Kinome Sirna-Phosphoproteomic Screen Identifies Networks
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
Recombinant MAP2K2 Protein
Recombinant MAP2K2 protein Catalog No: 81332, 81632 Quantity: 20, 1000 µg Expressed In: Baculovirus Concentration: 0.3 µg/µl Source: Human Buffer Contents: Recombinant MAP2K2 protein is supplied in 25 mM HEPES-NaOH pH 7.5, 300 mM NaCl, 10% glycerol, 0.04% Triton X-100, and 0.5 mM TCEP. Background: MAP2K2 (Mitogen-Activated Protein Kinase Kinase Kinase 2) is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase plays a critical role in mitogen growth factor signal transduction. It phosphorylates and activates MAPK1/ERK2 and MAPK2/ERK3. The activation of this kinase itself is dependent on the Ser/Thr phosphorylation by MAP kinase kinase kinases. Mutations in this gene cause cardiofaciocutaneous syndrome (CFC syndrome), a disease characterized by heart defects, cognitive disability, and distinctive facial features similar to those found in Noonan syndrome. Protein Details: Recombinant MAP2K2 protein was expressed in baculovirus expression system as the full length protein (accession number NP_109587.1) with a N-terminal FLAG Tag. The molecular weight of the protein is 45.7 kDa. Application Notes: This product was manufactured as described in Protein Details. Where possible, Active Motif has developed functional or activity assays for Recombinant MAP2K2 protein gel recombinant proteins. Additional characterization such as enzyme kinetic activity 10% SDS-PAGE with Coomassie blue assays, inhibitor screening or other biological activity assays may not have been staining MW: 45.7 kDa performed for every product. All available data for a given product is shown on the lot- Purity: >90% specific Technical Data Sheet. Storage and Guarantee: Recombinant proteins in solution are temperature sensitive and must be stored at -80°C to prevent degradation. -
Influencers on Thyroid Cancer Onset: Molecular Genetic Basis
G C A T T A C G G C A T genes Review Influencers on Thyroid Cancer Onset: Molecular Genetic Basis Berta Luzón-Toro 1,2, Raquel María Fernández 1,2, Leticia Villalba-Benito 1,2, Ana Torroglosa 1,2, Guillermo Antiñolo 1,2 and Salud Borrego 1,2,* 1 Department of Maternofetal Medicine, Genetics and Reproduction, Institute of Biomedicine of Seville (IBIS), University Hospital Virgen del Rocío/CSIC/University of Seville, 41013 Seville, Spain; [email protected] (B.L.-T.); [email protected] (R.M.F.); [email protected] (L.V.-B.); [email protected] (A.T.); [email protected] (G.A.) 2 Centre for Biomedical Network Research on Rare Diseases (CIBERER), 41013 Seville, Spain * Correspondence: [email protected]; Tel.: +34-955-012641 Received: 3 September 2019; Accepted: 6 November 2019; Published: 8 November 2019 Abstract: Thyroid cancer, a cancerous tumor or growth located within the thyroid gland, is the most common endocrine cancer. It is one of the few cancers whereby incidence rates have increased in recent years. It occurs in all age groups, from children through to seniors. Most studies are focused on dissecting its genetic basis, since our current knowledge of the genetic background of the different forms of thyroid cancer is far from complete, which poses a challenge for diagnosis and prognosis of the disease. In this review, we describe prevailing advances and update our understanding of the molecular genetics of thyroid cancer, focusing on the main genes related with the pathology, including the different noncoding RNAs associated with the disease. -
Anti-SEK1 / MKK4 Phospho (Ser80) Antibody (ARG51673)
Product datasheet [email protected] ARG51673 Package: 100 μl, 50 μl anti-SEK1 / MKK4 phospho (Ser80) antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes SEK1 / MKK4 phospho (Ser80) Tested Reactivity Hu, Ms, Rat Tested Application ICC/IF, IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name SEK1 / MKK4 Antigen Species Human Immunogen Peptide sequence around phosphorylation site of serine 80 (T-H-S(p)-I-E) derived from Human SEK1/MKK4. Conjugation Un-conjugated Alternate Names MEK 4; MAPK/ERK kinase 4; PRKMK4; SAPKK-1; SAPK/ERK kinase 1; SKK1; JNK-activating kinase 1; EC 2.7.12.2; MEK4; MAP kinase kinase 4; c-Jun N-terminal kinase kinase 1; SEK1; SAPKK1; MAPKK4; Stress- activated protein kinase kinase 1; JNKK1; MKK4; SERK1; SAPK kinase 1; Dual specificity mitogen- activated protein kinase kinase 4; JNKK; MAPKK 4 Application Instructions Application table Application Dilution ICC/IF 1:100 - 1:200 IHC-P 1:50 - 1:100 WB 1:500 - 1:1000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Calculated Mw 44 kDa Properties Form Liquid Purification Antibodies were produced by immunizing rabbits with KLH-conjugated synthetic phosphopeptide. Antibodies were purified by affinity-chromatography using epitope-specific phosphopeptide. In addition, non-phospho specific antibodies were removed by chromatogramphy using non- phosphopeptide. Buffer PBS (without Mg2+ and Ca2+, pH 7.4), 150mM NaCl, 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol www.arigobio.com 1/3 Concentration 1 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. -
Map2k1 and Map2k2 Genes Contribute to the Normal Development of Syncytiotrophoblasts During Placentation
RESEARCH ARTICLE 1363 Development 136, 1363-1374 (2009) doi:10.1242/dev.031872 Map2k1 and Map2k2 genes contribute to the normal development of syncytiotrophoblasts during placentation Valérie Nadeau*, Stéphanie Guillemette*, Louis-François Bélanger, Olivier Jacob, Sophie Roy and Jean Charron† The mammalian genome contains two ERK/MAP kinase kinase genes, Map2k1 and Map2k2, which encode dual-specificity kinases responsible for ERK/MAP kinase activation. In the mouse, loss of Map2k1 function causes embryonic lethality, whereas Map2k2 mutants survive with a normal lifespan, suggesting that Map2k1 masks the phenotype due to the Map2k2 mutation. To uncover the specific function of MAP2K2 and the threshold requirement of MAP2K proteins during embryo formation, we have successively ablated the Map2k gene functions. We report here that Map2k2 haploinsufficiency affects the normal development of placenta in the absence of one Map2k1 allele. Most Map2k1+/–Map2k2+/– embryos die during gestation because of placenta defects restricted to extra-embryonic tissues. The impaired viability of Map2k1+/–Map2k2+/– embryos can be rescued when the Map2k1 deletion is restricted to the embryonic tissues. The severity of the placenta phenotype is dependent on the number of Map2k mutant alleles, the deletion of the Map2k1 allele being more deleterious. Moreover, the deletion of one or both Map2k2 alleles in the context of one null Map2k1 allele leads to the formation of multinucleated trophoblast giant (MTG) cells. Genetic experiments indicate that these structures are derived from Gcm1-expressing syncytiotrophoblasts (SynT), which are affected in their ability to form the uniform SynT layer II lining the maternal sinuses. Thus, even though Map2k1 plays a predominant role, these results enlighten the function of Map2k2 in placenta development. -
Circrna LRIG3 Knockdown Inhibits Hepatocellular Carcinoma Progression by Regulating Mir-223-3P and MAPK/ERK Pathway
CircRNA LRIG3 knockdown inhibits hepatocellular carcinoma progression by regulating miR-223-3p and MAPK/ERK pathway Type Research paper Keywords hepatocellular carcinoma, miR-223-3p, circ_LRIG3, MAP2K6, MAPK/ERK pathway Abstract Introduction Emerging evidence suggests that circular RNAs (circRNAs) play critical roles in tumorigenesis. However, the roles and molecular mechanisms of circRNA leucine-rich repeat immunoglobulin domain-containing protein 3 (circ_LRIG3) in hepatocellular carcinoma (HCC) has not been investigated. Material and methods The expression levels of circ_LRIG3, miR-223-3p, and mitogen-activated protein kinase kinase 6 (MAP2K6) were determined by qRT-PCR. Flow cytometry was applied to determine the cell cycle distribution and apoptosis. Cell proliferation, migration and invasion were assessed by MTT, colony formation, and transwell assays. Western blot assay was employed to measure the protein levels of the snail, E-cadherin, MAP2K6, mitogen-activated protein kinase (MAPK), phospho-MAPK (p- MAPK), extracellular signal-regulated kinases (ERKs), and phospho-ERKs (p- ERKs). The relationship between miR-223-3p and circ_LRIG3 or MAP2K6 was predicted by bioinformatics tools and verified by dual-luciferase reporter assay. A xenograft tumor model was established to confirm the functions of circ_LRIG3 in vivo. Results Preprint Circ_LRIG3 and MAP2K6 expression were enhanced while miR-223-3p abundance was reduced in HCC tissues and cells. Knockdown of circ_LRIG3 inhibited cell proliferation, metastasis, and increasing apoptosis. MiR-223-3p was a target of circ_LRIG3, and its downregulation reversed the inhibitory effect of circ_LRIG3 knockdown on the progression of HCC cells. Moreover, MAP2K6 could bind to miR-223-3p, and MAP2K6 upregulation also abolished the suppressive impact of circ_LRIG3 interference on progression of HCC cells. -
Profiling Data
Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8 -
Application of a MYC Degradation
SCIENCE SIGNALING | RESEARCH ARTICLE CANCER Copyright © 2019 The Authors, some rights reserved; Application of a MYC degradation screen identifies exclusive licensee American Association sensitivity to CDK9 inhibitors in KRAS-mutant for the Advancement of Science. No claim pancreatic cancer to original U.S. Devon R. Blake1, Angelina V. Vaseva2, Richard G. Hodge2, McKenzie P. Kline3, Thomas S. K. Gilbert1,4, Government Works Vikas Tyagi5, Daowei Huang5, Gabrielle C. Whiten5, Jacob E. Larson5, Xiaodong Wang2,5, Kenneth H. Pearce5, Laura E. Herring1,4, Lee M. Graves1,2,4, Stephen V. Frye2,5, Michael J. Emanuele1,2, Adrienne D. Cox1,2,6, Channing J. Der1,2* Stabilization of the MYC oncoprotein by KRAS signaling critically promotes the growth of pancreatic ductal adeno- carcinoma (PDAC). Thus, understanding how MYC protein stability is regulated may lead to effective therapies. Here, we used a previously developed, flow cytometry–based assay that screened a library of >800 protein kinase inhibitors and identified compounds that promoted either the stability or degradation of MYC in a KRAS-mutant PDAC cell line. We validated compounds that stabilized or destabilized MYC and then focused on one compound, Downloaded from UNC10112785, that induced the substantial loss of MYC protein in both two-dimensional (2D) and 3D cell cultures. We determined that this compound is a potent CDK9 inhibitor with a previously uncharacterized scaffold, caused MYC loss through both transcriptional and posttranslational mechanisms, and suppresses PDAC anchorage- dependent and anchorage-independent growth. We discovered that CDK9 enhanced MYC protein stability 62 through a previously unknown, KRAS-independent mechanism involving direct phosphorylation of MYC at Ser . -
Comparative Analysis of Protein Expression Concomitant with DNA Methyltransferase 3A Depletion in a Melanoma Cell Line
American Journal of Analytical Chemistry, 2011, 2, 539-572 doi:10.4236/ajac.2011.25064 Published Online September 2011 (http://www.SciRP.org/journal/ajac) Comparative Analysis of Protein Expression Concomitant with DNA Methyltransferase 3A Depletion in a Melanoma Cell Line Shengnan Tang1,#, Xiaoyan Liu1,#, Tonghua Li1*, Haoyue Wang2, Jiangming Sun1, Qian Qiao1, Jun Yao3, Jian Fei2 1Department of Chemistry, Tongji University, Shanghai, China 2School of Life Science & Technology, Tongji University, Shanghai, China 3School of Medicine, Fudan University, Shanghai, China E-mail: *[email protected] Received March 17, 2011; revised May 3, 2011; accepted June 1, 2011 Abstract DNA methyltransferase 3A (Dnmt3a), a de novo methyltransferase, has attracted a great deal of attention for its important role played in tumorigenesis. We have previously demonstrated that melanoma is unable to grow in-vivo in conditions of Dnmt3a depletion in a mouse model. In this study, we cultured the Dnmt3a depletion B16 melanoma (Dnmt3a-D) cell line to conduct a comparative analysis of protein expression con-comitant with Dnmt3a depletion in a melanoma cell line. After two-dimensional separation, by gel elec- tro-phoresis and liquid chromatography, combined with mass spectrometry analysis (1DE-LC-MS/MS), the re-sults demonstrated that 467 proteins were up-regulated and 535 proteins were down-regulated in the Dnmt3a-D cell line compared to the negative control (NC) cell line. The Genome Ontology (GO) and KEGG pathway were used to further analyze the altered proteins. KEGG pathway analysis indicated that the MAPK signaling pathway exhibited a greater alteration in proteins, an interesting finding due to the close rela- tion-ship with tumorigenesis. -
TRIM67 Inhibits Tumor Proliferation and Metastasis by Mediating
Journal of Cancer 2020, Vol. 11 6025 Ivyspring International Publisher Journal of Cancer 2020; 11(20): 6025-6037. doi: 10.7150/jca.47538 Research Paper TRIM67 inhibits tumor proliferation and metastasis by mediating MAPK11 in Colorectal Cancer Ying Liu1*, Guiqi Wang1*, Xia Jiang1*, Wei Li1, Congjie Zhai1, Fangjian Shang1, Shihao Chen1, Zengren Zhao1 and Weifang Yu2 1. Department of General Surgery, Hebei Key Laboratory of Colorectal Cancer Precision Diagnosis and Treatment, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China. 2. Department of Endoscopy Center, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China. *These authors contributed equally to this work. Corresponding authors: Prof. Zengren Zhao or Weifang Yu, The First Hospital of Hebei Medical University, Donggang Road No.89, Shijiazhuang, Hebei 050031, P.R. China; Tel: +86 0311 85917217; E-mail: [email protected] or [email protected]. © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2020.04.28; Accepted: 2020.08.04; Published: 2020.08.18 Abstract Purpose: We recently reported that tripartite motif-containing 67 (TRIM67) activates p53 to suppress colorectal cancer (CRC). However, the function and mechanism of TRIM67 in the inhibition of CRC cell proliferation and metastasis remains to be further elucidated. Methods: We detected the expression of TRIM67 in CRC tissues compared with normal tissues and confirmed its relationship with clinicopathological features. -
PRKACA Mediates Resistance to HER2-Targeted Therapy in Breast Cancer Cells and Restores Anti-Apoptotic Signaling
Oncogene (2015) 34, 2061–2071 © 2015 Macmillan Publishers Limited All rights reserved 0950-9232/15 www.nature.com/onc ORIGINAL ARTICLE PRKACA mediates resistance to HER2-targeted therapy in breast cancer cells and restores anti-apoptotic signaling SE Moody1,2,3, AC Schinzel1, S Singh1, F Izzo1, MR Strickland1, L Luo1,2, SR Thomas3, JS Boehm3, SY Kim4, ZC Wang5,6 and WC Hahn1,2,3 Targeting HER2 with antibodies or small molecule inhibitors in HER2-positive breast cancer leads to improved survival, but resistance is a common clinical problem. To uncover novel mechanisms of resistance to anti-HER2 therapy in breast cancer, we performed a kinase open reading frame screen to identify genes that rescue HER2-amplified breast cancer cells from HER2 inhibition or suppression. In addition to multiple members of the MAPK (mitogen-activated protein kinase) and PI3K (phosphoinositide 3-kinase) signaling pathways, we discovered that expression of the survival kinases PRKACA and PIM1 rescued cells from anti-HER2 therapy. Furthermore, we observed elevated PRKACA expression in trastuzumab-resistant breast cancer samples, indicating that this pathway is activated in breast cancers that are clinically resistant to trastuzumab-containing therapy. We found that neither PRKACA nor PIM1 restored MAPK or PI3K activation after lapatinib or trastuzumab treatment, but rather inactivated the pro-apoptotic protein BAD, the BCl-2-associated death promoter, thereby permitting survival signaling through BCL- XL. Pharmacological blockade of BCL-XL/BCL-2 partially abrogated the rescue effects conferred by PRKACA and PIM1, and sensitized cells to lapatinib treatment. These observations suggest that combined targeting of HER2 and the BCL-XL/BCL-2 anti-apoptotic pathway may increase responses to anti-HER2 therapy in breast cancer and decrease the emergence of resistant disease.