Studies on toroviruses of humans and cattle
Lynn Marie Duckmanton
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy, Graduate Department of Molecular and Medical Genetics, University of Toronto
Copyright by Lynn M. Duckmanton, 1999 National Library Bibliotheque nationale 1*1 of Canada du Canada Acquisitions and Acquisitions et Bibliographic Services services bibliographiques 395 Wellington Street 395, rue Wellington OttawaON KIA ON4 OttawaON KlAON4 Canada Canada
The author has granted a non- L'auteur a accorde une licence non exclusive licence allowing the exclusive pennettant a la National Library of Canada to Bibliotheque nationale du Canada de reproduce, loan, distribute or sell reprodwe, preter, distribuer ou copies of this thesis in microform, vendre des copies de cette these sous paper or electronic formats. la foxme de microfiche/film, de reproduction sur papier ou sur format Bectronique.
The author retains ownership of the L'auteur conserve la propriete du copyright in this thesis. Neither the droit d'auteur qui protege cette ththe. thesis nor substantial extracts fiorn it Ni la these ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent &re imprimes reproduced without the author's ou autrement reproduits sans son permission. autorisation. Studies on toroviruses of humans and cattle, Degree of Doctor of Philosophy, 1999, Lynn Marie Duckmanton, Graduate Department of Molecular and Medical Genetics, University of Toronto.
Abstract
Human torovirus (HTV) was purified from patient stool specimens and characterized. By negative contrast electron microscopy (EM) and thin-section
EM, torovirus-like particles were found to be morphologically similar to Berne virus (BEV) and Breda virus (BRV). HTV was shown to react with BRV antiserum and human convalescent serum from torovirus-positive patient stools, by hemagglutination inhibition (HI), immunoelectron microscopy (IEM), and immunoblotting. RNA extracted from HTV preparations was amplified by RT-
PCR using primers bracketing a 219-base region at the 3' end of the BEV genome. Sequence analysis of amplicons from five HTV specimens showed a high degree of sequence similarity among the human viruses as well as with
BEV.
Using EM and RT-PCR, the incidence of torovirus excretion in calves with diarrhea from farms in Southern Ontario was investigated and compared to the excretion of other enteric pathogens. By RT-PCR, torovirus RNA was detected in 36% of diarrheic specimens. The incidence of torovirus in asymptomatic control specimens by RT-PCR was only 12%, thereby allowing us to make a significant correlation between disease and virus shedding.
Nucleotide sequence analysis of 5 of the arnplicons from EM- and RT-PCR- positive samples revealed that the 3' end of the genome of bovine torovirus found in Southern Ontario manifested 96%-97% sequence identity to that of the
BRV-1 strain found in Iowa. The nucleotide sequence of 7.5kb in the 3' region of the BRV-1 genome was derived from an arnplicon of BRV-f RNA amplified by long RT-PCR.
Sequence analysis revealed the presence of 4 open reading frames (ORF) corresponding to the peplomer (S), envelope (M), and nucleocapsid (N) genes, as well as an ORF for a novel I .2kb gene located between the M and N genes.
This gene was 99% identical in nucleotide sequence to the hernagglutinin- esterase (HE) gene of BRV-2. Using primers designed from the BRV-1 HE gene, an amplicon was obtained from HTV RNA, and on sequencing was shown to have 75% sequence identity with the BRV-I HE gene. The BRV-1 N gene, and the HE genes of BRV-1 and HTV were cloned and expressed. Guinea pig antisera to the N and HE recombinant proteins were shown to be reactive with bovine and human toroviruses by immunoblot, IEM, and dot blot analyses.
iii Acknowledgments
The work described in this thesis took approximately five years to complete, and there are a number of people whom I would like to thank for their help and support during this period. First, Dr. Paul Widden at Concordia University is responsible for introducing me to the field of scientific research, and encouraging me to pursue graduate studies at the University of Toronto.
The encouragement and guidance provided by my supervisor, Dr. Martin Petric, aided me to complete my research and to pursue a career in industry. I am certainly grateful for his support. I would also like to thank Dr. Raymond Tellier for his advice and direction throughout the final years of this project. The wonderful staff in the Virology laboratory at the Hospital for Sick Children also aided me by providing valuable technical assistance and ideas, as well as motivation and friendship. I would like to thank John, Sumita, Antonietta, Willy, Maria, Anna, Rose, Fran, Gloria, Lily, and my office mate, Karen.
I am grateful to my parents, John and Ckline, for their constant love and support. Their enthusiasm and encouragement were indispensable to me. Many thanks, also, to Diane, Chandan and Adrienne for their kindness and reassurance. I save a hug for Simba, whose companionship warmed my lap and my heart while writing this thesis. Finally, I would profoundly like to thank my husband, Arun, whose love and devotion gave me the will to persevere and attain my goals. His listening ear and continuous motivation made this work possible. I share all this with you. Table of Contents
Page Title page i Abstract ii Acknowledgements iv Table of contents v List of abbreviations viii List of tables xi List of figures xi i Dissemination of work arising from this thesis xvi Chapter 1: Introduction i lnfectious diarrhea 2 Viral gastroenteritis 3 Nidovirales: Coronaviridae and Arteriviridae 10 Arterivirus Morphology Genetics and replication Epidemiology Coronavirus Morphology Genetics and replication Antigenic properties Pathology and pathogenesis Diagnosis Epidemiology Prevention and control Torovinrs Morphology Physicochemical properties Genome organization Replication Antigenic properties Pathology and pathogenesis Epidemiology Diagnosis Prevention and control Evolutionary relationships Summary Chapter 2: Objectives Chapter 3: Characterization of torovirus from human fecal specimens Summary Introduction Materials and methods Results Discussion Chapter 4: Detection of bovine torovirus in fecal specimens of calves with diarrhea from Ontario farms Summary lntroduction Materials and methods Results Discussion Chapter 5: Bovine torovirus: sequencing of the structural genes and expression of the nucleocapsid protein of Breda virus Summary Introduction Materials and methods Results Discussion Chapter 6: The novel hemagglutininesterase genes of human torovirus and Breda virus Summary lntroduction Materials and methods Results Discussion Chapter 7: Discussion References
vii List of Abbreviations alc acute and convalescent AHL Animal Health Laboratory baBRV bovine anti-Breda virus baBRV-1 bovine anti-Breda virus-I baBRV-2 bovine anti-Breda virus-2 BCIP-NBT 5-bromo4thloro-3-indolyl phosphate- nitro blue tetrazolium BCV bovine coronavirus BEV Berne virus BRV Breda virus BRV-1 Breda virus-I BRV-2 Breda virus-2 Blv bovine torovirus BVDV bovine viral diarrhea virus ccv canine coronavirus CVLP coronavirus-like particle EAV equine arteritis virus ELlSA enzyrne-linked immunosorbent assay EM electron microscopy ER endoplasmic reticulum FlPV feline infectious peritonitis virus PHI guinea pig hyperimmune gpHla5RV guinea pig anti-Breda virus4 HE protein hyperimmune gpHlaHTV guinea pig anti-human torovirus HE protein hyperimmune gpHlaN guinea pig anti-Breda virus4 N protein hyperimmune 9 PPI guinea pig preimmune gpPlaBRV guinea pig anti-Breda virus-I HE protein preirnmune gpPlaHTV guinea pig anti-human torovirus HE protein preimmune gpPlaN guinea pig anti-Breda virus-I N protein preimmune HA hemagglutination HCV human respiratory coronavirus
viii HE hemagglutinin-esterase HECV human enteric coronavirus HEF hemagglutinin-esterase fusion protein HI hemagglutination inhibition HTV human torovirus huA human acute huC human convalescent IBV avian infectious bronchitis virus ICW International Committee for the Taxonomy of Viruses ICV influenza C virus IEM immunoefectron microscopy IFA immunofluorescence assay LDV lactate dehydrogenase-elevating virus M viral envelope MHV murine hepatitis virus Mr molecular mass N viral nucleocapsid NS non-structural ORF open reading frame PCR polymerase chain reaction POL viral polymerase PRRSV porcine reproductive and respiratory syndrome virus PVDF polyvinylidene fluoride RaGP rabbit anti-guinea pig RIA radioimmunoassay RT-PCR reverse transcription-polymerase chain reaction S viral peplomer SDS-PAGE sodium dodecyl sulfate-polyacrytamide gel electrophoresis SHW simian hemorrhagic fever virus SRSV small round structured virus TBST Tris-buffered saline containing 0.5% Tween-20 TCV turkey bluecomb coronavirus TGEV transmissible gastroenteritis virus of swine ix TS-EM thin section-electron microscopy TVLP torovirus-li ke particle VBS veronal buffered saline X Beme virus pseudogene List of Tables
Page
1. Species within the genera Coronavirus, Tomvvhrs, and Arterivims
2. Properties and functions of the toroviral structural proteins
3. EM and ELISA results for 89 stool specimens from children with diarrhea
4. Comparison of features of coronaviruses, toroviruses, and Artenviruses
5. IEM and HI results for two TVLP-positive human fecal specimens
6. Detection of torovirus by EM in symptomatic and asymptomatic patients
7. HI results showing seroconversion to human torovirus
8. EM and RT-PCR results for the detection of torovirus in stools from diarrheic calves in Southern Ontario
9. Viruses present in stools of symptomatic and asymptomatic calves from Ontario farms t 0.HI results for a human torovirus-positive fecal specimen using antisera to the BRV-I and HWHE proteins List of Figures
Page
Gastroenteritis viruses 5
Role of elological agents in severe diarrheal illnesses 8
Electron micrograph of LDV and diagrammatic representation of the Arterivirion
Organization of the genomes of LDV, EAV, and PRRSV
Organization of the EAV genome and its replication strategy
Electron micrograph of enteric coronavirus and diagrammatic representation of the coronavirion
Genomic organization of coronaviruses
Model of coronavirus replication
Electron micrograph of Beme virus and diagrammatic representation of the torovirion
10. Thin section electron micrographs of BEV-infected equine dermis cells
11. Schematic representation of the BEV genome
12. Replication strategy of the BEV genome
13. Stages of toroviral budding into smooth membrane vesicles
xii 14. Conserved domains in the POL genes of coronaviruses, toroviruses, and arteriviruses
I5. Electron micrograph of TVLPs from human fecal specimens
16. Electron micrographs of HTV particles in ultrathin sections of a purified TVLP preparation
17. lmmunoelectron microscopy of a purified human TVLP preparation
18. Monthly incidence of rotavirus and torovirus diagnoses in 1993
19. SDS-PAGE and immunoblot of a purified human TVLP preparation with huA and huC sera
20. Gel electrophoresis of RT-PCR products amplified using RNA from TVLP- positive fecal specimens and primers specific for the 3' non-coding region of BEV
21. Alignment of the nucleotide sequence of the 3' end of the BEV genome with that of five human TVLP-positive specimens I01
22. Electron micrograph of torovirus particles in a calf fecal specimen I14
23. Gel electrophoresis of RT-PCR products from five-BTV positive fecal specimens 116
24. Alignment of the nucleotide sequence of the 3' end of the BRV-1 genome with that of five BTV-positive specimens and BEV
25. Diagram of the pET28a (+) cloning vector 26. Gel electrophoresis of products amplified by long RT-PCR using RNA from a BRV-I positive specimen
27. Schematic representation of the BRV-1 genome
28. Nucleotide sequence of the BRV-1 peplomer gene, envelope gene, hemagglutinin-esterase gene, nucleocapsid gene and the 3' non-coding region of the BRV-1 genome 142
29. SDS-PAGE and immunoblot of expressed BRV-1 N protein I54
30. SDS-PAGE and imrnunoblots of BTV-positive, BTV-negative, HTV- positive and BRV-1 N protein control samples with various sera 156
31. lmmunoelectron microscopy of a purified bovine torovirus-positive preparation with gpPlaN and gpHlaN
32. Dot blot of 5 BTV-positive, 5 HW-positive, 5 BTV-negative, and 5 rotavirus-positive fecal specimens using gpPl and gpHl sera 162
33. Dot blots of 30 BTV-positive, 30 HTV-positive, 15 BW-negative, and 15 rotavirus-positive fecal specimens using gpPl and gpHl sera 164
34. Diagram pETL-EK (His) 6 baculovirus vector 178
35. Flow diagram of BaculoGold transfection assay 180
36. Gel electrophoresis of products amplified by long RT-PCR using RNA from a HTV positive specimen 186
37. Nucleotide sequences of the BRV-1 and HW hemagglutinin-esterase genes 188
xiv 38. SDS-PAGE and immunoblots of BTV-positive, BTV-negative, HTV-positive, and HWnegative fecal specimens with gpPlaHTV, gpPlaBRV, gpHlaBRV, and gpHlaHW antisera
39. lmmunoblots of BRV-1 HE protein control samples with guinea pig antisera to the BRV-1 and HTV HE genes, human acute and convalescent paired sera, and bovine anti-BRV-1 antisera
40. lmmunoelectron microscopy of a purified human torovirus-positive preparation with gpPlaBRV, gpHlaBRV, gpPlaHW, and gpHlaHTV sera
41. Dot blot of 5 HTWpositive, 5 BW-positive, 5 HTV-negative, 5 BN- negative, 5 human rotavirus-positive, and 5 bovine rotavirus-positive fecal specimens using gpPlaBRV, gpHlaBRV, gpPIaHTV, and gpHIaHTV sera 200 Dissemination of Work Described in this Thesis
This thesis is presented as a compilation of studies on the toroviruses of humans and cattle. These studies have resulted in the following publications:
1. Chapter 3 of this thesis, excluding the case-control study on human torovirus, was published as follows:
Duckmanton, L., Luan, B., Devenish, J., Tellier, R., and Petric, M. (1997). Characterization of torovirus from human fecal specimens. Virology 239: 158- 168.
Data from the case-control study on human torovirus outlined in chapter 3 was adapted from the following publication:
Jamieson, F.B., Wang, E.E.L., Bain, C., Good, J., Duckmanton, L. and Petric, M. (1998) Human torovirus: a new nosocomial gastrointestinal pathogen. J. Infect. Dis. I78 (II): 1263-1269.
2. Chapter 4 was published as follows:
Duckmanton, L., Carmen, S., Nagy, E., and Petric, M. (1998a). Detection of bovine torovirus in fecal specimens of calves with diarrhea from Ontario farms. J. Clin. Micro. 36: 'l266-1270.
3. Chapter 5 was published as follows:
Duckmanton, L., Tellier, R., Liu, P. and Petnc, M. (1998b). Bovine torovirus: sequencing of the structural genes and expression of the nucleocapsid protein of Breda virus. Virus Res. 58: 83-96. 4. Chapter 6 has been submitted for publication:
Duckmanton, L., Tellier, R., Richardson, C. and Petric, M. (1998~).The novel hemagglutinin-esterase genes of human torovirus and Breda virus. Manuscript submitted to Vims Res.: submitted October 1998.
I would like to thank those who provided irre with a number of the specimens and reagents used in this thesis. Dr. G. Woode at Texas A&M and Dr. M. Hardy at Montana State University provided the BRV-I -infected bovine fecal specimen, and the immune sera from calves infected with Breda virus used in chapters 5 and 6. Dn. Eva Nagy and Susy Carman from the Animal Health Laboratory, Guelph, Ontario provided the BWpositive specimens from diarrheic calves, control specimens from asymptomatic calves, and rotavirus- positive specimens from diarrheic calves used in chapters 4, 5, and 6.
Many thanks to Maria Szymanski and John Nishikawa in the Department of Microbiology at the Hospital for Sick Children for their help with electron microscopy, as well as Lois Lines and Julia Hwang in the Department of Immunopathology at the Hospital for Sick Children for preparing ultrathin sections of TVLP preparations used in chapter 3.
Finally, I would like to thank Tamara Martino and Anne Opavski for their assistance with the expression of the BRV-1 N gene in E. coli, and Dr. Chris Richardson and Cathy lorio for their invaluable help with the expression of the BRV-1 and HWHE genes in baculovirus.
Contributions to the above publications are reflected by the sequence of authors. In publications 1,3,4 and 5, 1 am the first author since I performed all the laboratory studies in those studies. In publication 2 by Jamieson et a/., my contribution was limited to performing the serology on patient sera. In publication 3, testing for BVDV, rotavirus, and coronavirus were performed by Dr. Susy Carrnan.
xvii Chapter I
General Introduction INFECTIOUS DIARRHEA
Infectious diarrhea is a major worldwide public health burden, the impact of which is greatest among children. It is estimated that each year in the United States, greater than 210 000 children less than 5 years of age with diarrhea are hospitalized for an average of 4.5 days, at an annual inpatient cost of almost $1 billion. In the U.S., between 1973 and 1983, an average of 504 children aged 1 month to 4 years died annually from diarrhea (Ho et al., 1988). However, the morbidity and mortality of infectious diarrhea increase dramatically in developing countries where diarrheal diseases are a major cause of death among infants and young children. It has been reported that in Africa, Latin America, and Asia, 744 million to 1 billion diarrheal episodes occur annually, and an estimated 4.6 million children under 5 years of age are estimated to die of diarrhea each year (Snyder and Merson, 1982). Thus, diarrhea has been ranked first among infectious diseases in developing countries with regard to frequency and mortality (Walsh and Warren, 1979).
Infectious diarrhea has also been reported as an important disorder affecting both domesticated and farm animals. For example, winter dysentery, an acute gastrointestinal disorder primarily affecting dairy cattle, and neonatal calf diarrhea encountered in calf rearing leads to substantial losses each year due to severe decreases in milk production in dairy cattle, as well as growth retardation and death in calves (Koopmans et a/., 1991 b).
During most of the past century, major discoveries in the fields of bacteriology and parasitology have led to the identification of numerous etiological agents of infectious diarrhea. This illness has been attributed to bacteria such as Salmonella spp. (Homick, 1986), Campylobacter jejuni (Butzler, 1986). and Eschenchia spp.
(Levine, 1987, Karrnali, 1989), as well as to protozoa such as Cryptospondium, and
2 Giardia lamblia (Wolfe, 1986). However, these agents were found to account for only a limited proportion of diarrhea cases, and the etiology of most diarrheal illnesses remained unknown until the early 1970s.
Viral Gastroenteritis
For the first half of this century, viruses were only hypothesized to play a role in the etiology of many of the undiagnosed cases of diarrheal illness. Studies carried out in the U.S. and Japan between 1945 and I947 showed that bacteria-free filtrates derived from community outbreaks of gastroenteritis induced diarrheal illness in healthy adult volunteers (Kapikian, 1996). Initially, it was suspected that well recognized, culturable enteroviruses (echovirus and coxsackie virus) which replicate mainly in the gastrointestinal tract were responsible for gastroenteritis. However, epidemiological investigations later disproved this hypothesis by demonstrating that children without diarrhea shed these viruses with frequencies equal to symptomatic patients (Kapikian, 1996).
Investigations into the association of a specific virus with gastroenteritis have taken 3 major forms. The most direct approach is to administer a virus to healthy volunteers that have been documented to be seronegative for the virus. Alternatively, the association of a virus with disease can be made in outbreaks of gastroenteritis by showing that the virus is consistently present in patients and their symptomatic contacts, but not in controls over a defined period of the outbreak.
Finally, a virus may be associated with disease in a longitudinal case/control study where the virus is significantly more often found in cases than in controls.
The initial discovery that viruses are important agents of gastroenteritis began with the investigation of an outbreak of acute gastroenteritis affecting 50% of students
3 and teachers in an elementary school in Norwalk, Ohio in 1968. Preliminary studies failed to yield an etiological agent in these cases because efforts to propagate a viral agent in vitm were not successful. However, bacteria-free filtrates derived from the outbreak were found to produce gastroenteritis when administered to healthy adult volunteers (Dolin et al., 1971). This was followed by an important breakthrough when
27 nm virus-like particles were discovered by immunoelectron microscopy (IEM) in a stool filtrate from a volunteer infected with a specimen from the Norwalk outbreak
(Kapikian et al., 1972). Norwalk virus (fig. la), the infectious agent of the original
Norwalk outbreak is therefore considered the first virus to be identified as an important etiological agent of gastroenteritis in humans. Viruses of the Norwalk group are now known as the major causative agents of epidemic gastroenteritis in adults and older children (Kapikian, 1996).
The most significant breakthrough in viral gastroenteritis in the past 2 decades was made in 1973 when the 70 nm rotaviruses (fig. 1b) were discovered by thin section electron microscopy (TS-EM) in biopsies of duodenal mucosa from 2 young children with acute gastroenteritis (Bishop et a/., 1973a). During the mid-1WOs, these particles were detected by electron microscopy (EM) in small bowel biopsies and stool specimens obtained from infants with non-bacterial gastroenteritis (Bishop, 1973b,
Middleton et a/., 1977). Rotavirus has long been recognized as the primary causative agent of infantile diarrhea worldwide (Kapikian, 1996).
The discoveries of Nowalk virus and rotavirus as etiological agents of infectious diarrhea stimulated the use of direct detection techniques such as EM, IEM, radioirnmunoassay (RIA), and enzyme-linked immunoassay (ELISA) to detect, in stool samples, viral antigens and particles that could not be propagated in conventional cell culture (Dascal and Blacklow, 1986). Over the past 20 years, these detection methods
4 Figure 1. Negative stained gastroenteritis viruses. (a) Norwalk virus; (b) rotavirus; (c) adenovirus; (d) astrovirus; (e) calicivirus; (f) coronavirus; (g) torovirus. Bars=IOOnm.
have aided in the association of a number of other viral agents with infectious diarrhea
both in humans and animals (fig. 2).
Adenoviruses infect most species of mammals, birds and amphibians. Human enteric adenoviruses (fig. Ic), types 40 and 41, have been reported to be the second most important group of viruses associated with severe diarrheal illness of infants and children, contributing to 5%-20% of hospitalizations for diarrhea in developed countries. In Asia and Europe, 50% of 6-8 year old children have neutralizing antibodies to adenovirus 41 (Uhnoo et a/., 1984). In prospective studies, adenoviruses
40 and 41 together were found to account for 59% of the adenoviruses detected in stools and were the only detectable agents associated with 7.25% of cases with diarrhea (De Jong et ai., 1983). Local retrospective analyses also showed an association of adenovirus 31 with gastroenteritis (Krajden et a/, 1990, Brown, 1990).
Gastroenteritis due to astrovirus (fig. Id) is most frequent in children from infancy to 7 years of age, and 34% of children hospitalized for diarrhea have been found to excrete this virus (Ellis et a/., 1984, Blacklow and Greenberg, 1991, Petric,
1995). Antibodies to astrovirus have been shown to develop in 70% of children by 3 to
4 years of age (Herrmann, 1991). Astroviruses are also important enteric pathogens of young cattle, sheep, and pigs (Woode et a/., 1985a).
Pestiviruses, including bovine viral diarrhea virus, classical pig cholera virus and border disease of sheep are widespread in most animal-raising societies, causing huge economic losses of up to $42 million per year in some countries (Houe, 1995).
However, no human pestiviruses have been discovered to date.
Coronaviruses (fig. If) are well established agents of acute enteritis in piglets and calves (Macnaughton and Davies, 1981). These viruses have also been identified Figure 2. An estimate of the role of etiological agents in severe diarrheal illnesses requiring hospitalization of infants and young children in developed and developing countries. Reprinted from Kapikian, 1993. Other Bacteria Rotavirus
Caficivirus Calicivirus Developed Countries Developing Countries in the stools of young children with gastroenteritis, particularly living in areas of poor sanitation (Mortensen et a/., 1985, Payne et al., 1986).
Toroviruses (fig. Ig) are known causes of diarrhea among horses and cattle
(Weiss et a/., 1983, Woode et al., 1985b), and they have also been reported in the fecal specimens of children with diarrhea (Beards et al., 1984, Koopmans et al., 1987).
The characterization of toroviruses, and their role as etiological agents of infectious diarrhea in both humans and animals, will be the focus of this thesis.
NIDOVIRALES: Coronaviridae and Arteriviridae
In August 1996, the Executive Committee of the International Committee for the
Taxonomy of Viruses (ICTV) revised the taxonomy of the previously monogeneric family Coronaviridae to include both the genera coronavirus and torovirus, and identified the arteriviruses as a single genus within the new family Arteriviridae
(Pringle, 1996). Striking features common to the Coronaviridae and the Aderiviridae have now led to their placement in a newly established order, Nidovirales. The creation of Nidovirales follows a precedent set in 1991 when the fCW endorsed the proposition that the taxonomic category "Order" be introduced into virus classification to include families of viruses with similar genomic organization and replication strategies (Cavanagh, 1997). Nidovirales is the third such order created, following
Mononegavirales (Pringle, 1991), comprised of Filoviridae (Ebola virus),
Pammyxoviridae (measles) and Rhabdoviridae (rabies), and Caudovirales (Pringle,
1992) comprised of 3 bacterial virus families Myoviridae (P2 phage), Siphoviridae
(coliphage h) and Podovin'dae (coliphage T7).
The primary features that define membership of the Coronaviridae and
Arterividae in the order Nidovirales include the nature and organization of the genome
10 of each virus, and its overall replication strategy. For instance, the nested-set arrangement of the subgenornic mRNAs of these viruses inspired the name of the order Nidovirales, from the Latin nidus, meaning nest. Secondary features focus on
morphological, structural, and functional aspects of each virus (De Vries et a/., 1997).
These common features will become evident as the various characteristics of
arteriviruses, coronaviruses, and toroviruses are described below.
ARTERIVIRUS
The genus Arferivims contains 4 known species: equine arteritis virus (EN), lactate dehydrogenase-elevating virus of mice (LDV), simian hemorrhagic fever virus
(SHFV), and porcine reproductive and respiratory syndrome virus (PRRSV) (table 1).
EAV was first isolated from lung tissues of an aborted fetus during an endemic disease outbreak among pregnant mares in Bucyrus, Ohio in 1953 (Doll et a/., 1957). LDV (fig.
3) was discovered in 1960 as a contaminant of transplantable mouse tumors, which had unknowingly been passaged in LDV-infected laboratory mice (Riley et a/., 1960).
SHFV was first isolated from diseased macaque monkeys during devastating epizootics of hemorrhagic fever in primate centers in the U.S. and the farmer Soviet
Union in 1964 (Palmer et a/. , 1968, Tauraso et a/., 1968). Lastly, PRRSV was recently identified as the cause of the new swine disease PRRS, which appeared suddenly in the U.S. in I987 (Collins et a/., 1992) and in Germany in 1990 (Wensvoort, 1993).
Morphology
Arteriviruses are spherical particles measuring 50 to 70 nm in diameter (fig. 3).
They consist of an icosahedral nucleocapsid (diameter 25-35 nm) surrounded by an envelope bearing 2 surface glycoproteins (Magnusson et a/., 1970, Brinton-Darnell
11 Table 1. Species within the genera Coronaviius, Torovinrs, and Arferivims. Reprinted with permission from Cavanagh et a/., 3 994.
Coronaviius Avian infectious bronchitis virus (IBV) Fche coronavirus (feline infectious peritonitis virus, FLPV) (feline enteric coronavi.us, FECV) Caniie coronavirus (CCV) Porcine aansrnissibIe gasn-oentdritisvirus (TGEV) Human coronavirus 229E (HCV 229E) Porcine epidemic dioea virus (PEDV) Murine hepatitis virus (MHV)' Bovine coronavirus (BCV)' Human coronavirus OC43 (HCV OC43p Turkey comnavints (TCV Porcine haemagglutinating encephalomyelitis virus (HEW Rat conmavirus (RWsialodacyroadenitis virus, SDAV) Rabbit c0rb;'iravirus (RbCV)
Berne virus (BEV; equine) Breda virus (B RV; bovine)
Equine arteritis virus (EAV) lactate dehydrogenaseelevatingvim (LDV; murine) Simiihaemonhagic fever virus (SHFV) Porcine reproductive and respiratory syndrome virus (PRRSV) (Swine infertiliey and respiratory syndrome virus. SWV)
.These species contain a gene encoding a haemagglutininesterase glycoprotein (HE) Figure 3. (A) Electron micrograph of a positively stained thin section of gradient- purified LDV. Bar=100 nm. (Reprinted from Brinton, 1994). (B) Diagrammatic representation of the arterivirion (Adapted from Cavanagh et a/., 1994).
and Plagemann, 1975, Den Boon eta].,1991a). These viruses do not agglutinate the erythrocytes of any species tested, and no serological cross-reactivity between
arteriviruses has been detected (Plagemann and Moennig, 1992).
Genetics and replication
The genomes of the EAV Bucyrus strain (Den Boon et a/., 1991a), the PRRSV
Lelystad strain (Meulenberg et a/., 1993), and the LDV-C (Godney et a/., 1993) and
LDV-P (Palmer et a/., 1995) strains have been completely sequenced (fig. 4). The viral genome is a single-stranded positive-sense RNA of approximately 13 to 15kb in length
(Van der Zeijst et a/., 1975). During EAV replication, 3'-coterrninat nested sets of 6 or 7 viral mRNAs are produced. Each subgenomic RNA contains a leader sequence derived from the 5' terminus of the genome, and only the 5' unique regions of each mRNA are translated (De Vries ef a/., 1990, Cavanagh et al., 1994). Eight open reading frames (ORF) have been identified in the EAV and PRRSV genomes (fig. 5).
Starting from the 5' end, ORFla and ORFl b are translated from the genomic RNA and code for the viral polymerase protein, and ORFs 2, 5, 6, and 7 encode the small glycoprotein, large glycoprotein, envelope protein, and nucleocapsid protein, respectively. ORFs 3 and 4 code for nonstructural (NS) proteins (Cavanagh, 1997).
The LDV genome contains all 8 ORFs plus an additional ORF that carries the 3' end of
ORF Ib and is translated into a 148 amino acid protein of unknown function (Chen et a/., 1993).
The nucleocapsid protein, encoded by the 3'-most ORF is phosphorylated, has a molecular weight (Mr) of 12-14K and is highly basic. Its basic properties may facilitate its interaction with genomic RNA during viral assembly. The envelope protein
(Mr 18-19K) is nonglywsylated, and also unusually basic. This protein possesses 3
15 Figure 4. Organization of the genomes of LDV, EAV, and PRRSV. The 5' portion contains two open reading frames ORFs (la11 b) with a frameshift near the centre.
Conserved domains in lalib are indicated by shaded boxes. The 3' portion of the genome contains 6 overlapping ORFs. Adjacent 3' ORFs are in different frames.
Adapted from Brinton, 1994.
Figure 5. Transcription of the EAV genome. RNAs 1-7 represent subgenomic RNAs.
Solid boxes indicate the EAV leader sequence. Adapted from Den Boon et a/., 1991a. adjacent transmembrane regions near the N-terminal end. The region at the extreme
N-terminal end of the protein may function as an uncleaved signal sequence (Brinton-
Darnell and Plagemann, 1975). The 2 envelope glycoproteins consist of a small protein (Mr 25K) and a large primary protein (Mr 55K). The small glycoprotein possesses a signal peptide and a C-terminal transmembrane segment with I to 4 potential Nglycosylation sites. The large glycoprotein has a structure that is unique for a major envelope glycoprotein in that it possesses a signal peptide and 3 potential internal transmembrane segments. After cleavage of the signal peptide, a segment of only about 30 amino acids of this protein with 1 to 3 N-glycosylation sites is projected externally. This would explain the smoothness of the outer surface of the artenvirion
(Faaberg and Plagernann, 1995). It has been shown for EAV, that neutralizing antibodies are all specific for this large envelope glycoprotein (Balasuriya et a/., 1995).
Epidemiology
Serological evidence has shown that EAV is widespread in the horse population, but rarefy causes disease. Clinical features of disease include acute anorexia and fever, usually accompanied by palpebral edema, conjunctivitis, and edema of the legs, genitals, and abdomen. Abortion is common in infected pregnant mares (Golnik et a/., 1986). LDV causes a lifelong infection in laboratory mice regardless of strain, age or sex. The chronic infection is asymptomatic, except for some subtle effects on the host immune system (Plagemann and Moennig, 1992).
PRRSV is thought to be transmitted largely via aerosols because the virus replicates primarily in the lung, it is present in nasal secretions, and swine can be readily infected by intranasal administration. However, fecal-oral transmission may also be involved because PRRSV is secreted in urine and feces. In addition, pregnant sows have been
20 shown to transmit this virus transplacentally (Murtaugh et a/., 1993). In recent years,
PRRS has spread rapidly in North America and Europe, especially in areas with high pig densities. This virus has been shown to spread very quickly within an infected farm
(Meredith, 1993).
Overall, the biology of artenviruses is poorly understood because field isolates are rare and may be difficult to propagate in cell culture (Den Boon et a/., 1991a).
Nonetheless, the inapparent and persistent nature of infections caused by LDV,
PRRSV, SHW, and EAV requires the development of reliable diagnostic assays to identify infected animals, and to detect potential new members of this virus group.
CORONAVIRUS
Coronaviruses are typically species-specific and cause endemic respiratory or enteric disease, although several can also cause hepatitis, infectious peritonitis, nephritis, myocarditis, and neurological, reproductive, or immunological disorders
(Holmes, 1994). Species within the genus Coronavirus include rnurine hepatitis virus
(MHV), avian infectious bronchitis virus (IBV), feline infectious peritonitis virus (FIPV), canine coronavirus (CCV), rat, rabbit, and bovine coronaviruses (BCV), human enteric coronavirus (HEW), human respiratory coronavirus (HCV), turkey bluecomb coronavirus (TCV), 3 swine-transmissible gastroenteritis viruses (TGEV), and 2 porcine coronaviruses (Mclntosh, 1996; table 1). Particles resembling coronaviruses have also been detected by EM in the fecal specimens of adults, children, and neonates, both with (Mortensen et a/., 1985) and without (Dourrnashkin et a/., 1980) symptoms of acute gastroenteritis (Vaucher et a/., 1'982). Hence, these coronavirus- like particles (CVLP) have not consistently been associated with infectious diarrhea or other gastrointestinal symptoms in humans.
2 1 Morphology
The coronavirion is a spherical, moderately pleornorphic particle measuring
100-150 nm in diameter (fig. 6). It is made up of a helical nucleocapsid of RNA and protein (N) surrounded by an envelope bearing large club-shaped glycoprotein spikes
(S), and smaller integral membrane proteins (M). Some coronaviruses also bear hemagglutinin-esterase envelope glycoproteins (HE) (Holmes, 1994). The phosphorylated N protein has a Mr between 30-50K, and has been shown to contain protein kinase activity (Siddell et a/., 1983). The M gfycoproteins (Mr 20-30K) traverse the lipid bilayer 3 times and are associated with the nucleocapsid. The M protein localizes in the Golgi and this is considered to determine the intracellular site of coronavirus morphogenesis. The S glycoproteins (M, 80-200K) are 12-24 nm in length, and have been shown to bind receptors, to be involved in virus-induced cell fusion, and to elicit neutralizing antibodies upon infection (Siddell et a/., 1983,
Vennema et a/., 1990). The HE glycoproteins (M, 65K) have been shown to bind 9-0- acetylated sialic acid residues on cell membranes during initiation of infection, and to cleave their ester linkages in a receptor-destroying activity (Holmes, 1994).
Genetics and replication
The coronavirus genome is a single-stranded, positive-sense RNA of approximately 30kb in length (fig. 7). The infectious genomic RNA is capped at its 5'- terminus, polyadenylated at the 3'-terminus, and serves as a mRNA for the synthesis of the RNA-dependent RNA polymerase (POL) (Lai, 1990). Using the genomic RNA as a template, the polymerase generates a full-length minus-strand, which is then used to generate a new plus-strand genomic RNA and a 3' co-terminal nested set of 5 to 7 subgenornic RNAs (Sawicki and Sawicki, 1990, Lai, 1995). A 60-70 base capped
22 Figure 6. (A) Electron micrograph of a fecal specimen showing an enteric coronavirus particle. Bar=l00 nm. (6) Diagrammatic representation of the coronavirion. A subset of coronaviruses contains the HE glycoprotein andlor the sM protein. Adapted from
Cavanagh et a/., 1994.
Figure 7. Genomic organization of coronaviruses. The MHV genome is 31.2kb, while the l5V is 27.6kb in length. Filled boxes indicate open reading frames encoding the structural proteins. Numbers indicate the subgenornic mRNA in which each ORF is found. Reprinted from Holmes and Lai, 1996. leader sequence, corresponding to the sequence at the 5 tenninus of the genome, is present on all mRNAs (fig. 8). Between genes on the genomic or subgenornic minus- strand templates are short, 7 base consensus transcription initiation signals, such as
UCUAAAC for MHV (Shieh et a/., 1987). A complex of polymerase and leader transcribed from the template may bind these sequences and serve as primer for synthesis of new mRNAs (Lai, 1990). The location, sequence, and repeat number of these 7 base signals on the minus-strand template determine the number, properties, and relative abundances of subgenomic mRNAs. Thus, the deletion or mutation of consensus intergenic sequences (mutants, subgenomic defective-interfering RNAs) can result in the absence of corresponding mRNAs. For example, while some MHV strains express an mRNA with the HE gene at its 5' terminus, other MHV strains lack the transcription initiation sequence that precedes the HE ORF and consequently do not express the HE glycoprotein (Holmes, 1994).
Coronaviruses express 5 to 7 overlapping mRNAs in infected cells, and only the
ORF at the 5'-terminus of each viral mRNA is translated (fig. 8). The N protein, which is translated from the smallest mRNA, is the most abundant viral protein in infected cells (Stohlman et al., 1983). It assembles with genomic RNA in the cytoplasm to form helical nucleocapsids (Baric et a/., 1988). Viral glycoproteins are translated on the rough endoplasmic reticulum (ER) where S oligomerizes. The HE, S, and M proteins are then transported to the Golgi, where M accumulates. Some S and HE proteins accumulate in the Golgi, while a fraction of the S and HE oligomers are slowly transported to the plasma membrane, where HE can cause hemadsorption and S may play a role in cell to cell fusion. The viral glycoproteins and the nucleocapsid are assembled to form budding virions at a special pre-Golgi compartment. The virions are then transported to the cell surface in large vesicles that fuse with the plasma
27 Figure 8. Model of coronavirus replication based on MHV. Reprinted from Holmes and
Lai, 1996.
membrane, thus releasing the virus from the intact cell (Griffiths and Rottier, 1992,
Holmes, 1994; fig. 8).
Antigenic properties
Coronaviruses are divided into 3 distinct serogroups. The first group of viruses is related to HCV-229E, the second group is related to MHV, and the third group includes the strains of IBV. The viruses within each group show serological cross- reactivity, similar genome organization, and nucleotide sequence homology (Mclntosh etal., 1969). Although the order of the genes encoding the POL, S, M, and N proteins is the same in the genornes of all coronaviruses, the 3 serogroups differ significantly in the number, order, and properties of additional ORFs that are believed to encode NS proteins. Furthermore, there is substantial strain variation between coronavirus isolates (Holmes, 1994). Deletions or mutations in segments of ORFs or intergenic sequences are common. For example, at specific regions within the Sq subunit of the spike protein, different isolates of a coronavirus may have insertions or deletions of several hundred amino acids in length that affect viral antigenicity, virulence, and tissue tropism. While all 3 glycoproteins of the human coronaviruses have been shown to be antigenic, the S protein appears to elicit the major immune response (Schmidt and Kenny, 1981). Antibodies to this protein inhibit hernagglutination and probably neutralize infectivity, while M has neutralizing potential only in the presence of complement (Collins et al., 1982).
Pathology and pathogenesis
Although the animal coronaviruses produce a wide variety of diseases in multiple organ systems, the known human coronaviruses produce only acute
30 respiratory disease and acute gastroenteritis (Mclntosh, 1996). Coronaviruses that cause respiratory or enteric disease generally replicate in the epithelial cells at these sites, where the apical membranes express the glycoprotein receptors for these viruses. Thus, most coronaviruses are shed in respiratory secretions or feces. Virus titers in the respiratory or enteric tract rise during the first 3 to 5 days post-inoculation.
Recovery of infectious virus is usually not possible after 1 or 2 weeks, although viral antigens and RNA can be detected in tissues for several additional weeks (Schmidt and Kenny, 1981, Holmes, 1994).
Coronavirus-induced lesions vary markedly depending on the virus strain, tissue tropism, and the genetic background of the host. Human respiratory coronaviruses related to HCV-229E or HCV-OC43 infect the epithelial cells in the upper respiratory tract and cause colds. Lower respiratory tract infections have occasionally been observed in adults, and infections in young asthmatic children can exacerbate wheezing (Mclntosh, 1996). Intestinal infections with HECV, MHV, BCV, TGEV, CCV and TCV cause loss of apical epithelial cells of the intestinal villi as well as shortening and broadening of the villi. Some enterotropic coronaviruses cause necrotizing enterocolitis, particularly in neonatal animals, while others cause watery diarrhea or asymptomatic enteric infections (Holmes, 1994). The TGEV model of gastroenteritis in piglets provided great insight into the pathogenesis of coronaviral gastroenteritis
(Hamilton et a/., 1976). CVLPs have been associated with outbreaks of explosive diarrhea in young adults (Caul et a/., 1975, Marshall et a/., 1989), and outbreaks of diarrhea and necrotizing enterocolitis in neonates and young children (Chany et a/.,
1982, Mortensen ef a/.,1985, Sitbon, 1985). Diarrhea due to a coronavirus infection is probably caused by the altered transport of fluids and electrolytes by immature epithelial cells that cover the blunted villi (Doughri and Storz, 1977, Holmes, 1994).
3 1 Diagnosis
Most diagnoses of human respiratory coronavirus infections are made retrospectively by monitoring serownversion, and are confined to infections by viruses antigenically related to HCV-229E or HCV-OC43. Isolation is generally not feasible since respiratory coronaviruses are grown in tissue culture with great dificulty 'if at all
(Mclntosh, 1996). Fortunately, immunofluorescence and staining of epithelial cells shed from the respiratory tract offers a diagnostic method that theoretically could circumvent the need for cell culture. However, this assay is limited to the serological groups of HCV-229E and HCV-0C43 due to the availability of antisera to these viruses
(Mclntosh et a/., 1996). Also, an ELlSA for the detection of coronavirus antigen in nasal swabs or secretions has been reported, but the specificity and sensitivity of this assay are unknown (Macnaughton et a/., 1983). The detection of coronavirus nucleic acid in respiratory secretions by the polymerase chain reaction (PCR) has also been reported (Mclntosh et a/., 1996).
The diagnosis of enteric coronavirus infections is performed by the detection of characteristic particles in stool specimens by EM. No culture or antigen detection systems yet exists at the time of this writing for the diagnosis of these enteric viruses
(Mclntosh, 1996). However, based on studies of respiratory coronaviruses by PCR, this assay holds promise for the detection of enteric agents in the future. PCR will also be useful to extend our knowledge of coronaviruses as etiological agents of disease, as well as to better understand strain variations among human coronaviruses.
Epidemiology
Reinfection with coronavirus is common in animals and humans because of the extensive antigenic variability among coronavirus strains and because many
32 coronaviruses replicate only in epithelia where the immunity that is generated is
relatively short-lived. Infection is often asymptomatic, and virus particles may be
detected in healthy individuals. These viruses are enzootic or endemic in their host
species, causing sporadic disease and seasonal outbreaks when a sufficient number
of susceptible hosts become available (Holmes, 1994). Coronavirus diseases are
more severe in newborns than adults, and irnmunocornprornised hosts often have
asymptomatic infections with prolonged virus shedding. AIDS patients with diarrhea
and newborn infants with necrotizing enterowlitis may carry CVLPs in their feces for
extended periods of time (Kern et a/., 1985).
Outbreaks of coronaviral diseases are often seasonal. In humans, respiratory
coronaviruses cause 15.30% of colds, predominantly in winter months. Outbreaks of
BCV-induced winter dysentery in cattle, and severe enteritis due to TGEV or BCV
infections in suckling pigs and calves, respectively, also occur seasonally in correlation
with breeding cycles (Holmes, 1994). Outbreaks of HECV or CVLPs have been shown
to have seasonal distributions similar to that of rotavirus, with peak incidences
occurring in the fall and early winter (Mortensen et a/., 1985).
Coronaviruses have a broad geographic distribution. IBV, TGEV, BCV, FIPV, and CCV infections, as well as human infections with viruses related to HCV-229E or
HCV-OC43, occur worldwide. Human enteric coronaviruses have also been found in the stools of adults and children in many parts of the world, including Central America,
Europe, Africa, India, Australia, and Japan (Mclntosh, 1996). However, human enteric
CVLPs have been observed more frequently in tropical areas and developing countries than in Europe or North America (Macnaughton and Davies, 1981). Prevention and control
The economic importance of coronavirus diseases in domestic animals has
prompted the development of modified live vaccines against IBV, TGEV, BCV, CCV,
and FIPV. However, these do not provide complete protection from infection with wild-
type coronaviruses. Other approaches to protection and control of these agents
include the use of recombinant S proteins, synthetic peptides that mimic neutralizing
epitopes, and passive immunization with antibodies against S glycoproteins (Holmes,
1994). These approaches have been shown to be fairly consistent in their abilities to
initiate antibody development.
To date there have been no attempts to develop a vaccine against human
respiratory or enteric coronaviruses. Studies of volunteers inoculated with an HCV-
229E-like strain have shown that the incidence of colds, the severity of symptoms, and
virus replication can all be reduced by pretreatment with intranasal a-interferon
(Higgins et a/., 1983). Gastroenteritis caused by a coronavirus infection is normally a
self-limited illness of a few days duration. The main risks of dehydration and electrolyte
imbalance are generally treated by rehydration therapy in children, and the
maintenance of good hydration in adults (Christensen, 1989, Kapikian, 1993).
TOROVIRUS
Berne virus (BEV), the torovirus prototype, was first isolated from the rectal
swab of a diarrheic horse during routine laboratory diagnostic work at the Surgery
Clinic in Berne, Switzerland, in 1972. The animal died Iweek after the sample had
been collected. Post-mortem examination revealed pseudomembranous enteritis, as well as miliary granulomas and necrosis in the liver. Salmonella lifle was considered as the causative agent of disease in this case. Upon analysis, this BEV laboratory strain
34 P138/72 was shown to possess a unique morphology and substructure, and the agent
was not neutralized by reference antisera against other equine viruses (Weiss et a/.,
1983).
A decade later, a morphologically similar virus was found in Breda, lowa in the
stools of neonatal calves with diarrhea (Woode et a/., 1982). This agent was termed
Breda virus (BRV). Viruses similar to BRV were later found in feces from a colostrum-
deprived calf in lowa, and in the stools of 5-6 month old diarrheic calves in Ohio. On
the basis of results from hemagglutination inhibition (HI) tests, ELJSA, and JEM, the 3
BRV agents were found to be antigenically related and were also subdivided into 2 serotypes (Woode et a/, l98Sb).
It was found that the 2 enteric pathogens, BWand BRV, are morphologically
and antigenically related, and as such they were initially placed in a newly designated genus torovims (table 1) within the proposed family Toroviridae (Horzinek et a/., 1987).
However, based on genetic and morphological evidence, it has since been established that toroviruses are sufficiently closely related to the coronaviruses to be included as members of the family Coronavriidae (Cavanagh and Horzinek, 1993).
In 1984, Beards et a/. first reported the appearance by EM of particles similar to
BEV and BRV in the fecal specimens of children with diarrhea in Birmingham, England and Bordeaux, France. These human torovirus-like particles (TVLPs) were found to be related to BEV and BRV on the basis of morphological and serological similarities
(Beards et a/, 1986). Similar particles have been reported in diarrheic feces from children and adults in Europe, South America, India, and Canada (Koopmans et a!.,
1997, Krishnan and Naik, 1997, Duckmanton et a/., 1997). Most of these studies were based on the diagnosis of the virus by EM or by ELSA with sera to the related Breda virus. Morphology
By negative contrast electron microscopy, toroviruses are pleomorphic, appearing as circular, crescent, and rod shaped particles that measure 100-120 nm at their largest diameter (Horzinek et a/., 1987; Weiss and Horzinek, 1987; Snijder,
1991). Each particle is enveloped and contains an elongated, tubular nucleocapsid of helical symmetry (fig. 9). The nucleocapsid has been described for Bn/ as a sausage- like internal structure with transverse striations (Weiss et a/., 1983). Virions are covered on their surface with peplomers. BEV surface projections consist of thin stalks carrying distal spherules, and measuring 20 nm in length (Weiss et a/., 1983).
However, the peplomers of BRV and WLPs have been reported as measuring 7-9nm in length (Woode et a/., 1982, Beards et a/., 1984). Occasionally, a second ring of smaller peplomers, partly superimposed upon the first was observed on particles purified from human feces (Beards et a/.,1984).
The thin section morphologies of BEV in infected horse kidney cells, embryonic mule skin fibroblasts, and equine dermal cells, as well as BRV in gut epithelium from infected calves have been examined (fig. 10). BEV-infected cells were found to contain densely staining spherical, elliptical, and elongated particles accumulating at the cytoplasmic membrane and in vacuoles. At a higher magnification, a clear distinction can be made between the electron-lucent envelope and the electron-dense core. Rod- and crescent-shaped virions are prevalent in the extracellular space. In these cells, twin circular structures with conspicuous light centers surrounded by a closely fitting membrane are regularly seen. These structures have been interpreted as cross- sections through a hollow, tubular nucleocapsid (diameter 23 nm) bent into an open torus. The length of the nucleocapsid has been estimated between 170 nm and I80 nm (Weiss et a/., 1983, Weiss and Horzinek, 1987). In cells of the intestinal mucosa of
3 6 Figure 9. (A) Electron micrograph of Berne virus particles showing their circular-, rod-, and crescent-shaped conformations. Bar=50 nm. (Weiss and Horzinek, 1987). (B)
Diagrammatic representation of the torovirion. Adapted from Cavanagh et a/., 1994.
Figure 10. Different forms of BEV particles encountered in ultrathin sections through
BEV-infected equine dermis cells. Shown on the right are electron micrographs of BEV particles, and on the left are schematic interpretations of the viral structures seen in the corresponding photographs. Section planes 1 and 2 cut the nucleocapsid twice and once respectively. Reprinted from Weiss and Horzinek, 1987.
BRV-infected calves, elongated virions with rounded ends were detected. An electron dense core (diameter 22 nm) surrounded by an outer membrane of medium electron density was reported. The particles were described as pleomorphic and varying in length, with average dimensions of 35 x 80 nm (Pohlenz et a/., f 984, Fagerland et a/.,
1986). The crescent shape described above for BEV was not reported.
Physicochemical properties
Berne virus and Breda virus have been shown to be stable in the environment.
BEV is readily inactivated by heat, but well preserved at temperatures below -20'~.
This virus is very sensitive to UV irradiation but for a lipid-containing virus, BEV possesses an unusual stability to acidic environments. Whereas a number of viruses such as ortho- and paramyxoviruses are inactivated at pH values below 5.0, BEV retains its infectivity titers at pH 2.5 (Weiss and Horzinek, 1986). BEV has also been found to be resistant to sodium deoxycholate, phospholipase C, trypsin and chymotrypsin. Treatment with Triton X-100 leads to the rapid inactivation of BEV, and organic solvents and formalin completely destroy viral infectivity.
Toroviruses have been shown to have a buoyant density in sucrose between
1.14 and I.18 glml. The sedimentation coefficients of BEV and BRV have been determined to be approximately 400 S (Weiss et a/., 1983, Koopmans et a/., 1986).
Analysis by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) shows that BEV possesses 4 structural polypeptides (table 2). The phosphorylated nucleocapsid protein (N) accounts for nearly 84% of the protein mass, and is the most prevalent protein in the BEV virion. This 20kDa protein can be liberated by treating the virus with Triton X-100. By irnmunoblot, the N protein was shown to be the only RNA- Table 2. Properties and functions of torovirus structural proteins.
Nucleocapsid protein, N Phosphoprotein Binds to viral RNA to nucleocapsid
Envelope protein, M Lipoprotein May interact with viral nucleocapsid Essential for envelope fbrrnation
Peplomer glycoprotein, S N-linked gl ycos ylated Induces neutralizing antibody Involved in hemagglutination
Hemagglutinin-esterase protein, HE a N-gl y cosyIated Has role in hernagglutination Postulated to bind from 9-0-acetylated neuraminic acid on cell membranes Esterase activity considered cleave acetyl groups from 9-0- acetylneuraminic acid
a To date present only in BRV (Cornelissen et a/., 1997. ~uckmantonet a/., 1W8b) and HW (Duckmanton st al., 1998~). binding viral polypeptide species detectable in infected cell lysates (Horzinek et a/.,
1985).
Second in abundance, accounting for 13% of the virion protein mass, is the
22kDa envelope protein (M). M is a lipoprotein as demonstrated by its extreme
sensitivity to organic solvents. A 37kDa phosphorylated polypeptide has also been
shown to be present for BEV, and this protein may be associated with the viral
envelope. However, the location of its ORF in the toroviral genome remains unknown,
and thus it may be a breakdown product and not a separate protein. Lastly, the
peplomer protein (S) migrates as a heterogeneous band between 75-100K. This
protein is membrane associated, and has been shown to be variably N-glycosylated
since treatment with tunicamycin prevented the formation of infectious virus, as well as
the appearance of the 75-100K band in SDS-PAGE analysis of cells infected with BEV
(Weiss and Horzinek, 1987). In BEV-infected cells, a 200K precursor to the S protein
is synthesized. Post-translational processing of this precursor molecule, involving glycosylation and subsequent proteolytic cleavage, gives rise to the 75-100K constituents of the torovirus peplorner protein.
By SDS-PAGE, BRV was shown to possess 5 structural polypeptides with similar molecular weights to those found for BEV (table 2). The BRV N and M proteins possess similar properties to those of BEV (Horzinek et a/., 1985, Den Boon et a/.,
I991b). The 37kDa matrix protein thought to be associated with the envelope is also present. The N-glycosylated S protein migrates as 2 bands with Mr of 85K and 105K, that probably arise following post-translational processing of the BRV S protein precursor. A fifth BRV protein with a Mr of 65K, which was initially not thought to be virus-specific (Koopmans et a/., 1986), has recently been shown to represent a novel hemagglutinin-esterase protein (Cornelissen et a/., 1997). This protein was shown to
43 be N-glycosylated, and display acetylesterase activity as demonstrated in an in situ
esterase assay developed for the HE fusion protein of influenza C virus (ICV;
Wagaman eta/., 1989).
Genome organization
The insensitivity of BEV replication to the presence of 5-iodo-2'-deoxyuridine
initially indicated that these particles contain an RNA genome (fig. 11). The genomic
RNA is single-stranded, of positive polarity, polyadenylated, and infectious in a
transfection assay. It has an apparent Mr of 9x106, and has been estimated to be
approximately 25-30kb in length (Snijder et ai., 1990a). As with coronaviruses, the
genomic RNA serves as a mRNA for the synthesis of an RNA-dependent RNA
polymerase. Using the genomic RNA as a template, the polymerase generates a full-
length minus-strand, which is then used to generate new plus-strand genomic RNAs and a 3' co-terminal nested set of 5 viral mRNAs (approximately 25, 7, 2.1, I.4, and
0.8 kb in length). Except for the smallest one, these RNAs are polycistronic, but only the ORF at the 5'-terminus of each mRNA is translated (Snijder et a/., 1988, 1990a; fig. 12). The torovirus genome has been shown to contain at least 6 open reading frames. The 4 smallest ORFs are located on subgenomic mRNAs, and each of these
ORFs is preceded by a conserved 8-nucleotide sequence (U C/G UUUAG AN) which probably represents a transcription initiation signal on the RNA that directs the synthesis of subgenomic mRNAs.
The first recognized ORFs from the 5' end (ORFla and ORFl b) constitute the viral polymerase gene. Of these, only the nucleotide sequence of BEV ORFlb (6873 nts) has been completely determined to date (Snijder et al., 1990b). As with coronaviruses, BEV was shown to express ORFl b by ribosomal frameshifting during
44 Figure 1I. Schematic representation of the BEV genome showing the open reading frames (ORF) for polymerase gene (POLlaA b), the peplomer (S) gene, envelope (M) gene, and nucleocapsid (N) gene. ORF marked X represents a pseudogene. The POL la gene has not yet been sequenced and is thus shown as a dotted box.
Figure 12. Transcription strategy of the BRI genome. RNA numbers indicate subgenomic mRNAs that encode the polymerase gene (POL), the peplomer gene (S), the envelope gene (M), the recombinant gene (X) for BEV or the hemagglutinin- esterase (HE) gene for BRV, and the nucleocapsid gene (N). translation of the genomic RNA. The predicted tertiary "pseudoknot" RNA structure in the toro- and coronaviral frameshifi-directing region is similar. Analysis of the amino acid sequence of POLlb revealed the presence of 4 domains that are highly conserved among the Coronaviridae. These domains include the putative polymerase domain, an area containing conserved cysteine and histidine residues, a putative helicase motif, and a domain apparently unique to toroviruses and coronaviruses
(Snijder et a/., l99Ob).
ORF 2 of the torovirus genome has been identified as the peplomer protein gene (4743 nts). This gene encodes an apoprotein of 1581 amino acids with a Mr of approximately 200K. In vitn, expression studies and immunoprecipitation of the S gene translation product identified this protein as the S protein precursor (Snijder et a/.,
1990~).The deduced amino acid sequence of the peplomer gene contains a number of domains that are typical of type I membrane glycoproteins: an N-terminal signal sequence, a putative C-terminal transmembrane anchor, and a cytoplasmic tail.
Eighteen potential N-glycosylation sites, 2 heptad repeat domains, and a possible cleavage site for a trypsin-like protease were also identified. A heptad repeat is a seven-residue periodicity in which hydrophobic amino acids are regularly spaced (eg. every first and fourth position). The heptad repeats are probably involved in the generation of an intra-chain coiled-coil secondary structure. Based on sucrose gradient ultracentrifugation studies, the mature S protein was shown to form dimers.
Thus, the intra- and inter-chain coiled-coil interactions may help stabilize the elongated viral peplomers (Snijder et al., I990c).
ORF 3 has been identified as the envelope-protein gene (699nts), whose translation product is the smallest, most abundant, membrane-associated protein.
Analysis of the amino acid sequence of the M protein revealed the characteristics of a
49 type Ill membrane protein, lacking a cleaved signal sequence, but containing 3 successive transmembrane a-helices in its N-terminal half (Den Boon et a/., 1991b).
These features are also found in the coronavirus M protein (Siddell et a/., 1983).
In BEV, ORF4 has been described as a pseudogene (426 nts) that encodes a protein with 30-35% sequence similarity to a portion of the HE proteins of coronaviruses and ICV. However, the 5' terminus of ORF 4 appears truncated. Thus the N-terminal part of the putative HE protein, including the catalytic center for the acetylesterase, is absent. Such a deletion may have occurred during tissue culture adaptation of the virus (Snijder et a/., 1991). In contrast, the BRV genome has been shown to contain the complete HE gene sequence in ORF 4. The encoded protein
(416 amino acids in length) displays the characteristics of a type I membrane glycoprotein: a 14 residue cleavable N-terminal signal sequence, a 24 residue C- terminal transmembrane anchor, and 7 potential N-glycosylation sites. The putative catalytic site of the coronavirus and ICV acetylesterases, the F-G-D-S motif, is conserved in the BRV HE homolog, which manifests acetylesterase activity
(Cornelissen et a/. 1997).
ORF 5 at the 3' terminus of the BEV genome has been identified as the nucleocapsid-protein gene (480 nts). This ORF codes for a 160 residue polypeptide with a predicted molecular weight (Mr) of approximately 18.3kD. In addition, 2 clusters of basic amino acid residues are present in the N protein (Snijder et a/., 1989).
Replication
Although BRV has not yet been grown in cell culture, BEV has been grown in embryonic mule skin fibroblasts, and exhibits cytopathic effects at 24-30 hours post- infection (Snijder, 1991). The morphogenesis of BEV in cultured cells and BRV in 50 intestinal cells of infected calves has been studied by EM (fig. 13). At approximately
10 hours after infection, BEV particles can be seen within parts of the Golgi apparatus,
as well as extracellularly. At this time, tubular structures of variable length, diameter,
and electron density appear in the cytoplasm and in the nucleus of infected cells.
These structures probably represent newly formed nucleocapsids. It is unknown
whether the accumulation of nucfeocapsids in the nucleus reflects a nuclear phase
during torovirus replication or a sort of defective assembly (Horzinek, I994). Viruses
predominantly bud into the lumen or cisternae of the Golgi, but budding into the rough
ER and the perinuclear space has also been described. The preformed nucleocapsid tubules approach the Golgi membrane with 1 of their rounded ends, and attach to it
along 1 side. This strategy is comparable to the morphogenesis of coronavirus
particles whereby nucleocapsids have been observed to bud from the membranes of the Golgi apparatus or the rough ER during assembly (Snijder ef a/., 1994). During budding, the torovirus nucleocapsid is apparently stabilized, leading to a higher electron density and a constant diameter of 23 nm (Horzinek, 1994). This may occur due to the interaction of the nucleoprotein with a putative matrix polypeptide, M
(Horzinek et at., 1987). Cytoplasmic vesicles containing virus fuse with the peripheral plasma membrane and release their contents. A morphological change has been shown to take place in these particles during virus maturation. During transition from the intravesicular to the extracellular state, the morphology of the virions changes from the rod-like form to the characteristic torus shape (Weiss and Horzinek, 1987).
The morphogenesis of BRV cannot be followed sequentially since this virus has not yet been grown in tissue culture. However, studies of BRV replication in cells of the bovine intestine indicate that the morphogenesis of BRV is similar to that of BEV
(Fagerland etal., 1986). That is, tubular structures were encountered in the cytoplasm
5 1 Figure 13. Various stages of BEV budding into smooth membrane vesicles. (a) Initial stage: 1 pole of the nucleocapsid is fixed to the membrane (arrowhead). (b) Membrane is attached to 1 side of the capsid (arrowhead). (c) Enveloped part of the nucleocapsid protruding into the vesicular lumen. (d) Enveloped bacilliforrn virus particle within a smooth membrane structure. Bars=lOO nrn. Reprinted from Weiss and Horzinek,
1986.
and the nucleus, and enveloped particles were seen predominantly in vesicles of the
Golgi system. Virus-containing vesicles appeared to move to the cell surface, fuse with
the plasma membrane, and release their contents. All BRV particles encountered in
ultrathin sections during these studies were elongated and rod-shaped (Pohlenz et a/.,
1984, Weiss and Horzinek, 1987).
Antigenic properties
In EM studies, purified BEV particles were shown to bind through their
peplomers to the surface of erythrocytes, accounting for their hemagglutinating
properties. BEV particles hemagglutinate human group 0, rabbit, and guinea pig
erythrocytes, but not rat or mouse erythrocytes (Horzinek ef a/., 1987). Purified BRV
particles were found to hemagglutinate mouse and rat erythrocytes, but not human
group 0 or guinea pig erythrocytes (Zanoni et a/., 1986). Neither of the viruses showed
hemagglutinating activity with bovine, hamster, horse, sheep, goose, turkey or chicken erythrocytes (Horzinek et a/., 1987).
Only the 1 prototype BEV strain has ever been isolated from equine fecal specimens, and all atiempts to obtain additional equine isolates have been unsuccessful. However, 2 serotypes of BRV have been recognized on the basis of results from HI assays, ELISA, and EM. Breda virus serotype 1 (BRV-I) represents the original isolate from lowa, and serotype 2 (BRV-2) includes a second isolate from a
2-day-old colostrum-deprived calf in lowa, and an isolate from a 5-month-old diarrheic calf in Ohio (Woode et al., 1985b).
BEV and BRV demonstrate antigenic cross-reactivity in a number of serological assays. BEV preparations reacted in IEM, ELISA and RIA with bovine convalescent sera (Weiss et a/., 1983, Horzinek et a/., 1985, Beards et a/., 1986), and a mouse
54 serum raised against BRV-2 was shown to neutralize the infectivity of BEV (Koopmans et a/., 1986). BRV antigens are active with BW antibodies by imrnunofluorescence microscopy (IFA), ELISA, and IEM (Weiss and Horzinek, 1987, Beards et a/., 1986). In addition, WLPs were found to be aggregated by calf sera containing antibodies to
BRV or BEV (Beards et al, 1986). Lastly, human stool specimens documented to contain NLPs by electron microscopy were also shown to be reactive in a torovirus- specific ELISA based on BRV antiserum raised in rabbits (Koopmans et a/., 1993; table 3).
The cross-reacting antigen involved in virus neutralization and hemagglutination has primarily been shown to be the torovirus peplomer protein. However, recent evidence has shown that the BRV HE protein may also have hemagglutinating properties (Cornelissen et a/., 1997). Monoclonal antibodies produced against BEV recognized the 75-100kDa S glycoprotein by RIA, and showed neutralizing and HI properties (Horzinek et a/., 1986). A horse field serum with high neutralizing activity against BEV also preferentially recognized the S protein (Horzinek et a/., 1985).
Furthermore, mouse serum produced against BRV-2 recognized the 85-105kDa S protein of BRV-1 by RIA (Koopmans et a/., 1986).
f athology and pathogenesis
To date only the pathology of BRV has been described. Torovirus infections are prominent causes of neonatal calf diarrhea (Brown et a/., 1990, Koopmans et a/.,
1991b, Scott et a/., 1996) and winter dysentery of adult cattle (Van Kruiningen et a/.,
1992). In calves, BRV infects the lower half of the small intestine and the large intestine, particularly the colon. Histological examinations show villus atrophy and epithelial desquamation from the mid jejunum to the lower small intestine, and areas of
55 Table 3. EM and ELISA results for 89 stool specimens from children with diarrheaa. Reprinted from Kooprnans et a/., I993.
No of specimens with the following TVX,P-EM result ELISA result Positive Negative Total
Positive
Negative
Total
Samples were screened by EM fbr the presence (EM positive) or absence (EM negative) of TVLPs, coded, and tested by ELISA. ELISA was peaformed with rabbit sera to bovine torovirus after partial purification of the stool specimens by sucrose gradient. necrosis in the large intestine. At the cellular level, lesions were characterized by cell volume expansion, duplication of the Golgi complex with many small vesicles associated with both faces of the Golgi, distension and fragmentation of the cytocavitary network, and appearance of phagolysosomes containing viral structures and cellular debris. Antigen can be detected as early as 48 hours post-infection in dome epithelium, and in crypt and villus epithelial cells as shown by EM and IFA
(Pohlenz et a!., 1984, Woode et a/., 1984).
Watery diarrhea in BRV-infected calves is considered to result from a loss of the resorptive capacity of the colonic mucosa, combined with malabsorption in the small intestine. Infection of the crypt epithelium may increase the duration of diarrhea, as regeneration of villus epithelium starts in the crypts (Horzinek, 1994). Most infected calves develop anorexia and a watery yellow-green diarrhea that lasts 4 to 6 days, and shed virus for 3 to 4 days following the cessation of symptoms. Some animals experience dehydration, shivering, hyperpnea, and watery eye discharge. In some calves, the diarrhea is preceded by a mild fever. Diarrhea is normally more severe in calves with a normal intestinal flora than in gnotobiotic calves. Mortality in experimental infection approaches 25% (Horzinek and Weiss, 'I 990, Horzinek, 1994).
Epidemiology
There is serological evidence that Berne virus has been widespread in the horse population (81%). In Switzerland, rises in antibody titers were noted in 9% of paired sera sampled at random. In addition, positive reactions were obtained in serum neutralization tests and ELISA using small numbers of horse sera from Germany,
France, Italy and the U.S. (Weiss et a/., 1984). In the former German Democratic
Republic, 35% of sera collected randomly from horses contained torovirus-specific
57 antibodies when tested by a serum neutralization assay against BEV (Liebermann,
1990). Using BRV as an antigen in ELISA, 57% of horse sera randomly selected in the
US. had antibodies to torovirus (Horzinek and Weiss, 1990).
Breda virus has been associated with infectious diarrhea in cattle all over the
world. Testing by ELISA showed that 88.5% of calf sera sampled at random in the
US., and 91% of sera sampled in the German Federal Republic were positive for BRV
specific antibodies (mode, 1987, Horzinek and Weiss, 1990). In France, 76% of diarrheic calf feces examined by EM contained BRV-like particles (Larnouliatte et a/.,
1987). BRV has also been shown to be the etiological agent of diarrhea in neonatal calves and adult caffle in the United Kingdom (Brown et a/., 4990, Scott ef a\., 1996). as well as in calves in South Africa (Vorster and Gerdes, 9993). Finally, BRV was detected by ELISA 4 times more often in the feces of diarrheal calves than in healthy animals in The Netherlands (Koopmans et a/., 1991b). BRV-associated-diarrhea has been found to begin in calves at an average age of 12.7 days, while enteritis due to rota- or coronaviruses begins at average ages of 7.7 and 8.3 days, respectively.
Enteric infections with torovirus have been found to occur mainly during spring and winter months in calves fewer than 3 weeks of age. (Vanopdenbosch eta/.. 1992).
In addition to the toroviruses of horses, cattle, and man, torovirus-like particles have been detected by EM in the feces of piglets with diarrhea in Saskatchewan and
South Africa, (Durham et a/., 1989, Penrith and Gerdes, 1992), in cats with transmissible diarrhea (Muir et a/., 1990), and in Australian dogs with diarrhea
(Finlaison, 1995). Furthermore, the sera of a number of animal species were found to have neutralizing antibody activity for BEV. High antibody titers were detected in 86% of cattle, 69% of goats, 34% of sheep, 81% of pigs, 17% of laboratory rabbits, and 2 species of wild mice (CIethrionomys glareolus and Apodemus sylvaticus) (Weiss et a/.,
1984).
Recent evidence suggests that toroviruses may also have an etiological role in respiratory disease of young calves. In 1982, Woode et a/. first reported watery ocular discharge and hyperpnea in young calves af€er experimental infection with BRV.
Koopmans et a/. (1989) demonstrated seroconversions to BRV in 4 of 10 neonatal calves after respiratory infection. In the winter of 1990-1991, 6 neonatal calves on a
Belgian breeding farm died after severe respiratory troubles. Examination of the larynx, trachea, and lungs of these calves by IFA using 3 different anti-torovirus sera revealed that BRV was present in these bovine fatal respiratory cases
O/anopdenbosch et a/., 1991). Lastly, torovirus antigens were detected by indirect IFA in 3.2% of post-mortem bovine respiratory tract samples sent to the National Institute for Veterinary Research in Brussels. Respiratory toroviral infections were found to occur mainly in calves during the first month of life, and from 4 to 6 months of age.
These infections appear to have an even seasonal distribution throughout the year, with a slight peak in the autumn. In about 25% of all cases examined in this study, sudden death and central nervous system involvement were reported along with pneumonia and tracheitis (Vanopdenbosch et a/., 1992).
Diagnosis
The BEV strain PI38/72 was originally isolated in secondary equine kidney cells inoculated with material from a rectal swab of an infected horse. BEV rapidly adapted to growth in equine dermis cells and embryonic mule skin fibroblasts, where the virus caused a lytic cytopathic effect (Horzinek and Weiss, 1990). However, this strain is the only equine torovirus that has been isolated to date despite numerous culture attempts.
As BRV has not been adapted to growth in cell or organ cultures, a number of other methods have been adopted for the diagnosis of this virus. The following methods have also been used for the diagnosis of BEV and human WLPs.
Torovimses can be detected in fecal material by negative contrast EM, and diagnoses can be confirmed by examination of thin sections through ultracentrifuged viral pellets by EM (Weiss and Horzinek, 1987). As all strains of BRV possess cross-reacting antigens, these viruses can be detected by IFA in intestinal sections, as well as by
IEM, HI, and ELISA (Weiss and Horzinek, 1987, Woode, 1987, Brown et a/., 1987,
Beards et a/., 1986, Koopmans et a/., 1993). Recently, nucleic acid hybridization
(Koopmans et a/., 1991a) and RT-PCR (Koopmans and Horzinek, 1994) have been examined as molecular techniques for the diagnosis of toroviruses.
Prevention and control
Since the importance of toroviruses as agents causing enteric infections and disease in humans and animals has only begun to emerge, infection control measures have not yet been developed or implemented (Horzinek and Weiss, 1990). However, good hand washing techniques, especially in a hospital setting, would help to lower the incidence of nosocornial infections. As is the case for coronaviruses, dehydration and electrolyte imbalance pose the greatest risks, and are generally treated by the maintenance of good hydration in adults, and rehydration therapy in children
(Christensen, l983, Kapikian, 1993). EVOLUTIONARY RELATIONSHIPS
Despite their morphological differences, there are a number of striking features common to the Comnaviridae and Arterividae that resulted in their placement in the order Nidovirales (table 4). First, the structural proteins of BW and BRV are comparable to those of the coronaviruses, IBV and MW. In this regard, structurally similar transmembrane proteins (M proteins) have been found in torovirus and coronavirus particles. These membrane proteins all lack an N-terminal signal sequence, and instead contain 3 successive transmembrane a-helices in their N- terminal half. In addition to these structural similarities, the IBV, MHV, and BEV membrane proteins fall within a similar size class (22-25K), and contain a small region of sequence similarity. The envelopes of both corona- and torovirus particles possess
N-glycosylated drumstick-shaped surface glycoproteins of similar size, which are derived by similar post-translational cleavages of a precursor. These glycoproteins both form oligomers and contain hydrophobic domains and heptad repeat sequences at corresponding positions on their sequence. Thus, the coiled-coil structural model, which has been put forward to explain the elongated shape of the coronavirus spike, may also very likely apply to the torovirus surface projections (Snijder et a/., 1994).
Second, the genome organization and expression of toroviruses, coronaviruses, and arteriviruses are strikingly similar. These viruses possess a linear, non- segmented, polyadenylated, positive-sense, single-stranded RNA genome (figs. 4, 7,
11). The organization of their genomes is comparable in that the polymerase ORF is situated in the 5' terminal half of the genome and the ORFs for the structural genes are located in the 3' terminal half. ORFs for non-structural genes, variable in number, are situated at various locations downstream of the polymerase gene. The genomic
RNAs of these viruses function as the mRNA for the translation of the polymerase
61 Table 4. Comparison of features of coronaviruses, toroviruses, and arteriviruses. Reprinted with permission from Cavanagh et a/., 1994.
Feature Coronav irus Torovirus Ancrivirus
Envdoped + +. + Nucleocapsid helical tubular isometxic Positive ssRNA with ply (A) tail + + + Genome size (kb) 27-30 - 25 13-15 3' co-terminal nested set of mRNAs + + -I- Leader on mRNAs + unlikely + Genome organization- similar similar similar Ribosomal frame-shihig in pol gene + -k + Some (iimircd) amino acid identity in pol +u- +ff + Prominent spikes + + no Fresence of coiled-coil structure in spikes + + no Size of virion proteins pa) Large surface glycoprotein (S or G) 180-220 200
Hacmagglutinincsterase giycoprotein (HE) 60-65' -b Membrane protein (I@ 25-35 26 Small rnt~nbrancprotein (sM) 10-12d -= Nucleocapsid pmtein 43-50 ,I8 M protein with triple membrane spanning sequences 4- + Inaacellular budding + +
'Present in only a subset of coronaviruses (see Table I) HE pseudogene known for BEV No such protein described SM'currently identified only for IBV and TGEV protein. During replication, a 3' co-terminal nested set of 4 or more subgenomic
mRNAs is transcribed, and only the ORF at the 5' terminus of each mRNA is translated (Snijder et al., IggOa, Snijder and Horzinek, 1993).
Third, evidence of common ancestry has been obtained by comparison of the
nucleotide sequences, translation products, and expression mechanisms of the polymerase genes of BEV, MHV, and EAV (fig. 14). Similarities in viral genome organization and expression, as well as amino acid sequence homologies in polymerase proteins, are considered indicative of ancestral relationships between groups of viruses (Goldbach and Wellink, 1988, Strauss and Strauss, 1988, 1991).
The polymerase genes of toroviruses and coronaviruses comprise 2 ORFs (la and
Ib); ORFl b is translated by ribosomal frame-shifting. Sequence elements and RNA structures, such as heptanucleotide 'slippery" sequences (frameshifl site UUUAAAC) and RNA pseudoknots, which promote ribosomal frameshifting have been identified in the POL1b genes of both toro- and coronaviruses. In addition, ORFlb contains 4 domains for putative RNA-dependent RNA polymerase and NTP-dependent helicase activities that are highly conserved at the amino acid level (4550%) among the members of the Nidovimles. Based on the above evidence, it has been-suggested that toro- and coronaviruses are evolutionarily more closely related to each other than to any other family of positive-stranded RNA viruses (Snijder etal., 1990b).
Lastly, an important aspect in the evolution of toroviruses and coronaviruses is recombination. One of the best examples of non-homologous recombination is the fact that some coronaviruses and toroviruses possess a HE gene that has 30.35% amino acid identity with the amino-terminal subunit of the HE-fusion glycoprotein of
ICV (Luytjes et al., 1988, Lai, 1992). Furthermore, a second non-homologous event is believed to account for the finding that the amino acid sequence of the predicted
63 Figure 14. Position of conserved domains in the ORFI b products of the POL genes of the coronaviruses MHV-A59 and IBV-M42, the torovirus BEV, and the arterivirus EAV.
Domains represent I)putative polymerase, 2) cysteine/histidine-rich motif, 3) putative
NTP-binding helicase, and 4) C-terminal "coronavirus-liken domain. Dotted lines indicate that the potential ORF has not yet been completely sequenced at time of writing. Reprinted from Den Boon eta/., 1991b. MHV 1 ORF Ia I 123 t IBV
BEV I ORF 1a I------ORF I b
EAV product of the C-terminal part of the BEV POLla gene is 31936% identical to the
30kDa protein encoded by the first ORF of gene 2 of MHV (Snijder et al., 1991). These
2 examples suggest that adoption and incorporation of foreign genes may be pathogenetically important for certain RNA viruses. Moreover, such recombination may offer an evolutionary advantage, whereby viruses possessing this property may adapt to altering environments and expand into new host species, perhaps causing new diseases (Goldbach and Wellink, 1988, Lai, 1992, Horzinek, 1993).
SUMMARY
This overview has highlighted the etiological agents of viral diarrhea and gastroenteritis, with a focus on the coronaviruses, and toroviruses. Coronaviruses, toroviruses, and arteriviruses share a number of common morphological and genetic features, and as such they have been assigned to the new order Nidovimles.
Members of the Arterivindae share some common biotogical properties, but have quite distinct morphological and genomic properties. The coronaviruses cause both respiratory and enteric illnesses in humans and animals. Much is known about their morphology, genome, pathology and distribution. The toroviruses are newly recognized etiological agents of disease amongst horses and cattle, and these viruses have also been detected in the fecal specimens of children with diarrhea. The torovirus prototype, Berne virus, has been shown to be morphologically and genetically similar to the coronaviruses and as such the toroviruses have been assigned to the family
Coronavinbae. Furthermore, the common features between these viruses suggest that the coronaviruses and toroviruses may be evolutionarily related. Further study of toroviruses, especially the characteristics of human agents, and the molecular aspects of Breda virus, will reinforce the position of toroviruses as important etiological agents of disease among animals and humans. Chapter 2
Objectives Berne virus (BEV), the only torovirus that can be grown in cell culture, is the best
studied representative of the genus toroviius. By the early 1990s, this agent had been
well characterized at the morphological, biochemical, and molecular levels. However,
little was known about Breda virus (BRV) or the torovirus-like particles (TVLPs) found in
human feces. Morphological and serological evidence showed that BRV was related to
BEV, but experimental data regarding the organization of the BRV genome was limited.
At the time, TVLPs were perceived as curious particles resembling toroviruses, and were in fact dismissed by many authorities as artifacts. These particles were thus not fully accepted as etiological agents of gastroenteritis in humans.
The overall objectives of my research were to investigate the characteristics of toroviruses affecting humans and cattle. This was done in an effort to provide evidence that the TWPs found in the fecal specimens of children with diarrhea were indeed toroviruses, to compare the epidemiology of bovine and human toroviruses (HTV) in our setting, and to examine the molecular characteristics of the BRV and HTV genomes.
My initial undertaking involved the characterization of totoviruses from human fecal specimens by describing the morphological, antigenic, and molecular aspects of these agents (Chapter 3). Second, since bovine torovirus had only been reported once in Canada, a study was performed to determine the extent to which it was present in calves with diarrhea from farms in Southern Ontario (Chapter 4). The third objective was to use long RT-PCR and sequencing to characterize the 3' portion of the Breda virus serotype I(BRV-1) genome which codes for the structural proteins of the virus (Chapter
5). The fourth goal was to express the BRV-1 nucleocapsid protein in Escherichia coli, obtain antisera to this recombinant protein, and use these sera to develop a rapid diagnostic assay for bovine and human toroviruses (Chapter 5). My final goal was to determine whether the human torovirus possesses a hemagglutinin-esterase (HE)
69 gene, and to compare it to the HE gene of BRV-1. The BRV-1 and HW HE genes were then expressed in a baculovirus system, and the antigenic properties of these proteins were examined (Chapter 6). Chapter 3
Characterization of Torovirus from Human Fecal Specimens
Duckmanton, L., Luan, B., Devenish, J., Tellier, R., and Petric, M. (I997) Wralogy 239: 158-168 Permission of use granted by Academic Press.
Jamieson, F.B., Wang, E.E.L., Bain, C., Good, J., Duckmanton, L., and Petric, M. (I998) J. Infect. Dis. l78(lI): 1263-1269 Permission of use granted by The University of Chicago Press. SUMMARY
The toroviruses, Berne virus (BEV) and Breda virus (BRV), are recognized pathogens of horses and cattle, respectively. Torovirus-like particles (lVLPs) that are immunologically related to BRV have been reported as etiological agents of gastroenteritis in humans. Of the toroviruses, only BEV has been shown to replicate in cell culture. Hence, these agents can only be routinely detected by electron microscopy
(EM), although serological testing has been used as well. Our studies have provided supporting evidence that the TVLPs detected in the stool specimens of pediatric patients with gastroenteritis are human toroviruses. By EM, these particles are morphologically similar to BEV and BRV. Thin-section electron microscopy revealed that WLPs contain toroidal-shaped nucleocapsids. Viruses purified from human fecal specimens agglutinate rabbit erythrocytes. BRV antiserum, as well as convalescent sera from patients with gastroenteritis whose stools contain lVLPs, were shown to contain antibodies that react with purified TVLPs as demonstrated by hemagglutination inhibition, immunoelectron microscopy, and immunoblotting. RNA extracted from partially purified TVLP preparations can be amplified by RT-PCR using primers bracketing a 219-base region at the 3' end of the Berne virus genome. Sequence analysis of amplimns from 5 isolates showed a high degree of identity with the corresponding BNsequence1.
Human tomvirus nucleotide sequence GenBank accession number AF024.539 72 INTRODUCTION
The torovirus prototype, Beme virus, was isolated in 1972 from the rectal swab of a diarrheic horse in Berne, Switzerland (Weiss at a/., 1983). A decade later, a morphologically similar virus, called Breda virus, was found in Breda, lowa in the stools of neonatal calves with diarrhea (Woode et a/., 1982). Other BRV isolates were later found in feces from a colostrum-deprived calf in lowa, and in the stools of diarrheic calves in Ohio (Woode et al., 1985b, Weiss and Horzinek, 1987). It was found that the 2 enteric pathogens, BEV and BRV, are morphologically and antigenically related (Weiss et al., 1983). and as such they were initially proposed to comprise a separate family
(Weiss and Horzinek, 1987, Horzinek et a/., 1987). However, recent analysis of the genome and replication strategy of BEV indicates that toroviruses are more closely related to the coronaviruses (Snijder et al., 1991, Snijder et a/., 1990b). Thus, BEV and
BRV are now classified as members of the genus torovirus in the family Comnavindae
(Cavanagh et a/., 1994, Cavanagh, 1997).
Morphologically, toroviruses are composed of an elongated tubular nucleocapsid of helical symmetry, surrounded by an envelope bearing peplomers. These particles measure 120 to 140 nrn at their largest diameter (Horzinek ef a/., 1987, Weiss and
Horzinek, 1987). In the mature virion, the helical nucleocapsid is torus-shaped, hence the name torovirus. However, the nucleocapsid may also exist in the form of a rod or crescent in a subset of particles (Weiss et a/., 1983).
Purified BRV particles were found to hemagglutinate mouse and rat erythrocytes, whereas BEV particles hemagglutinate human 0, rabbit, and guinea pig erythrocytes
(Horzinek et a/., 1987). These viruses also have cross-reacting antigens as demonstrated by immunoelectron microscopy (EM) (Beards et a/., 1986) and enzyme- linked imrnunosorbent assay (ELISA) (Weiss et a/., 1983, Brown et a/. , 1987, Koopmans 73 et a\., 1989). Viral structural proteins include the phosphorylated nucleocapsid protein,
N (molecular mass ZOK), the envelope protein, M (molecular mass 25K) and the glycoprotein peplomer, S, which exhibits a molecular weight ranging from 75-100K since it has variable degrees of N-glycosylation (Horzinek et a/., 1986, Weiss and
Horzinek, 1987).
The organization of the BEV genome and its replication strategy have been described by Snijder et a/. (1990a). The BEV genome has been shown to be a singte- stranded positive sense RNA of approximately 26-28kb in length whose organization is similar to that of equine arterivirus (EAV), avian infectious bronchitis virus, and mouse hepatitis virus, with which there is evidence of common ancestry (Horzinek et a/., 1987,
Snijder and Horzinek, 1993, Snijder et al., 1994). In addition, the sequence of the 269nt upstream of the poly (A) tail of the BRV genome has been determined, and shown to be
93% identical to that of BEV (Koopmans et al., 1991a).
Evidence that toroviruses could also be potential human pathogens initially came from Beards et a/. (1984) who reported the appearance by EM of particles similar to
BEV and BRV in the fecal specimens of children with diarrhea. These agents, termed human torovirus-like particles, have since been proposed to be related to BEV and BRV on the basis of rnorphologicai and serological similarities. (Beards et a/., 1986). Further support for the existence of a human torovirus was obtained when human stool specimens, which were found to contain WLPs by EM were shown to be reactive in a torovirus-specific ELISA based on BRV antiserum (Koopmans et a/., 1993).
The above studies have provided good evidence that the NLPs found in the stools of pediatric patients with gastroenteritis are human toroviruses. However, there remains a need to further characterize the biochemical, antigenic, and molecular properties of human TVLPs. In this study, we report on the purification and 74 characterization of human torovirus from the fecal specimens of patients with gastroenteritis.
MATERIALS AND METHODS
Electron microscopy
Diarrheic stool samples (1 -2ml) suspended in 1% ammonium acetate, or purified
WLP preparations, were stained with 2% phosphotungstic acid and examined by negative contrast electron microscopy on a Philips EM 300 at a magnification of 50
OOOx (Middleton et a/., 1977).
Purification of WLPs
Stool specimens obtained from pediatric patients with gastroenteritis whose stools were found to be positive for TVLPs by EM, were diluted with an equal volume of
1% ammonium acetate (wlv) and clarified by centrifugation at 9000 x g for 20 minutes at
4OC. Approximately 8 ml of the supernatants were layered on a 4 ml cushion of 25%
Histopaque-1077 (Sigma Chemicals, St. Louis, MO) in 1% ammonium acetate in 12ml
Beckman polyallomer ultracentrifuge tubes. The specimens were then centrifuged in a
Beckman SW41Ti rotor at 100 000 x g for 90 minutes at 4'~. The pellets were resuspended in 1% ammonium acetate and stored at 4'~.All control stool specimens used in this study were processed in a similar manner.
Thin-section electron microscopy
Purified TMP preparations were subjected to ultracentrifugation at 100000 x g for 2 hours at ~OC, the pellets were fixed in 2% gluteraldehyde for 24 hours, and submitted to the Department of lmmunopathology at the Hospital for Sick Children for thin sectioning. Briefly, pellets were post-fixed with osmium tetroxide ovemight, dehydrated in acetone, infiltrated and embedded in Epon araldite resin, and heat- polymerized ovemight. Ultrathin sections (80 nm) were then cut on a Reichert Ultracut E ultramicrotome (Leica Canada Inc.), collected on copper grids, and stained w*th uranyl acetate and Reynolds lead citrate. The sections were then examined by EM at a magnification of 70 000 x (Quan and Doane, 1983).
lmmunoelectron microscopy
lmmunoelectron microscopy was performed using either convalescent serum from BRV-infected calves (baBRV; provided by G. Woode, Texas A&M), or paired acute and convalescent sera (alc) from patients with gastroenteritis whose stools were positive for TVLPs by EM (alc paired sera). The sera were heat inactivated at 56'~for
30 minutes, diluted 1:50 with 1% ammonium acetate, mixed with an equal volume of purified TVLP preparations or control preparations, and incubated for 2 hours at 37'~.
The preparations were centrifuged at 9 000 x g for 15 minutes at room temperature.
The pellets were resuspended in 1% ammonium acetate and examined by EM at a magnification of 50 000 x (Kapikian et a/., 1972, Woode et a/., 1985b). Control specimens included a purified rotavirus-positive fecal sample, and a purified sample from a patient with diarrhea in which no viruses could be detected by EM.
Hemagglutination assay
Serial 2-fold dilutions of purified TVLP preparations were made in 50 pl volumes of veronal buffered saline (VBS) (Oxoid, England) in V-shaped bottom microtitre plates. For the hemagglutination assay (HA), 50 pl of a 0.5% sirspension of either human 0,
rabbit, guinea pig, horse, or sheep erythrocytes in VBS was added to each well. The
plates were incubated for 2 hours at room temperature and examined for
hemagglutination voode et al., 1985b). The reciprocal of the final dilution of the TVLP
preparation showing complete hemagglutination was defined as the titre in HA units. A
purified fecal specimen documented to be positive for rotavirus by EM, and 2 stool
sample preparations from patients with diarrhea, in which no viruses could be detected
by EM, were tested in parallel as controls.
Preparation of guinea pig antisera to TVLPs
Two young adult male guinea pigs were inoculated subcutaneously once a week
for 5 successive weeks with a 2:l suspension of purified TVLPs in Freund's incomplete
adjuvant. Pre- and post-immunization sera were collected.
Hemagglutination inhibition
The panel of sera tested for hemagglutination inhibition (HI) included guinea pig
pre-immune (gpPI) and hyper-immune (gpHI) sera, baBRV serum, and human a/c
paired sera. Prior to use in the HI assay, the serum aliquots were absorbed with an
equal volume of packed rabbit erythrocytes for 1 h at 4'~to remove non-specific
hemagglutinating activity. 2-fold serial dilutions of each serum were made in 25 pl volumes of VBS in V-bottomed microtitre plates. Four HA units of partially purified WLP
preparations in 25 pl of VBS were then added to each well and the plates were
incubated for 1 hour at room temperature. A 50 p1 volume of a 0.5% suspension of
rabbit erythrocytes in VBS was added to each well containing TVLP preparations. The plates were incubated for 2 hours at room temperature and examined for 77 hemagglutination (Waode et a/., l985b). Control hernagglutination inhibition testing was performed using 4 HA units of a purified rotavirus preparation. Serum aliquots were absorbed with human 0 erythrocytes. These HI assays were performed as above, except that a 0.5% suspension of human group 0 erythrocytes in VBS was added to all wells containing rotavirus preparations. A four-fold or more increase in titre between the acute and convalescent sera was considered to be a positive HI result.
SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting
Purified TVLP preparations were subjected to SDS-PAGE on a 15% resolving gel and a 4% stacking gel as per standard methodology (Sambrook et a/., 1989). The gels were either stained with Coomassie brilliant blue R250 or used to perform an immunoblot procedure (Sambrook et al., 1989). For the immunoblot, the proteins present in the SDS-PAGE gel were transferred electrophoretically to a polyvinyfidene fluoride (PVDF) nylon membrane (Millipore, Bedford, MA) for 90 minutes at 100V. The membranes were washed and blocked overnight in a solution of 5% skim milk and 5% goat serum in Tris-buffered saline containing 0.5% Tween 20 (TBST) (for blots with alc paired sera), or 1% pig gelatin in TBST (for blots with baBRV serum). The membranes were then incubated for 4 hours at room temperature in a 1:2000 dilution of either human a/c paired sera in 1% skim milk in TBST, or baBRV serum in 1% pig gelatin in
TBST. The membranes were washed and incubated for 2 hours at room temperature in a I:I 000 dilution of biotinytated murine anti-human lgG (Sigma Chemicals) in 1% skim milk in TBST (for blots with alc paired sera), or biotinylated goat anti-bovine IgG (Sigma
Chemicals) in 1% pig gelatin in TBST (far blots with baBRV serum). Following further washing, the membranes were incubated for 45 minutes at room temperature in ImmunoPure ABC peroxidase staining reagents (Pierce, Rockford, It), treated for 1 minute with ECL horseradish peroxidase detection reagent (Amersham Life Science,
Oakville, ON) and exposed to Kodak X-Omat AR imaging film for 15-30 seconds.
RNA extraction
Fecal specimens (1-2 ml) were diluted in an equal volume of phosphate-buffered saline (w/v) and clarified by centrifugation at 9000 x g for 15 minutes at 4'~.The supernatant was transferred to a new tube and centrifuged at 12000 x g for 95 minutes at 4*~.In a separate room, using dedicated micropipetters and aerosol-resistant tips, viral RNA was extracted from the clarified supernatant using TRlzol Reagent (Gibco
BRL, Gaithersburg, MD) according to the manufacturer's protocol. Each RNA pellet was resuspended in 10 pl of DNase free, RNase free double distilled water (5 prime 3 prime
Inc., Boulder, CO) and stored at -80'~.
RT-PCR
A total of 18 stool samples positive for TVLPs by EM were tested for the presence of torovirus RNA by RT-PCR. For each TVLP-positive sample assayed, we included a negative control (ddHnO), and a second control consisting of RNA extracted from either a stool sample without any detectable gastroenteritis viruses by EM (8 assays), or RNA extracted from samples containing rotavirus (6 assays) or enteric coronavirus (4 assays). Oligonucleotide primers (General Synthesis and Diagnostics,
Toronto, ON) were designed from the 3' end of the BNgenome (DDBJ accession number D00563). The sense primer (STAATGGCACTGAAGACTC3') and the antisense primer (S'ACATAACATCTTACATGG3') bracketed a genome fragment of 219 nucleotides, which included the 3' end of the N protein coding region and most of the 3' non-coding region upstream of the polyA tail.
The RT and PCR reaction mixtures were set up in an isolated room, using dedicated micropipetters and aerosol-resistant tips. Reactions were then performed in a third room designated for PCR amplification. For the RT reaction, an RNA aliquot was thawed on ice, and incubated for 5 min at 6S°C. The RNA was added to 10 pl of the RT mixture containing 5 mM MgC12, 10 mM Tris-HCI (pH 8.3), 50 mM KCI, 1.25 mM (each) dATP, dCTP, dGTP, and dTTP (Promega, Madison, WI), 2.6 pM random hexamer primers, 20 U RNase Guard (Gibco, BRL), and 50 U of Moloney murine leukemia virus reverse transcriptase (Gibco BRL). The reaction mixture was overlaid with sterile mineral oil and incubated at room temperature for 10 minutes. The RT reaction was performed in a Perkin-Elmer (Mississauga, ON) thermal cycler at 42'~for 30 minutes,
99'~for 5 minutes, and then held at S'C for 5 minutes.
For the PCR reaction, 10 pI of the RT reaction product was added to the PCR mixture containing ImM MgCI2, 8 mM Tris-HCI (pH 8.3), 40 mM KCI, 2.5 U Arnplitaq
DNA polymerase (Perkin-Elmer Cetus and Applied Biosysterns Inc.), and 50 pmol of each primer. The total volume of the PCR reaction was 50 PI. The reaction mixture was overlaid with sterile mineral oil and amplified in a PerkinnElmer thermal cycler. After denaturation at 94% for 2 minutes, the reaction was subjected to 35 cycles consisting of denaturation at 95'~for 40 seconds, annealing at 50'~for 1 minute, and extension at 72'~for 90 seconds. Reactions were then incubated at 72'~for 10 minutes, and held at 4'~.Reactions were analyzed by electrophoresis in a 1.2% agarose gel, which was subsequently stained with ethidium bromide, and viewed under a UV transilluminator. Cloning and DNA sequencing
PCR products were purified using the Wizard PCR Preps DNA Purification
System (Promega). Arnplicons were then cloned into a pCR-Script Amp SK+ cloning vector, and transformed into Epicurian coli XLI-blue MRF' Kan supercompetent cells using the pCR-Script Amp SK+ cloning kit (Stratagene, LaJolla, CA) as per the manufacturer's recommendations. Clones were screened by PCR using the same primers as above. Ptasrnids containing the PCR insert were purified from LB broth cultures using the Wizard Miniprep DNA purification system (Promega), and sequenced using the protocol for direct label incorporation in the fmol DNA Sequencing System
(Promega) according to the manufacturer's recommendations. Sequence data were analyzed using the computer program GCG version 8 (Genetics Computer Group Inc.,
Madison, WI). As an additional precaution against plasmid contamination of PCR reactions, all cloning and sequencing assays were undertaken only after the RT-PCR experiments on stool samples had been completed.
RESULTS
Electron microscopy and thin-section electron microscopy
Human NLPs detected by negative contrast electron microscopy were morphologically similar to BEV and BRV in that they exhibited crescent, torus and rod shaped conformations (figs. 15a and 15b). The particles measured between 100 and
120 nrn at their largest diameter. The envelope and peplomers on these particles remained intact throughout the purification process, and these features were readily discernible. The peplomers measured approximately 10 nm in length. TVLPs can be readily distinguished from enteric coronaviruses which are somewhat larger in size, and whose peplomer spikes are longer and more prominent (fig. 15c). 81 Figure 15. (a and b) Electron micrographs of a purified fecal specimen showing torus
(arrow), crescent (arrow head), and rod (double arrow head) shaped human TVLPs. (c)
Electron micrograph of an enteric coronavirus. Bars= 100 nm.
When examined by EM, ultrathin sections of purified virus preparations demonstrated a number of elliptical particles enclosing hollow torus-shaped cores (figs.
16a, 16d, and 16e), structures corresponding to cross sections of these particles showing either 1 or 2 electron dense areas bound by the envelope (figs.16b-16d, and
169, as well as sections showing full rod or crescent shapes (figs 16a, and 16e). The particles representing the whole virion measured 100 to 120 nm in diameter and the nucleocapsid cross-sections measured approximately 25 nm in diameter.
lmmunoelectron microscopy
A total of 12 human a/c paired sera and 1 baBRV convalescent serum were tested far their reactivity with 2 purified TVLP preparations, a preparation containing rotavirus, and a virus-negative preparation. lmmunospecific reactivity was defined by the formation of viral aggregates by the convalescent but not the acute serum (fig. 17).
No acute serum was available for comparison with the baBRV serum. In all cases it was found that the convalescent sera were imrnuno-reactive with the TVLPs while the acute sera showed no reactivity (table 5). The baBRV serum formed numerous aggregates with both TVLP-positive specimens. In all cases, the human acute and convalescent sera were not reactive with the control specimens.
Hemagglutination and hemagglutination inhibition
When purified NLP preparations were examined for their ability to agglutinate the erythrocytes of 5 different species, rabbit erythrocytes were agglutinated to the highest dilution (1:1280) of virus. Hemagglutination was also observed to a lesser extent with human 0 erythrocytes (1:40). Minimal activity was observed with the guinea pig, Figure 16. Electron micrographs of human torovirus particles in ultrathin sections of a purified TVLP preparation. (a) elliptical and crescent-shaped particles, (b) cross-section of torus showing 1 electron dense area, (c) elliptical particle showing 1 electron dense area, (d) elliptical particle and cross-section of torus showing 2 electron dense areas,
(e) elliptical particle and rod-shaped particle, (9 cross-section of crescent-shaped particle. Arrows indicate designated particles and structures. Bars=100 nm.
Figure 17. lmmunoelectron microscopy of a purified TVLP preparation with (a) human acute serum, and (b) human convalescent serum. Bars=100 nm.
horse and sheep erythrocytes. To determine the consistency of this reaction, 12 partially
purified TVLP preparations from patients with gastroenteritis were tested for HA activity
with rabbit erythrocytes. Nine of these had HA titres of 1:640 or greater, and the
remainder had titres of 1:40, 1:I 60 and 1:320. The rotavirus-positive control specimen
was found to agglutinate human group 0 erythrocytes (t320) as previously
demonstrated by Spence et a/., 1978. Hemagglutination could not be demonstrated with
the virus-negative control samples (data not shown).
A number of sera were tested for their ability to inhibit the hemagglutination of
rabbit erythrocytes by purified TVLP preparations, or of human group 0 erythrocytes by
a rotavirus preparation. Hemagglutination inhibition of rabbit erythrocytes by purified
TVLPs was shown with both of the gpHl sera, and to a lesser extent with the buBRV
serum. The gpPl serum showed negligible activity. The human convalescent sera
manifested 4-fold or greater antibody rises in all but 2 cases compared to the acute sera
(table 5). None of the paired sera showed more than 2-fold rises in antibody titre when
tested with rotavirus control antigen.
Quantitation of torovirus antibody by hemagglutination inhibition
A case/control study to which I contributed was carried out at the Hospital for
Sick Children to determine if shedding of torovirus was associated with gastroenteritis
(Jamieson et a/.,1998). Stool specimens from patients with gastroenteritis and matched
asymptomatic controls were examined by EM for the presence of torovirus (performed
by Ms. Maria Szymanski). Toroviruses were identified in 72 of 206 (35.0%) of gastroenteritis cases compared to 30 of 206 (14.5%) asymptomatic controls (table 6).
This was evidence that torovirus excretion may be associated with gastroenteritis.
Analysis of the monthly hgquency distribution of viruses identified by EM in 1993 90 showed that, while rotavirus infections were most frequent during the winter and spring,
the incidence of torovirus infections remained relatively constant throughout the year
(fig. 18).
My contribution to this study was to determine the extent of seroconversion
among patients who developed torovirus infections. Acute and convalescent sera from a subset of 88 patients were tested for antibody to torovirus by a HI assay. Of the 88 patients, II irnmunocompromised and 40 non-immunocompromised patients experienced seroconversion defined by a 4-fold or greater increase of antibody titre
(table 7). Seroconversion was significantly more likely to occur in older patients over 4 years of age than in those aged from 0 to 4 years (p < 0.01) (table 7). After controlling for age, it was also found that non-immunocompromised patients were significantly more likely to seroconvert than immunocompromised patients (p SDS-PAGE and immunoblotting When the TVLP preparations were analyzed by SDS-PAGE, bands with molecular masses of 32, 75,88, 100, 115, 134, and 141kDa were detected as shown in figure 19. The bands between 75 and 100K are of interest as they are expected to correspond to the S protein equivalents of BRV and BEV. To establish whether these bands are specific for toroviruses, the gels were further analyzed by immunoblot using 2 of the a/c paired patient sera whose titres to TVLPs were previously determined by HI Table 6. Detection of torovirus by EM in the fecal specimens of patients with and without the symptoms of gastroenteritis. Patients with Asymptomatic diarrhea patients Torovirus positive Torovirus negative Total Chi Square: p < 0.001 Figure 18. Monthly incidence of rotavirus and torovirus diagnoses at the Hospital for Sick Children in 1993, based on EM results. To rovirus Rotavirus Jan Feb Mar Apr May Jun Jul Aug Sep Od Nov Dec Table 7. Results of HI analysis showing seroconversion to human torovirus in patients whose stools were diagnosed positive for TVLPs by electron microscopy. Immunocompromised patients Non-immunocompromised patients Figure 19. (A) Coornassie blue-stained SDS-polyacrylarnide gel and (B) corresponding immunoblot of a purified TVLP preparation using human acute (huA) and convalescent (huC) serum, and murine anti-human antiserum (math). mah huA huC and IEM. The human convalescent serum but not the acute serum reacted consistently with bands between 78 and 90K. The 32K band was reactive with both the acute and convalescent sera, as well as with the secondary antibody control, and was therefore considered to be non-specific. This 32K band was also present in irnmunoblots using baBRV serum, and only limited reactivity of the 78K band with this convalescent serum could be demonstrated (data not shown). RT-PCR Using primers designed from the 3' end of the BEV genome, an amplicon of 219 bases was detected in all of the 18 TVLP-positive samples tested (sensitivity, 100%). Of the 8 control specimens that were negative for any virus by EM, only 1 was positive by RT-PCR. Of the remaining 10 control specimens that contained either rotavirus or enteric coronavirus, 1 sample containing coronavirus particles gave a positive result by RT-PCR (specificity, 89%). Shown in figure 20 are representative amplification products after agarose gel electrophoresis. Cloning and sequencing of torovirus-positive RT-PCR products To assess the nature of the 219 nucleotide product obtained in TMP-positive specimens by RT-PCR, amplicons obtained from 5 different samples (fig. 20) were cloned, and sequenced. These 5 products were amplified from fecal specimens taken in 4 different years (1993-1996) in order to test for the possibility of genetic variation among the specimens. Clones were screened by PCR using the same primers, and 11 of them (at least 2 clones per sample) were found to contain the 219-base fragment. These 1I clones were sequenced, and a comparison was made with the 3' region of the BEV genome, which includes the 3' end of the N protein gene (fig. 21). 98 Figure 20. Gel electrophoresis of RT-PCR products amplified using RNA extracted from 5 NLP-positive fed specimens, and primers specific for the 3' non-coding region of the BEV genome. The fecal specimens were collected over a 4 year period: lane I, 1993; lane 2, 1994; lane 3, 1995; lanes 4 and 5, 1996. Lanes marked - and R represent a negative control (ddH20), and a rotavirus sample respectively. DNA mass ladder was used as the molecular size marker. Figure 21. Alignment of the nucleotide sequence from the 3' end of the BEV genome (consensus) with that of 5 human TVLP-positive samples collected over a 4 year period (a, 1993; b, 1994: c, 1995; d and e, 1996). Nucleotides identical to the consensus sequence are shown as dots. The nucleotide sequences of each of the 5 MPisolates were found to be 99% identical to BEV in this area. For each isolate, there were no discrepancies between the sequences of its clones. However, each isolate had at least 1, but no more than 2 nucleotide substitutions compared to BEV. All of these substitutions were situated at the 3' end of the N gene between nucleotides 49-61, and none of these substitutions would result in changes in the predicted amino acid sequence of the N protein. DISCUSSION Particles with morphological features similar to those of BEV and BRV have been reported in the fecal specimens of children with diarrhea (Beards et a/., 1984). However, the status of these torovirus-like particles as human pathogens remained unclear because they lacked the definitive icosahedral morphology of other gastroenteritis viruses, they could not be propagated in conventional cell culture, and they could not be identified by readily available immuno-specific reagents. Nevertheless, the observation that the WLPs detected by EM in human stool specimens were reactive in an ELlSA based on BRV antiserum provided immunospecific evidence that these agents were toroviruses (Koopmans et a/.,1993). The investigation of NLPs from patient specimens was initially compromised by difficulties in obtaining adequate preparations of intact virions. While ultracentrifugation through sucrose gradients allowed for the purification of immunoreactive particles (Koopmans et a/., 1993), such preparations could not be consistently obtained. This procedure also appeared to alter the morphology of some NLPs and disrupt the peplomer fringes, thereby making any biochemical analyses of these particles difficult to interpret. Thus, an alternative method was designed to purify TMPs by sedimentation through a cushion of Ficoll (Histopaque 1077) in 1% ammonium acetate. This procedure 103 resulted in highly enriched preparations of intact TVLPs whose peplomer fringes were well preserved. Although these WLPs should be deemed to be only partially purified, their preserved morphology suggests that they are likely to contain immunoreactive structural proteins. The morphology of the WLPs purified from human fecal specimens provides evidence that these agents are toroviruses. Human TVLPs closely resemble BWand BRV when examined by negative contrast electron microscopy. These purified particles have the same pleomorphic nature as those detected directly in stool specimens. It is not clear whether these forms are part of the virus population or simply due to drying and staining during EM examination. Furthermore, the ultrastructure of the virus, as visualized by thin section EM, was consistent with that found in BEV infected cells and BRV infected gut epithelium (Weiss et al., 1983, Weiss and Horzinek, 1987). These structures included particles with enveloped, crescent-shaped cores, as well as cross- sections through these cores showing the tubular nucleocapsid surrounded by the envelope. Human WLPs are morphologically pleomorphic and could not be propagated in cell culture. Therefore, three independent immunospecific approaches (IEM, HI, and immunoblotting) were used to charact&ire these particles. Beards et a/. (1986) observed a serological relationship between BEV, BRV, and WLPs on the basis of IEM studies. Using IEM, we demonstrated seroconversion to human NLPs following infection. Our finding that purified TVLP preparations manifested strong hemagglutination activity with rabbit erythrocytes led to the design of a hemagglutination inhibition assay. Seroconversions following torovirus infection were readily documented using acutelconvalescent paired patient sera. HI titres were found to be reproducible using NLP preparations that were either homologous or heterologous to the patient 104 sera. These results were consistent with those found by IEM for the same sera. Furthermore, it was demonstrated by HI in the caselcontrol study that a torovirus infection leads to seroconversion predominantly in older, non-imrnunocompromised patients with gastroenteritis. This study showed that torovirus may be an important cause of gastroenteritis in the pediatric population, often causing nosocornial diarrhea in immunocompromised patients in hospital, but also causing gastroenteritis in previously healthy patients (Jamieson et a/., 1998). The immunoblot assays showed that the human convalescent sera, but not the acute sera, were reactive to a 78-90 kDa protein that is present in partially purified virus preparations. Based on its molecular weight, this protein most likely represents the viral glycoprotein peplomer, S, which in the case of BEV and BRV migrates as a band between 75-100 K due to variable degrees of glycosylation (Snijder et al., 4990~).The demonstration of irnmunoreactivity to only the S protein in the immunoblot is consistent with reports on coronavirus infections in which the spike protein elicits the major immune response. (Battaglia et a/., 1987, Macnaughton et a/., 1981, Schmidt and Kenny, 1981). Specific immunoreactivity with the S protein is also in concordance with the detection of immune responses by IEM and HI since both of these assays are likely to involve the peplomer protein. The strong immunoreactivity of the 32 kDa protein cannot be explained at present, but it appears to be non-specific as it is present with the human acute serum and even slightly with the secondary antibody control. I propose that this protein may represent copro antibody that remained bound to the virus after purification, and thus independently binds the secondary antibody in our assay. Koopmans et aL, (1991a) showed that the 3' region of the BEV genome, spanning the C-terminus of the N gene and the 3' non-coding region, is 93% identical to the corresponding region of BRV. Using a RT-PCR assay targeting this region, we 105 found that the 18 samples that were NLP-positive by EM, were also positive by RT- PCR, whereas other enteric viruses were not detected by this assay. A positive PCR result with 2 samples in which we did not detect NLPs by EM was not unexpected given the presumed higher sensitivity of our RT-PCR assay compared to EM. Sequence analysis of a subset of these amplicons confirmed that WLPs are related to the torovirus prototype, BEV, since their sequences demonstrated 99% sequence identity in the 219 nucleotide region amplified. Exhaustive precautions were taken to avoid contamination throughout the RNA extraction and amplification procedures. The arnplicons can not be the result of contamination with BEV sequences because none of our negative controls gave rise to an amplicon, we never had BEV in our laboratory, and small but real sequence differences were noted among the 5 TVLP isolates, and with BEV. Chapter 4 Detection of Bovine Torovirus in Fecal Specimens of Calves with Diarrhea from Ontario Farms Duckmanton, L., Carrnan, S., Nagy, E., and Petric, M. (I998) J. Clin. Micro. 36: 1266-1270. Permission of use granted by The American Society for Microbiology. 1 07 SUMMARY Breda virus (BRV), a member of the genus tomvims, is an established etiological agent of disease in cattle. BRV has been detected in the stools of neonatal calves with diarrhea in both Iowa and Ohio, and in several areas of Europe. However, this virus has only been reported once in Canada. Therefore, a study was performed to determine the extent to which bovine torovirus is present in calves with diarrhea from farms in Southern Ontario. A total of 118 fecal samples from symptomatic calves and 43 control specimens from asymptomatic calves were examined by EM and RT-PCR for the presence of torovirus. Torovirus RNA was detected in 43 of the It8 diarrheic samples (36.4%) by RT-PCR with primers designed in the consewed 3' end of the torovirus genome. By EM, torovirus particles were observed in 37 of the 118 specimens (31.4%). All but 1 of these samples were also positive by RT-PCR. The incidence of torovirus in the asymptomatic control specimens by RT-PCR was only 14.6%. To establish the identity of the particles observed in the diarrheic specimens, 5 of the amplicons from samples positive by both RT-PCR and EM were cloned, and sequenced. Nucleotide sequence analysis revealed that the bovine torovirus found in Southern Ontario manifests between 96% and 97% sequence identity to the BRV-1 strain found in lowal. This study shows that bovine torovirus is a common virus in the fecal specimens of calves with diarrhea from farms in Southern Ontario, and thus may be an important pathogen of cattle. -- Bovine tomvirus nucleotide sequence GenBank -on number AF053061 108 INTRODUCTION The etiology of infectious diarrhea in calves has been attributed to rotavirus, coronavirus, calicivirus, parvovirus and astrovirus (Storz and Bates, 1973, Woode and Bridger, 1978, Moerman et al., 1986, Snodgrass et a/., 1986). All of these are agents of defined morphology that can be readily detected by EM. Breda virus, a member of the genus torovirus, was first associated with enteritis of calves in 1982 (Woode et al., 1982). This agent has been infrequently reported because the inability to isolate bovine torovirus in cell culture has precluded the large scale preparation of reference antisera and antigens for the development of commercial immunospecific diagnostic tests such as ELISA and latex agglutination, which are currently used to diagnose coronavirus and type A rotavirus infections (Ellens and De Leeuw, 1977, Eleens et a/., 1978, Carman and Hazlett, 1992). However, the partial sequencing of the 3' end of the BRV genome (Koopmans et al., 1Wla) has allowed for the application of RT-PCR for the diagnosis of bovine torovirus infections. Prospective studies in the Netherlands, in which viruses were examined in symptomatic and asymptomatic calves by enzyme linked immunosorbent assay (ELISA), demonstrated that torovirus was present in 6.4% of calves with diarrhea compared with only 1.7% of asymptomatic controls. In contrast rotavirus was found in 37.4% of symptomatic animals and 13.9% of controls in this study (Koopmans et a/., 1991b). Epidemiologic studies have shown that bovine torovirus is widespread in the Netherlands (Koopmans et a/., 1989), Germany and Switzerland (Weiss et ai., 1984). the United Kingdom (Brown et al., 1987), and the United States mode et a/., 1983, Woode et al., 1985b, Van Kruiningen eta/., 1992) with approximately 90% of dairy cattle being seropositive. In 1 study from Belgium, bovine toroviruses were found to play a role in respiratory,'digestive, and reproductive disorders of cattle (Vanopdenbosch et al., 1992). In a study from Saskatchewan, Canada, Breda virus-like particles were detected in 42 of 221 fecal or intestinal specimens of symptomatic calves (Durham et al., 1989). The aim of this study was to use RT-PCR and EM to determine the incidence of torovirus excretion in calves with diarrhea from farms in Southern Ontario, for comparison with the excretion of other entetic pathogens including bovine rota- and coronaviruses. MATERIALS AND METHODS Specimens A total of 118 stool specimens from calves with diarrhea and 43 specimens from asymptomatic calves were obtained from the Animal Health Laboratory (AM) in Guelph, Ontario. These specimens were submitted to the AHL by veterinarians in the region of Southern Ontario between April, 1995 and March, 1997. The majority of the calves were between 2 and 60 days old at the time of specimen collection. Since testing for torovirus was performed retrospectively, the diarrheic specimens had all previously been tested at the AHL for bovine coronavirus by an in-house ELISA system (Athanassious et aL, 1994, Carman and Hazlett, 1992). for bovine type A rotavirus by latex agglutination (Microgen Bioproducts Ltd., Camberley, U.K.), and for bovine viral diarrhea virus (BVDV) by isolation in cell culture. In addition, I coded all specimens, examined them for the presence of viruses by negative contrast EM, and tested them for bovine torovirus by RT-PCR in a blinded fashion. Electron microscopy Fecal specimens were diluted with an equal volume of 1% ammonium acetate (wlv) and clarified by centrifugation at 9000 x g for 15 minutes. at 4OC. The supernatant 110 was transferred to a new tube and centrifuged at 12 000 x g for 15 minutes at 4OC. Each sample was then examined by negative contrast electron microscopy as described previously in chapter 3 of this thesis. RNA extraction Extraction of RNA from bovine fecal specimens was performed as described previously for human stool specimens in chapter 3 of this thesis. RT-PCR All specimens were tested for the presence of torovirus RNA by RT-PCR. For each set of specimens assayed, a negative control (ddH20), and a control RNA extracted from a stool specimen shown to contain only bovine rotavirus by EM, were included. RNA extracted from a BRV-I (Iowa strain) stool specimen (obtained from G. Woode, Texas A&M) was tested as a positive control in every third RT-PCR assay due to the limited amount of control stool available. Oligonucleotide primers (General Synthesis and Diagnostics, Toronto, ON) were designed from the 3' end of the BEV genome as described in chapter 3 of this thesis, and bracketed a genome fragment of 219-bases. The RT and PCR reactions mixtures were performed as described in chapter 3 of this thesis. Cloning and DNA sequencing Cloning and sequencing of selected PCR products containing bovine torovirus were performed as described previously for human samples in chapter 3 of this thesis. RESULTS Electron microscopy Of the 118 diarrheic specimens that were examined, 37 (31.4%) were found to be positive for bovine torovirus by negative contrast EM. Conversely, torovirus particles were detected in only 2 of the 43 asymptomatic control specimens examined (table 8). The torovirus particles detected by EM were morphologically similar to the Breda virus previously reported in the stool specimens of diarrheic calves in Iowa and Ohio (Woode et a/., 1985b), and to particles observed in human fecal specimens (fig. 15). These particles measured between 100 and 120 nm at their largest diameter, and they exhibited torus, crescent, and rod shaped conformations. The particles were clearly enveloped and bore a fringe of peplomers, each measuring approximately 10 nm in length (fig. 22). RT-PCR By RT-PCR analysis, a DNA fragment of 219-bases was detected in 43 of the 118 (36.4%) specimens from symptomatic calves. Of these 43 samples, 36 were shown to contain torovirus particles by EM. Only 1 diarrheic specimen that was negative by RT- PCR was found to contain torovirus by EM (Table 8). Repeat testing was performed on all discordant samples to confirm the initial RT-PCR results. Among the 43 asymptomatic control samples tested, only 5 (1 1.6%) were positive for torovirus by RT-PCR, and 2 of these were also positive by EM. All 38 specimens that were negative by RT-PCR were also negative by EM (Table 8). Therefore, there was a significantly greater number of torovirus positive specimens in the symptomatic calf population than in the asymptomatic calves @=0.0023). None of the negative control and rotavirus control samples gave a positive result by RT-PCR. Figure 23 shows representative amplification products after agarose gel electrophoresis. 112 Table 8. EM and RT-PCR results for the detection of torovirus in stool specimens from diarrheic and asymptomatic 6alves in southern Ontarioa. No. (%) of calves RT-PCR result Symptomatic Asymptomatic EM+ EM- Total EM+ EM- Total Positive 36(30.5) 7(5 -9) 43(36.4) 2(4.7) 3(6.9) 5(11.6) Negative l(0.9) 74(62.7) 75(63.4) 0 38(88.4) 38(88.4) Total 37(31.4) 8 l(68.6) 1 18 2(4.7) 41(95.3) 43 Figure 22. Electron micrograph of a calf fecal specimen showing torus and crescent shaped bovine torovirus particles. Bar=100 nm. Figure 23. Gel electrophoresis of RT-PCR products from 5 torovirus-positive fecal specimens. Lanes marked (0) and R represent a negative control (ddH20), and a bovine rotavirus sample respectively. 100bp ladder was used as the molecular size marker. Other viruses Of the 118 specimens from diarrheic calves, 29 were positive for viruses other than bovine torovirus, including coronavirus, rotavirus, BVDV, and small round structured viruses (SRSV) as seen by EM. Of the 43 specimens that were positive for torovirus by RT-PCR, 10 were also positive for another virus. Of these, 5 had torovirus and rotavirus, 2 were positive for torovirus and coronavirus, Ihad torovirus and BVDV, 2 were found to contain torovirus, rotavirus, and coronavirus (table 9). In addition, 19 of the 75 diarrheic specimens that were negative for torovirus by RT-PCR were positive for other viruses. Of these, 3 had rotavirus, 5 had coronavirus, 3 were positive for BVDV, Icontained SRSV, and 7 had mixtures of either rotavirus and coronavirus, or rotavirus and BVDV (table 9). There was no significant difference between torovirus positive diarrheic specimens and torovirus negative diarrheic specimens for the presence of other viruses in the stools (p= 0.8). Only 3 of the asymptomatic control samples that were negative for torovirus by both EM and RT-PCR contained other viruses. These included 2 specimens with rotavirus, and 1 specimen with coronavirus as seen by EM. Cloning and sequencing of torovirus positive RT-PCR products To confirm that the 219-base product obtained by RT-PCR was indeed from bovine torovirus, and to determine the degree of heterogeneity among samples, amplicons obtained from 5 different specimens were cloned and sequenced. Clones were screened by PCR using the same primers, and at least 2 clones per sample were found to contain the 219-base fragment. These clones were isolated, sequenced, and their nucleotide sequences were compared to the 3' regions of the BRV-I and BEV genomes (fig. 24). The nucleotide sequences of each of the 5 torovirus-positive isolates 118 Table 9. Summary of viruses present in the stools of symptomatic and asymptomatic calves from Ontario farmsa. No. (%) of calves Symptomatic Asymptomatic (n= 1 18) (n= 43) Tomvirus alone Torovirus plus rotavirus' Tomvirus plus coronavirus Torovirus plus BVDV Torovirus plus SRSV Tomvirus plus rotavirus and coronavirus Rotavirus alonec Coronavirus alone BVDV alone SRSV alone Rotavirus plus coronavirus Rotavirus plus BVDV No virus present " The presence of torovirus was determined by RT-PCR, that of rotavirus was determined by latex agglutination and EM, that of coronavim was determined by ELISA and EM, that of BVDV was determined by cell culture, and that of SRSV was determined by EM. Bp= 0.016 * The number of other viruses present in totovirus-positive diarrheic specimens was compared to the number of other viruses present in totovirus-negative diarrheic specimens by chi square analysis (p= 0.8). Figure 24. Alignment of the nucleotide sequence from the 3' end of the BRV-I (Iowa strain) genome with that of 5 bovine torovirus-positive samples from diarrheic calves in Southern Ontario (a-e), and the BEV genome. Nucleotides identical to the consensus sequence are shown as dots. 5' 1 CAATGGCACT GAAGACTCTA ATAAGCGAGT CGCTACCTTT ACGATTAAGG TGGTAATGAA TTCAGCAACC a ...... b ...... A,...... C ...... T..... d ...... e ...... bev ...... C.A...... C.,...... T...,...... T...... 81 TTGTGGTTGG TCTGTAACTG TGTTATCAAC ATGGCATAAC TTGCCTCTGG CTCCACTCTG TGTAACCATC a ..AA ...... T....,.., .I..*.*.*...... b ..AA ...... T...... C ..A...... d . AA ...... 9 .AA...... 0...... bev ..AA ...... 5' 161 TAGATTTTAA TGGTTTTGCT TCCATGTAAG a ...... a A...... b ...... A,...... C ...... l....A...... d ...... A...... e ...... bev ...... were found to be between 96% and 97% identical to BRV-I, and between 95% and 96% identical to BEV in this area. The nucleotide substitutions were interspersed throughout the 219 base fragment. None of these substitutions resulted in changes in the predicted amino acid sequence of the BRV-1 nucleocapsid (N) protein, and substitutions at nucleotide positions 23 and 25 resulted in only 1 amino acid change from gtutamine to lysine in the predicted amino acid sequence of the BEV N protein. DISCUSSION Without convenient diagnostic tests, the etiology of a substantial proportion of viral diarrhea in calves due to BRV may not be diagnosed. This impacts on the establishment of containment measures, and the potential incentive towards the development of vaccines. While hybridization with cDNA probes has been previously reported (Koopmans et a/., 1991a) for the identification of torovirus, our findings show that RT-PCR may be a more suitable method for routine diagnosis of torovirus. The RT- PCR assay was more sensitive than EM in that it detected torovirus in 10 specimens that were negative for torovirus by EM. It is unlikely that these specimens represent false-positives because of the exhaustive precautions taken to control for contamination of the RT-PCR assay. Only 1 specimen that was positive by EM was negative by RT- PCR. This may have been due to genetic variation between samples of bovine torovirus, or to the presence of non-specific inhibitors present in the stool as has been shown previously for other gastroenteritis viruses (Wilde et a/., 1990). Due to limited amounts of BRV-1 control stool available, the presence of inhibitors could not be verified by spiking an aliquot of the discordant sample with a known amount of BRV-1 control specimen and repeating the RT-PCR assay. In this study, bovine torovirus was present significantly more frequently (36.4%) in calves with diarrhea than in the asymptomatic controls (11.6%; p= 0.0023). Thus, bovine torovirus is associated with the symptoms of enteritis in these symptomatic cases. The excretion of torovirus, as well as other viruses including rotavirus and coronavirus, by asymptomatic animals has been previously reported (Crouch and Acres, 1984), and our findings are consistent with these observations. In a number of cases, other viruses were present along with torovirus. That is, 10 of 43 diarrheic specimens that were positive for bovine torovirus by RT-PCR were also shown to contain other viruses. Nevertheless, the incidence of torovirus alone in the diarrheic specimens (27.9%) was still significantly greater than the presence of bovine torovirus in asymptomatic calves (11.6%, p= 0.016). However, it remains impossible to determine whether bovine torovirus was the primary cause of diarrhea in the symptomatic calves that had concomitant infections with other viral agents of enteritis. This phenomenon of mixed infection was also observed among the diarrheic specimens that were negative for torovirus by EM and RT-PCR but contained other viruses, and has previously been reported in other studies of animals and humans voode, 1982, Woode et a/. , I984, Moeman et a/., 1986, Snodgrass et a/. , 1 986). In keeping with previous observations from North America (Woode et a/., 1983, Woode et a/., 1985b, Durham et a/., 1989, Van Kruiningen et a/., 1992) and Europe (Weiss et a/., 1984, Brown et a/., 1987, Koopmans et a/, 1989, Vanopdenbosch et a/., 1992), torovirus enteritis is also prevalent in the Southern Ontario cattle population. Moreover, bovine torovirus was shown to be a common pathogen in the stools of symptomatic calves, exceeding the prevalence of bovine rotavirus and bovine coronavirus in this study. This was also the case in the Saskatchewan study where 19% of symptomatic specimens were found to contain Breda virus-like particles, whereas only 9.5% were positive for rotavirus as detected by EM (Durham et a/., 1989). Sequence analysis of a subset of the torovirus-positive RT-PCR arnplicons confirmed that the particles detected in the fecal specimens of calves in Southern Ontario are related to the torovirus prototype, BEV, and to BRV-I, since their sequences demonstrated between 95% and 97% sequence identity in 3' non-coding regions of the genomes of these viruses (Koopmans et a/.,1991 a). The bovine torovirus sequences also demonstrated between 95% and 96% sequence identity with the nucleotide sequences from the human torovirus samples shown in figure 21 (chapter 3). Thus, there exists strong cross-species similarities between the 3 characterized toroviruses. In addition, a small, yet defined amount of genornic heterogeneity was found among the bovine torovirus clones despite the conserved nature of the 3' end of the torovirus genome. This could be interpreted as evidence that genetic variation may exist among toroviruses isolated from different outbreaks. A more complete analysis of the sequences of specific viral genes, especially the peplomer and hemagglutinin- esterase genes, is presented in chapter 5 to confirm this hypothesis. Chapter 5 Bovine torovirus: sequencing of the structural genes and expression of the nucleocapsid protein of Breda virus Duckmanton, L., Tellier, R., Liu, P., and Petric, M. (1998) Vinrs Res. 58: 83-96. Permission of use granted by Elsevier Science. 125 SUMMARY Breda virus (BRV), a member of the genus torovirus, is an established etiological agent of cattle, which is found as 2 separate serotypes, BRV-I and BRV-2. In this study, a 7.5kb fragment of the BRV-'l genome that bracketed the genes for the structural proteins of BRV was amplified by long RT-PCR. The amplicon was purified and sequenced directly1. Sequence analysis revealed the presence of 4 open reading frames (ORF) corresponding to the peplomer (S), envelope (M), and nucleocapsid (N) genes, as well as an ORF for a 1.2kb gene located between the M and N genes. This new gene was 99.9% identical in nucleotide sequence to the hemagglutinin-esterase (HE) gene of BRV-2. With the exception of this new ORF, BRV-I manifests 80% nucleotide sequence identity with the torovirus prototype, Berne virus (BEV), in the 7.5kb segment from the 3' end of the genome that contains the ORFs for the structural A 504 nucleotide segment containing the ORF for the BRV-1 N gene was amplified by RT-PCR. This amplicon was cloned into an E. coli expression system and the resulting protein was purified by SDS-PAGE and used to immunize guinea pigs. Hyperimmune serum was found to be reactive with both bovine torovirus (BTV) and human torovirus (HTV) antigens. By immunoelectron microscopy, this serum was shown to aggregate broken but not intact torovirus particles from BTV-positive fecal specimens. By imrnunoblot, the hyperimmune serum reacted specifically with the 20kDa N proteins of both BWand HTV, as well as with the expressed N protein control. BRV- I and BRV-2 immune sera from gnotobiotic calves, but not human convalescent sera from HW-infected patients, reacted with the expressed N protein by immunoblot. These Breda virus-1 nucleotide sequence Genbank accession number NO76621 126 findings were applied to the design of a dot blot assay that could specifically detect BTV-positive and HTV-positive fecal specimens. INTRODUCTION Breda viruses are pleomorphic particles that can be difficult to recognize by electron microscopy, and cannot as yet be propagated in cell culture. Hence, serological methods have been used for the routine identification of this agent (Brown et al., 1987, Koopmans et a/., 1989). On the basis of results from hernagglutination inhibition (HI) tests, enzyme-linked imrnunosorbent assays (ELISA), and immunoelectron microscopy (IEM), 2 serotypes of BRV have been recognized. Breda virus serotype 1 (BRV-I) represents the original isolate from lowa, and serotype 2 (BRV-2) includes a second isolate from a colostrum-deprived calf in lowa, and an isolate from a diarrheic calf in Ohio (Woode et at., 1985b). Although the biochemical and serological properties of BRV have been well described, little is known about the molecular characteristics of this virus. To date, the 3' non-coding region of the BRV-1 genome has been partially sequenced (Koopmans et a/., 1991a). This finding provided a basis for the studies described in chapters 3 and 4 of this thesis (Duckmanton et a/., 1997, 1998a) whereby RT-PCR was used to show that toroviruses are major etiological agents of diarrhea in humans and calves. More recently, an additional 3kb upstream of the poly (A) tail of the BRV-2 genome has been sequenced (Cornelissen eta/., 1997). These findings revealed the presence of a 1.2 kb hernagglutinin-esterase gene, located between the M and N genes, that is not present in BEV, although the nucleotide sequence at the 3' end of this gene was shown to be highly similar to the X pseudogene of BEV (Cornelissen et at., 1997). To further our understanding of the BRV genome, the BRV-1 sequence was extended from the 3' end of the genome to include the sequence encoding the structural genes with the goal of producing viral proteins for use in serological assays. As described in this chapter, an amplicon encompassing the entire 3' end of the BRV-1 genome that encodes the viral structural proteins was obtained by long RT-PCR and sequenced. From these data, the BRV-1 N gene that codes for the nucleocapsid protein was cloned and expressed in Eschenchia coli. Antisera to this recombinant protein were tested for their reactivity with bovine and human toroviruses. MATERIALS AND METHODS Specimens and sera A stool specimen from a gnotobiotic calf infected with a purified preparation of the Breda-I (code GC-32) and antisera to BRV-1 and BRV-2 from experimentally infected gnotobiotic calves were obtained from Dr. G. Woode, Texas A&M and Dr. M. Hardy, Montana State University, respectively. Bovine torovirus-positive fecal specimens from diarrheic calves, control specimens from asymptomatic calves, rotavirus-positive specimens from diarrheic calves, and patient specimens containing human torovirus and acutelconvalescent paired sera from patients whose stools were diagnosed positive for HTV by electron microscopy (EM) were obtained as previously described in chapters 3 and 4 of this thesis. Primers Oligonucleotide primers (synthesized by ACGT Corp., Toronto, Canada) for amplification of the 7.5kb fragment of the BRV-1 genome encompassing the genes for the viral structural proteins were designed based on the known sequence of the BEV genome. Two sets of PCR were performed using the same antisense end primers and two different sense primers. The second sense primer was nested 240 bases downstream from the first. The first sense primer (5' CAGCTGGTGTGAATACCTCCTCTTCGGAGGT 3') was derlved from the 3' end of the BEV polymerase gene (EM81 accession number X52374) and the second sense primer (5' CTCTGGATTAATTCAGGAGGTGCCGTTGTTGTGTC 3') was derived from the 5' end of the peplomer gene (EMBL accession number X52506). The antisense primer (5' TCTAGATGGTTACACACAGTGGAGCCAGAGGCAAG3') was derived from the 3' non- coding region upstream of the poly (A) tail (DDBJ accession number D00563). Oligonucleotide primers (synthesized by ACGT Corp., Toronto, Canada) for amplification of the 504 nucleotide fragment containing the ORF of the BRV-1 N gene were designed based on the sequence of the BRV-1 N gene obtained in this study. The sense primer (5' TCGCGGATCCATGAATTCTATGCTTAAATCCAAATG 3')' designed in the 5' end of the N gene ORF, contained a BamHl restriction site upstream of the start codon for cloning purposes. The antisense primer (5' CCGTGCGAGCTCGAGTATTCATTACCACCT37, designed in the 3' end of the N gene ORF, contained an Xhol restriction site in place of the stop codon. RNA extraction RNA was extracted from fecal specimens as described previously in chapter 3 of this thesis. Each RNA pellet was resuspended in 10 pl of DNase free, RNase-free double distilled water (5 prime 3 prime lnc., Boulder, CO) containing 10% 100 mM dithiothreitol, and 5% (vlv) 2040 UIpI RNasin (Promega, Madison, WI). AJiquots of RNA were stored at -80 OC. Long RT-PCR The RT and PCR reactions were performed using the approach of Tellier et a/. (1996b). Reaction mixtures were set up in an isolated room, using dedicated micropipetters and aerosol-resistant tips. Reactions were then performed in another room designated for PCR amplification. For the RT reaction, an RNA aliquot was thawed on ice, incubated for 2 minutes at 65OC, and chilled on ice. The RNA was added to 10 pl of the RT mixture containing 4 pl of 5% lStStrand Synthesis Buffer (Gibco BRL, Gaithersburg, MD), 0.5 pI RNasin (20-40Ulpl) (Promega), 1 pI of 100 mM dithiothreitof (Promega), 1 pl of a 10 mM stock solution of deoxynucleotide triphosphates (dNTPs) (Pharmacia, Piscataway, N.J.), 2.5 pl of a 10 pM primer stock solution, and 1 pI (200 U) of Superscript II reverse transcriptase (Gibco BRL). The reaction mixture was incubated at 42OC for 1 hour, after which 1 GI of RNase H (1-4 Ulpl) (Gibco BRL) and 1 pl of RNase TI (900-3000 U/pI) (Gibco BRL) were added, and the reaction mixture was further incubated at 37% for 20 minutes For the PCR reaction, 2 pl of the RT reaction were added to the PCR mixture containing ) 5 p1 KlenTaq PCR reaction buffer [40 mM Tricine-KOH (pH 9.2 at 257, 15 mM KOAc, 3.5 mM Mg(OAc)*, 75pgIml bovine serum albumin; Clontech, Palo Alto, CAI, 250 pM each dNTP, 10pmol of each primer, and 1 pI of SOX Advantage KlenTaq polymerase mix (Clontech). The total volume of the PCR reaction in thin walled PCR tubes (Stratagene, La Jolla, CA) was 50 pl. The reaction mixture was overlaid with 40pl of mineral oil and amplified in a Robocycler thermal cycler (Stratagene). To amplify the 7.5 kb BRV-1 genome fragment, the DNA underwent denaturation at 9Q°C for 35 seconds, annealing at 67OC for 30 seconds, and elongation steps of 68OC for 8 minutes for the first 25 cycles, and 68OC for 12 minutes for the last 10 cycles. The same RT-PCR protocol was used to amplify the BRV-1 N gene fragment, but the cycling program was modified as follows: denaturation at 9g°C for 35 seconds, annealing at 67OC for 30 seconds, and elongation at 68OC for 4 minutes for 35 cycles. Reaction products were analyzed by electrophoresis on a 0.7% agarose gel, which was subsequently stained with ethidium bromide, and viewed under an UV transilluminator. When excising DNA from the gels, shielding from UV was provided by illuminating the gel tray through 2 plexiglas trays to minimize photo nicking. DNA sequencing PCR products were excised from agarose gel, and purified using the Jetsorb system (Genomed, Frederick, MD). Purified amplicons were then sequenced as described in chapter 4 of this thesis, except that [PPI~ATPwas used as the radiolabel. Sequence data were analyzed using the computer programs GCG version 8 (Genetics Computer Group Inc., Madison, WI), and Gene Runner version 3.04 (Hastings on the Hudson, NY). Cloning and expression The PCR product containing the BfW N gene was purified using the Wizard PCR Preps DNA Purification System (Promega). The amplicon was cut with Xhol and BamHI, and then ligated to a pET28a(+) cloning vector (Novagen, Madison, WI) which contains a T7*tag, a T7lac promoter and the natural promoter and coding sequence for the lac repressor (lac/) (fig. 25). The arnplicon was inserted into a multiple cloning site immediately dowstream from the T7"tag sequence. The ligated vector was introduced into INVaF' One Shot cells (Invitrogen, Carlsbad, CA) according to the manufacturer's recommendations. Plasmids were purified from LB broth cultures using the QIAGEN 13 1 Plasmid Mini Kit (QIAGEN, Chatsworth, CA), and the presence of the insert was confirmed by sequencing using the fmol DNA sequencing system (Promega) as described above. Purified clones containing inserts that were shown to be intact and in frame with the T7*tag sequence were introduced into BUI(ADE3) expression host cells (Novagen) as per the manufacturer's recommendations. These lysogenized cells contain a copy of the T7 RNA polymerase gene, under lacUV5 control, integrated into the host chromosome. Upon addition of IPTG, the lacUV5 promoter is induced and T7 RNA polymerase is produced within the cell. This enzyme then, in turn, recognizes the T7 lac promoter on the pET28a(+) plasmid which begins transcription of the lac operator leading to the expression of the N protein. Thus, the transformed cells were grown in broth cultures, to which IPTG was added to induce expression of the N protein. Samples containing total cell protein were removed from induced cultures at 2 hours and 3 hours post-induction. Soluble and insoluble cell fractions were prepared from total cell protein preparations by the addition of 100 pglml of lysozyme (Pharmacia) and 1/10 volume of 1% Triton X-100 (Sigma Chemicals, St. Louis, MO) to the samples. Each sample was sonicated with a microtip to shear the DNA, and centrifuged at 12,000 g for 15 minutes at 4'. Soluble and insoluble cell fractions were analyzed by SDS-PAGE on a 12% resolving and 4% stacking gel as per standard methodology (Sambrook et a/., 1989). Proteins present in the SDS-PAGE get were transferred electrophoretically to a polyvinylidene fluoride (PVDF) nylon membrane (Millipore, Bedford, MA) for 90 minutes at 100 V. The membranes were washed and blocked overnight in a solution of 5% skim milk in Tris-buffered saline containing 0.5% Tween-20. The membranes were then incubated for 1 h at room temperature in a 1:3000 dilution of T7Tag Antibody Alkaline Phosphatase Conjugate (Novagen) in TBST. The membranes were washed and developed using 1 caplet of 5-broma-4-chloro-3-indolyl phosphate-nitro blue tetrazoliurn 132 (BCIP-NBT; SigmaFAST, Sigma Chemicals) dissolved in 10 ml of water. Color developed at room temperature within 5-1 0 minutes. Preparation of guinea pig antisera to BRV-I The insoluble cell fraction was subjected to preparative SDS-PAGE on a 12% resolving gel and a 4% stacking gel. The gel was stained with Coomassie brilliant blue R250. The band corresponding to the 20 kDa N protein was excised and soaked in distilled water for 2 hours to remove traces of destaining solution. The gel slice was cut into small pieces, resuspended in an equal amount of distilled water (w/v), and mixed 1:1 with Freund's incomplete adjuvant. Two young adult male guinea pigs were inoculated subcutaneously with the protein mixture once a week for 3 successive weeks. The guinea pigs were then injected 1 week later with a 1:1 suspension of the purified insoluble cell fraction pellet containing the N protein with Freund's incomplete adjuvant. Pre- and post-immunization sera, designated gpPlaN and gpHlaN, were collected. The sera were heated at 56OC for 30 minutes to inactivate complement. These were then aliquoted, and stored at -20°C. SDS-PAGE and immunoblotting The guinea pig sera were used to perform immunoblots on a number of bovine and human specimens that were purified by differenlal centrifugation and characterized as described in chapters 3 and 4 of this thesis. Proteins were separated by SDS-PAGE and transferred electrophoretically to a nylon membrane. The membrane was then blocked as described above, and incubated for 3 h at room temperature in a 1:2000 dilution of either gpPlaN and gpHlaN antisera in 1% skim milk in TBST. The membranes were washed in TBST and incubated for 2 h at room temperature in a 133 Figure 25. Diagram of the PET-28a (+) cloning vector. Lac 2: lac operator and lac Z gene, Lac I: lac repressor, T7: T7 lac promoter, Kan: kanarnycin resistance gene. In the cloning region, the T7 promoter is shown in red, the lac operator is shown in turquoise and the T7 terminator is shown in blue. Restriction sites are shown in green, and the T7*tag region is underlined. Adapted from the 1998 Novagen product catalogue. N gene (504 nts) Kan (3995-4807) PET 28a (+) (5369 bp) PET 28a (+) cloning region: T7 promoter lac operator .. . ..AGATCTCGATCCCGCGAAA~AATACGACTCACTATAGGGGAA?TGTGAGCGGATAACAA?TCCCCTCT AGAAATAA?TTTGTTTAAmAAGAAGGAGATATACCAT~cA~AGcCATcATcATcATcATcAcA T'*@ BamHI GCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGCTAGCATGACTGGTWACAGCMTGGGTCGCGGA XhoI TCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACC GGCTGCTAACAAAGCCCGMGGAAGCTGAG1TGGCTGCTGCCACCGCTGAGCAATAACTAGCATAAC T7 terminator CCC?TGGGGCCTCTAAACGGGTCnGAGGGGmG 1:3000 dilution of alkaline phosphatase conjugated-rabbit anti-guinea pig IgG (RaGP; Sigma Chemicals) in 1% skim milk in TBST. Purified N protein control samples were also tested for reactivity with a number of human and bovine sera. Primary sera were used at dilutions of 1:2000 followed by 1:3000 dilutions of either alkaline phosphatase conjugated-murine anti-human IgG, or alkaline phosphatase conjugated-goat anti-bovine IgG, respectively (Sigma Chemicals). Following further washing, the membranes were developed using BCIP-NBT as described above. Immunoelectron microscopy lmmunoelectron microscopy was performed as described in chapter 3 of this thesis, using gpPlaN and gpHlaN antisera. Control specimens included a purified bovine rotavirus-positive sample, and 2 purified samples from calves with diarrhea in which no viruses were detected by EM, and which were negative for BTV by RT-PCR. Dot Blot All specimens (1 ml) were diluted in an equal volume of phosphate-buffered saline (wlv) and clarified by centrifugation at 9000 g for 15 minutes at 4OC. The supernatants were transferred to a new tube and centrifuged at 12000 g for 15 minutes at 4OC. A 15pl volume of each supernatant was vacuum spotted onto a PVDF nylon membrane (Millipore) and allowed to dry for 2-5 minutes. The membranes were blocked for 30 minutes in a solution of 5% skim milk in TBST. The membranes were then incubated for 1 h at room temperature in a 1:1000 dilution of either gpPlaN and gpHlaN antisera in 1% skim milk in TBST. The membranes were washed with TBST and incubated for 45 minutes at room temperature in a 1:3000 dilution of alkaline 136 phosphatase conjugated-RaGP (Sigma Chemicals) in 1% skim milk in TBST. Following further washing for 10 minutes. with TBST, the membranes were developed using BCIP-NBT (Sigma Chemicals) as described above. RESULTS Long RT-PCR and sequencing of BRV-I structural genes Using primers designed from the genome sequence of BEV, an ampliwn of 7550 bases was amplified from BRV-1 RNA (Genbank Accession No. AF076621) (fig. 26). The amplicon was excised from an agarose gel, purified and used directly for DNA sequencing. Sequence analysis revealed the presence of 4 ORFs (figs. 27 and 28). The first ORF, 4752 nucleotides in length (nts 55-4806), codes for a polypeptide of 1583 residues which contains domains typical of type I membrane glycoproteins: a 26 residue C-terminal transmembrane anchor, a 19 residue N-terminal signal sequence, and 21 potential N-glycosylation sites. A cleavage site for a trypsin-like protease (arginine residues 1003-1OO7), and 2 heptad repeat domains (residues 1160-1 231 and 1474- 1519) were also identified. A heptad repeat is a seven-residue periodicity in which hydrophobic amino acids are regularly spaced. The nucleotide sequence of ORF1 is 76% identical to the peplomer gene of BEV. The next downstream ORF, 702 nucleotides in length (nts 4834-5535), codes for a polypeptide of 233 amino acids. The nucleotide sequence of this ORF is 85% identical to that of the BEV envelope gene, which codes for the M protein (den Boon et a/., 1991b). Analysis of the amino acid sequence showed that the encoded protein contains the characteristics of a class Ill membrane protein with 3 possible successive transmembrane a-helices in the N-terminus. Figure 26. Gel electrophoresis of products amplified by long RT-PCR using RNA extracted from a bovine fecal specimen positive for Breda virus-1 (BRV-1) and primers flanking the torovirus nucleocapsid and peplomer genes based on the BEV genome. Lane marked N represents a negative control (ddH20). DNA mass ladder (M) (0.1-2kb) and lambda Hjndlll (A) (23.1-0.56kb) were used as molecular size markers. Figure 27. Schematic representation of the BRV-I genome showing the open-reading frames (ORF) for the 4 viral structural genes, the peplomer (S), envelope (M), hemagglutinin-esterase (HE), and nucleocapsid (N) genes. Numbers indicate the genome positions of the first and last nucleotides of each ORF starting from the 5' end of the genome. The 2 potential ORFs of the BRV-1 polymerase gene (POLla and POL1b) have not yet been sequenced; their positions are estimated from those of the Berne virus genome. Figure 28. cDNA nucleotide sequence of BRV-7 RNA and corresponding amino acid sequences of the BRV-1 peplomer gene, envelope gene, hemagglutinin-esterase gene, nucleocapsid gene and the 3' non-coding region of the BRV-I genome. Initiation (>>>) and termination (<<<) codons are indicated. Transcription initiation signals are boxed. Putative N-terminal signal sequences and C-terminal transmembrane domains are highlighted in green and pink, respectively. Potential N-glycosylation sites are shown in bold. Heptad repeats are underlined. Clustered basic amino acids (N gene) are highlighted in turquoise. Arginine residues preceding the cleavage site for a trypsin-like protease are highlighted in blue, and the FGDS acetylesterase catalytic site is highlighted in red. Termination codons, TAG and TAA, are indicated by @ and #, respectively. M F 1 dOTGmAOTJ ACTAGTTTAA GTTATAGATT TAGTAGTGIT AAGllTGTGC AAAAATGTIT >>> LCF C TA P ILC LWI NSGG AVV 61 TTATGTITCT GTACCGCGCC AAllTTGTGC CTCTGWA ATTCAGGAGG TGCCGTTGlT VSN ESLV VCE PVSYPYS LQV 121 GTGTCAAATG AATCATTAGT GGTTTGTGAG CCAGTATCCT ACCClTAlTC ACTACAAGTC LRS FSQ R VNL R TK RAVT TDA 181 CTTCGCTCTT TlTCACAGCG TGTTAATTTA AGAACAAAGA GAGCTGTTAC TACTGATGCC WSF AYQI STS SLN VNGW YVN 241 TGGTClllTG CCTACCAAAT CTCAAClTCA TCTITGAATG TTAATGGlTG GTATGlTAAT FTS PLGW SYP NGK LFGI VLG 301 TTTACATCTC CCTTAGGITG GAGTTATCCA AACGGTAAAC TGTTTGGAAT TGTCCTGGGT SDA MMRA S VS TFT YDVI SYV 361 TCTGATGCCA TGATGAGAGC ATCGGTGAGT ACCTTTACAT ATGATGTTAT ATCATATGTA GQR PNLD CQI NDL ANGG LES 421 GGGCAAAGAC CAAACClTGA CTGTCAAATA AACGAlTTAG CAAATGGTGG GTTGGAAAGT RY S TVRV DNC GNY PCHG G GK 481 CGGTACAGCA CTGTTAGAGT GGATAAlTGT GGTAATTACC CATGCCACGG TGGGGGAAAA PGC SIGH PYM ANG VRTR VLL 541 CCTGGCTGTT CCATGGACA CCClTATATG GCCAATGGTG TGCGTACCCG TGmGTTG TTQ SPGI QYE IYS GQDY AVY 601 ACCACCCAGT CTCCAGGCAT TCAGTATGAG ATATATTCTG GTCAAGATTA TGCTGTGTAT QIT PYTQ YTV TMP SGTS GYC 661 CAAATTACAC CTTATACACA GTATACTGTT ACCATGCCAT CTGGAACCTC TGGTTAlTGT QQT PLYV ECG SWT PYRV HAY 721 CAACAGACAC CGCTCTATGT AGAGTGTGGT TCCTGGACAC CATATAGAGT TCATGCATAT GCDKATQ SCN YTI SSDW VVA 781 GGlTGTGACA AGGCAACTCA GAGCTGCAAC TATACCATlT CATCAGAlTG GGTTGTCGCT FKS KASA I IL RSQ LIVA LAQ 841 TlTAAGAGTA AGGCTAGTGC AAlTAlllTA CGATCTCAGC TAATTGTGGC TCTAGCACAA KLS RTVG VNK AVY FWFL KQP 901 AAGCTATCTC GGACGGTAGG TGTTAATAAA GCAGTTTATT TTiGGTCTT AAAACAGCCT Y HY LSLV N FS PNY ALFS PLC 961 TACCATTATT TGTCAClTGT AAATTTCTCA CCTAAlTATG CCITGTTTTC ACCACTCTGT KS L RQQS ATY SAL SYGS PFF 1021 AAATCACTTA GACAACAATC AGCAACATAT TCAGCTITAT CTTATGGTTC TCCATlllTC VAQ ECYN NAL YLP DCCL YTL 1081 GTGGCTCAAG AGTGCTATAA TAATGCATTG TArrrGCCTG ACTGCTGTCT TTACACTITG FS I LFSW DYQ VNY PVNN VLQ 1141 TllTCAATCT TGTITAGTTG GGATTATCAG GTGAATTATC CAGTGAATAA TGllTACAA AN€ TFLQ L PT TGY LGQT VSQ 1201 GCAAATGAGA CC111rTACA ATfACCAACA ACTGGATAIT TGGGCCAGAC AGTTTCCCAA GRM LNLF K DA IVF LDFY DTK 1261 GGACGCATGT TGAACCTTTT TAAGGATGCC ATAGTGTTTC lTGAllllTA CGATACCAAG FYR TNDG PGG Dl F AVVV KQV 1321 ITITACCGCA CGAATGATGG ACCTGGTGGT GACAlll-ITG CTGTTGITGT GAAGCAAGTA PVf AYSA FRI EQQ TGYL AVK 1381 CCAGTCATTG CATATAGTGC ATTTAGAAIT GAACAACAGA CTGGCTATCT TGCTGlTAAG CNGVIQA TLA PHs SRVV LLA 1441 TGTAATGGTG TTATACAGGC AACACTAGCA CCACACTCAT CTCGTGTTGT CCTGCTTGCT RHMSMWS IAA ANS TTIY CPI 1501 AGACACATGT CTATGTGGTC AATTGCTGCA GCTAACTCCA CCACTAfTTA ITGCCCAAlT YTL TSFV RLD IST SWYF HTL 1561 TACACCTTGA CAAGlllTGT TCGCTTGGAT ArrrCCACAT ClTGGTAllT TCACACCITG AQPSGPI QQVSMPVLST GAA 1621 GCACAGCCGT CCGGCCCAAT ACAACAGG'IT TCCATGCCTG TTCTlTCTAC TGGCGCCGCT GVYMHPM IEHWVT LLAQ SSV 1681 GGTGTGTATA TGCATCCAAT GATTGAACAT TGGGTTACTC TTTTGGCACA ATCAAGTGTT YQ P SMFNMGV NK S VTLT TQL 1741 TATCAGCCTA GTATGTAA TATGGGTGTT AATAAGTCTG TTACTCTGAC AACACAGTTG QAY AQVY TAW FLS ILYT RLP 1801 CAGGCrrATG CTCAGGTTTA TACTGCTTGG IIGTCCA TTCTATACAC CCGGCTCCCC ESR RLTL GAQ LT P FI QA LLS 1861 GAGTCTAGAA GATTGACAlT GGGTGCACAG TGACACCCT TTATTCAAGC ACTTITATCA FKQ ADID ATD VDT VARY NVL 1921 TTTAAGCAGG CTGATATTGA TGCTACTGAT GTGATACAG TAGCCCGlTA TAATGTGCTT ILMWGRK YAA VIYNQLP EWS 1981 ATCTTGATGT GGGGTAGAAA GTATGCTGCT GTGATCTATA ACCAAlTACC TGAGTGGTCA Y PL FKGG VGDSMW FRKK FLV 2041 TATCCGCTGT WGGGTGG AGlTGGTGAT TCTATGTGGT TTAGAAAGAA ATffCTTGTA TTK I HQT ASH FPF IAGY LDF 2101 ACTACCAAAA TCCATCAAAC CGCATCACAT TTCCClllTA TAGCTGGlTA TTTGGAlllT LDY KYIP KYK DVA CPLS TMV 2161 TTAGAlTATA AGTATAlTCC CAAGTATAAA GATGlTGCAT GTCCACTATC CACAATGGTA PSI LQVY ETPQLF VIIV QCV 2221 CCATCAAllT TGCAAGTTTA TGAAACACCA CAGCTGTITG lTATAATTGT TCAATGTGlT STTYSWY PGL RNP HTIY RSY 2281 TCCACCACAT ACTCATGGTA TCCTGGACTT CGAAACCCAC ACACAATTTA TCGlTCATAT KLG TICV LVPYSS PTDV YSS 2341 AAAClTGGCA CGAllTGTGT llTGGTGCCA TATTCAAGTC CGACCGATGT lTATTCATCA FG F FFQS ALT I PT VQTT DDI 2401 T1TGGGTTCT TIIIICAATC TGCACTTACA ATACCTACAG TGCAAACGAC CGATGATATT LPGCVGF VQDSVF TPCH PSG 2461 TTACCTGGlT GTGTGGGT TGTACAAGAT AGTGTTTTTA CGCCATGTCA TCCATCTGGT CPV RNSY DNY I IC PGSS ASN 2521 TGTCCTGTTC GTAARCTTA TGACAATTAT ATCATTTGTC CTGGTTCTAG TGCGTCAAAC YTL RNYY RTT TPVTNVP IEE 2581 TACACClTGC GCAACTATTA CAGGACAACT ACTCCAGTTA CGAACGTACC AATTGAGGAA VPL QLEI PTV SLT SYEL KQS 2641 GTGCCTlTAC AGCTTGAAAT ACCAACAGTA AGTTTAACAT CATATGAACT TAAACAATCT ESVLLQDEG GIV VDHN TGS 2701 GAGTCTGTIT TGTTGCAGGA CATTGAGGGG GGCATTGlTG TTGACCACAA CACTGGTTCA IWY PGGQ AY DVSF YVSV I IR 2761 ATCTGGTACC CTGGTGGTCA GGCCTATGAT GTCTCTTTCT ATGTTTCTGT AATTATACGT YAP PKLE LPS TLANFTS CLD 2821 TATGCTCCAC CTAAGCTTGA GlTGCCATCT ACACTTGCTA ATllTACATC GTGTCTTGAT YIC FGNQQCR GEA QTFC TSM 2881 TACAlTTGTT TGGTAATCA ACAGTGTAGA GGTGAGGCAC AGAClll7TG CACTTCAATG DYF EQVF NKS LTS L I TA LQD 2941 GAlTAllTG AACAAGTTIT TAATAAGAGT TTAACATClT TGATAACAGC TTGCAAGAT L HY VLKL VL P ET T L ELT E DT 3001 TTGCAlTATG TTTTAAAACT TGTGTACCA GAAACAACCC TTGAACTTAC TGAGGATACA RRR RRAV DEFSDT ISLL SES 3061 CGTCGTAGGC GACGTGCTGT AGATGAGTTT TCAGACACAA TATCACTTTT GTCAGAGTCA FER FMSP ASQ AYM ANMM WWD 3121 llTGAGAGGT TTATGTCACC AGCTTCACAG GCCTATATGG CTAACATGAT GTGGTGGGAT EAFOGISLPQ RTG SI LS SAP 31 81 GAAGCATTTG ATGGTATAAG TITGCCACAG AGAACTGGCT CTATACTATC GAGTGCACCT SLS SI SSWHS YSS RTPL I SN 3241 TCGCTGTCGT CCATTTCiTC CTGGCATTCA TATTCTTCAC GCACACCACT TAlTTCGAAT VKT PKTT FNV KLS MPKL PKA 3301 GTTAAAACAC CAAAGACTAC TllTAATGTG AAGTTATCTA TGCCAAAGCT ACCTAAGGCA STL STIG SVL SSG LSIA SLG 3361 TCTACTCTCT CAACTATTGG GTCTGTACTA TCATCCGGTC TCTCTAnGC ITCTTTGGGT LSI FS II E DR RVI E LTQ Q QI 3421 ITGTCTATAT TITCAATTAT AGAGGATAGA AGAGTTATAG AGCTTACACA ACAGCAAATT MALE DQI TI1 AGY TTKN FEE 3481 ATGGCTCTTG AAGATCAGAT TACTATITA GCTGGTATA CAACGAAGAA TiTGAGGAA I QS SLNT LGQ QVQ D F SQ TSA 3541 ATACAATCCT CCTTGAACAC TITGGGACAG CAAGTTCAGG ATT?TTCACA AACAAGTGCA L SL QQLS NGF EQI TQQL DKS 3601 TTGTCATTAC AGCAGCTGTC TAATGGGTTT GAGCAAATTA CCCAGCAGIT GGATAAGAGT IYY VMAV QQY ATY MSSL VNQ 3661 ATITATTATG TTATGGCAGT ACAGCAGTAT GCCACCTATA TGTCATCTCT TGTAAATCAG LNE LSQA VYK TQD MYIT C IH 3721 ClTAATGAGC TGTCCCMGC TGTGTATAAG ACACAAGATA TGTATATAAC ATGCATACAT S LQ SGVL S PN C I T PFQI C HL 3781 TCllTACMT CTGGTGTTCT TTCACCCAAC TGTAlTACCC CCTTCCAAAT ITGTCATTTG YQVAKNLSSG ECQ PILS ERE 3841 TATCAAGTAG CAAAAAAI7-r AAGTAGCGGA GAGTGTCAAC CAAlllTGTC AGAGCGTGAG ISR FYSL PLV TDAMVHN DTY 3901 AllTCACGCT 7TTATTCCCT TCCACrrGTG ACTGATGCTA TGGTGCATAA TGATACTTAT WFS WSIP ITC SNI LGSVYKV 3961 TGGlTl7CGT GGTCAATCC TATCACATGT TCCAACATlT TGGGCTCAGT lTATAAGGlT QPGYIVN PHH PTS LQYD VPT 4021 CAACCAGGTT ACATAGTAAA TCCCCACCAC CCCACCAGCC TACAATATGA TGTTCCTACT HVV TSNA GAL IFD EHYC DRY 4081 CATGlTGlTA CTTCAAATGC TGGTGCGlTA ATATITGACG AGCATTATTG CGATAGGTAT NQV YLCT KSA FDL AEAS YLT 4141 AACCAGGTCT ACCTATGCAC AAAGTCTGCA TITGATClTG CAGAAGCTAG CTACCITACA MLY SNQT DNS SLT FHPA PRP 4201 ATGCTCTACT CTAATCAAAC AGATAATAGT AGCCTGACAT rrCATCCAGC ACCAAGACCT D PC VY LS AS A LY C Y Y S D E CH 4261 GACCCTTGTG TTTATTTGTC AGCATCAGCC CTTTACTGCT ATTACTCAGA TGAATGTCAT QCV IAVG NCT NRT VTYE NYT 4321 CAATGTGTTA TAGCAGTTGG TAArrGTACT AATCGTACTG ITACCTATGA AAACTACACC YPI MDPQ CRG FDQ ITIS SPI 4381 TACCCAAlTA TGGACCCACA GTGTAGAGGT TTTGACCAGA TAACCATATC ATCACCAATT A I G AD FT ALP S R P PL PL HL S 4441 GCCATTGGTG CTGATllTAC AGCTTTACCA TCTCGGCCAC CllTGCCllT GCATTTGTCA YVN VTFN VTL PNE LNWT DLV 4501 TATGTGAATG ITACATTTAA TGTCACTTTA CCCAATGAGT TAAATTGGAC TGATTTGGT L DY SFKD KVY E IS KNIT Q L H 4561 lTAGATTATA GllTTAAAGA TAAAGTTTAT GAGATlTCAA AGAATATAAC CCAGCTACAT EQ I LQ VS NWA SGW FQRL R DF 4621 GAGCAGATAC TTCAAGTTTC CAATTGGGCT TCTGGATGGT TTCAGCGTIT AAGAGATTTT LYG LI PA WI T WLT LGFS LFS 4681 CTTTATGGTT TAAlTCCTGC lTGGATTACA TGGCTTACTT TAGGTllTAG TlTGlTTAGT I LI SGVN I I L FFEMNGK VKK 4741 ATATTAATAA GTGGTGTAAA TATTATAlTG TCTTTGAGA TGAATGGCAA GGlTAAGAAA s@ MF ETNY WPF 4801 AGCTAGTCAC T~~TGAAGGTGCCAAATG~G AGACCAA~A ~GGCCCITC <<< >>> PDQ APNP FNAQVE QLSA TEN 4861 CCTGATCAGG CTCCAAACCC ATITAATGCT CAAGlTGAGC AGTTATCAGC AACTGAAAAT VY I F LTT L F G I LQ LVY V I FK 4921 GrrrATATATTT TTCTTACTAC AClllTTGGA ATACTCCAAC TAGTGTATGT AA71111AAG LLC TMFP ALHWSP IWRG LEN 4981 TTGITATGTA CTATGTTTCC AGCTCTGCAT TGGTCGCCTA TATGGCGCGG TITGGAGAAC FW L FLSL ASL AIA YWWL PSM 5041 TITGGCTTT TCTTGAGTTT AGCATCCCT GCAATTGCCT ATTGGTGGCT CCCCAGTATG TFT GYWA LTI IAT ILGL IML 5101 ACCTTTACTG GCTATTGGGC ATTGACTATT ATTGCCACCA TllTGGGllT GATTATGTTG IMM SVKF VSF VKL FYRT GSF 5161 ATAATGATGT CTGTTAAGlT TGTCAGlllT GTTAAGTTGT TITATAGGAC TGGAAGTIT AIA IRGP IVL VAL DVTI KLH 5221 GCAAlTGCTA TACGGGGACC AATTGTGCTT GTTGCACTTG ATGTTACTAT TAAGC'TTCAT CTPFAIL VKE VGN IFYL SEY 5281 TGCACACCTT ITGCAATTCT TGTCAAGGAG GlTGGCAATA 11ll1rAC11 GTCAGAGTAT CNK PLTA AQVAAL RICVGGQ 5341 TGCAATAAAC CATTAACAGC TGCTCAGGTT GCTGCGTTGC GGATTTGTGT TGGCGGACAA WFAYTRS TTT SAAKVAA ANS 5401 TGGTTTGCU ACACTCGGTC CACTACTACC AGCGCCGCTA AAGTAGCTGC AGCTAACAGC TAKYHLF VLQ GVA EYTQ LSS 5461 ACTGCAAAAT ACCATClTlT TGTGCTGCAA GGTGTTGCAG AGTACACGCA ATTGTCTAGT VKF E @ MLS LI LF FPS 5521 GTTAAGmG AGTAGCACT ~IAGATGCTGAGT TAATAClTT lllTCCATCT <<< >>> FAF AATP Vf PYYG PGHI TFD 5581 TTTGCCTTTG CGGCAACACC AGTAACACCA TATTATGGTC CAGGACATAT TACClTTGAT WCG FG DS R SD CT N PQ S P M S L !?@I1 !?@I1 TGGTGTGGAT ITGGTGATAG CAGGTCTGAT TGCACCAACC CTCAGTCACC TATGAGTCTT Dl PQQLC PKF SS K SSSS MFL 5701 GATATTCCTC AACAGTTGTG TCCTAAGlTT TCATCAAAGT CATCCTCGTC CATGlTTlTG SLH WNNH SSF VSY DYFN CGV 5761 TCATTACATT GGAATAATCA TTCCAGTTTT GTTTCCTATG ACTAlllTAA UGTGGTGTG EKV FYEG VNF SPR KQYS CWD 5821 GAGAAGGTIT TITATGAGGG TGTGAATTTT TCACCACGTA AGCAGTATAG ITGITGGGAT EGV DGWI ELK TRF YTKL YQM 5881 GAGGGTGTTG ATGGlTGGAT TGAACTTAAG ACCAGGm ATACTAAGCT lTATCAAATG ATT SRCI KL I QLQ APSS LPT 5941 GCAACAACTT CACGTTGCAT CAAGCTTATC CAACTACAAG CCCCATCTAG TTTGCCAACA LQAGVCR TNKQLP DNPRLAL 6001 CTACAAGCTG GTGTGTGTCG TACCAATAAG CAGTTGCCTG ACAACCCTCG TlTGGCllTG LSD TV PT SVQ FVL PG SS GT T 6061 CTTAGTGACA CTGTGCCAAC TTCTGTCCAG TITGTTKGC CTGGlTCAAG TGGTACCACA ICT KHLV PFC YLN HGCF TTG 6121 ATTTGCACTA AACATClTGT GCCGlllTGT TATCTTAATC ATGGlTGTlT TACAACGGGT GSC L P FG VSY VS D S FY Y G YY 61 81 GGTTCTTGTC TGCClTlTGG TGTTTCTTAT GllTCAGAlT CAllTTAlTA TGGGTAlTAT DAT PQIG STE SH DYVCDYLF 6241 GATGCAACAC CACAGATAGG TTCAACTGAG TCCCATGAlT ATGllTGTGA TTATCIlllT MEP GTYN AST VGK FLVY PTK 6301 ATGGAACCAG GCAClTATAA TGCATCTACT GlTGGTAAAT TTCTTGllTA TCCCACAAAG SYCMDTM NIT VPVQAVQ SIW 6361 TCATATTGTA TGGACACAAT GAATATAACA GlTCCAGlTC AAGCTGTACA GAGCATTTGG SEQYASD DAI GQA CKAP YC I 6421 TCAGAACAGT ACGCCTCTGA TGATGCAATA GGTCAGGCGT GTAAAGCACC ATACTGTATA FYN KTTP YTV TNG SDAN HGD 6481 TTTTATAATA AGACCACTCC ATATACAGTA ACCAATGGTT CTGATGCAAA TCATGGTGAT DEVRMMM QGLLRN SSCI SPQ 6541 GATGAGGlTA GAATGATGAT GCAGGGTCTT UGAGGAATT CATCCTGCAT TTCACCTCAA GST PLAL YS T EM1 Y EPN YGS 6601 GGTTCCACCC CAC'ITGCTCT TTAlTCAACT GAGATGATTT ATGAACCAAA lTATGGTTCT CPQ FYKL FDT SGN EN1 D VIS 6661 TGTCCACAGT TTATAAATT GTTTGATACA TCTGGCAATG AGAATATAGA TGTATTTCT SSY FVAT WVL LVV VVIL I FV 6721 TCTTCTTATT TTGTGGCTAC CTGGGTllTG TTGGTGGTGG ITGTTAW AATATITGTA MNSM LNP NAV PCQP S PQ 6841 AGAGCCAAGA TGAAlTCTAT GCTAATCCA AATGCTGTGC CATGTCAGCC GTCCCCTCAG >>> VV A I PMQ Y PS GFS PGFR RQR 6901 GTTGTCGCCA TACCTATGCA GTACCCATCT GG11111CTC CTGGATTCCG TAGACAACGT N P FR PM FN R R R N NNGN Q NR 6961 AACCCAGGTT TCGGCCTAT GTTTAATAGG CGGCGGAATA ATAATGGCAA TCAAAACCGT GRQNRQRVQN NNR GNIR NRQ 7021 GGCCGTCAAA ATCGGCAACG TGTTCAAAAT AATAATCGTG GCAACATTCG AAATCGTCAA NN G QRGN R RQYNQ PSPN VPF 7081 AATAACGGGC AACGCGGTAA TAGGCGCCAA TATAATCAGC CGTCCCCAAA TGTGCCTTTT EQQLLMM ANE TAY AATY PPE 7141 GAACAGCAAT TGCTGATGAT GGCAAATGAA ACCGCATACG CTGCAACCTA TCCACCAGAG MQN VAPT KLV KIA KRAA MQI 7201 ATGCAGAATG TTGCCCCCAC CAAATTGGTG AAAAlTGCCA AAAGAGCTGC AATGCAGATT VSG HATV E IS NGT EDSN K RV 7261 GTCTCCGGTC ATGCCACCGT TGAGATITCC AATGGCACTG AAGACTCTAA TAAGCGAGTC ATF TIKV VMN # 7321 GCTACCTfTA CGATTAAGGT GGTAATGAAT TAAAACCTTT TCAGCAACCT TGTGGlTGGT <<< 7381 CTGTAACTGA AATGCTTAGT GTATCAACA TGGCATAACT TGCCTCTGGC TCCACTGTGT 7441 GTAACCATCT AGAlllTAAT GGTITGCTA GATAGTATGG TTGAGTGTCT CCATGTAAGA 7501 TGlTATGTTA GTTAGAATTA GGCCTACCCC AGATGTAGTA AAAAGCAGCT Downstream from the BRV-1 envelope gene, a third ORF of 1251 nucleotides in length (nts 5551-6801) was identified. Nucleotide sequence analysis revealed that the 457 bases at the 3' end of this ORF exhibit 77% identity with the X pseudogene of BEV. However, there remain 794 bases upstream of this section that are not present in the BEV genome. Together, these 2 sections make up an ORF whose sequence is 99.9% identical to the hemagglutinin-esterase gene of BRV-2 (Cornelissen et a/., 1997). Interestingly, the positions of the termination codons of the BRV-1 and BRV-2 HE genes differ from that of the BEV X pseudogene by 7 nucleotides. However, the BEV X pseudogene contains a deletion in this area to maintain the reading frame. The BRV-1 ORF codes for a protein of 416 amino acids with the characteristics of a type I membrane glycoprotein: a 14 residue N-terminal signal sequence, a 24 residue C- terminal transmembrane anchor, and 7 potential N-glycosylation sites. The putative catalytic site of influenza C virus (ICV) and coronavirus acetylesterases, the F-G-D-S motif, is also consewed in this BRV-I HE homolog (Cornelissen et a/., 1997). The 3'-most ORF is 504 nucleotides in length (nts 6850-7353), and nucleotide sequence analysis revealed that it manifests 83% sequence identity to the BEV N gene. This ORF codes for a 167 residue polypeptide with a predicted molecular weight (Mr) of approximately 19.2K, which is consistent with the Mr of the BEV nucleocapsid protein. In addition, 2 clusters of basic amino acid residues are present in the N protein. Each of the 4 ORFs is preceded by a short conserved nucleotide sequence (U GIC UUUAG UIA) which probably represents a transcription initiation signal on the RNA that directs the synthesis of subgenomic mRNAs. With the exception of the 1.2 kb that make up the HE gene, the ORFs of the BRV-1 structural proteins manifested 80% nucleotide sequence identity to the BEV genome. Expression of the N gene The 504 nucleotide ORF of the N gene, cloned in frame downstream of the T7 promoter in the pET28a (+) cloning vector (figure 25), was expressed in BL21(DE3) cells following induction of the T7 RNA polymerase with IPTG. SDS-PAGE and immunoblot analysis revealed that the expressed N protein was located mainly in the insoluble cell fraction and could not be solubilized by cell lysis (fig. 29).The N protein from the insoluble pellet was purified and used to immunize young male guinea pigs. Pre- and post-immunization sera were collected and tested for N gene-specific reactivity. SDS-PAGE and immunoblotting When purified BTV and HTV preparations were analyzed by SDS-PAGE, bands with M,of 9, 20, 32, 35, 42, 66, and 75 K were detected for BlV as shown in Fig. 30a, and bands with Mr of 7, 18, 20, 32, 36, 66, 75 K were detected for HTV (Fig. 30b). The 20K bands correspond to the N protein equivalent of BEV (Snijder et a/., 1989). The guinea pig sera were tested for specific reactivity with these protein bands by immunoblot using 3 BTV-positive stool samples, 2 BTV-negative stool samples, 4 HlV positive stool specimens, and a purified BRV-1 N protein (insoluble fraction) positive control. The gpHlaN serum, but not the gpPlaN serum, was found to react specifically with the BTV-positive specimens (Fig. 30a), and cross-react with the HN-positive specimens (Fig. 30b). Neither of the sera reacted with the BW-negative specimens. The expressed N protein positive control reacted specifically with the gpHlaN serum. The purified N protein control was also tested for reactivity with 4 human acute/convalescent paired sera from patients whose stools were diagnosed positive for HWby EM, and bovine anti-BRV-I (baBRV-I), or bovine anti-BRV-2 (baBRV-2) pre- 153 Figure 29. (A) Coomassie blue-stained polyacrylarnide gel and (B) corresponding irnmunoblot of induced E. coli total cell culture (T), the soluble cell fraction (S), the insoluble cell fraction (I), and an uninduced control (U) using alkaline phosphatase- conjugated T7Tag antibody against the expressed BRV-1 N protein. Figure 30. Representative Coomassie blue-stained SDS-PAGE gels of torovirus- positive specimens and corresponding immunoblots using guinea pig anti-BRV-I N protein preimmune (gpPI) and hyperimmune (gpH1) sera and rabbit antiguinea pig antiserum for (A) purified bovine torovirus-negative (BRV -) and positive (BRV +) fecal specimens, and (B) a purified human torovirus-positive fecal specimen. (C) SDS-PAGE gel of purified BRV-I N protein control samples and corresponding immunoblots using gpPl and gpHl sera, human acute (huA) and convalescent (huC) paired sera, and bovine anti-BRV-I preimmune (bPI) and hyperimmune (bHI) sera. ~PPI PHI BRV- BRV+ BRV- BRV+ and post-immune sera from gnotobiotic calves infected with purified BRV. The N protein control reacted specifically with the baBRV-I post-immune serum, and the baBRV-2 post-immune serum, but not with the gpPlaN, the buBRV-I pre-immune serum or the baBRV-2 pre-immune serum. The expressed 20kDa N protein did not react with any of the human acute/convalescent paired sera tested (Fig. 30c). lmmunoelectron microscopy The guinea pig antiserum to the BRV-1 N protein was tested by IEM for reactivity with 5 purified BTV-positive preparations, 2 BTV-negative preparations, and a preparation containing bovine rotavirus. In all cases it was found that the gpHlaN serum caused the formation of viral aggregates when mixed with BTV-positive specimens, while no aggregates were demonstrated with the gpPlaN serum (Fig. 31). The gpHIaN serum specifically bound to broken BTV particles, but not to intact BWparticles. In addition, the gpPlaN and gpHlaN sera did not aggregate any particles in the BW- negative specimens, or the bovine rotavirus control. Dot Blot The reagents characterized above were used to design a dot blot system to detect virus in stool specimens. The guinea pig antisera were tested for immunoreactivity with a series of fecal specimens previously characterized as torovirus- positive and torovirus-negative by EM and RT-PCR in previously reported studies (Chapters 3 and 4: Duckmanton et a/., 1997 and 1998a). These consisted of 10 specimens positive for HTV, 20 specimens positive for BTV, 5 bovine rotavirus-positive samples, and 10 virus-negative specimens. Of the 20 specimens that were positive for Figure 31. lrnrnunoelectron microscopy of a purified bovine torovirus-positive preparation with (A) guinea pig anti-BRV-I N protein preirnmune serum and (B) guinea pig anti-BRV-I N protein hyperimmune serum. Bars = 100 nm. BW,19 were specifically reactive with the gpHlaN and not the gpPlaN serum. Eight of the 10 HW-positive samples showed cross-reactivity with the gpHlaN serum. None of the virus-negative specimens or rotavirus-positive specimens was reactive with either of the guinea pig sera. Figure 32 illustrates representative dot blots of 5 BTV-positive, 5 HTV-positive, 5 bovine rotavirus- positive, and 5 virus-negative specimens that were previously characterized by EM and RT-PCR (Chapters 3 and 4: Duckmanton et a/., 1997 and 1998a). Application of the dot blot assay as a diagnostic tool The dot blot assay developed in this study appeared to be a practical and specific test for determining the presence of toroviruses in fecal specimens. This assay was therefore evaluated as a diagnostic method for the detection of toroviruses from humans and cattle. A further number of stool specimens was examined for immunoreactivity with the gpPlaN and gpHIaN by dot blot analysis using specimens that had previously been examined by EM and RT-PCR (Chapters 3 and 4: Duckmanton et al., 1997 and 1998a). These consisted of 30 specimens positive for HlV, 30 specimens positive for BN, 15 bovine rotavirus-positive samples, and 15 bovine fecal specimens that were virus-negative. Of the 30 specimens that were positive for BTV, 28 (sensitivity 93%) were specifically reactive with the gpHlaN and not the gpPlaN serum (fig. 33). The 2 specimens that were not immunoreactive were both positive for bovine torovirus by EM and RT-PCR (Duckmanton et a/., 1998a). Of the 30 HTV-positive samples, 28 (sensitivity 93%) showed cross-reactivity with the gpHlaN serum not the gpPlaN serum. Five of the 15 rotavirus-positive specimens (specificity 67%) and 3 of the 15 virus- Figure 32. Representative dot blot of 5 bovine torovirus-positive (BRV+), 5 human torovirus-positive (HlV+), 5 bovine virus-negative (NEG), and 5 bovine rotavirus- positive (ROTA) fecal specimens using guinea pig anti-BRV-I N protein preimmune (gpPI) and hyperimmune (gpHI) sera and rabbit anti-guinea pig antiserum. Figure 33. Dot blot of 30 bovine torovirus-positive (BlV+), 30 human torovirus-positive (HW+),1 5 bovine rotavirus-positive (ROTA), and 15 bovine virus-negative (NEG) fecal specimens using guinea pig anti-BRV-I N protein preimmune (gpPI) and hyperimmune (gpHI) sera and rabbit anti-guinea pig antiserum. BTV + HTV + ROTA NEG negative specimens (specificity 80%) were found to be reactive with the gpHlaN. However, these also showed some reactivity with the gpPlaN serum (fig. 33). Upon analysis, it was found that 2 of the 5 rotavirus-positive specimens that were immunoreactive in this assay, were previously shown to contain torovirus by EM and RT-PCR (Chapter 4: Duckmanton et a/., t998a). The remaining 6 control specimens that were reactive with the gpHlaN serum were not tested by RT-PCR for the presence of torovirus, and as such may contain low levels of torovirus or represent a co-infection with rotavirus. DISCUSSION In this study, long RT-PCR has been used successfully to amplify 7.5kb upstream from the 3' end of the BRV-1 genome. This method has been used previously to amplify the full-length or nearly full-length genomes of hepatitis A virus, and hepatitis C virus (Tellier et a/., 1996a, b). Sequence analysis of the BRV-I amplicon revealed the presence of 4 ORFs that bear strong sequence similarities to corresponding ORFs of BEV, and have the capacity to code for all of the viral structural proteins. Sequencing the amplicon directly is advantageous since it immediately yields the consensus sequence and RNA viruses are typically quasispecies (Holland et a/.. 1992), and cloning of long viral sequences may lead to the selection of defective clones if the viral sequence is toxic to E. coli (Forns et a/., 1997). The torovirus peplomer protein is considered to be involved in viral infectivity (Snijder et a/., 1WOc), and has been shown to be recognized by neutralizing antibodies (Horzinek et a/.. 1986). The nucleotide sequence of the S gene and its corresponding amino acid sequence are highly conserved, especially in the C-terminal half of the protein. The BRV-1 peplorner protein displays the characteristics of a type I membrane glycoprotein, and as such is potentially variably N-glywsylated. The presence of a cleavage site for a trypsin-like protease indicates that the S protein may be subject to post-translational cleavage during viral replication. As has been predicted for BEV (Snijder et a/., 1990~)~cleavage between amino acids 1003 and 1007 (fig. 28) may generate a precursor to the mature S protein. Host-dependent cleavage by a trypsin-like protease has been known to occur during the maturation of membrane proteins in a number of virus families including BEV (Cavanagh eta/., 1986, Snijder et a/., l99Oc). The presence of 2 heptad repeats in the amino acid sequence of the S protein is indicative of a wiled-coil protein structure. In this conformation, a-helical domains are stabilized by the interaction of regularly spaced hydrophobic residues that form the interface between 2 a-helices (Cohen and Parry, 1986). As for the S proteins of BEV and coronavirus, the 2 heptad repeats of BRV-I are unequal in length. It has been proposed that the major heptad repeat may be involved in the generation of the intra- chain coiled-coil secondary structure of the S protein, as well as inter-chain interactions that can play a role in S protein oligornerization (Snijder et a/., 1990~;Cavanagh, 1983, DeGroot etal., 1987). Such interactions may stabilize the elongated BRV-I S protein in its spike configuration. BEV and coronaviruses are intracellularly budding RNA viruses whose maturation is thought to be governed by specific properties of their envelope proteins (Den Boon et a/., 1991b). The BRV-1 M protein shows several similarities to the envelope proteins of BEV and coronaviruses (Den Boon et a/., 1991b, Armstrong et a/., 1984). It is a class Ill membrane protein with 3 membrane-spanning domains in its N- terminus. Thus, the BRV-1 envelope protein, like that of BEV, may be essential for viral assembly. It has been previously suggested that the predicted amino acid sequence of the BEV X pseudogene shows a striking similarity to the 3' ends of the coronavirus HE protein and the HE-I subunit of ICV (Snijder et al., 1991). Furthermore, the BRV-2 HE gene was found to manifest 30% amino acid sequence identity with the HE proteins of both coronavirus and ICV. The BRV-2 HE protein was shown to be a 65 kDa glycoprotein that displays acetylesterase activity. Serological evidence indicated that the HE protein is expressed during a natural toroviral infection and represents a prominent antigen (Cornelissen et al., 1997). The nucleotide sequence of the BRV-1 HE gene shown in this study is 99.9% identical to that of the BRV-2 HE gene (Cornelissen et a/., 1997), and the predicted amino acid sequences of these genes are identical. Hence, the BRV-1 HE displays the properties of an N-glycosylated protein, and may also possess acetylesterase activity since it contains the putative F-G-D-S acetylesterase catalytic site that is conserved among the HE proteins of coronaviruses, ICV, and BRV-2. This HE gene homolog has also been found to be present in the HlV genome (Chapter 6: Duckmanton et a/, 1998~).Thus, to date, BEV is the only torovirus that was not found to contain the HE gene. It has been suggested that BEV lost the 5'-most portion of its HE gene during tissue culture adaptation (Snijder eta/., 1991). Hence, the HE gene may be present in the natural BEV virion, and may play a role in viral infectivity in its natural host. The nucleotide sequence and predicted amino acid sequence of the BRV-1 N protein also closely resemble those of BEV. The amino acid sequence of the BRV-1 N protein contains 2 clusters of basic amino acid residues, which are also present in the BEV sequence. These may play a role in the binding of nucleic acid during assembly of 168 the torovirion (Snijder et a/., 1989). In addition, the 3' non-coding region of the BRV genome was found to be conserved among the toroviruses (Koopmans et a/., 1991a; Chapter 3: Duckmanton et a/., 1997). It has been proposed that part of this non-coding sequence, excluding the poly (A) tail, may likely play a role in the initiation of negative- strand RNA synthesis during viral transcription. Computer analysis of this region of the torovirus genome revealed the presence of a large stem-loop secondary structure that may serve as 1 of the recognition signals involved in negative-strand RNA synthesis (Snijder et a/., 1989). The BRV-1 N protein was a good candidate for expression because its amino acid sequence is highly conserved among the tomvirus species. Thus, using the expressed N protein to develop guinea pig antisera allowed us to study the degree of immune cross-reactivity between the toroviruses. By immunoblot, the gpHlaN serum reacted specifically with a 20kDa protein in the BW-positive fecal specimens. The size of this protein corresponds to the predicted molecular weight of the BRV-1 and BEV nucleocapsid proteins. The gpHlaN senrm also reacted specifically with the HTV-positive specimens, demonstrating cross-reactivity of the serum among torovirus species. This suggests a high degree of sequence identity between the HTV and BTV N genes, which is consistent with our previous obsewation that the nucleotide sequence in the 3' end of the HTV genome, encompassing a portion of the N gene, has been shown to be 92% identical to the BRV-1 sequence in the corresponding region of the genome (Chapter 3: Duckmanton et a/., 1997, Koopmans et a/., 1991a). Cross-reactivity between torovirus species has previously been demonstrated. BEV preparations were found to react with bovine convalescent sera by IEM (Beards et a/., 1986), and positive reactions were noted between BRV antigens and BEV antibodies by immunofluorescence microscopy 169 assays (IFA), ELISA, and IEM (Weiss and Horzinek, 1987; Beards et a/., 1986). In addition, HTV particles were found to be coated and aggregated by calf sera containing antibodies to BRV (Beards et a/., 1986). Lastly, human stool specimens documented to contain HTV particles by electron microscopy were also shown to be reactive in a torovirus-specific ELISA based on BRV antiserum (Koopmans et a/., 1993). It is surprising to note that no cross-reactivity of the BRV-1 N protein control could be demonstrated with the human convalescent sera, even though these sera were previously shown to react with torovirus-positive human fecal specimens by HI and IEM (Chapter 3: Duckmanton et a/., 1997). However, this result is consistent with immunoblot analyses done previously using these human acute/convalescent paired sera, in which the convalescent serum was only found to react specifically with a 75- 90kD band representing the peplomer protein (Chapter 3: Duckmanton et a/., 1997). This suggests that, following a torovirus infection, the major immune response in humans is to the torovirus peplomer protein (and possibly the HE protein) and not to other structural proteins such as the nucleocapsid. This type of selective response has also been demonstrated in the coronaviruses, and appears to be specific to surface proteins that are responsible for eliciting neutralizing antibodies during infection (Battaglia et a/., 1987, Schmidt and Kenny, 1981). By IEM, the gpHlaN serum was shown to aggregate broken BRV-1 particles but not intact particles. This is consistent with the fact that the nucleocapsid protein is internal to the virion, and only broken particles whose nucleocapsid protein is exposed would be reactive in this assay. These observations support previously reported concepts of torovirus structure and the location of the N protein veiss et a/., 1983, Snijder et a/.,1989). Lastly, dot blot analysis demonstrated that the gpHlaN serum reacted specifically with clarified BN-positive fecal specimens, and HTV-positive specimens, but not with virus-negative controls or rotavirus-positive specimens. As shown by EM and IEM, many BRV-I particles in stool samples are broken and their nucleocapsids exposed. Thus, once these agents are bound to a nylon membrane, it is possible to specifically detect them using designated antisera. The speed and facility of the dot blot assay highlights its great potential as a practical immunospecific method for the diagnosis of bovine torovirus in veterinary practice. The strong cross-reactivity of the serum with HTV-positive specimens demonstrated by immunoblot and by this assay suggests that the dot blot may also be useful for the diagnosis of torovirus in human populations. Chapter 6 The novel hemagglutinin-esterase genes of human torovirus and Breda virus Duckmanton, L., Tellier, R., Richardson, C., and Petric, M. (1998) Vinrs Res.: submitted October 1998. SUMMARY The hemagglutinin-esterase (HE) gene of Breda virus serotype 2 (BRV-2) was identified by Cornelissen et a/. (1997). The nucleotide sequence of this gene was 77% identical to the X pseudogene of the torovirus prototype, Berne virus (BEV), and the amino acid sequence of the HE protein had 30% identity with the HE proteins of coronaviruses and influenza C virus (ICV). The nucleotide sequence for 7.5kb at the 3' end of the BRV serotype I(BRV-1) genome which contains the open reading frames for the viral structural proteins is described in chapter 5 of this thesis and revealed the presence of a 1.2kb gene whose nucleotide sequence is 99.9% identical to that of the BRV-2 HE gene. Given that the HE gene is present, or partially present, in both BRV and BEV it was of interest to determine whether the HE gene is also present in human torovirus (HTV). In this study, the 1.2kb HE gene was amplified from the HTV genome using long RT-PCR and sequenced the amplicon directly. At the nucleotide level, the HTV HE gene manifests 85% sequence identity to the HE genes of BRV-7 and BRV-2 and 89% sequence identity with BEV. The 1.2kb amplicons which contained the HE genes of BRV-1 and HTV were cloned and expressed in a baculovirus system and the resulting proteins were purified by SDS-PAGE and used to immunize guinea pigs. Hyperimmune sera were found to be reactive with both bovine torovirus (BTV) and HTV antigens. By irnmunoblot, the guinea pig anti-BRV-1 HE hyperimmune serum (gpHlaBRV) and the guinea pig anti-HTV HE hyperimmune serum (gpHlaHfV) reacted specifically with a 65- 66kDa protein corresponding in size to the torovirus HE protein. Furthermore, the hyperimmune sera and not the preimmune sera reacted with a series of BTV-positive and HTWpositive fecal specimens by immunoblot and dot blot analysis. By immunoelectron microscopy (IEM) using BTV-positive specimens from calves with diarrhea and HW-positive specimens from patients with gastroenteritis, the gpHlaBRV and gpHl~HlVsera and not the preimmune sera were shown to aggregate torovirus particles. INTRODUCTION The genes for the structural proteins of BRV-I were recently characterized usin long RT-PCR and sequencing (Chapter 5: Duckmanton et al., 1998b). Sequence analysis revealed the presence of an open reading frame (ORF) for a 1.2kb hemagglutinin-esterase gene that displayed 99.9% nucleotide sequence identity to the HE gene of BRV-2 (Cornelissen eta/., 1997). In addition, sequence at the 3' end of this gene was shown to be 77% identical to the X pseudogene of BEV (Snijder et a/., 1991). However, limited sequence data was available for the HTV genome, specifically, only the nucleotide sequence encompassing the 3' non-coding region and the 3' terminus of the nucleocapsid gene (Chapter 3: Duckmanton et a/., 1997). Thus, the aims of this study were to determine whether the HE gene is present in the tm/ genome, and if it is present, to express the BRV-1 and HTV hemagglutinin-esterase proteins, and investigate them for their immunospecific properties. MATERIALS AND METHODS Specimens and sera Stool specimens demonstrated by EM to contain human torovirus, or human rotavirus, or to be free of detectable virus particles; acute/convalescent paired sera from patients diagnosed positive for hurnan torovirus; bovine torovirus-positive fecal specimens from diarrheic calves, control specimens from asymptomatic calves, and rotavirus-positive specimens from diarrheic calves; a stool specimen from a gnotobiotic calf infected with a purified preparation of the Breda virus4 (code GC-32); and antisera to BRV-'1 (baBRV-I) from experimentally infected calves were obtained as described in chapters 3,4 and 5 of this thesis. RNA extraction RNA was extracted from fecal specimens as described previously in chapter 3 of this thesis. Each RNA pellet was resuspended in lop1 of DNase-free, RNase-free double distilled water (5 prime 3 prime Inc., Boulder, CO) containing 10% 100 mM dithiothreitol, and 5% (vlv) 20-40UIpI RNasin (Promega, Madison, WI). Aliquots of RNA . were stored at -80 OC. Primers Oligonucleotide primers used to amplify the 7.5kb fragment of the BRV-1 genome including the HE gene were described in chapter 5 of this thesis (Duckmanton et a/., 1998b). These primers were used in expression studies to amplify a 1.2kb fragment containing the ORF of the BRV-1 HE gene. The primers contained Nhel restriction sites for cloning purposes. Oligonucleotide primers (ACGT Corp., Toronto, Canada) used to amplify the HTV HE gene were deduced from the sequence of the BRV-1 HE gene shown in chapter 5 of this thesis (Genbank accession no. AF082169). The sense primer (5' TCTAGTGTTAAGTTTGAGTAGCACTTATCTC 3') and the antisense primer (5' GACATGGCACAGCATTGGATTAAGCATAG 3') bracketed a genome fragment of approximately 1.4kb. Oligonucleotide primers (ACGT Corp.) used to specifically amplify the I.2kb fragment containing the ORF of the HTV HE gene for expression studies were designed based on the sequence of the HTV HE gene obtained in this study. The sense primer (5' GGCGTGCTAG CATGCTGAGT TTAATACTIT TITTCCATC TlTGCCTTT GCAGTS'), designed in the 5' end of the HTV HE gene ORF, contained a Nhel restriction site (underlined) upstream of the start codon for cloning purposes. The antisense primer (5' GATCCGCTAG GACAAAAAAA ACTTATATT ACAAATATA AAATAACAAC CACCACC 3'), designed in the 3' end of the HE gene ORF, did not contain a stop codon and had a Nhel restriction site in its place. Long RT-PCR The RT and PCR reactions were performed as outlined in chapter 5 of this thesis. The following cycling parameters were used to initially amplify the 1.2kb HTV HE gene, as well as to amplify the ORFs of the HTV and BRV-1 HE genes for cloning: denaturation at 9g°C for 35 seconds, annealing at 67OC for 30 seconds, and elongation at 68OC for 5 minutes for 35 cycles. Reactions were analyzed by electrophoresis on a 1% agarose gel, subsequentfy stained with ethidium bromide, and viewed under an UV transilluminator When excising DNA from the gels, shielding from UV was provided by illuminating the gel tray through 2 plexiglas trays to minimize photo nicking. DNA sequencing PCR products were excised from agarose gels, and purified using the Jetsorb system (Genomed, Frederick, MD) according to the manufacturer's recommendations. Purified amplicans were then sequenced directly and analyzed as described previously in chapter 5 of this thesis. Cloning and expression PCR products containing the HlV and BRV-1 HE genes were purified using the Jetsorb system (Genorned) according to the manufacturer's recommendations. Arnpficons were cut with Nhel and then ligated to dephosphorylated pETL-EK (His) 6 baculovirus transfer vectors (fig. 34), and transformed into Epicurian coliXL1-blue MRF' supercompetent cells (pCR-Script Amp SK+ cloning kit; Stratagene) as per the manufacturer's recommendations. Plasmids containing the PCR inserts were purified from LB broth cultures using the Wizard Miniprep DNA Purification System (Promega), and any remaining resin was removed by a standard phenol:chloroform extraction (Sambrook et a/., 1989). Positive clones as identified by RT-PCR were sequenced using the fmol DNA sequencing system (Promega) as described previously. Purified clones whose inserts were intact and in frame with the His*tag sequence were introduced into Spodoptera fmgiperda 9 (Sf9) insect cells using the BaculoGold transfection system (PharMingen Canada, Mississauga, Ontario) as per the manufacturer's recommendations (fig.35). The BaculoGold baculovirus DNA is linearized, contains a lethal deletion (essential 1629 gene), and thus does not code for viable virus. Recombination between homologous sequences between the transfer vector and the linearized DNA will generate a circular baculovirus genome which is infectious and which contains the torovirus HE gene. Supernatants from the transkcted cells, harvested upon evidence of CPE, that contained the recombinant baculovirus were serially diluted and used to infect Sf9 cells which were overlaid with 1% Seaplaque agarose (FMC BioProducts, Rockland, ME) in serum-free Grace's medium containing 250 pglrnl Bluo-Gal (Gibco BRL), and incubated at 27% for 1 week. Plugs of agarose containing cells and virus from single blue plaques Figure 34. Diagram of the pETL-EK (His) 6 baculovirus vector. PP: polyhedrin promoter, PH: polyhedrin gene, lac 2: lac Z gene, ETL: early promoter, pSP72: backbone from the bacterial shuttle plasmid. The His*tag (H)is shown in red. Adapted from drawing by C. Richardson, Princess Margaret Hospital, Toronto, Canada. NheI m(-I pETL-EK (Ris) 6 (10316 bp) EK (HIS) 6 Tag: NheI DLYDDDDKHH H H CGT-GO CT-AGC-GAT-CTG-TAC-GAC-GAT-GAC-GAT-AAG-CATCAT-CAT- HHH CAT-CAT-CAT-TAG Figure 35. Generation of recombinant baculovirus carrying the HE gene of torovirus using the pETL-EK (His) 6 baculovirus transfer vector and BaculoGold baculovirus DNA. Lac 2: lac Z gene, ETL: early promoter, PP: polyhedrin promoter, PH: polyhedrin gene. Linearized BaculoGo ld baculovirus DNA Recombinant Transfer vector Transform XL 1- Blue cells Select recombinant \ Co-transfection / plasmids Sequence Homo logous SB cell recombination I Lac Z HE gene Amplification and -Plaque Assay were incubated in 100 pl serum-free Grace's media overnight at 27OC to elute recombinant virus. The media were then centrifuged at 3000 g for 5 min to pellet the cells. Viral DNA was extracted from a sample of the supernatants using the DNAzol system (Gibco BRL) according to the manufacturer's recommendations, and tested for the presence of the HE gene by PCR as described above. Virus from clones that contained the HE gene was then passaged twice in Sf9 cells to a final titre of 2x10~ PFUfml. The infected cells were pelleted as described above, ruptured by freezing and thawing 4 successive times in a dry ice and ethanol bath, sonicated with a microtip to shear the DNA, and mixed with 100pl of 6x SDS sample buffer. Proteins from the cell lysates were then separated by SDS-PAGE on a 12% resolving and 4% stacking gel and transferred electrophoretically to a polyvinylidene fluoride (PVDF) nylon membrane (Millipore, Bedford, MA) for 90 min at 100 V. The membranes were washed with Tris- buffered saline containing 0.5% Tween-20 (TBST) and blocked overnight in a solution of 5% skim milk in TBST. The membranes were then incubated for 1 h at room temperature in a tl000 dilution of mouse-Hisrag Antibody (Babco, Richmond, CA) in TBST. The membranes were washed with TBST and incubated for 2 h at room temperature in a 12000 dilution of horseradish peroxidase-conjugated goat anti-mouse IgG in TBST. The membranes were washed with TBST and soaked in a 50 mM TBS solution containing 10% 4-chloro-I-naphthol in methanol and 0.025% hydrogen peroxide. Color development at room temperature was complete within 5 to 10 min. Preparation of antisera to the HE proteins of BRV-I and HTV in guinea pigs The cell slurries (2 ml) containing the expressed HE proteins of BRV-1 or HTV were resuspended in 6x SDS sample buffer and subjected to preparative SDS-PAGE on a 12% resolving gel and a 4% stacking gel. The gel was stained with Coomassie brilliant blue R250. The bands corresponding to the 65kDa HE proteins of each virus were excised and soaked in distilled water for 2 hours to remove residual destaining solution. The bands were cut into small pieces, resuspended in 0.5 ml of distilled water, and mixed t1with Freund's incomplete adjuvant. A pair of young adult male guinea pigs from whom preimmunization sera were collected, were inoculated subcutaneously with the protein mixture of each respective virus once a week for 4 successive weeks, following which they were exsanguinated. Pre- and post-immunization sera to the BRV- 1 and HTV HE proteins were designated gpPlaBRV, gpHlaBRV, and gpPlaHTV, gpHlaHTV, respectively. The sera were heat inactivated at 56OC for 30 rnin and used for HI, IEM, and dot blot assays as described in chapters 3 and 5 of this thesis. SDS-PAGE and immunoblotting Bovine and human stool specimens that were partially purified by differential centrifugation and positive control cells containing either BRV-I or HNHE proteins were subjected to immunoblot analysis using the above guinea pig sera. Following SDS-PAGE,proteins were transferred electrophoretically to a nylon membrane, and blocked as described above. Membranes were incubated for 2 h at room temperature in t2000 dilutions of either gpPIaBRV, gpHlaBRV, gpPlaHTV, or gpHlaHW sera in 1% skim milk in TBST. The membranes were washed and incubated for 1 h at room temperature in a 1:3000 dilution of alkaline phosphatase conjugated-rabbit antiguinea pig IgG (RaGP;Sigma Chemicals, St. Louis, MO) in I%skim milk in TBST. HE proteins control samples were also tested for reactivity with' 12 human acute/convalescent paired sera from patients whose stools were diagnosed positive for HTV by EM as described previously (Duckmanton et a/, 1997), and baBRV-I pre- and post-immune sera from a gnotobiotic calf infected with purified BRV-1. Primary sera were used at dilutions of I:2000 followed by I:3000 dilutions of either alkaline phosphatase conjugated-murine anti-human IgG, or alkaline phosphatase conjugated-goat anti-bovine IgG, respectively (Sigma Chemicals). Following further washing, the membranes were developed using a 5-bromo-4-chlaro-3-indolyl p hosphatenitro blue tetrazolium (BC1 P-NBT; SigmaFAST, Sigma Chemicals) dissolved in 10 rnl of water. Wemagglutination inhibition The hemagglutination inhibition assay was performed as described previously in chapter 3 of this thesis. lmmunoelectron microscopy lmmunoelectron microscopy was performed as previously described in chapter 3 of this thesis. Dot Blot Human and calf stool specimens positive by EM for HTV, BTV, and rotavirus, as well as negative control stools were examined for immunoreactivity with the gpPlaBRV, gpHlaBRV, and gpPlaHTV, gpHlaHTV sera by dot blot analysis as described in chapter 5 of this thesis. Blotted membranes were incubated for Ih at room temperature in 1:I000 dilutions of either guinea pig anti-BRV antisera, or guinea pig anti-HTV antisera in 1% skim milk in TBST. The membranes were washed with TBST and incubated for 45 min at room temperature in a 1:3000 dilution of alkaline phosphatase conjugated- RaGP (Sigma Chemicals) in 1% skim milk in TBST. Following further washing, the membranes were developed using BCIP-NBT (Sigma Chemicals) as described above. RESULTS Long RT-PCR and sequencing of the BRV-I and HTV HE genes As described in chapter 5 of this thesis, a 7.5 kb fragment including the BRV-1 HE gene was amplified by long RT-PCR and sequenced. The gene contained an ORF of 1251 nucleotides that codes for a protein of 416 amino acids with the characteristics of a type I membrane glycoprotein. The nucleotide sequence of the BRV-1 HE gene was shown to be 75% identical to the X pseudogene of BEV, and 99.9% identical to the HE gene of BRV-2 (Cornelissen et a/., 1997). Using primers designed from the genome sequence of the BRV-1 HE gene, an amplicon of 1371 bases was amplified from HTV RNA (fig. 36). The amplicon was excised from an agarose gel, purified, and used directly for sequencing. Sequence analysis revealed that the HE gene of HlV contains an ORF of 1251 nts in length, whose nucleotide sequence is 85% identical to that of the BRV-I HE gene (fig. 37), and 89% identical to the X pseudogene of BEV. This ORF codes for a polypeptide of 416 amino acids which contains domains typical of type I membrane glycoproteins: a 14 residue N-terminal signal sequence, a 24 residue C-terminal transmembrane anchor, and 8 potential N-glycosylation sites. Also present in the HTV HE gene is the putative catalytic site of ICV and coronavirus acetylesterases, the F-G-D-S- motif. As with most 185 Figure 36. Gel electrophoresis of product amplified by long RT-PCR using a serial dilution (lanes 1 to 3: lo-' to loa) of RNA extracted from a human torovirus-positive fecal specimen and primers specific for the torovirus hemagglutinin-esterase gene based on the BRV-1 genome. Lane marked N represents a negative control (ddH20). Lambda Hindlll (23.1-0.56kb) was used as the molecular size marker. Figure 37. Alignment of the nucleotide sequence of the HTV hemagglutinin-esterase gene with that of BRV-1. Identical nucleotides are shown as dots (full nucleotide sequence of BRV-1 HE gene shown in figure 28). The predicted amino acid sequence of the BRV-1 HE protein is also shown, and initiation (>=) and termination (<-) codons are underlined. MLS LILF F'PS FAF AATP VTP YYG PGHI TFD brv ...-.-...... I-----.-" --0------..-...... htv---.-.-.-- ...... -A.T.----- ...... ----T------TT-T------.A..,A.. >** SSK SSSS MFL SLH WNNH SSF VSY DYFN CGV EKV FYEG VNF SFR KQYS CWD EG.V DGWI ELK FVL PGSS G5PT ICT K':HLV PFC YLN HGCF TTG GSC LPFG VSY VSD SFYY G'YY DA'T FQIG. STE bm: ...... ~...... h~ A..AGC.o.- CA.-----.- .-.....-...... -----A-... -..--T-A- ...... -.T .C..... -*T.G--.-* DEV.RMMM QGL LRN .S.SCI SPQ GST PLAL YST SSY FVAT WVL LVV VVIL IFVeIIS F.FC.8 bm ...... hm -....'C-..- ...... T...... 4u4 of the ORFs in the genomes of BEV, BRV-1 and BRV-2, the ORF for the HTV HE gene is preceded by a short conserved nucleotide sequence (UUAGA) which is thought to represent part of a transcription initiation signal on the RNA that directs the synthesis of subgenomic mRNAs (Snijder eta/., 1990, Cornelissen eta/.,1997). Expression of the BRV-1 and HTV HE genes The HE proteins of BRV-1 and HTV were expressed using a baculovirus system, and their immunospecific properties were investigated. Sf9 cells infected with the recombinant baculovirus containing the HE genes of BRV-I and HWwere subjected to immunoblotting with pre- and post-immune sera from calves infected with BRV-1. Analysis of both cells and supernatants revealed that the expressed HE proteins (Mr 65K) were located inside the Sf9 cells, and were not secreted into the medium. The HE proteins were thus extracted from cell pellets and purified by SDS-PAGE before using them to immunize the guinea pigs. Immunospecific analyses As described in chapter 5 of this thesis, SDS-PAGEanalysis of partially purified BTV and HlV preparations revealed bands with Mr of 9, 32, 35, 42,45, 50, 53, 54, 60, and 65K for BTV (fig. 38a) and bands with Mr of 7, 20, 32, 36, and 65K for HW (fig. 38c). The bands at 65 K correspond in size to the HE protein equivalent of BRV-2 that was shown to have an approximate Mr of 65K in its glycosylated form (Cornelissen ef a/., 1997). The guinea pig sera were tested for their reactivity by irnmunoblot assay with virus proteins from 3 BN-positive stool samples and 1 BTV-negative control, 3 HTV- positive stool specimens and 1 HTV-negative control, and cell extracts from Sf9 cells 190 Figure 38. lmmunoblots of partially purified bovine torovirus-positive (BlV+), human torovirus-positive (HTV+), bovine torovirus-negative (Bn/-), and human torovirus- negative (HTV-) fecal specimens using A) guinea pig anti-BRV-l HE protein hyperimmune serum, 8) guinea pig anti-BRV-1 HE protein preimmune serum, C) guinea pig anti-HTV HE protein hyperimmune serum, and D) guinea pig anti-HW HE protein preimmune serum with rabbit anti-guinea pig antiserum. Shown in panels A) and C) are Coomassie blue-stained polyacrylamide gels of a BTV+ fecal specimen and a HlV+ fecal specimen, respectively. infected with the recombinant baculoviruses. The gpHlaBRV and gpHlaHTV sera reacted with the HE proteins in all of the BTV-positive (fig. 38a) and HTV-positive fecal specimens (fig. 38c) but not with the virus-negative controls. No reactivity was observed with either of the guinea pig preimmune sera (fig. 38b and d). The gpHlaBRV and gpHlaHnl sera, as well as the baBRV-I post-immune serum, and alt 12 human convalescent sera from patients diagnosed positive for HTV reacted by immunoblot with the 65K band from Sf9 cells infected with either BRV-1 or HWrecombinant baculovirus (fig. 39). No reactivity was seen with either of the guinea pig pre-immune sera, the baBRV-I pre-immune serum, or the human acute sera. Hernagglutination Inhibition A panel of sera including human acute (huA) and convalescent (huC) paired sera, gpPlaBRV and gpHlaBRV sera, gpPlaHTV and gpHlaHnl sera, and guinea pig anti-BRV-I N protein preimmune (gpPlaN) and hyperimmune (gpHlaN) sera were tested for their ability to inhibit the hemagglutination of rabbit erythrocytes by a purified HW preparation. Hemagglutination inhibition was demonstrated with the gpHluBRV and gpHlaHTV sera, as well as with the human convalescent serum. These sera manifested 8-fold or greater antibody rises compared to the acute sera (table 10). The gpHlaN serum and all of the guinea pig preimmune sera showed negligible Hi activity. lmmunoelectron microscopy The gpPlaBRV and gpHlaBRV antisera, or the gpPlaHW and gpHIaH'N antisera were also tested by IEM for reactivity with 3 BTWpositive preparations, 3 HW- positive samples, and control specimens including a purified human rotavirus-positive Figure 39. Representative Coomassie blue-stained polyacrylarnide gels of (A) a clarified BRV-1 HE protein control sample from BRV-1 recombinant baculovirus and (B) a clarified HNHE protein control sample from HTV recombinant baculovirus with corresponding immunoblots using guinea pig anti-BRV-I HE protein preimrnune and hyperimmune sera (gpPluBRV and gpHlaBRV), guinea pig anti-HW HE protein preirnmune and hyperimmune sera (gpPlaHTV and gpHlaHlV), human acute (huA) and convalescent (huC) paired sera, and bovine anti-BRV-I preimmune (bPf) and hyperimmune (bHI) sera. Table 10. HI results for a human torovirus-positive fecal specimen using guinea pig anti-BRV-1 N protein preimmune (gpPlaN) and hyperimmune (g pHlaN) sera, human acute (huA) and convalescent (huC) paired sera, and guinea pig pre- and hyperimmune antisera to the BRV-1 (gpPlaBRV and gpHlaBRV), and HTV (gpPlaHTV and gpHlaHn/) HE proteins. * A LGfdd or more increase in titre between acute and convalescent sera is considered to be a positive HI result Figure 40. Representative immunoelectron micrograph of a purified human torovirus- positive preparation with (A) guinea pig anti-HN HE protein preimmune serum and (B) guinea pig anti-HTV HE protein hyperimmune serum. Bars =I00 nm. sample, a purified bovine rotavirus-positive sample, a human virus-negative sample, and a purified sample from a calf with diarrhea in which no viruses could be detected by EM. Viral aggregates were observed in ail preparations containing the gpHlaBFW serum mixed with the BTVIpositive and the HN-positive specimens (fig. 40). No aggregates were demonstrated with the gpPlaBRV serum. Likewise, viral aggregates were observed in preparations of gpHlaHTV serum mixed with the BWpositive and HTV-positive specimens, but aggregates were smaller and less frequent than with the gpHla6RV serum. No aggregates were observed when the gpPlaHTV serum was mixed with BTV- or HTV-positive specimens. None of the guinea pig sera formed aggregates with any of the control specimens. Dot Blot The above pre- and post-immune sera to the HE proteins of BRV-1 and HTV were applied to the detection of virus in stool specimens using a dot blot system. Fecal specimens used in this system had been previously characterized as torovirus-positive or negative by EM and RT-PCR (Chapters 3 and 4: Duckmanton ef al., 1997 and 1998a), and consisted of 10 HN-positive, 10 8 N-positive, 5 human rotavirus-positive, 5 bovine rotavirus-positive, 5 human virus-negative, and 5 bovine vi rus-negative fecal specimens. All of the 10 specimens that were positive for BTV were specifically reactive with the gpHlaBRV and not the gpPlaBRV serum, and 8 were specifically reactive with the gpHlaHTV and not the gpPlaHTV serum. All of the 10 HTV-positive samples were reactive with the gpHlaBRV serum and 9 reacted with the gpHlaHTV serum. The HTV- positive and BN-positive specimens did not react with either of the guinea pig preimmune sera. In addition, none of the virus-negative specimens or rotavirus-positive Figure 41. Representative dot blot of 5 human torovirus-positive (HN+),5 bovine torovirus-positive (BTV+), 5 human rotavirus-positive (HRoV+), 5 bovine rotavirus- positive (BRoV+), 5 human virus-negative (HV-), and 5 bovine virus-negative (BV-) fecal specimens using guinea pig anti-BRV-I HE protein preimmune and hyperimrnune sera (gpPlaBRV and gpHlaSRV), and guinea pig anti-HTV HE protein preimmune and hyperimrnune sera (gpPlaHTV and gpHlaHTV). specimens were reactive with any of the guinea pig sera. Figure 41 illustrates representative dot blots of 5 BW-positive, 5 HW-posi tive, 5 bovine rotavirus-positive, 5 human rotavirus-positive, 5 bovine virus-negative and 5 human virus-negative specimens using the guinea pig preirnmune and hyperirnmune antisera to either the BRV-I or HWHE proteins. DISCUSSION The existence of recombination in RNA virus evolution is exemplified by the presence of hemaggiutinin-esterase genes in some coronavirus and torovirus species. The coronavirus and BRV HE proteins are 65kDa class I membrane proteins that share 30-35% amino acid identity with the HE-1 subunit of the HE fusion protein (HEF) of influenza C virus (10. However, the fact that the HE genes of coronaviruses and toroviruses are located at different positions in their genomes suggests that these viruses acquired their HE genes through separate heterologous RNA recombination events (Snijder et a/., 1991). Although the origin of the torovirus HE gene is unknown, it has been speculated that coronaviruses captured their HE module from ICV or a related virus during a mixed infection (Luytjes et a/., 1988). In ICV and coronaviruses, the HE protein displays acetylesterase activity specific for N-acetyl-9-O-acetylneuraminic acid, and the ICV HEF has been shown to serve as both a receptor-binding and receptordestroying protein during viral entry (Herder et a/.,1988, Vlasak ef a/., 1987). Although receptor binding and membrane fusion in coronaviruses has been shown to be mediated by the S protein (Cavanagh, 1995), it has been suggested that the coronavirus HE may serve as an additional membrane- binding protein (Parker et a/., 1989, Vlasak et a/., 1988). However, it has been shown from studies on mouse hepatitis virus that infection cannot be mediated by HE alone as 202 it requires the interaction of S with its receptor (Gagneten et a/., 1995). Instead, it has been postulated that the HE protein may play a role in the early stages of infection where it mediates viral adherence to the intestinal wall of the host by specifically yet reversibly binding the mucopolysaccharides in the mucus layer that protects the epithelial cells of the enteric tract. That is, the process of binding 9-0-acetylated receptors, followed by cleavage and rebinding intact receptors, may result in virus migration through the mucus layer, thereby facilitating infection (Cornelissen et a/., I997). In this study we have identified a HE gene homolog in the human torovirus. Sequence analysis revealed that the HNHE gene is 85% identical to the BRV-1 and BRV-2 HE genes at the nucleotide level and 76% at the amino acid level. The torovirus prototype, BEV, does not have an HE gene but has a short ORF referred to as ORF X whose sequence is 77% identical to the 3' end of the HE genes of BRV-1 and BRV-2 (Cornelissen et al., 1997). The corresponding 3' end of the human HE gene is 89% identical to the BEV X gene. This is an important finding since we have previously shown that the untranslated 3' end of the human torovirus genome manifests 99% nucleotide sequence identity with BEV in a 219 base region that was sequenced. In contrast, the 89% sequence identity between the 3' end of the HlV HE gene and the BEV X gene demonstrates that, while they may be evolutionarily more closely related to each other than to BRV, they are quite distinct viruses. Furthermore, the encoded 65kDa HE protein of HTV contains domains that are characteristic of type I membrane glycoproteins, and an acetylesterase catalytic site. This indicates that this protein has the same function on both the human and bovine viruses, though it is lacking in the BEV prototype. The expressed HE proteins of both BRV-1 and HJV were used as antigens to produce guinea pig antisera. By immunoblot, the gpHlaBRV and gpHlaHlV sera reacted specifically with the 65-66K bands in the BTV-positive fecal specimens from calves with diarrhea and the HJV-positive fecal specimens from patients with gastroenteritis, as well as with the expressed HE protein controls. These controls also reacted by immunoblot with the baBRV-I antiserum and all 12 human acute/convalescent paired sera from patients whose stools were diagnosed positive for HWby EM, and who were shown to have experienced seroconversion by HI and IEM. This type of cross-reactivity among torovirus species has previously been reported between BRV antigens and BEV antibodies by immunofluorescence microscopy assays (IFA) and ELlSA (Weiss and Horzinek, 1987), and human stools documented to contain HTV particles by EM have been shown to be reactive in a torovirus-specific ELlSA using BRV antiserum (Koopmans et a/., 1993). Thus, as was shown for the BRV-2 HE protein (Cornelissen et a/., 1997), the HE homologs of BRV-1 and HWare expressed during natural toroviral infections and the immune response to these may be a variable marker of viral infection. In marked contrast, the expressed nucleocapsid protein of BRV-I did not react with convalescent human sera from patients with torovirus (Chapter 5: Duckmanton et a/., 1998b). This could be interpreted as evidence that the nucleocapsid proteins of BRV-I and HTV are antigenically different, in that the overall immune response to the nucleocapsid protein is low and hence only antibodies to the homologous virus can be detected. The guinea pig hyperimmune sera to the BRV-1 and HTV HE proteins were found to inhibit the hemagglutination of rabbit erythrocytes by a purified human torovirus preparation. This indicates that, in addition to possibly having acetylesterase activity, as demonstrated for the HE of BRV-2 (Cornelissen et a/., 1997), the HE proteins of BRV-1 and HWpossess hemagglutinating properties. This does not preclude the possibility that the toroviral peplomer protein may also function as a hemagglutinin because the BEV, which does not possess a functional HE gene, is still capable of hemagglutinating human group 0, rabbit, and guinea pig erythrocytes (Horzinek et a/., 1987). By dot blot analysis, the gpHluBRV and gpHlaHTV sera, as well as the guinea pig antisera to the BRV-1 nucleocapsid protein were shown to react specifically with BTV-positive and HTV-positive fecal specimens (Chapter 5: Duckmanton et a/., 1998b). This shows that there is good potential to apply these reagents to the immunospecific diagnosis of these viruses from human and bovine fecal specimens. IEM studies demonstrated that both BTV and HWparticles could be aggregated by the gpHlaBRV and gpHlaHTV sera, whereas virus-negative controls, and the gpPlaBRV and gpPlaHlV sera showed no reactivity. This is consistent with IEM studies performed using bovine antiserum to the expressed BRV-2 HE gene, in which the HE was identified as a structural protein of toroviruses, reacting consistently with convalescent-phase serum (Cornelissen et a/., 1997). Any non-reacting particles may represent differences in serotypes among the torovirus samples as has been demonstrated by Woode et a/. (1985b). Close examination of electron micrographs of BRV and HW reveal, in addition to the 7-9 nm peplomer proteins, the presence of shorter 4-6 nm surface projections, resembling those formed by the HE proteins of coronaviruses (Sugiyama and Arnano, 1981). This second ring of small peplomers has previously been obsenred by Woode et a/. (1982) in BRV and by Beards et a/. (1984) in human torovirus-like particles. However, the nature of these projections remained unknown. It has been postulated that these smaller surface projections, which are absent from the BEV virion, represent the HE proteins of BRV (Cornelissen et a/., 1997), and we propose that these are also present on HTV as they are visible by EM. A comparison of the IEM aggregates from the reaction of toroviruses with the gpHlaBRV HE serum and those resulting from the reaction with guinea pig hyperimmune serum to the BRV-1 nucleocapsid protein (Chapter 5: Duckmanton eta/., 1998b) showed marked differences. Most of the aggregates from the antiserum to the HE protein consisted of intact viruses whereas the antiserum to the nucleocapsid protein formed aggregates of broken particles. This is consistent with the HE being a surface protein and the nucleocapsid being an internal protein. In summary, the HE genes of BRV-1 and HlV that have been amplified using long RT-PCR and sequenced were shown by sequence analysis to be related in part to the torovirus prototype, BEV (Snijder et a/., 1991), and to the HE gene of BRV-2 (Cornelissen et a/., 1997). Expression of these genes in a baculovirus system resulted in proteins that served as antigens in the development of specific antisera to the HE proteins of BRV-1 and HTV. These sera were used in a number of serological assays to demonstrate the immunoreactivity of the HE proteins to specific antisera, and to show cross-reactivity among torovirus species. These findings have the potential of being exploited for the design of diagnostic assays for human and bovine toroviruses and have provided us with important tests with which to further study torovirus infections both in experimental systems and in populations. Chapter 7 Discussion and future perspectives Infectious diarrhea of man and animals has been attributed to rotavirus, Norwalk virus, adenovirus, coronavirus, calicivirus, parvovirus and astrovirus (Storr and Bates, 1973, Woode and Bridger, 1978, Brown et a/., 1984, Moerman et a/., 1986, Snodgrass et a/., 1986, Petric, 7995, Kapikian et a/., 1996), all of which are agents of defined morphology that can be readily detected by electron microscopy. However, the etiology of a substantial number of cases of infectious diarrhea in both humans and calves remain undiagnosed each year. This situation has a negative impact on the establishment of containment measures and the potential development of vaccines (Kapikian, 1996). Based on the results of this thesis, it is likely that a significant proportion of these cases is due to torovirus. Although serological methods had been reported for the investigation of BRV, no immunospecific tests existed specifically for the detection of human toroviruses or of antibody to these agents. Furthermore, no reference reagents were available for human torovirus, and only limited reagents in the form of preimrnune and convalescent sera from infected calves were available for BRV. In 1993, Koopmans et a/. reported using a BRV reference antiserum, developed in rabbits, to show that human stools documented to contain torovirus-like particles by EM were reactive in a torovirus- specific ELISA. Thus, the experiments described in this thesis were designed to characterize both human and bovine toroviruses in an effort to better our understanding of these enteric pathogens. Given that neither human nor bovine toroviruses had been adapted to growth in cell culture, it was necessary to purify all the viruses used in these studies directly from stool specimens. Although no human torovirus stock was available, a defined stock virus in fecal material was available for BRV. Initially, human fecal specimens were partially purified by sucrose density gradient centrifugation followed 208 by filtration through an agarose gel column. However, in this procedure, excess sucrose remained in most preparations, and obscured the visualization of viral peplomers by EM. Furthermore, this method appeared to alter the morphology of some TVtPs and cause a loss of integrity in a subset of particles. This may have been due to the high osmolality and viscosity of the sucrose. Thus, an alternative procedure was adopted to purify TVLPs from stool samples by ultracentrifugation through a cushion of Ficoll-ammonium acetate. Viral particles purified by this method remained intact and were present in relatively high numbers as judged by electron microscopy. Our studies on the morphological, serological, and molecular characteristics of toroviruses from human fecal specimens have provided several lines of evidence that the torovirus-like particles detected in the stools of children with diarrhea are indeed toroviruses. The morphological features and ultrastructure of human toroviruses resemble those of BEV and BRV. These particles were found to elicit an immune response, and show immune cross-reactivity with BRV. As with coronaviruses (Battaglia et a/., 1987), the peplomer protein was identified as the primary immunoreactive component of human toroviruses. Sequence analysis of the 3' non- coding region of the HlVgenome revealed that this virus is related to BEV and BRV at the molecular level, and that some heterogeneity existed among isolates of human torovirus. Finally, the results of a case-control study on the role of human torovirus in gastroenteritis identified these agents as an important cause of gastrointestinal disease in the pediatric population, and demonstrated an immune response to the virus following infection. Hence, our findings have established that the pleomorphic particles seen by EM in human fecal specimens are toroviruses, and that these are likely important infectious agents of diarrhea in man. Prior to these analyses, bovine torovirus had been reported in the fecal specimens of calves with diarrhea in the U.S. and Europe, and on one occasion in Canada (Durham et a/., 1989). In our study, bovine torovirus was found to be the most common agent identified in calves with diarrhea as determined by EM and RT-PCR. It was also observed that, as for other enteric viruses, toroviruses could be detected in asymptomatic animals, but these agents were present significantly more frequently in animals with diarrhea (Crouch and Acres, 1984). In a small number of cases, other viruses were present in conjunction with torovirus but such double infections were also noted among these other viruses. However, it could not be determined in these cases whether BTV was the primary cause of enteritis in those calves that had another virus present in their stools. These results are concordant with previous reports on the occurrence of mixed infections in the fecal specimens of humans and animals (Moerman et a/., 1986, Snodgrass et a/., 1986, Woode, 1982). These findings have demonstrated a remarkable similarity between the epidemiology of the human and bovine toroviruses. Both of these viruses cause an appreciable number of asymptomatic infections, but are present significantly more frequently in the symptomatic cases. In fact, toroviruses are the predominant agents present among their symptomatic hosts. Our studies on the molecular characteristics of the BRV-1 and HNgenomes have identified the genes for all the structural proteins of BRV-1, as well as the HE gene of HW. Sequence analysis of the BRV-1 structural genes revealed that this virus closely resembles BEV except for the presence of the novel HE gene, which has also been reported in BRV-2 (Cornelissen et a/., 1997). The nucleotide sequence at the 3' end of the HTV HE gene shows more sequence homology with the BEV X pseudogene than it does with the 3' end of the BRV-1 or BRV-2 HE genes. This 210 finding, along with the sequence similarity in the 3' end of this gene indicates that the HW is evolutionarily more closely related to BEV than it is to BRV, and that BRV is thus evolutionarily further from BEV. Therefore, expression of specific torovirus proteins, in particular the HE proteins of BRV-1 and HTV has provided the basis for the development of immunospecific assays for direct detection of toroviruses in the fecal specimens of both humans and cattle. This potential for improved diagnosis of toroviruses may be expected to have a positive impact on the establishment of containment measures and the development of vaccines. Significance of research presented in this thesis The work presented in this thesis has contributed substantially to our state of knowledge about the characteristics and biology of human and bovine toroviruses. We determined that human and bovine toroviruses are prevalent causative agents of gastroenteritis in children and cattle, respectively. We also thoroughly characterized the molecular aspects of the BRV-1 structural genes and established that the HE gene is present in the genomes of HlV and BRV but not in that of the torovirus prototype, BEV. Furthermore, we demonstrated the important use of expressed proteins, such as the torovirus N and HE proteins, in the development of immunospecific diagnostic assays for human and bovine toroviruses. Thus, the methodologies used in these studies, and the findings from our experiments have formed a substantial basis upon which to continue investigating the toroviruses of humans and cattle. Future directions Although the RT-PCR and long PCR proved to be practical approaches for amplifying torovirus RNA from fecal specimens, and direct sequence analysis of 21 1 ampticons and gene expression revealed important aspects about these viruses, many of the molecular characteristics of BRV and HW still remain unknown. Obtaining the complete sequence of the genomes of BRV and HTV would allow us to determine the degree of identity between these two viruses, and provide templates for expression of viral proteins, especially the envelope and peplomer proteins. As the peplomer protein was shown to be involved in the immune response, it would be an excellent candidate for use in the production of polyclonal and monoclonal antibodies, which could be used to develop an ELlSA system with two distinct capture antibodies such as the anti-HE antibodies and the anti-S antibodies. The development of a torovirus-specific ELlSA using antisera to the neutralizing proteins of toroviruses would facilitate further epidemiological studies of human and bovine toroviruses. It would thus be possible to follow outbreak situations or monitor experimental studies in humans and cattle, to increase our understanding of torovirus host and tissue tropisms and the pathology of these viruses. Similar studies performed with Norwalk virus (Dolin et a/., 1971) and rotavirus (Bishop et a/., 1973) established these agents as the major causes of viral gastroenteritis in adults and young children. Finally, our knowledge of the biology of human and bovine toroviruses is limited because these agents have not been adapted to growth in cell culture. However, the above immunospecific probes and molecular tools such as PCR can be used to investigate virus-host cell interactions in an effort to find the appropriate cells and conditions under which the virus will replicate in a culture system. The ability to grow toroviruses in cell culture would ultimately allow for the investigation of their replication, the characterization of particular viral proteins and their roles during infection, and the analysis of the virus-neutralizing potential of antibodies to specific proteins. In addition, virus propagated in cell culture would provide a consistent inoculurn for studies in 212 animal models. A better understanding of the immune response to toroviruses in humans and cattle would aid in the interpretation of diagnostic test results, and in the development of potential vaccination strategies. References Armstrong, J., Niemann, H., Smeekens, S., Rottier, P., and Warren, G. (1984). Sequence and topology of a model intracellular membrane protein, El glycoprotein, from a coronavirus. Nature 308: 751-752. Athanassious, R., Marsolais, G., Assaf, R., Dea, S., Descouteaux, J.P., Dulude, S., and Monpetit, C. (1994). Detection of bovine coronavirus and type A rotavirus in neonatal calf diarrhea and winter dysentery of cattle in Quebec: evaluation of three diagnostic methods. Can. Vet. J. 35: 163-169. Balasuriya, U.B.R., Maclachlan, N.J., De Vries, A.A.F., Rossitto, P.V. and Rottier, P.J.M. (1995). Identification of a neutralizing site in the major envelope glycoprotein (GL) of equine arteritis virus. Virology 207: 518-527. Baric, R.S., Nelson, G.W. and Fleming, J.O. (1988). Interactions between coronavrius nucleocapsid protein and viral RNAs: implications for viral transcription. J. Virol. Battaglia, M., Passarani, N., Di Matteo, A. and Gerna, G. (1987). Human enter coronaviruses: further characterization and immunoblotting of viral proteins. J. lnfect. Dis. I55: 140-143. Beards, G.M., Green, J., Hall, C., Flewett, T.H., Lamouliatte, F. and Du Pasquier, P. (1984). An enveloped virus in stools of children and adults with gastroenteritis resembles the Breda virus of calves. Lancet 2: 1050-1052. Beards, G.M., Brown, D.W., Green, J. and Flewett, T.H. (1986). Preliminary characterization of torovirus-like particles of humans: comparison with the Berne virus of horses and Breda virus of calves. J. Med. Virol. 20: 67-78. Bishop, R.F., Davidson, G.P., Holmes, I.H., and Ruck, B.J. (1973a). Evidence for viral gastroenteritis. N. Engl. J. Med. 289: 1096-1097. Bishop, R.F., Davidson, G.P.,Holmes, I.H., and Ruck, B.J. (1973b). Virus particles in epithelial cells of duodenal mucosa from children with viral gastroenteritis. Lancet 2: 1281-1283. Blacklow, N.R. and Greenberg, H. B. (1991). Viral gastroenteritis. N. Engl. J. Med. 325: 252-264. Brinton, M.A. (1994). Lactate dehydrogenase-elevating, equine arteritis and Lelystad viruses. pp. 763-771. In Encyclopedia of Virology. R. G. Webster and A. Granoff (eds.), London: Academic Press Ltd. Brinton-Damell, M. and Plagemann, P.G.W. (1975). Structure and chemical-physical characteristics of lactate dehydrogenase-elevating virus. J. Virol. 16: 420433. Brown, D.W., Beards, G.M. and Flewett, T.H. (1987). Detection of Breda antigen and antibody in humans and animals by enzyme-immunoassay. J. Clin. Microbial. 25: 637-640. Brown, D., Morgan, J.H. and Bridger, J.C. (1990). Survey for Breda virus in neonatal calf diarrhoea. Vet. Rec. 126: 337. Brown, M. (1 990). Laboratory identification of adenoviruses associated with gastroenteritis in Canada from 1983 to 1986. J. Clin. Microbial. 28: 1525-1529. Butzter, J-P. (1986). Campylobacter. pp. 51-64. In infectious dianhea. S.L. Gorbach (ed.). Boston: Blackwell Scientific Publications. Carman, P.S., and Hazlett, M.J. (1992). Bovine coronavirus infection in Ontario, 1990- 1991. Can. Vet. J. 33: 812-814. Caul, E.O., Paver, W.K. and Clarke, S.K.R. (1975). Coronavirus particles in feces from patients with gastroenteritis. Lancet I: 1192. Cavanagh, D. (1983). Coronavirus IBV: structural characterization of the spike protein. J. Gen. Virol. 64: 2577-2583. Cavanagh, D. (I995). The coronavirus surface glycoprotein. pp. 73-113. In The Comnaviridae. S.G. Siddel (ed.). New York: Plenum Press. Cavanagh, D. (1997). Nidovirales: a new order comprising Coronaviridae and Arteriviridae. Arch. Viml. 142: 629-633. Cavanagh, D. and Horzinek, M.C. (1993). Genus Torovirus assigned to the Comnaviridae. Arch. Virol. 128: 395-396. Cavanagh, D., Davis, P.J., Pappin, D.J.C., Binns, M.M., Boursnell, M.E.G., and Brown, T.D.K. (1986). Coronavirus IBV: partial amino terminal sequencing of spike polypeptide 52 identifies the sequence Arg-Arg-PheArg-Arg at the cleavage site of the spike precursor polypeptide of IBV strains Beaudette and M41. Vims Res. 4: 133-1143. Cavanagh, D., Brien, D.A., Brinton, M., Enjuanes, L., Holmes, K.Y., Horzinek, M.C., Lai, M.M.C., Laude, HalPlagemann, P.G.W., Siddell, S., Spaan, W.J.M., Taguchi, F. and Talbot, P.J. (1994). Revision of the taxonomy of the coronavirus, torovirus, and arterivirus genera. Arch. VimL 135: 227-237. Chany, C., Moscovici, O., Lebon, P. and Rousset, S. (1982). Association of coronavirus infection with neonatal necrotizing enterocolitis. Pediatrics 69: 209- 214. Chen, Z., KUO, L., Rowland, R.R.R., Even, C., Faaberg, K.S. and Plagemann, P.G.W. (1993). Sequence of 3'-end of genome and of 5'-end of ORF la of lactate dehydmgenase-elevating virus (LDV), and common junction motifs between 5'- leader and bodies of seven subgenomic mRNAs. J. Gen. Virol. 74: 643-660. Christensen, M.L. (1989). Human viral gastroenteritis. Clin. Micmbiol. Revs. 2: 51-89. Cohen, C. and Parry, D.A.D. (1986). a-helical wiled coils- a widespread motif in proteins. Trends Biochem. Sci. II : 245-248. Collins, A.R., Knobler, R.L., Powell, H. and Buchmeier, M.J. (1982). Monoclonal antibodies to murine hepatitis virus (strain JHM) define the viral glycoprotein responsible for attachment and cell-ceH fusion. Virology I19: 358-371. Collins, J.E., Benfield, D.A. and Christianson, W.T. (1992). isolation of swine infertility and respiratory symdrome virus (isolate ATCC VR-2332) in North America and experimental reproduction of the disease in gnotobiotic pigs. J. Vet. Diagn. Invest. 4: 117-126. Cornelissen, L.A.H.M., Wierda, C.M.H., van der Meer, F.J., Herrewegh, A.A.P.M., Horzinek, M.C., Egberink, H.F., and de Groot, R.J. (1997). Hemagglutinin esterase, a novel structural protein of torovirus. J. Virol. 71: 5277-5286. Crouch, C.F., and Acres, S.D. (1984). Prevalence of rotavirus and coronavirus antigens in the feces of normal cows. Can. J. Comp. Med. 48: 340-342. Dascal, A. and Blacklow, N.R. (1986). Viral diarrhea. pp. 125-139. In Infectious diarrhea. S.L. Gorbach (ed.). Boston: Blackwell Scientific Publications. Den Boon, J.A., Snijder, E.J., Chirnside, E.D., De Vries, A.A.F., Horzinek, M.C. and Spaan, W.J.M. (1991a). Equine arteritis virus is not a togavirus but belongs to the coronavhs-like superfamily. J. Virol. 65: 2910-2920. 219 Den Boon, J.A., Snijder, E.J., Locker, J.K., Horzinek, M.C., and Rottier, P.J.M. (1991b). Another tripleapanning envelope protein among intracellulady budding RNA viruses: the torovirus E protein. Virology 182: 655-663. De Groot, R. J., Luytjes, W, Honinek, M.C., van der Zeijst, B.A.M., Spaan, W.J.M., and Lenstra, J.A. (1987). Evidence for a coiled-coil structure in the spike proteins of coronaviruses. J. Mol. Biol. 196: 963-966. De Jong, J.C., Weigand, R., Kidd, A.H., Waddell, G., Kapsenberg, J.G., Muzerie, C.J., Werrnenbol, A.G. and Firtzlaff, R.G. (1983). Candidate adenoviruses 40 and 41: fastidious adenoviruses from human infant stool. J. Med. Vim/. 111: 215-231. De Vries, A.A.F., Chirnside, E.D., Bredenbeek, P.J., Gravestein, L.A., Horzinek, M.C. and Spaan, W.J.M. (1990). All subgenomic mRNAs of equine arteritis virus contain a common leader sequence. Nucleic Acids Res. 18: 324103247. De Vries, A.A.F., Hoainek, M.C., Rottier, P.J.M., De Groot, R.J. (1997) The genome organization of the Nidovirales: similarities and differences between arteri-, toro-, * and coronaviruses. Semin. Virol. 8: 33-47. Dolin, R., Blacklow, N.R., DuPont, H., Formal, S., Buscho, R.F., Kasel, J.A., Chames, R.P., Hornick, R. and Chanock, R.M. (1971). Transmission of acute infectious nonbacterial gastroenteritis to volunteers by oral administration of stool filtrates. J. Infect. Dis. 123: 307-31 2. Doll, E.R., Bryans, J.T., McCollum, W.H.M. and Wallace, M.E. (I957). Isolation of a filterable agent causing arteritis of horses and abortion of mares. Its differentiation from the equine (abortion) influenza virus. Cornell Vet. 47: 3-41. Doughri, A.M. and Storz, J. (1977). Light and ultrastructural pathological changes in intestinal coronavirus infection of newborn calves. Zblt. Vetennifnned. 24: 367- 385. Doumashkin, R.R., Davies, H.A. and Smith, H. (1980). Are coronavirus-like particles seen in diarrhea stools really viruses? Lancet 2: 971-972. Duckmanton, L., Luan, B., Devenish, J., Tellier, R., and Petric, M. (1997). Characterization of torovirus from human fecal specimens. Virolagy 239: 158-168. Duckmanton, L., Carman, S., Nagy, e., and Petric, M. (1998a). Detection of bovine torovirus in fecal specimens of calves with diarrhea from Ontario farms. J. Clin. Microbial. 36: 1266-1 270. Duckmanton, L., Tellier, R., Liu, P. and Petric, M. (1998b). Bovine torovirus: sequencing of the structural genes and expression of the nucleocapsid protein of Breda virus. Virus Res. 58: 83-96. Duckmanton, L., Tellier, R., Richardson, C. and Petric, M. (1998~). The novel hemagglutinin-esterase genes of human torovirus and Breda virus. Virus Res.: submitted October 7998. 221 Durham, P.J.K., Hassard, L.E., Norman, G.R., and Yemen, R.L. (1989). Viruses and virus-like particles detected during examination of feces from calves and piglets with diarrhea. Can. Vet. J. 30: 876-881. Ellens, D.J., and De Leeuw, P.W. (1977). ELSA for diagnosis of rotavirus infections in calves. J. Clin. Microbiol. 6: 530-532. Ellens, D.J., Van Balken, J.A.M., and De Leeuw, P.W. (1978). Diagnosis of bovine coronavirus infections with hemadsorption-elution-hemagglutinationassay (HEHA) and with enzyme-linked immunosorbent assay (ELISA), pp. 321-330. In Proceedings. Int. Symp. on Neonatal Diarrhea, Saskatoon, Canada. Ellis, M.E., Watson, B. and Mandal, B.K. (1984). Micro-organisms in gastroenteritis. Arch. Dis. Child. 59: 848-855. Faaberg, K.S. and Plagemann, P.G.W. (1995). The envelope proteins of lactate dehydrogenaseelevating virus and their membrane topography. Virology 212: 512-525. Fagerland, J.A., Pohlenz, J.F.L. and Woode, G.N. (1986). A morphologic study of the replication of Breda virus (proposed family Toroviridae) in bovine intestinal cells. J. Gen. Viml. 67: 1293-1304. Finlaison, D.S. (1995). Fecal viruses of dogs-an electron microscope study. Vet. Microbiol. 46: 295-305. 222 Forns, X., Bukh, J., Purcell, R.H. and Emerson, S.U. (1997). How Escherichia coli can bias the results of molecular cloning: preferential selection of defective genomes of hepatitis C virus during the cloning procedure. Pmc. Natl. Acad. Sci. USA. 94: 13909-1 3914. Gagneten, S., Gout, O., Dubois-Dalcq, M., Rottier, P., Rossen, J. and Holmes, K.V. (1995). Interaction of mouse hepatitis virus (MHV) spike glycoprotein with receptor glycoprotein MHVR is required for infection with an MHV strain that expresses the hernagglutinin-esteraseglycoprotein. J. Virol. 69: 889-895. Godney, E.K., Chen, L., Kumar, S.N., Methven, S.L., Koonin, E.V. and Brinton, M.A. (1993). Complete genomic sequence and phylagenetic analysis of the lactate dehydrogenase-elevating virus (LDV) . Virology I 94: 585-596. Goldbach, R. and Wellink, J. (1988). Evolution of plus-stranded RNA viruses. Inten~irology29: 260-267. Golnik, W., Moraillon, A. and Golnik, J. (1986). Identification and antigenic comparison of equine arteritis virus isolated from an outbreak of epidemic abortion of mares. J. Vet. Med. B 33: 413-417. GrifFiths, 0. and Rottier, P. (1992). Cell biology of viruses that assemble along the biosynthetic pathway. Semin. Cell Biol. 3: 376-381 . Hamilton, J.R., Gall, D.G., Butler, D.G. and Middleton. (1976). Viral gastroenteritis: recent progress, remaining problems. Ciba Found. Symp. 42: 209-222. Herder, G., Durkop, I, Becht, H. and Klenk, H.-D. (1988). The glycoprotein of influenza C virus is the hemagglutinin, esterase and fusion factor. J. Gen. Virol. 69: 839- 846. Herrrnann, J. E., Taylor, D.N., Echeverria, P. and Blacklow, N.R. (1991). Astroviruses as a cause of gastroenteritis in children. N. E. J. M. 324: 1757-1 760. Higgins, P.G., Phillpotts, R.J., Scott, G.M., Wallace, J., Bernhardt, L.L. and Tyrrell. D.A. J . (1983). lntranasal interferon as protection against experimental respiratory coronavirus infection in volunteers. Antimicmb. Agents Chemother. 24: 713-71 5. Ho, M-S, Glass, R.I., Pinsky, P.F., Young-Okoh, N., Sappenfield, W.M., Buehfer, J.W., Gunter. N., and Anderson, L.J. (1988). Diarrheal deaths in American children- are they preventable? JAMA 260: 328 1-3285. Holland, J.J.. De La Torre, J.C. and Steinhauer, D.A. (1992). RNA virus populations as quasispecies. Cum Topics Microbial. Immunol. 176: 1-20. Holrnes, K.V. (1994). Coronaviruses pp. 255-260. In Encyclopedia of Virology. R. G. Webster and A. Granoff (eds.), London: Academic Press Ltd. Holmes, K.V. and Lai, M.C. (1996) Coronaviridae: the viruses and their replication. Pp. 1075-1093. In Fields Vimlogy 3" ed. B.N. Fields, D.M. Knipe and P.M. Howley, et a/. (eds.), Philadelphia, Lippincott-Raven publishers. Hornick, R.B. (1986). Salmonella. pp. 17-30, In Infectious dianhea. S.L. Gorbach (ed.). Boston: Blackwell Scientific Publications. Horzinek, M.C. (1993). New virus diseases: visible evolution. Austnl. Vet. J. 70: 433- 436. Horzinek, M.C. (1994). Toroviruses. pp. 1452-1458. In Encyclopedia of Virology. R. G. Webster and A. Granoff (eds.), London: Academic Press Ltd. Horzinek, M.C. and Weiss, M. (1990) Toroviruses. pp. 253-262. In Viral diarrheas of man and animals. L.J. Saif and K.W. Theil (ads.). Boca Raton: CRC Press Inc. Horzinek, M.C., Ederveen, J. and Weiss, M. (1985). The nucleocapsid of Berne virus. J. Gen. Virol. 65: 645-649. Horzinek, M.C., Ederveen, J., Kaehr, B, De Boer, D. and Weiss, M. (1986). The peplomers of berne virus. J. Gen. Virol. 67: 2475-2483. Horzinek, M.C., Flewett, T.H., Saif, L.J., Spaan, W.J., Weiss, M. and Woode, G.N. (1987). A new family of vertebrate viruses: Tomvindae. htetvirology 27: 17-24. How, H. (1995). Epidemiology of bovine diarrheal virus. Vet. Clin. North Am. Food. Anim. Pract. II: 521-547. Jamieson, F.B., Wang, E.E.L., Bain, C., Good, J., Duckmanton, L. and Petric, M. (1998) Human torovirus: a new nosocomial gastrointestinal pathogen. J. Infect. Dis. 178: 1 263-1 269. Kapikian, A.Z., Wyatt, R.G., Dofin, R., Thornhill, R., Kalica, A.R. and Chanock, R.M. (1972). Visualization by immune electron microscopy of a 27 nm particle associated with infectious non-bacterial gastroenteritis. J. Virol. 10: 1075-1081. Kapikian, A.Z. (I993). Viral gastroenteritis. JAMA 269: 627-630. Kapikian, A.Z. (1996). Overview of viral gastroenteritis. Arch. Virol. Suppl. 12: 7-1 9. Kapikian, A.Z., Estes, M.K., Chanock, R.M. (1996). Norwalk group of viruses. pp. 783- 810. In Virology. B.N. Fields, D.M. Knipe, P.M. Howley, R.M. Chanock, J.L. Melnick, T.P. Monath, B. Roizman, and S.E. Straus (eds.). New York: Raven Press Ltd. Karmali, M.A. (1989). Infection by verocytotoxin-producing Escherichia coli. Clin. Micmbiol. Revs. 2: 15-38. Kern, P., Muller, G. and Schmitz, H. (1985). Detection of coronavirus-like particles in homosexual men with acquired immunodeficiency and related lymphadenopathy syndrome. KIin. Woch. 63: 68-72. Koopmans, M. and Horzinek, M.C. (1994). Toroviruses of animals and humans: a review. Adv. Vims Res. 43: 233-273. Kooprnans, M., Ederveen, J., Woode, G.N. and Horzinek, M.C. (1986). The surface proteins of Breda virus. Am. J. Vet. Res. 47: 1896-1900. Koopmans, M., Van den Boom, U., Woode, G.N. and Horzinek, M.C. (1989). Seroepiderniology of Breda virus in cattle using ELISA. Vet. Res. 19: 233-243. Kooprnans, M., Snijder, E. and Horzinek, M.C. (1991a). cDNA probes for the diagnosis of bovine torovirus (8reda virus) infection. J. Clin. Microbiol. 29: 493- 497. Koopmans, Mal Van WuijckhuiseSjouke, L., Schukken, Y.H., Crerners, H., and Horzinek, M.C. (1991b). Association of diarrhea in cattle with torovirus infections on farms. Am. J. Vet. Res. 11 : 1769-1773. Koopmans, M., Petric, M., Glass, R. and Monroe, S.S. (1993). Enzyme-linked immunosorbent assay reactivity of torovirus-like particles in fecal specimens from humans with diarrhea. J. Clin. Microbiol. 31 : 2738-2744. Koopmans, M., Goosen, E.S.M., Lima, A.A.M., McAulifie, I.T., Nataro, J.P., Barrett, L.J., Glass, R.I. and Guerrant, R.L. (1997). Association of torovirus with acute persistent diarrhea in children. Ped. Infect. Dis. J. 16: 504-507. Krajden, M., Brown, M., Petrasek, A. and Middleton, P.J. (1990). Clinical features of adenovirus enteritis: a review of 127 cases. Pediatr. Infect. Dis. J. 9: 636-641 . Krishan, T. and Naik, T. N. (1997). Electronmicroscopic evidence of torovirus like particles in children with diarrhoea. Indian J. Med. Res. q05: 108-110. Lai, M.M.C. (1990). Coronavirus: organization, replication and expression of genome. Annu. Rev. Micmbiol. 44: 303-333. lai, M.M. (1992). Genetic recombination in RNA viruses. Curi. Top. Microbiol. Immunol. 176: 2 1-32, Lai, M.M. (1995). Transcription, replication, recombination, and engineering of coronavirus genes. Adv. Exp. Med. Biol. 380: 463-471. Lamoufiatte, F., Du Pasquier, P., Rossi, F., Laporte, J. and Loze, P. (1987). Studies on bovine Breda virus. Vet. Micmbiol. 15: 261-278. Levine, M.M. (1987). Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroad herent. J. lnfect. Dis. 155: 377-389. 228 Lieberrnann, H. (1990). New types of virus infections of domestic animals in the German Democratic Republic. 1. Serologic survey studies of the distribution of equine torovirus infections in the GDR. Arch. Exp. Vetennarmed. 44: 251-253. Luytjes, W., Bredenbeek, P.. Noten, A., Hoainek, M.C. and Spaan, W. (1988). Sequence of mouse hepatitis virus A59 mRNA2: indications for RNA recombination between coronaviruses and influenza C virus. Virology 166: 415- 422. Macnaughton, M.R. and Davies, H.A. (I981 ). Human enteric coronaviruses: brief review. Arch. Viml. 70: 301-31 3. Macnaughton, M.R., Hasonc, H.J., Madge, M.H. and Reed, S.E. (1981). Antibody to virus components in volunteers experimentally infected with human coronavirus 229e group viruses. Infect. Immun. 31: 845-849. Macnaughton, M.R., Flowers, D. and lsaacs, D. (1983). Diagnosis of human coronavirus infections in children using enzyme-linked immunosorbant assay. J. Med. Virol. II : 319-325. Magnusson, P. Hyllseth, B. and Marusyk, H. (1970). Morphological studies on equine arteritis virus. Arch. Ges. Vimsforsch. 30: 105-1 I2. Marshall, JA.. Thompson, W.L. and Gust, I.D. (1989). Coronavirus-like partides in adults in Melbourne, Australia. J. Med. Viml. 29: 238-243. 229 Mclntosh. K. (1996). Coronaviruses pp. 1095-1103. In Virology. B.N. Fields, D.M. Knipe, P.M. Howley, R.M. Chanock, J.L. Melnick, T.P. Monath, 6. Roizman, and S.E. Straus (eds.). New York: Raven Press Ltd. Mclntosh, K., Kapikian, A.Z., Hardison, K.A., Hartley, J.W. and Chanock, R.M. (1969). Antigenic relationships among the coronaviruses of man and between human and animal coronaviruses. J. Immunol. 102: 1109-1 118. Mclntosh, K., McQuillin, J., Reed, S.E. and Gardner, P.S. (1978). Diagnosis of human coronavirus infection by immunofluorescence: method and application to repiratory disease in hospitalized children. J. Med. Virol. 2: 341-346. Meredith, M.J. (1993). Porcine reproductive and respiratory syndrome. 7m ed. Cambridge, England: University of Cambridge Press. Meulenberg, J.J.M., Hulst, M.M. and De Meijer, E.J. (1993). Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS), is related to LDV and EAV. Virology 192: 62-72. Middleton, P.J., Szymanski, M. and Petric, M. (1977). Viruses associated with acute gastroenteritis in young children. Am. J. Dis. Child. 131: 733-737. Moerman, A., Van Zijdervetd, F.G. and De Leeuw, P.W. (1986). Neonatal calf diarrhea. p. 36-41. In Ann. Rep. Cenfrel Vet. Institute. Lelystad. Mortensen, M.L., Ray, C.G., Payne, C.M., Friedman, A.D., Minnich, L.L. and Rousseau, C. (1985). Coronaviruslike particles in human gastrointestinal disease. Am. J. Dis. Child. 139: 928-934. Muir, P., Harbour, D.A., Gruffydd-Jones, T.J., Howard, P.E., Hopper, C.D., Gruffydd- Jones, E.A., Broadhead, H.M., Clarke, C.M. and Jones, M.E. (1990). A clinical and microbiological study of cats with protruding nictitating membranes and diarrhoea: isolation of a novel virus. Vet. Rec. 127: 324-330. Murtaugh, M. Collins, J.E. and Rossow, K.D. (1993). Porcine respiratory and reproductive syndrome. pp. 43-53. A.D. Leman Swine Conference. Minneapolis, MN: University of Minnesota. Palmer, A.E., Allen, A., Tauraso, N. and Shelokov, A. (1968) Simian hemorrhagic fever. I. Clinical and epizootiologic aspects of an outbreak among quarantined monkeys. Am. J. Trop. Med. Hyg. 17: 4M-414. Palmer, G.A., Kuo, L., Chen, Z., Faaberg, K.S. and Plagemann, P.G.W. (1995). Sequence of the genome of lactate dehydrogenase-elevating virus: heterogeneity between strains P and C. Virology 209: 637-642. Parker, M.D., Cox, G.J., Deregt, D., Fitzpatrick, D.R. and Babuik, L.A. (1989). Cloning and in vitro expression of the gene for the E3 hemagglutinin glycoprotein of bovine coronavirus. J. Gen. Vim/. 70: 155-164. Payne, C.M., Ray, C.G., Borduin, V., Minnich, L.L. and Lebowitz, M.D. (1986). An eight-year study of the viral agents of acute gastroenteritis in humans: ultrastuctural observations and seasonal distribution with a major emphasis on coronavirus-like particles. Diagn. Microbial. Inf. Dis. 5: 39-54. Penrith, M.L. and Gerdes, G.H. (1992). Breda virus-like particles in pigs in South Africa. J. S. Afr. Vet. Assoc. 63: 102. Petric, M. (1995). Caliciviruses, astrovinrses and other diarrheic viruses. pp. 1017- 1024. In Manual of Clinical Microbiology, P. Murray, E. Barron, M. Pfaller, F. Tenover, R. Yolken (eds.) 6m edition, Washington, D.C.: American Society for Microbiology Plagemann, P.G.W. and Moennig, V. (1992). Lactate dehydrogenase-elevating virus, equine arteritis virus, and simian hemorrhagic fever virus: a new group of positive- stranded RNA viruses. Adv. Virus Res. 41 : 99492. Pohlenz, J .F., Cheville, N.F., Woode, G.N. and Mokresh, A.H. (I984). Cellular lesions in intestinal mucosa of gnotobiotic calves experimentally infected with a new unclassified bovine virus (Breda virus). Vet. Pathol. 21: 407-4'l7. Pringle, C.R. (1991). Mononegavirales. pp. 239-241. In: Cabsification and nomenclature of viruses. Francki, R.I.B., Fauquet, C.M., Knudson, D.L. and Brown, F. (eds.). Fifth report of the International Committee on Taxonomy of Viruses. Wien New York, Springer. Pringle, C.R. (1992). The ICNdb project and other initiatives. Arch. Virol. 126: 351- 353. Pringle, C.R. (1996). Virus taxonomy 1996- a bulletin from the Xth International Congress of Virology in Jerusalem. Arch. Virol. I41: 2251-2256. Quan, C. and Doane, F.W. (1983). Ultrastructural evidence for the cellular uptake of rotavirus by endocytosis. lntewirology 20: 223-231. Riley, V., Lilly, F., Huerto, E. and Bardell, D. (1960). Transmissible agent associated with 26 types of experimental mouse neoplasms. Science 132: 545-547. Sambrook, J., Fritsch, E.F. and Maniatis, T. (eds.) (1989). Molecular cloning: a laboratory manual. 2nd ed. New York, Cold Spring Harbor Laboratory Press. Sawicki, S.G. and Sawicki, D.L. (1990) Coronavirus transcription: subgenomic mouse hepatitis virus replicative intermediates function in RNA synthesis. J. Viml. 64: 1050-1056. Schmidt, O.W. and Kenny, G.E. (1981). lmmunogenicity and antigenicity of human coronaviruses 229e and oc43. Infect. lmmun. 32: 1000-1006. Scott, F.M., Holliman, A., Jones, G.W., Gray, E.W. and Fitton, J. (1996). Evidence of torovirus infection in diarrhoeic cattle. Vet. Rec. 138: 284-285. Shieh, C.K., Soe, L.H., Makino, S., Chang, M.F., Stohlman, S.A. and Lai, M.M. (1987). The 5'-end sequence of the rnurine coronavirus genome: implications for multiple fusion sites in leader-primed transcription. Virology 156: 321-330. Siddell, S., Wege, H. and Ter Meulen. V. (1983). The biology of coronaviruses. J. Gen. Virol. 64: 761-776. Sitbon, M. (1985). Human-enteric-coronaviruslike particles (CVLP) with different epidemiological characteristics. J. Med. Virol. 16: 67-76. Snijder, E.J. (1991). Berne virus: replication and evolution of the torovirus prototype. Doctor of Philosophy thesis. Institute of Virology, Veterinary Faculty, State University of Utrecht. Snijder, E.J. and Horzinek, M.C. (1993). Toroviruses: replication, evolution and comparison with other members of the coronavirus-like superfamily. J. Gen. Virol. 74: 2305-2316. Snijder, E.J., Ederveen, J., Spaan, W.J.M., Weiss, M. and Horzinek, M.C. (1988). Characterization of Berne virus genomic and messenger RNAs. J. Gen. Virol. 69: 2135-21 44. Snijder, E.J., Den Boon, J.A., Ve jans, G.M., Spaan, W. J. and Horzinek, M.C. (I989). Identification and primary structure of the gene encoding the Berne virus nucleocapsid protein. J. Gen. Virol. 70: 3363-3370. 234 Snijder, E.J., Horzinek, M.C. and Spaan, W.J. (1990a). A 3' co-terminal nested set of independently transcribed mRNAs is generated during Berne virus replication. J. Vim/.64: 331-338. Snijder, E.J., Den Boon, J., Bredenbeek, J.A., Horzinek, M.C., Rijnbrand, R. and Spaan, W.J. (1990b). The carboxy-terminal part of the Berne virus polymerase is expressed by ribosomal frame shifting and contains sequence motifs which indicate that the toro- and coronaviruses are evolutionarily related. Nucl. Acid Res. 18: 4535-4542. Snijder, E.J., Den Boon, J., Spaan, W.J., Weiss, M. and Horzinek, M.C. (1990~). Primary structure and post-translational processing of the Berne virus peplomer protein. Virology I78: 355-363. Snijder, E.J., Den Boon, J.A., Horzinek, M.C. and Spaan, W.J.M. (1991) Comparison of the genome organization of toro- and coronaviruses: evidence for two non- homologous RNA recombination events during Berne virus evolution. Virology 180: 448-452. Snijder, E.J., Horzinek, M.C. and Spaan, W.J. (1994). The coronavirus-like superfamily. In Comnaviruses: molecular biology and pathogenesis. H. Laude and J.F. Vautherot (eds.). New York: Plenum Publishing Corporation. Snodgrass, DR., Terzolo, H.R., and Shewood, D. (1986). Aetiology of diarrhea in young calves. Vet. Rec. 119: 31-34. 235 Snyder, J.D. and Merson, M.H. (1982). The magnitude of the global problem of acute diarrhoea1 disease: a review of active surveillance data. Bull. WHO 60: 605-613. Spence, L., Fauvel, M., Petro, R. and Babiuk, L.A. (1978). Comparison of rotavirus strains by hemagglutination inhibition. Can. J. Microbiol. 24: 353-362. Stohlman, S.A., Fleming, J.O., Patton, C.D. and Lai, M.M. (1983). Synthesis and subcellular localization of the murine coronavirus nucleocapsid protein. Virology 130: 527-532. Storz, J., and Bates, R.C. (1973). Parvovirus infections in calves. J. Am. Vet. Med. ASSOC.163: 884-886. Strauss, E.G. and Strauss, J.H. (1991). RNA viruses: genome structure and evolution. Cur. Opin. Genet. Dev. I:485-493. Strauss, J.H. and Strauss, E.G. (1988). Evolution of RNA viruses. Annu. Rev. Microbiol. 42: 657-683. Sugiyama, K. and Amano, Y. (1981). Morphological and biological properties of a new coronavirus associated with diarrhea in infant mice. Arch. Virol. 67: 241-251. Tauraso, N.M., Shelokov, A., Palmer, A.E. and Allen, A.M. (1968). Simian hemorrhagic fever. Ill. Isolation and characterization of a viral agent. Am. J. Trop. Med. Hyg. 17: 422-431. 236 Tellier, R., Bukh, J., Emerson, S.U., and Purcell, R.H. (1996a) Amplification of the full- length hepatitis A virus genome by long reverse transcription-PCR and transcription of infectious RNA directly from the arnplicon. Pmc. Natl. Acad. Sci. USA 93: 4370-4373. Tellier, R., Bukh, J., Emerson, S.U., Miller, R.H., and Purcell, R.H. (1996b) Long PCR and its application to hepatitis viruses: amplification of hepatitis A, hepatitis 6,and hepatitis C virus genornes. J. Clin. Microbiol. 34: 3085-3091. Uhnoo, I., Wadell, G. Svenson, L., and Johansson, M.E. (1984). Importance of enteric adenoviruses 40 and 41 in acute gastroenteritis in infants and young children. J. Clin. Microbiol. 20: 365-372. Van der Zeijst, B.A.M., Horzinek, M.C. and Moennig, V. (1975). The genome of equine arteritis virus. Virology 68: 418-425. Van Kruiningen, H.J., Castellano, V.P., Koopmans, M., and Harris, L.L. (1992). A serologic investigation for coronavirus and Breda virus antibody in winter dysentery of dairy cattle in the northeastern United States. J. Vet. Nag. Invest. 4: 450-452. Vanopdenbosch, E., Wellemans, G., Charlier, G., and Petroff, K. (1991). Breda virus ' associated with respiratory disease in calves. Vet. Rec. 31: 203. Vanopdenbosch, E., Wellemans, G., Oudewater, J., and Petroff, K. (1992). Prevalence of torovirus infections in Belgian cattle and their role in respiratory, digestive, and reproductive disorders. VIaams Diergeneeskd. Tijdschr. 61 : 187-191. Vaucher, Y.E., Ray, C.G., Minnich, L.L., Payne, C.M., Beck, D. and Lowe, P. (I982). Pleomorphic, enveloped, virus-like particles associtaed with gastrointestinal illness in neonates. J. Infect. Dis. 145: 27-36. Vennerna, H., Heijnen, L., Zijderveld, A., Horzinek, M.C. and Spaan, W.J.M. (1990). lntracellular transport of recombinant coronavirus spike proteins: implications for virus assembly. J. Vim/. 64: 339-346. Vlasak, R., Krystal, M., Nacht, M. and Palese, P. (1987). The influenza C virus glycoprotein (HE) exhibits receptor-binding (hemagglutinin) and receptor- destroying (esterase) activities. Virology 160: 419-425. Vlasak, R., Luytjes, W., Spaan, W. and Palese, P. (1988). Human and bovine coronaviruses recognize sialic acid containing receptors similar to those of influenza C virus. Pmc. Natl. Acad. Sci. USA 85: 4526-4529. Vorster, J.H. and Gerdes, G.H. (1993). Breda virus-like particles in calves in South Africa. J. S. Afr. Vet. Assoc. 64: 58. Wagaman, P.C., Spence, H.A. and O'Callaghan, R.J. (1989). Detection of influenza C virus by using an in situ esterase assay. J. Clin. Microbial. 27: 832-836. 238 Walsh, J.A. and Warren, K.S. (1979). Selective primary health care. An interim strategy for disease control in developing countries. N. Engl. J. Med. 301 : 967- 974. Weiss, M. and Horzinek, M.C. (1986) Resistance of Berne virus to physical and chemical treatment. Vet. Microbiol. I1 :41 -49. Weiss, M. and Horzinek, M.C. (1987). The proposed family toroviridae: agents of enteric infections. Arch. Virol. 92: 1-15. Weiss, M., Steck, F. and Horzinek, M.C. (1983). Purification and partial characterization of a new enveloped RNA virus (Berne virus). J. Gen. Virol. 64: 1849- I858. Weiss, M., Steck,, F., Kaderli, R., and Horzinek, M.C. (1984). Antibodies to Berne virus in horses and other animals. Vet. Microbiol. 9: 523-531 . Wensvoort, G. (1993). Lelystad virus and the porcine epidemic abortion and respiratory syndrome. Vet. Res. 24: I1 7-1 24 Wilde, J., Eiden, J.. and Yolken, R. (1990). Removal of inhibitory substances from human fecal specimens for detection of group A rotaviruses by reverse transcriptase and polymerase chain reactions. J. Clin. Micro. 28: 1300-1307. Wolfe, MS. (1986). Parasites. pp. 141-1 55. In Infectious dianhea. S.L. Gorbach (ed .). Boston: Blackwell Scientific Publications. Woode, G.N. (1987). Breda and Breda-like viruses: diagnosis, pathology, and epidemiology. Ciba Found. Symp. 128: 175-1 91. Woode, G.N. (1982). Etiology of enteric viral infections of calves: pathological and clinical aspects. In The Netherlands, 12th World Congr. Cattle Dis. 1 : 201-208. Woode, G.N., and Bridger, J.C. (1978). Isolation of small viruses resembling astroviruses and caliciviruses from acute enteritis of calves. J. Med. Microbiol. II : 44 1-452. Woode, G.N., Reed, D.E., Runnels, P.L., Herrig, M.A. and Hill, T.H. (1982). Studies with an unclassified virus isolated from diarrheic calves. Vet. Micmbiol. 7: 221- 240. Woode, G.N., Mohammed, K.A., and Saif, L.J. (1983). Diagnostic methods for the newly discovered "Breda" group of calf enteritis inducing viruses. Proc. Annu. Meet. Am. Assoc. Vet. Lab. Diagn. 3: 533-538. Woode, G.N., Pholenz, J.F., and Gourley, N.E.K. (1984). Astrovirus and Breda virus infection of dome cell epithelium of bovine ileum. J. CIin. Microbiol. 19: 623-630. Woode, G.N., Gourley, N.E.K., Pohlenz, J.F., Leibler, E.M., Marhews, S.L., and Hutchinson, M.P. (1 985a). Serotypes of bovine astrovirus. J. Clin. Microbial- 22: 668-670. Woode, G.N., Saif, L.J., Quesada, M., Winnand, N.J., Pohlenz, J.F. and Kelso Gourley, N. (1985b). Comparative studies on three isolates of Breda virus of calves. Am. J. Vet. Res. 46: 1003-101 0. Zanoni, R., Weiss, M. and Peterhans, E. (1986). The hemagglutinating activity of Berne virus. J. Gen. Virol. 67: 2485.