View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by UNL | Libraries University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln U.S. Department of Agriculture: Agricultural Publications from USDA-ARS / UNL Faculty Research Service, Lincoln, Nebraska 7-2-2013 Transmissible gastroenteritis virus: Identification of M protein- binding peptide ligands with antiviral and diagnostic potential Hao Zou Northeast Agricultural University Dante S. Zarlenga Agricultural Research Service Karol Sestak Tulane National Primate Research Center Siqingaowa Suo Northeast Agricultural University Xiaofeng Ren Northeast Agricultural University, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/usdaarsfacpub Zou, Hao; Zarlenga, Dante S.; Sestak, Karol; Suo, Siqingaowa; and Ren, Xiaofeng, "Transmissible gastroenteritis virus: Identification of M protein-binding peptide ligands with antiviral and diagnostic potential" (2013). Publications from USDA-ARS / UNL Faculty. 2278. https://digitalcommons.unl.edu/usdaarsfacpub/2278 This Article is brought to you for free and open access by the U.S. Department of Agriculture: Agricultural Research Service, Lincoln, Nebraska at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Publications from USDA-ARS / UNL Faculty by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Antiviral Research 99 (2013) 383–390 Contents lists available at SciVerse ScienceDirect Antiviral Research journal homepage: www.elsevier.com/locate/antiviral Transmissible gastroenteritis virus: Identification of M protein-binding peptide ligands with antiviral and diagnostic potential ⇑ Hao Zou a, Dante S. Zarlenga b, Karol Sestak c, Siqingaowa Suo a, Xiaofeng Ren a, a Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Northeast Agricultural University, 59 Mucai Street, Xiangfang District, Harbin 150030, China b Animal Parasitic Diseases Laboratory, Agricultural Research Service, Beltsville, MD, USA c Division of Microbiology, Tulane National Primate Research Center, 18703 Three Rivers Road, Covington, LA 70433, USA article info abstract Article history: The membrane (M) protein is one of the major structural proteins of coronavirus particles. In this study, Received 9 February 2013 the M protein of transmissible gastroenteritis virus (TGEV) was used to biopan a 12-mer phage display Revised 18 May 2013 random peptide library. Three phages expressing TGEV-M-binding peptides were identified and charac- Accepted 22 June 2013 terized in more depth. A phage-based immunosorbent assay (phage-ELISA) capable of differentiating Available online 2 July 2013 TGEV from other coronaviruses was developed using one phage, phTGEV-M7, as antigen. When the phage-ELISA was compared to conventional antibody-based ELISA for detecting infections, phage-ELISA Keywords: exhibited greater sensitivity. A chemically synthesized, TGEV-M7 peptide (pepTGEV-M7; HALTPIKYIPPG) TGEV was evaluated for antiviral activity. Plaque-reduction assays revealed that pepTGEV-M7 was able to pre- Membrane protein Peptide vent TGEV infection in vitro (p < 0.01) following pretreatment of the virus with the peptide. Indirect Antivirals immunofluorescence and real-time RT-PCR confirmed the inhibitory effects of the peptide. These results indicate that pepTGEV-M7 might be utilized for virus-specific diagnostics and treatment. Ó 2013 Elsevier B.V. All rights reserved. 1. Introduction assumes a topology where part of the endo domain constitutes the fourth transmembrane segment, thereby positioning the car- Transmissible gastroenteritis (TGE) is a highly contagious dis- boxy terminus on the exterior portion of the virion (Risco et al., ease of swine characterized by up to 100% mortality in suckling 1995; Masters, 2006). It has been suggested that the M protein piglets (Laude et al., 1993). The clinical symptoms include acute induces innate immunity including interferon production (Charley diarrhea, vomiting and dehydration. Pigs of all ages and categories and Laude, 1988; Laude et al., 1992). are susceptible. In seronegative herds, TGE can cause devastating Phage display is a powerful technology that has been applied to economic losses (Saif and Wesley, 1999; Ren et al., 2010; Yin antibody engineering (Hayden et al., 1997; Cyranka-Czaja and et al., 2010). The virus responsible for TGE (TGEV) has a glycopro- Otlewski, 2012), drug discovery and manufacturing (Kay et al., tein surface envelope and positive-sense RNA genome of approxi- 1998; Harper et al., 2011), ligand identification (Ehrlich and Bailon, mately 28.5 kb (Ortego et al., 2002). The virus consists of four 2001; Ladner and Ley, 2001; Yi et al., 2003; Beer and Liu, 2012), structural proteins: spike (S), small membrane (sM or E), mem- and development of new diagnostics (Ren et al., 2010; Gazarian brane (M), and nucleocapsid (N) proteins (Spaan et al., 1988; Saif et al., 2012) and vaccines (Lesinski and Westerink, 2001; Samoyl- and Wesley, 1999; Penzes et al., 2001). The S protein is a large ova et al., 2012). Phage display yields billions of heterologous transmembrane surface glycoprotein that induces virus-neutraliz- fusion peptides that are expressed on the surfaces of filamentous ing (VN) antibodies (Jiménez et al., 1986; Laude et al., 1987; Suñé bacteriophage (Scott and Smith, 1990). Inasmuch as each phage et al., 1990); the N protein, together with genomic RNA, forms the expresses only one fusion peptide, the technology permits high viral nucleocapsid (Suñé et al., 1990; Cavanagh, 1994); and the sM throughput panning of a phage library with the intent of identify- protein regulates virion assembly and release (Laude et al., 1990). ing single phage particles with the capacity to bind a target The M protein is the most abundant component of the coronavirus protein. This permits epitope mapping and easy purification at particle (Rottier, 1995). Roughly one-third of the M protein marginal costs. In the current study, three TGEV M-binding phage and the concomitant peptides were identified from a phage display library. Results indicate the ability of these peptides to function as ⇑ Corresponding author. Tel.: +86 451 55191974. TGEV-specific diagnostic reagents. One peptide was further studied E-mail addresses: [email protected], [email protected] (X. Ren). for its potential as an inhibitor of TGEV infectivity. 0166-3542/$ - see front matter Ó 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.antiviral.2013.06.015 384 H. Zou et al. / Antiviral Research 99 (2013) 383–390 2. Materials and methods separately to the wells at concentrations of 1.5 Â 1011 plaque forming units (pfu)/ml in 0.1 M NaHCO3 (pH 8.6) and incubated 2.1. Cells and virus at 37 °C for 1 h. The remaining steps were performed as described (Ren et al., 2011a). Plates were read at OD450 with an ELX808 (Bio- Swine Testis (ST) cells were grown in Dulbecco’s MEM with 10% Tek, USA) ELISA reader. fetal bovine serum at 37 °C, 5% CO2. TGEV (PUR46-MAD strain) (Sánchez et al., 1990) was propagated in ST cells in the absence 2.6. Virus detection using ELISA of serum, followed by gradient ultracentrifugation purification (Krempl and Herrler, 2001). Ten TGEV-positive phage clones were amplified using an E. coli expression system (36). The DNAs of interest were extracted, puri- 2.2. Virus titration fied (51106, Qiagen, Germany), PCR amplified and sequenced to corroborate the presence of TGEV-M sequences (3). Deduced ami- Cytopathic effect (CPE) assays were performed as described no acid sequences were determined (Wu et al., 2011). Phage ELISA (Ren et al., 2011b). Briefly, ST cells seeded onto 96-well tissue and antibody-ELISA were compared for their abilities to detect the culture plates (Costar, USA) were inoculated with 10-fold seri- presence of the virus as described (Wu et al., 2011). For phage-ELI- ally-diluted TGEV. After incubation at 37 °C for 48 h, CPE was SA, TGEV serially-diluted in DMEM was coated onto ELISA plates recorded at 100Â magnification using the BDS200 microscope overnight at 4 °C. Then either the specific phage clone or a non- (OPTEC, China). specific phage complex (negative control) from the phage display library was diluted in PBS (1.5 Â 1011 pfu/100 ll) and added to 2.3. Cloning and expression of the TGEV-M gene the wells. Next, the wells were incubated with commercially-avail- able rabbit anti-M13 antibody (1:1000 in PBS) followed by horse- Total RNA was isolated from TGEV-infected ST cells using radish peroxidase-conjugated goat anti-rabbit antibody (GARP) a commercial protocol (220010, Fastgene, China). Sense (P1: (1:5000 in PBS). For antibody-mediated ELISA, rabbits were immu- 50-GGGGGGATCCATGCGCTATTGTGCTATG) and antisense (P2: nized once with 2 mg rTGEV-M in Freund’s complete adjuvant fol- 50- CCCCGAATTCTTATACCATATGTAATAA) primers were used in lowed by three additional immunizations at 1 week intervals with RT-PCR. The amplified M gene was inserted into the BamHI-EcoRI the same amount of antigen in Freund’s incomplete adjuvant. Ani- site of a prokaryotic expression vector, pGEX (Novagen, Germany), mals were bled 5 days after the final boost. TGEV was coated onto resulting in the recombinant plasmid, pGEX-TGEV-M. After ELISA plates to which was added rabbit anti-TGEV-M followed by pGEX-TGEV-M was transformed into Rosette Escherichia coli bacte- GARP secondary antibody (1:5000). In all experiments, the concen- ria by heat shock (Bowyer, 2001), expression of the glutathione