5-NYG-10-NfaKYTQiC-16-GAagvdGcsPGdiVL-33-LiVSDiY-16-LALGGtivfKtTEsS-17-FfTagVNtSSSEvF ** * * * * *** * * * * *** * **** * ** * **.* * ** * ***** * ** * * * ** **** * ~ IIV zzaz GGlH-39-KqvcTvvO-Z1-SKVvtVsiD-16-TcYP-Z9-NYG-1'-NvaKYTQlC-17-GAgsdkGvaPGstVL-40-LviSOmY-32-lALGGsfavKvTEtS-17-FcTa-VNaSSSEaFCI MHV2315 GGlH-39-KsvcTviD-18-SKVvnVnvO-'6-TfYP-31-NYG-1'-NvaKYTQlC-17-GAgsdkGvaPGsaVL-40-LiiSOmY-28-LAlGGsvaiKiTEfS-17-FcTn-VNaSSSEgF MCVZZ81 GGlH-40-KtvcTymD-'8-SKVheViiD-'6-TfYP-30-NYG-"-NvvKYTQlC-'9-GAgsdyGvaPGtaVL-40-LlISOmY-28-LALGGslaiKvTEyS-17-FcTs-VNtSSSEaF FIGURE 7. Amino acids sequence cornparisons of the three most conserved domains of toro- and coronaviral ORF Ib proteins: polymerase, helicase, and ~ Z C-terminal domain, respectively. Residues identical in a11 four sequences are shown in capitals and indicated with asterisks. (1 o:r:

~ ~ MOLECULAR BIOLOGY OF TOROVIRUSES 231 tubular instead of the helical core found in the genus coronavirus, dictates the use of a different type of N protein. Therefore, it is not surprising that no significant sequence similarities are detected in the N proteins of toro- and coronaviruses are compared.

B. The M Protein

The BEV M pro tein, which is translated from ORF 3 (Snijder et a1., 1988), is an unglycosylated polypeptide (Horzinek et a1., 1986), accounting for about 13 % of the virion pro tein mass (Horzinek et a1., 1985). The M protein is a 26.5-kDa polypeptide of 233 aa. It does not contain an N-terminal signal sequence. In its N-terminal half, the three membrane-spanning a-helixes that are so charac teristic for coronavirus M pro teins are encountered (Fig. 8) (Den Boon et a1., 1991a). The small difference between the calculated and observed sizes of the M pro tein in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS PAGE) is explained by aberrant migration, probably due to the extreme hydro phobicity of the protein. The membrane topology of the M protein has been studied by in vitra translation using the M protein itself and a hybrid protein which contained a C-terminal tag (Den Boon et a1., 1991a). After in vitra translation in the presence of microsomes, about 85 % of the M protein was resistant to protease K diges tion. Therefore, its disposition in the membrane is thought to be very similar to that of the triple-spanning M proteins of coronaviruses such as MHV and IBV. The N-terminus is located in the lumen of the endoplasmic reticulum (and eventually at the virion surface), a large central part of the protein is embedded in the membrane, and the C-terminus is located at the cytoplasmic face of the endoplasmic reticulum. One of the hydrophobie transmembrane domains is assumed to function as an internal signal sequence. The BEV M hybrid carrying the C-terminal tag accumulated in intracellular membranes during transient expression experiments. Thus the torovirus M protein may playa role in the intracellular budding process, as has been suggested for its coronavirus counter part (Dubois-Dalcq et a1., 1982; Holmes et a1., 1981; Rottier et a1., 1981). Despite the striking similarities in size, structure, and functional charac teristics, no significant primary sequence similarities can be detected between the M protein sequences of BEV and coronaviruses (Den Boon et a1., 1991a). Still, the observed similarities are taken as evidence for a process of divergent evolu tion during which the properties essential for virus assembly have been con served.

C. The S Pro tein

The BEV envelope is studded with drumstick-shaped projections that mea sure about 20 nm in length (Weiss et a1., 1983) (Fig. 1). In early torovirus studies, the heterogeneous 75- to 100-kDa protein material was assumed to represent the viral spike protein(s), since it was recognized by both neutralizing and 232 ERlC J. SNlJDER AND MARlAN C. HORZlNEK

A 200 Q 0 ...... ,E .....~ >- ..CD 40 cGI GI -40 GI GI.. -Cl -120

B 200

Q 0 ..,....E 120 .....~ >- 40 ..CD GI C GI -40 GI ..GI -Cl -120

VIII. INDICATIONS FOR RECOMBINATION DURING TOROVIRUS EVOLUTION

Although all Coronaviridae display the same basic gene order (repliease, S, M, N), the number and loeation of additional reading frames in the genomie RNAis quite variable (Spaanet a1., 1988). RNArecombination, whichis eonsid ered an important faetor in RNA virus evolution (Strauss and Strauss, 1988; Goldbaeh and Wellink, 1988; Lai, 1992), is the most attractive explanation for the observed genetie heterogeneity. This idea is supported by the faet that MHV

f------ll00 am,no aCIdS I heptad repeat T c leavage slte D hydrophoblc segment t potentIal N-glycosylat,on slte

FIGURE 9. Schematic representation of the position of characteristie domains in the BEV peplomer protein. The positions of heptad repeats, hydrophobie segments, potential N-glycosylation sites and the putative cleavage site are indicated. In addition, a hydrophobicity plot of the amino acid sequence is presented. The plot was generated according to the method of Kyte and Doolittle (1982) using a window size of 21 (Snijder et a1., 1990b). 234 ERlC J. SNlJDER AND MARlAN C. HORZlNEK displays a high (homologous) recombination frequency (Makino and Lai, 1989; Spaan et a1., 1988; Lai, 1990, 1992), which may be a consequence of the replica tion strategy and replicase properties of coronaviruses. Although only the BEV genome has been (partially) sequenced, the toro virus es appear to follow the example of the coronaviruses. Thus, indications for two independent recombination events during BEV evolution have been ob tained (Snijder et a1., 1991a). The first putative recombination involves BEV ORF 4. Its 142-aa sequence shares 30-35% identical amino acid residues with the C-terminal parts of both the influenza C virus (IVC) and the coronavirus hemagglutinin esterase (HE) pro tein sequences, which were previously found to be related by common ancestry and heterologous recombination (Luytjes et a1., 1988; see also Chapter 8, this volume). Since the sequences corresponding to the 5' two thirds of the HE gene are lacking in BEV, ORF 4 has been hypothesized to be a pseudogene (Snijder et a1., 1991a). The second putative recombination event that has occurred during BEV evolution is quite similar to the case of ORF 4. The C-terminus of the BEV ORF 1a protein contains 31 to 36% identical amino acid residues compared with the N-terminal190 aa of the nonstructural coronavirus pro tein, ns30;32kDa (Bre denbeek et a1., 1990; Cox et a1., 1989). Like the HE protein gene, this ns pro tein is found only in the coronaviruses closely related to MHV (Snijder et a1., 1991a), where it is located between the polymerase and HE genes (Fig. 10). Apparently a sequence related to the 5' two thirds of this coronavirus nonstructural gene has been integrated into ORF 1a of BEV and is now expressed as part of its replicase. Remarkably, both recombinations previously described associate toro virus es with coronaviruses, in particular with the antigenic cluster to which MHV belongs, and it is clear that these sequence similarities must be the result of nonhomologous RNA recombination events. However, they do not imply that toroviruses are more closely related to the MHV cluster than to other

ORF1B ORF4 [ 1a .----s---, ~ 1 1b o BEV MN ns30K I 1a s ImJl MHV i 1b ru UU HE MN 1a s IOD 1b lliJw IBV M N FIGURE 10. Schematic representation of the genome organization of the torovirus BEV and the coronaviruses MHV and IBV. The replicase gene Ila and Ib) and the structural genes S, M, and N are indicated. Filled IORF 4/HE) and cross-hatched IORF la/ns30kDa) boxes indicate homologous sequences of BEV and MHV that are thought to be derived from independent recombination events ISnijder and Horzinek, 1993). MOLECULAR BIOLOGY OF TOROVIRUSES 235 coronaviruses. First, the homologous sequences are located at different posi tions in the genome (Fig. 10). Second, the BEV replicase is not more closely related to the MHV replicase than to, e.g., that of IBV. Third, the sequence similarities between the Sand M proteins of corona- and toroviruses are so low (see the previous paragraph) that the high similarities discussed above (>30% identical residues) can only be explained if divergence between BEV ORF 4 and the coronavirus HE gene, and between the BEV ORF 1a fragment and the coronavirus ns30/32-kDa gene is a more recent event than the divergence of the other homologous genes of toro- and coronaviruses. Considering the fact that several extant representatives of both virus groups cause enteric infections, direct recombination between toro- and coro naviruses during coinfection of the same cell is feasible. However, the involve ment of a third party of viral or cellular origin cannot be excluded.

IX. CONCLUDING REMARKS

The history of torovirus research illustrates the impact of molecular virol ogy on the taxonomy of viruses. The taxonomie career of the toroviruses-at first proposed as a new family, then a free-floating genus, and finally a genus in the Coronaviridae-was guided by increasingly detailed knowledge of toroviral genes and proteins. The BEV genome has turned out to be a showcase for the two driving forces in RNA virus evolution: divergence from a common ancestor and RNA recom bination. Traces of these processes are revealed in the primary protein sequence homologies in the replicase, conserved structural properties (in spite of diverged primary sequences) in the Sand M pro teins, the presence of apparently unre lated N pro teins coupled to a clearly different nucleocapsid architecture, and finally the recombination events discussed in the previous paragraph. Thus, the comparative analysis of the genomes and proteins of toroviruses and corona viruses, supplemented with the data from the molecular characterization of the arteriviruses (see Chapter 12, this volumeL has increased our understanding of the replication and evolution of all three virus groups.

ACKNOWLEDGMENTS. A number of the figures of this chapter have been pub lished previously (Snijder and Horzinek, 1993). We acknowledge the valuable contributions of Joke Ederveen, Johan den Boon, and Willy Spaan to the torovirus research described in this chapter. We thank Alexander Gorbalenya for his assistance with the replicase sequence alignment, Stuart Siddell for helpful suggestions, and Mareen de Best for her assistance in preparation of the manuscript.

X. REFERENCES

Baker, S. C., Yokomori, K., Dong, S., Carlisle, R., Gorbalenya, A. E., Koonin, E. V., and Lai, M. M. C., 1993, Identification of the catalytic sites of a papain-like cysteine proteinase of murine corona virus, f. Viro1. 67:6056. 236 ERlC J. SNlJDER AND MARlAN C. HORZlNEK

Beards, G. M., Hall, C., Green, J., Flewett, T. H., Lamouliatte, F., and Du Pasquier, P., 1984, An enveloped virus in stools of children and adults with gastroenteritis that resembles the Breda virus of calves, Lancet 2:1050. Beards, G. M. Brown, D. W. G., Green, J., and Flewett, T. H., 1986, Preliminary characterisation of torovirus-like particles of humans: Comparison with Berne virus of horses and Breda virus of calves, J. Med. Viral. 20:67. Bredenbeek, P. J., Noten, J. F. H., Horzinek, M. c., and Spaan, W. J. M., 1990, ldentification and stability of a 30 Kd nonstructural protein encoded by mRNA 2 of mouse hepatitis virus in infected cells, Virology 175:303. Brierley, 1., Diggard, P., and lnglis, S., 1989, Characterization of an efficient coronavirus ribosomal frameshifting signal: Requirement for an RNA pseudoknot, Cell 57:537. Cavanagh, D., Brian, D. A., Brinton, M., Enjuanes, 1., Holmes, K. v., Horzinek, M. C., Lai, M. M. c., Laude, H., Plagemann, P. G. W., Siddell, S., Spaan, W. J. M., Taguchi, F., Talbot, P. J., 1994, Revision of the taxonomy of the Coronavirus, Torovirus and Arterivirus genera, Arch. Viral. 135:227- 237. Cox, G. J., Parker, M. D., and Babiuk, 1. A., 1989, The sequence of cDNA of bovine coronavirus 32K nonstructural gene, Nuc1eic Acids Res. 17:5847. De Groot, R. J., Luytjes, W., Horzinek, M. C., Van der Zeijst, B. A. M., Spaan, W. J. M., and Lenstra, J. A., 1987, Evidence for a coiled-coil structure in the spike proteins of coronaviruses, J. Mol. Biol. 196:963. Den Boon, J. A., Snijder, E. J., Krijnse Locker, J., Horzinek, M. C., and Rottier, P. J. M., 1991a, Another triple-spanning envelope protein among intracellularly budding RNA viruses: The torovirus E protein, Virology 182:655. Den Boon, J. A., Snijder, E. J., Chirnside, E. D., De Vries, A. A. F., Horzinek, M. C., and Spaan, W. J. M., 1991b, Equine arteritis virus is not a togavirus but belongs to the coronavirus-like super family, T. Viral. 65:2910. Dubois-Dalcq, M. E., Doller, E. W., Haspel, M. V., and Holmes, K. V., 1982, Cell tropism and expres sion of mouse hepatitis virus (MHV) in mouse spinal chord cultures, Viralogy 119:317. Fagerland, J. A., Pohlenz, J. F. 1., and Woode, G. N., 1986, A morphological study of the replication of Breda virus (proposed family Toroviridae) in bovine intestinal cells, r. Gen. Virol. 67:1293. Goldbach, R., and Wellink, J., 1988, Evolution of plus-strand RNA viruses, Intervirology 29:260. Gorbalenya, A. E., and Koonin, E. V., 1993, Helicases: Amino acid sequence comparisons and structure-function re1ationships, Curr. Opin. Struct. Biol. 3:419. Gorbalenya, A. E., Koonin, E. v., Donchenko, A. P., and Blinov, V. M., 1989, Coronavirus genome: Prediction of putative functional domains in the non-structura1 po1yprotein by comparative amino acid sequence analysis, Nuc1eic Acids Res. 17:4847. Herold, J., Raabe, T., Schelle-Prinz, B., and Siddell, S. G., 1993, Nucleotide sequence of the human coronavirus 229E RNA polymerase locus, Viralogy 195:680. Holmes, K. v., Doller, E. W., and Sturman, 1. S., 1981, Tunicamycin resistant glycosylation of a coronavirus glycoprotein: Demonstration of a novel type of viral glycoprotein Viralogy 115:334. Horzinek, M. C., and Weiss, M., 1984, Toroviridae: A taxonomic proposal, Zentralbl. Veto Med. [BI 31:649. Horzinek, M. c., Weiss, M., and Ederveen, J., 1984, Berne virus is not "Coronavirus-like," r. Gen. Viral. 65:645. Horzinek, M. c., Ederveen, J., and Weiss, M., 1985, The nucleocapsid of Berne virus, r. Gen. Virol. 66:1287. Horzinek, M. C., Ederveen, J., Kaeffer, B., De Boer, D., and Weiss, M., 1986, The peplomers of Berne virus, J. Gen. Viral. 67:2475. Horzinek, M. c., Flewett, T. H., Saif, 1. J., Spaan, W. J. M., Weiss, M., and Woode, G. N., 1987, A new family of vertebrate viruses: Toraviridae, Interviralogy 27:17. Jacks, T., Madhani, H. D., Masiarz, F. R., and Varmus, H. E., 1988, Signals for ribosomal frameshift ing in the Rous sarcoma virus gag-pol region, Ce1l55:447. Kaeffer, B., Van Kooten, P., Ederveen, J., Van Eden, W., and Horzinek, M. C., 1989, Properties of monoclonal antibodies against Berne virus (Toroviridae), Am. r. Veto Res. 50:1131. Koopmans, M., Ederveen, J., Woode, G. N., and Horzinek, M. C., 1986, Surface proteins of Breda virus, Am. r. Vet. Res. 47:1896. MOLECULAR BIOLOGY OF TOROVIRUSES 237

Koopmans, M., Snijder, E. J., and Horzinek, M. c., 1991, cDNA probes for the diagnosis of bovine torovirus (Breda virus) infection, J. Clin. Micrabial. 29:493- 497. Kyte, J., and Doolittle, R. F., 1982, A simple method for displaying the hydropathic character of a protein, J. Mol. Biol. 157:105. Lai, M. M. c., 1990, Coronavirus-organization, replication and expression of genome, Annu. Rev. Microbiol. 44:303. Lai, M. M. C., 1992, RNA recombination in animal and plant viruses, Micrabiol. Rev. 56:6l. Lee, H. J., Shieh, C. K., Gorbalenya, A. E., Koonin, E. v., Lamonica, N., TUler, J., Bagdzhadzhuyan, A., and Lai, M. M. c., 1991, The complete sequence (22 kilobases) of murine coronavirus gene-l encoding the putative proteases and RNA polymerase, Viralogy 180:567. Luytjes, W., Bredenbeek, P. J., Noten, J. F. H., Horzinek, M. c., and Spaan, W. J. M., 1988, Sequence of mouse hepatitis virus A59 mRNA2: Indications for RNA recombination between corona viruses and influenza C virus, Viralogy 164:415. Makino, S., and Lai, M. M. C., 1989, High-frequency leader sequence switching during coronavirus defective interfering RNA replication, J. Viral. 63:5285. Makino, S., Yokomori, K., and Lai, M. M. c., 1990, Analysis of .efficiently packaged defective interfering RNAs of murine coronavirus: Localization of a possible RNA-packaging signal, J. Viral. 64:6045. Makino, S., Joo, M., and Makino, J. K., 1991, A system for study of coronavirus mRNA synthesis: A regulated, expressed subgenomic defective interfering RNA results from intergenic site inser tion, J. Viral. 65:6031. Poch, 0., Sauvaget, 1., Delarue, M., and Tordo, N., 1989, Identification of four conserved motifs among the RNA dependent polymerase encoding elements, EMBO J. 8:3867. Pringle, C. R., 1992, Committee pursues medley of virus taxonomic issues, ASM News 58:475. Rottier, P. J. M., Horzinek, M. c., and Van der Zeijst, B. A. M., 1981, Viral protein synthesis in mouse hepatitis virus strain A59-infected cells: Effect of tunicamycin, J. Virol. 40:350. Senanayake, S. D., Hofmann, M. A., Maki, J. L., and Brian, D. A., 1992, The nucleocapsid protein gene of bovine coronavirus is bicistronic, J. Viral. 66:5277. Snijder, E. J., and Horzinek, M. c., 1993, Toroviruses: Replication, evolution and comparison with other members of the coronavirus-like superfamily, J. Gen. Virol. 74:2305. Snijder, E. J., Ederveen, J., Spaan, W. J. M., Weiss, M., and Horzinek, M. c., 1988, Characterization of Berne virus genomic and messenger RNAs, J. Gen. Viral. 69:2135. Snijder, E. J., Den Boon, J. A, Spaan, W. J. M., Verjans, G. M. G. M., and Horzinek, M. c., 1989, Identification and primary structure of the gene encoding the Berne virus nucleocapsid protein, J. Gen. Viral. 70:3363. Snijder, E. J., Den Boon, J. A. Bredenbeek, P. J., Horzinek, M. c., Rijnbrand, R., and Spaan, W. J. M., 1990a, The carboxyl-terminal part of the putative Berne virus polymerase is expressed by ribosomal frameshifting and contains sequence motifs which indicate that toro- and corona virus es are evolutionarily related, Nucleic Acids Res. 18:4535. Snijder, E. J., Den Boon, J. A, Spaan, W. J. M., Weiss, M., and Horzinek, M. C., 1990b, Primary structure and post-translational processing of the Berne virus peplomer protein, Virology 178:355. Snijder, E. J., Horzinek, M. C., and Spaan, W. J. M., 1990c, A 3'-coterminal nested set of indepen dently transcribed messenger RNAs is generated during Berne virus replication, J. Viral. 64:33l. Snijder, E. J., Den Boon, J. A., Horzinek, M. C., and Spaan, W. J. M., 1991a, Comparison of the genome organization of toro- and coronaviruses: Both divergence from a common ancestor and RNA recombination have played a role in Berne virus evolution, Viralogy 180:448. Snijder, E. J., Den Boon, J. A, Horzinek, M. c., and Spaan, W. J. M., 1991b, Characterization of defective interfering Berne virus RNAs, J. Gen. Viral. 72:1635. Snijder, E. J., Wassenaar, A L. M., and Spaan, W. J. M., 1992, the 5' end af the equine arteritis virus genome encodes a papainlike cysteine protease. J. Viral. 66:7040. Spaan, W. J. M., Cavanagh, D., and Horzinek, M. c., 1988, Coronaviruses: Structure and genome expression, J. Gen. Viral. 69:2939. Strauss, J. H., and Strauss, E. G., 1988, Evolution of RNA viruses, Annu. Rev. Micrabiol. 42:657. Ten Dam, E. B., Pleij, C. W. A, and Bosch, L., 1990, RNA pseudoknots; translational frameshifting and readthrough on viral RNAs, Virus Genes 4:121. 238 ERIC J. SNIJDER AND MARIAN C. HORZINEK

Tellier, R., and Petric, M., 1993, Human torovirus-purification from faeces, in: Abstracts of the IXth International Congress of Viralogy, p. 47, Glasgow, Scotland. van der Most, R. G., Bredenbeek, P. J., and Spaan, W. J. M., 1991, A domain at the 3' end of the polymerase gene is essential for encapsidation of coronavirus defective interfering RNAs, r. Virol. 65:3219. van der Most, R. G., Heijnen, L., Spaan, W. J. M., and De Groot, R. J., 1992, Homologous RNA recombination allows efficient introduction of site-specific mutations into the genome of coronavirus MHV-A59 via synthetic co-replicating RNAs, Nuc1eic Acids Res. 20:3375. Von Heijne, G., 1981, On the hydrophobic nature of signal sequences, Eur. J. Biochem. 116:419. Weiss, M., and Horzinek, M. c., 1986, Morphogenesis of Berne virus (proposed family Toroviridae), J. Gen. Viral. 67:1305. Weiss, M., and Horzinek, M. c., 1987, The proposed family Toraviridae: Agents of enteric infec tions, Arch. Viral. 92:1. Weiss, M., Steck, F., and Horzinek, M. C., 1983, Purification and partial characterization of a new enveloped RNA virus (Berne virus), J. Gen. Virol. 64:1849. Woode, G. N., Reed, D. E., Runnels, P. L., Herrig, M. A., and Hill, H. T., 1982, Studies with an unclassified virus isolated from diarrhoeic calves, Veto Micrabiol. 7:221.