DOCSLIB.ORG

Transmissible Gastroenteritis Virus: Identification of M Protein-Binding Peptide Ligands with Antiviral and Diagnostic Potential" (2013)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Transmissible Gastroenteritis Virus: Identification of M Protein-Binding Peptide Ligands with Antiviral and Diagnostic Potential View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by UNL | Libraries University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln U.S. Department of Agriculture: Agricultural Publications from USDA-ARS / UNL Faculty Research Service, Lincoln, Nebraska 7-2-2013 Transmissible gastroenteritis virus: Identification of M protein- binding peptide ligands with antiviral and diagnostic potential Hao Zou Northeast Agricultural University Dante S. Zarlenga Agricultural Research Service Karol Sestak Tulane National Primate Research Center Siqingaowa Suo Northeast Agricultural University Xiaofeng Ren Northeast Agricultural University, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/usdaarsfacpub Zou, Hao; Zarlenga, Dante S.; Sestak, Karol; Suo, Siqingaowa; and Ren, Xiaofeng, "Transmissible gastroenteritis virus: Identification of M protein-binding peptide ligands with antiviral and diagnostic potential" (2013). Publications from USDA-ARS / UNL Faculty. 2278. https://digitalcommons.unl.edu/usdaarsfacpub/2278 This Article is brought to you for free and open access by the U.S. Department of Agriculture: Agricultural Research Service, Lincoln, Nebraska at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Publications from USDA-ARS / UNL Faculty by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Antiviral Research 99 (2013) 383–390 Contents lists available at SciVerse ScienceDirect Antiviral Research journal homepage: www.elsevier.com/locate/antiviral Transmissible gastroenteritis virus: Identification of M protein-binding peptide ligands with antiviral and diagnostic potential ⇑ Hao Zou a, Dante S. Zarlenga b, Karol Sestak c, Siqingaowa Suo a, Xiaofeng Ren a, a Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Northeast Agricultural University, 59 Mucai Street, Xiangfang District, Harbin 150030, China b Animal Parasitic Diseases Laboratory, Agricultural Research Service, Beltsville, MD, USA c Division of Microbiology, Tulane National Primate Research Center, 18703 Three Rivers Road, Covington, LA 70433, USA article info abstract Article history: The membrane (M) protein is one of the major structural proteins of coronavirus particles. In this study, Received 9 February 2013 the M protein of transmissible gastroenteritis virus (TGEV) was used to biopan a 12-mer phage display Revised 18 May 2013 random peptide library. Three phages expressing TGEV-M-binding peptides were identified and charac- Accepted 22 June 2013 terized in more depth. A phage-based immunosorbent assay (phage-ELISA) capable of differentiating Available online 2 July 2013 TGEV from other coronaviruses was developed using one phage, phTGEV-M7, as antigen. When the phage-ELISA was compared to conventional antibody-based ELISA for detecting infections, phage-ELISA Keywords: exhibited greater sensitivity. A chemically synthesized, TGEV-M7 peptide (pepTGEV-M7; HALTPIKYIPPG) TGEV was evaluated for antiviral activity. Plaque-reduction assays revealed that pepTGEV-M7 was able to pre- Membrane protein Peptide vent TGEV infection in vitro (p < 0.01) following pretreatment of the virus with the peptide. Indirect Antivirals immunofluorescence and real-time RT-PCR confirmed the inhibitory effects of the peptide. These results indicate that pepTGEV-M7 might be utilized for virus-specific diagnostics and treatment. Ó 2013 Elsevier B.V. All rights reserved. 1. Introduction assumes a topology where part of the endo domain constitutes the fourth transmembrane segment, thereby positioning the car- Transmissible gastroenteritis (TGE) is a highly contagious dis- boxy terminus on the exterior portion of the virion (Risco et al., ease of swine characterized by up to 100% mortality in suckling 1995; Masters, 2006). It has been suggested that the M protein piglets (Laude et al., 1993). The clinical symptoms include acute induces innate immunity including interferon production (Charley diarrhea, vomiting and dehydration. Pigs of all ages and categories and Laude, 1988; Laude et al., 1992). are susceptible. In seronegative herds, TGE can cause devastating Phage display is a powerful technology that has been applied to economic losses (Saif and Wesley, 1999; Ren et al., 2010; Yin antibody engineering (Hayden et al., 1997; Cyranka-Czaja and et al., 2010). The virus responsible for TGE (TGEV) has a glycopro- Otlewski, 2012), drug discovery and manufacturing (Kay et al., tein surface envelope and positive-sense RNA genome of approxi- 1998; Harper et al., 2011), ligand identification (Ehrlich and Bailon, mately 28.5 kb (Ortego et al., 2002). The virus consists of four 2001; Ladner and Ley, 2001; Yi et al., 2003; Beer and Liu, 2012), structural proteins: spike (S), small membrane (sM or E), mem- and development of new diagnostics (Ren et al., 2010; Gazarian brane (M), and nucleocapsid (N) proteins (Spaan et al., 1988; Saif et al., 2012) and vaccines (Lesinski and Westerink, 2001; Samoyl- and Wesley, 1999; Penzes et al., 2001). The S protein is a large ova et al., 2012). Phage display yields billions of heterologous transmembrane surface glycoprotein that induces virus-neutraliz- fusion peptides that are expressed on the surfaces of filamentous ing (VN) antibodies (Jiménez et al., 1986; Laude et al., 1987; Suñé bacteriophage (Scott and Smith, 1990). Inasmuch as each phage et al., 1990); the N protein, together with genomic RNA, forms the expresses only one fusion peptide, the technology permits high viral nucleocapsid (Suñé et al., 1990; Cavanagh, 1994); and the sM throughput panning of a phage library with the intent of identify- protein regulates virion assembly and release (Laude et al., 1990). ing single phage particles with the capacity to bind a target The M protein is the most abundant component of the coronavirus protein. This permits epitope mapping and easy purification at particle (Rottier, 1995). Roughly one-third of the M protein marginal costs. In the current study, three TGEV M-binding phage and the concomitant peptides were identified from a phage display library. Results indicate the ability of these peptides to function as ⇑ Corresponding author. Tel.: +86 451 55191974. TGEV-specific diagnostic reagents. One peptide was further studied E-mail addresses: [email protected], [email protected] (X. Ren). for its potential as an inhibitor of TGEV infectivity. 0166-3542/$ - see front matter Ó 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.antiviral.2013.06.015 384 H. Zou et al. / Antiviral Research 99 (2013) 383–390 2. Materials and methods separately to the wells at concentrations of 1.5 Â 1011 plaque forming units (pfu)/ml in 0.1 M NaHCO3 (pH 8.6) and incubated 2.1. Cells and virus at 37 °C for 1 h. The remaining steps were performed as described (Ren et al., 2011a). Plates were read at OD450 with an ELX808 (Bio- Swine Testis (ST) cells were grown in Dulbecco’s MEM with 10% Tek, USA) ELISA reader. fetal bovine serum at 37 °C, 5% CO2. TGEV (PUR46-MAD strain) (Sánchez et al., 1990) was propagated in ST cells in the absence 2.6. Virus detection using ELISA of serum, followed by gradient ultracentrifugation purification (Krempl and Herrler, 2001). Ten TGEV-positive phage clones were amplified using an E. coli expression system (36). The DNAs of interest were extracted, puri- 2.2. Virus titration fied (51106, Qiagen, Germany), PCR amplified and sequenced to corroborate the presence of TGEV-M sequences (3). Deduced ami- Cytopathic effect (CPE) assays were performed as described no acid sequences were determined (Wu et al., 2011). Phage ELISA (Ren et al., 2011b). Briefly, ST cells seeded onto 96-well tissue and antibody-ELISA were compared for their abilities to detect the culture plates (Costar, USA) were inoculated with 10-fold seri- presence of the virus as described (Wu et al., 2011). For phage-ELI- ally-diluted TGEV. After incubation at 37 °C for 48 h, CPE was SA, TGEV serially-diluted in DMEM was coated onto ELISA plates recorded at 100Â magnification using the BDS200 microscope overnight at 4 °C. Then either the specific phage clone or a non- (OPTEC, China). specific phage complex (negative control) from the phage display library was diluted in PBS (1.5 Â 1011 pfu/100 ll) and added to 2.3. Cloning and expression of the TGEV-M gene the wells. Next, the wells were incubated with commercially-avail- able rabbit anti-M13 antibody (1:1000 in PBS) followed by horse- Total RNA was isolated from TGEV-infected ST cells using radish peroxidase-conjugated goat anti-rabbit antibody (GARP) a commercial protocol (220010, Fastgene, China). Sense (P1: (1:5000 in PBS). For antibody-mediated ELISA, rabbits were immu- 50-GGGGGGATCCATGCGCTATTGTGCTATG) and antisense (P2: nized once with 2 mg rTGEV-M in Freund’s complete adjuvant fol- 50- CCCCGAATTCTTATACCATATGTAATAA) primers were used in lowed by three additional immunizations at 1 week intervals with RT-PCR. The amplified M gene was inserted into the BamHI-EcoRI the same amount of antigen in Freund’s incomplete adjuvant. Ani- site of a prokaryotic expression vector, pGEX (Novagen, Germany), mals were bled 5 days after the final boost. TGEV was coated onto resulting in the recombinant plasmid, pGEX-TGEV-M. After ELISA plates to which was added rabbit anti-TGEV-M followed by pGEX-TGEV-M was transformed into Rosette Escherichia coli bacte- GARP secondary antibody (1:5000). In all experiments, the concen- ria by heat shock (Bowyer, 2001), expression of the glutathione
Load more

Recommended publications
  • First Report and Genetic Characterization of Bovine Torovirus
    Shi et al. BMC Veterinary Research (2020) 16:272 https://doi.org/10.1186/s12917-020-02494-1 RESEARCH ARTICLE Open Access First report and genetic characterization of bovine torovirus in diarrhoeic calves in China Zhihai Shi1,2† , Wenjia Wang3† , Chaoxi Chen4, Xiaozhan Zhang3* , Jing Wang1, Zhaoxue Xu1,2 and Yali Lan1* Abstract Background: Coronaviruses are notorious pathogens that cause diarrheic and respiratory diseases in humans and animals. Although the epidemiology and pathogenicity of coronaviruses have gained substantial attention, little is known about bovine coronavirus in cattle, which possesses a close relationship with human coronavirus. Bovine torovirus (BToV) is a newly identified relevant pathogen associated with cattle diarrhoea and respiratory diseases, and its epidemiology in the Chinese cattle industry remains unknown. Results: In this study, a total of 461 diarrhoeic faecal samples were collected from 38 different farms in three intensive cattle farming regions and analysed. Our results demonstrated that BToV is present in China, with a low prevalence rate of 1.74% (8/461). The full-length spike genes were further cloned from eight clinical samples (five farms in Henan Province). Phylogenetic analysis showed that two different subclades of BToV strains are circulating in China. Meanwhile, the three BToV strains identified from dairy calves, 18,307, 2YY and 5YY, all contained the amino acid variants R614Q, I801T, N841S and Q885E. Conclusions: This is the first report to confirm the presence of BToV in beef and dairy calves in China with diarrhea, which extend our understanding of the epidemiology of BToVs worldwide. Keywords: Bovine torovirus, China, Calf diarrhoea, Beef, Dairy, Phylogenetic analysis Background viruses and parasites.
    [Show full text]
  • Guide for Common Viral Diseases of Animals in Louisiana
    Sampling and Testing Guide for Common Viral Diseases of Animals in Louisiana Please click on the species of interest: Cattle Deer and Small Ruminants The Louisiana Animal Swine Disease Diagnostic Horses Laboratory Dogs A service unit of the LSU School of Veterinary Medicine Adapted from Murphy, F.A., et al, Veterinary Virology, 3rd ed. Cats Academic Press, 1999. Compiled by Rob Poston Multi-species: Rabiesvirus DCN LADDL Guide for Common Viral Diseases v. B2 1 Cattle Please click on the principle system involvement Generalized viral diseases Respiratory viral diseases Enteric viral diseases Reproductive/neonatal viral diseases Viral infections affecting the skin Back to the Beginning DCN LADDL Guide for Common Viral Diseases v. B2 2 Deer and Small Ruminants Please click on the principle system involvement Generalized viral disease Respiratory viral disease Enteric viral diseases Reproductive/neonatal viral diseases Viral infections affecting the skin Back to the Beginning DCN LADDL Guide for Common Viral Diseases v. B2 3 Swine Please click on the principle system involvement Generalized viral diseases Respiratory viral diseases Enteric viral diseases Reproductive/neonatal viral diseases Viral infections affecting the skin Back to the Beginning DCN LADDL Guide for Common Viral Diseases v. B2 4 Horses Please click on the principle system involvement Generalized viral diseases Neurological viral diseases Respiratory viral diseases Enteric viral diseases Abortifacient/neonatal viral diseases Viral infections affecting the skin Back to the Beginning DCN LADDL Guide for Common Viral Diseases v. B2 5 Dogs Please click on the principle system involvement Generalized viral diseases Respiratory viral diseases Enteric viral diseases Reproductive/neonatal viral diseases Back to the Beginning DCN LADDL Guide for Common Viral Diseases v.
    [Show full text]
  • Studies on Toroviruses of Humans and Cattle
    Studies on toroviruses of humans and cattle Lynn Marie Duckmanton A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy, Graduate Department of Molecular and Medical Genetics, University of Toronto Copyright by Lynn M. Duckmanton, 1999 National Library Bibliotheque nationale 1*1 of Canada du Canada Acquisitions and Acquisitions et Bibliographic Services services bibliographiques 395 Wellington Street 395, rue Wellington OttawaON KIA ON4 OttawaON KlAON4 Canada Canada The author has granted a non- L'auteur a accorde une licence non exclusive licence allowing the exclusive pennettant a la National Library of Canada to Bibliotheque nationale du Canada de reproduce, loan, distribute or sell reprodwe, preter, distribuer ou copies of this thesis in microform, vendre des copies de cette these sous paper or electronic formats. la foxme de microfiche/film, de reproduction sur papier ou sur format Bectronique. The author retains ownership of the L'auteur conserve la propriete du copyright in this thesis. Neither the droit d'auteur qui protege cette ththe. thesis nor substantial extracts fiorn it Ni la these ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent &re imprimes reproduced without the author's ou autrement reproduits sans son permission. autorisation. Studies on toroviruses of humans and cattle, Degree of Doctor of Philosophy, 1999, Lynn Marie Duckmanton, Graduate Department of Molecular and Medical Genetics, University of Toronto. Abstract Human torovirus (HTV) was purified from patient stool specimens and characterized. By negative contrast electron microscopy (EM) and thin-section EM, torovirus-like particles were found to be morphologically similar to Berne virus (BEV) and Breda virus (BRV).
    [Show full text]
  • Structural Basis for Ligand and Substrate Recognition by Torovirus Hemagglutinin Esterases
    Structural basis for ligand and substrate recognition by torovirus hemagglutinin esterases Martijn A. Langereisa,1, Qinghong Zengb,1, Gerrit J. Gerwigc, Barbara Freyd, Mark von Itzsteind, Johannis P. Kamerlingc, Raoul J. de Groota,2,3, and Eric G. Huizingab,2,3 aVirology Division, Department of Infectious Diseases & Immunology, Faculty of Veterinary Medicine, bCrystal and Structural Chemistry, Bijvoet Center for Biomolecular Research, Faculty of Sciences, and cDepartment of Bio-Organic Chemistry, Bijvoet Center for Biomolecular Research, Faculty of Sciences, Utrecht University, 3584 CH Utrecht, The Netherlands; and dInstitute for Glycomics, Gold Coast Campus, Griffith University, Queensland, 4222, Australia Edited by Peter Palese, Mount Sinai School of Medicine, New York, NY, and approved July 14, 2009 (received for review April 24, 2009) Hemagglutinin esterases (HEs), closely related envelope glycopro- to subunit 1 of the influenza C virus hemagglutinin–esterase teins in influenza C and corona- and toroviruses, mediate reversible fusion (HEF) protein. While toro- and coronaviruses are of attachment to O-acetylated sialic acids (Sias). They do so by acting common ancestry, they apparently acquired their HE genes both as lectins and as receptor-destroying enzymes, functions exerted through horizontal gene transfer on separate occasions after the by separate protein domains. HE divergence was accompanied by torovirus–coronavirus split (3). Structural and bioinformatic changes in quaternary structure and in receptor and substrate spec- evidence suggests that the nidovirus HEs originated from trim- ificity. The selective forces underlying HE diversity and the molecular eric HEF-like fusion proteins (7–9). In the course of events, the basis for Sia specificity are poorly understood.
    [Show full text]
  • Yellow Head Virus: Transmission and Genome Analyses
    The University of Southern Mississippi The Aquila Digital Community Dissertations Fall 12-2008 Yellow Head Virus: Transmission and Genome Analyses Hongwei Ma University of Southern Mississippi Follow this and additional works at: https://aquila.usm.edu/dissertations Part of the Aquaculture and Fisheries Commons, Biology Commons, and the Marine Biology Commons Recommended Citation Ma, Hongwei, "Yellow Head Virus: Transmission and Genome Analyses" (2008). Dissertations. 1149. https://aquila.usm.edu/dissertations/1149 This Dissertation is brought to you for free and open access by The Aquila Digital Community. It has been accepted for inclusion in Dissertations by an authorized administrator of The Aquila Digital Community. For more information, please contact [email protected]. The University of Southern Mississippi YELLOW HEAD VIRUS: TRANSMISSION AND GENOME ANALYSES by Hongwei Ma Abstract of a Dissertation Submitted to the Graduate Studies Office of The University of Southern Mississippi in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy December 2008 COPYRIGHT BY HONGWEI MA 2008 The University of Southern Mississippi YELLOW HEAD VIRUS: TRANSMISSION AND GENOME ANALYSES by Hongwei Ma A Dissertation Submitted to the Graduate Studies Office of The University of Southern Mississippi in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Approved: December 2008 ABSTRACT YELLOW HEAD VIRUS: TRANSMISSION AND GENOME ANALYSES by I Iongwei Ma December 2008 Yellow head virus (YHV) is an important pathogen to shrimp aquaculture. Among 13 species of naturally YHV-negative crustaceans in the Mississippi coastal area, the daggerblade grass shrimp, Palaemonetes pugio, and the blue crab, Callinectes sapidus, were tested for potential reservoir and carrier hosts of YHV using PCR and real time PCR.
    [Show full text]
  • Proquest Dissertations
    Characterization of white spot syndrome virus of penaeid shrimp: Genomic cloning and sequencing, structural protein analyzing and sequencing, genetic diversity, pathology and virulence Item Type text; Dissertation-Reproduction (electronic) Authors Wang, Qiong Publisher The University of Arizona. Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author. Download date 26/09/2021 11:33:44 Link to Item http://hdl.handle.net/10150/284292 INFORMATION TO USERS This manuscript has been reproduced from the microfihn master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter &ce, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely afifect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, b^inning at the upper left-hand comer and continuing from left to right in equal sections with small overiaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book.
    [Show full text]
  • Porcine Torovirus
    PORCINE TOROVIRUS Prepared for the Swine Health Information Center By the Center for Food Security and Public Health, College of Veterinary Medicine, Iowa State University August 2015 SUMMARY Etiology • Porcine torovirus (ToV) is an enveloped RNA virus in the family Coronaviridae. • There are four known species: porcine ToV, bovine ToV, equine ToV, and human ToV. Porcine ToV is thought to be more closely related to bovine ToV than equine ToV. • The only porcine ToV strain isolated in the United States (PToV-NPL/2013) is 92% identical to the Chinese isolate PToV-SH1. Cleaning and Disinfection • Experimental data suggests that equine ToV is more easily heat-inactivated than some coronaviruses, and bovine ToV in fecal samples loses its infectivity within one to two days at o temperatures above 4 C. • Specific information on the disinfection of porcine ToV is lacking. Bovine ToV may lose infectivity upon treatment with chloroform or diethyl ether. ANIGENE HLD4V, a disinfectant sold by MEDIMARK Scientific in the United Kingdom, is labeled as effective against porcine ToV. Epidemiology • In addition to pigs, bovines, equines, and humans, toroviruses or torovirus-like particles have also been detected in turkeys, goats, sheep, rodents, lagomorphs, and domestic cats. • The zoonotic potential of porcine ToV is unclear. Early serological studies of farmworkers and veterinarians have not revealed a detectable antibody response against bovine and equine toroviruses. • Porcine ToV seems to be widespread in the global swine population. The prevalence of porcine ToV in the United States is unknown. Transmission • Transmission of porcine ToV is thought to be fecal-oral. Rapid spread of porcine ToV between facilities seems to coincide with the practice of moving and regrouping weaned pigs.
    [Show full text]
  • VIEW Open Access the Porcine Virome and Xenotransplantation Joachim Denner
    Denner Virology Journal (2017) 14:171 DOI 10.1186/s12985-017-0836-z REVIEW Open Access The porcine virome and xenotransplantation Joachim Denner Abstract The composition of the porcine virome includes viruses that infect pig cells, ancient virus-derived elements including endogenous retroviruses inserted in the pig chromosomes, and bacteriophages that infect a broad array of bacteria that inhabit pigs. Viruses infecting pigs, among them viruses also infecting human cells, as well as porcine endogenous retroviruses (PERVs) are of importance when evaluating the virus safety of xenotransplantation. Bacteriophages associated with bacteria mainly in the gut are not relevant in this context. Xenotransplantation using pig cells, tissues or organs is under development in order to alleviate the shortage of human transplants. Here for the first time published data describing the viromes in different pigs and their relevance for the virus safety of xenotransplantation is analysed. In conclusion, the analysis of the porcine virome has resulted in numerous new viruses being described, although their impact on xenotransplantation is unclear. Most importantly, viruses with known or suspected zoonotic potential were often not detected by next generation sequencing, but were revealed by more sensitive methods. Keywords: Porcine viruses, Virome, Xenotransplantation, Porcine endogenous retroviruses, Porcine cytomegalovirus, Porcine circoviruses, Hepatitis E virus Background virome of pigs and its impact on xenotransplantation. Xenotransplantation is being developed to overcome the These studies on the pig virome are, like investigations shortage of human tissues and organs needed to treat into the virome of humans and other species, only at organ failure by allotransplantation. Pigs are the pre- their very early stages [4].
    [Show full text]
  • Review of Coliphages As Possible Indicators of Fecal Contamination for Ambient Water Quality
    REVIEW OF COLIPHAGES AS POSSIBLE INDICATORS OF FECAL CONTAMINATION FOR AMBIENT WATER QUALITY 820-R-15-098 EPA Office of Water Office of Science and Technology Health and Ecological Criteria Division April 17, 2015 NOTICES This document has been drafted and approved for publication by the Health and Ecological Criteria Division, Office of Science and Technology, United States (U.S.) Environmental Protection Agency (EPA), and is approved for publication. Mention of trade names or commercial products does not constitute endorsement or recommendation for use. i ACKNOWLEDGMENTS The development of this criteria document was made possible through an effort led by Sharon Nappier, EPA Project Manager, EPA, Office of Science and Technology, Office of Water. EPA acknowledges the valuable contributions of EPA Internal Technical Reviewers who reviewed this document: Jamie Strong and Elizabeth Doyle. The project described here was managed by the Office of Science and Technology, Office of Water, EPA under EPA Contract EP-C-11-005 to ICF International. EPA also wishes to thank Audrey Ichida, Kirsten Jaglo, Jeffrey Soller, Arun Varghese, Alexandria Boehm, Kara Nelson, Margaret Nellor, and Kaedra Jones for their contributions and invaluable support. The primary contact regarding questions or comments to this document is: Sharon Nappier U.S. EPA Headquarters Office of Science and Technology, Office of Water 1200 Pennsylvania Ave., NW Washington, DC 20460 Mail Code 4304T Phone: (202) 566-0740 Email: [email protected] ii EXTERNAL PEER REVIEW WORKGROUP The External Peer Review was managed by the Office of Science and Technology, Office of Water, EPA under EPA Contract No. EP-C-13-010 to Versar, Inc.
    [Show full text]
  • Vaccination Against Rotavirus Infection
    Diagnostics, epidemiology of diarrhoeal diseases of viral origin; vaccination against rotavirus infection Krisztián Bányai ANTSZ Baranya County Institute of State Public Health Service, Regional Laboratory of Virology Historical overview Early 20th century • „pseudocholera infantum”; „winter vomiting disease” 1940s and 1950s • transmissible agent 1950s and1970s • identification of viruses in diarrheic feces 1970s • identification of the first human enteric viruses 1980s and 1990s • identification of new, potential enteric viruses Viruses found in the gut Found in the gut but not associated with gastroenteritis • Polio Enteroviruses 68-71 • Coxsackie A Coxsackie B • Echo • Hepatitis A Hepatitis E • Adenoviruses 1-39, 42-51 Reoviruses Found in the gut as opportunistic infection • CMV VZV • HSV HIV Human enteric viruses Virus Genome Virus morphology Serotypes Rotavirus A,B,C, RNA ~70-75 nm, double-shelled particle, 11 G (Reoviridae, Double-stranded, ‘wheel’-like appearance 12 P Rotavirus) 11 segments Calicivirus (Caliciviridae, RNA ~27-32 nm, featureless surface several Norovirus Positive sense Sapovirus) RNA ~33 nm, David-star surface several Positive sense Astrovirus RNA ~27-30 nm, 5 or 6 pointed star surface 8 (Astroviridae, Positive sense Astrovirus) Adenovirus DNA ~74 nm, classic icosahedral structure 2 (Adenoviridae, Double-stranded Mastadenovirus) Possible human enteric viruses Virus Genome Virus morphology Serotypes Aichi virus RNA ~ 28-35 nm, structured 1 ? (Picornaviridae, Positive sense surface (kobu = knob) Kobuvirus) Parechovirus
    [Show full text]
  • Human Torovirus: a New Nosocomial Gastrointestinal Pathogen
    1263 Human Torovirus: A New Nosocomial Gastrointestinal Pathogen Frances B. Jamieson, Elaine E. L. Wang, Cindy Bain, Departments of Microbiology and Pediatrics and the Clinical Jennifer Good, Lynn Duckmanton, and Martin Petric Epidemiology and Health Care Research Program, Hospital for Sick Children and University of Toronto, Toronto, Canada Studies were undertaken to determine if human torovirus is associated with gastroenteritis and to examine the clinical features of torovirus illness in children. The fecal excretion of torovirus in patients with gastroenteritis was compared with that in matched asymptomatic controls in a case-control study. Toroviruses were identi®ed in 72 (35.0%) of 206 gastroenteritis cases compared with 30 (14.5%) of 206 controls (P ! .001 ). Clinical features of torovirus gas- troenteritis in 172 patients positive for torovirus were compared with those of 115 patients infected with rotavirus or astrovirus. Persons infected with torovirus were more frequently immunocompromised (43.0% vs. 15.7%) and nosocomially infected (57.6% vs. 31.3%). They also experienced less vomiting (46.4% vs. 66.7%) but had more bloody diarrhea (11.2% vs. 1.8%). An antibody response to torovirus developed mainly in older, nonimmunocompromised children (P ! .01 ). These studies demonstrate an association between torovirus excretion and gastroenteritis in the pediatric population among immunocompromised hospitalized patients and in previously healthy patients. Acute viral gastroenteritis in family studies was second in long. Toroviruses were classi®ed on the basis of the Berne virus prevalence only to the common cold and accounted for 16% genome sequence as members of the family Coronaviridae, of illnesses or 1.52 cases per person per year [1].
    [Show full text]
  • A Porcine Enterovirus G Associated with Enteric Disease Contains a Novel Papain-Like Cysteine Protease
    SHORT COMMUNICATION Knutson et al., Journal of General Virology 2017;98:1305–1310 DOI 10.1099/jgv.0.000799 A porcine enterovirus G associated with enteric disease contains a novel papain-like cysteine protease Todd P. Knutson,1 Binu T. Velayudhan2 and Douglas G. Marthaler1,* Abstract Identification of unknown pathogens in pigs displaying enteric illness is difficult due to the large diversity of bacterial and viral species found within faecal samples. Current methods often require bacterial or viral isolation, or testing only a limited number of known species using quantitative PCR analysis. Herein, faeces from two 25-day-old piglets with diarrhoea from Texas, USA, were analysed by metagenomic next-generation sequencing to rapidly identify possible pathogens. Our analysis included a bioinformatics pipeline of rapid short-read classification and de novo genome assembly which resulted in the identification of a porcine enterovirus G (EV-G), a complete genome with substantial nucleotide differences (>30 %) among current sequences, and a novel non-structural protein similar in sequence to the Torovirus papain-like cysteine protease (PLpro). This discovery led to the identification and circulation of an EV-G with a novel PLpro in the USA that has not been previously reported. Porcine viral outbreaks in the USA cause substantial economic (including the species Foot-and-mouth disease virus, FMDv), losses to the swine industry. Rapid detection of common viral Senecavirus, Teschovirus, Sapelovirus and Enterovirus. The pathogens by quantitative PCR (qPCR) can be effective, yet genus Enterovirus comprises 12 species (enterovirus A–H and these methods often fail to differentiate viral subtypes and J, and rhinovirus A–C) [6].
    [Show full text]