DOCSLIB.ORG

Evolution and Regulatory Role of the Hexokinases

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Evolution and Regulatory Role of the Hexokinases Biochimica et Biophysica Acta 1401Ž. 1998 242±264 View metadata, citation and similar papers at core.ac.uk brought to you by CORE Review provided by Elsevier - Publisher Connector Evolution and regulatory role of the hexokinases Marõa Luz Cardenas a, Athel Cornish-Bowden a,), Tito Ureta b a Institut Federatif Biologie Structurale et Microbiologie, Laboratoire de Chimie Bacterienne,  Centre National de la Recherche Scientifique, 31 chemin Joseph-Aiguier, 13402 Marseille Cedex 20, France b Departamento de Biologõa, Facultad de Ciencias, UniÕersidad de Chile, Casilla 653, Santiago, Chile Received 19 September 1997; revised 24 November 1997; accepted 27 November 1997 Keywords: Evolution; Hexokinase; Glucokinase Contents 1. Introduction ................................................... 243 2. General characteristics of glucose-phosphorylating enzymes ...................... 243 2.1. Isoenzymes ................................................ 243 2.2 Sugar specificity ............................................. 243 2.3 Specificity of the putative ancestral hexokinase........................... 245 2.4 Hexokinases and transporters ..................................... 246 2.5 Nucleotide triphosphate specificity .................................. 248 2.6 Molecular mass.............................................. 248 2.7 Hexokinase DŽ. or glucokinase? .................................... 249 3. Functional organization of the hexokinases ................................ 250 3.1 Inhibition by glucose 6-phosphate................................... 250 3.2 Two active sites on hexokinase B: kinetic consequences ..................... 252 3.3 Inhibition of hexokinase C by excess glucose ............................ 253 3.4 Functional adaptation of the rat isoenzymes ............................. 254 4. Similarities in primary structure of hexokinases ............................. 255 4.1 Rat isoenzymes .............................................. 255 4.2 Low molecular mass hexokinases ................................... 257 4.3 Phylogenetic relationships between hexokinases .......................... 258 4.4 Structural similarities with other proteins .............................. 259 5. Acknowledgements .............................................. 261 References ..................................................... 261 ) Corresponding author. Fax: q33-491-71-89-14; E-mail: [email protected] 0167-4889r98r$19.00 q 1998 Elsevier Science B.V. All rights reserved. PII S0167-4889Ž. 97 00150-X M.L. Cardenas et al.rBiochimica et Biophysica Acta 1401() 1998 242±264 243 1. Introduction isoenzymes were first reported in rodent liverwx 14±18 , but appear to be characteristic of all animals, includ- The hexokinase-catalysed phosphorylation of glu- ing the humanwx 19,20 . Isoenzymes have also been cose by ATP occurs in all eukaryotic cells as the first found in green plantswx 21 and in several, but not all, step in the utilization of glucose, and the reaction is invertebrate species so far examinedwx 7 . Vertebrate also widespread in prokaryotic cells; the subsequent tissues contain up to four isoenzymes, designated as steps vary, as the glucose 6-phosphate formed in the hexokinases A, B, C and Dwx 18 on the basis of their first step may have different metabolic fates in differ- electrophoretic mobility; the alternative names hexok- ent types of cell and in different physiological condi- inases types I, II, III and IV, respectively, given by tions. Much information on hexokinases from differ- Katzen et al.wx 22 , are in widespread use; hexokinase ent species has accumulated since the pioneering DŽ. or IV is often called `glucokinase', but, as we work of Meyerhofwx 1 on yeast hexokinase, and there shall discuss in Section 2.7, this name is unfortunate are reviews on various aspects, including kinetics, because the four isoenzymes do not differ in their structure, and geneticswx 2±9 . specificity for glucose. Glucose is the preferred substrate of the hexoki- Comparisons between the isoenzymes from vari- nases, but they can also phosphorylate other hexoses ous sources has led several groups to suggest that to varying degrees, as recognized by the recom- evolution of the vertebrate hexokinases involved du- mended name of hexokinaseŽ ATP:D-hexose 6-phos- plication and fusion of an ancestral hexokinase of 50 photransferase, EC 2.7.1.1. Only a few species, es- kDa that resembled the present-day yeast hexokinases pecially bacteria, are known to contain true glucoki- and mammalian hexokinase D in sizewx 4,7,9,23±26 . nasesŽ ATP:D-glucose 6-phosphotransferase, EC We shall discuss this question in Section 4. 2.7.1.2. , i.e., enzymes specific for glucosewx 7 . Hexokinases from different species differ in 2.2. Sugar specificity molecular mass and tissue distribution, and the en- zyme often exists as a mixture of isoenzymes that It is widely believed that specificity has increased differ in kinetic characteristics and molecular mass. during evolution, i.e., that the more specific enzymes In this review, we first give a broad picture of the evolved from less specific ancestral proteinswx 27±29 , general characteristics of the hexokinases in different but one should not expect from this that the simpler phyla; we discuss whether a single kinetic model can modern organisms will have less specific enzymes be used to rationalize the kinetic and regulatory than the more complex organisms, because all mod- properties of the hexokinases; finally, we examine ern organisms have evolved to a high degree of similarities in primary structures and on the basis of efficiency in occupying particular ecological niches. sequence alignments propose a phylogenetic tree and As we will discuss in Section 3.4, at least three of the model of molecular evolution to explain it. four hexokinase isoenzymes in the rat have kinetic properties that correlate well with the functions of the organs in which they predominate, and there is no 2. General characteristics of glucose-phosphorylat- reason to doubt that a similar degree of adaptation ing enzymes exists in other organisms. Explanation for any differ- ences in enzyme specificity between different types 2.1. Isoenzymes of organisms should therefore be sought in differ- ences in their present-day requirements and not in Multiple hexokinases were first demonstrated in any supposed closeness to their ancestors. yeastwx 10 , which has three isoenzymes, hexokinases Examination of the glucose phosphorylating en- wx PIIIŽ. or A and P Ž. or B , and glucokinase 2,11±13 . zymes across the phylaŽ. Table 1 shows substantial The existence of distinct isoenzymes was shown not variation in hexose specificity, with the more specific only in diploid strains, in which hexokinases PI and enzymes found generally in the simpler organisms; PII could have been dismissed as allelic variants, but animals lack enzymes with high specificity for phos- also in haploid strainswx 12,13 . In animals, hexokinase phorylation of glucose, mannose or fructose at posi- 244 M.L. Cardenas et al.rBiochimica et Biophysica Acta 1401() 1998 242±264 Table 1 Specificity of hexokinases in different organisms Taxon High specificity Intermediate specificity Low specificity Archaeaa Pyrococcus furiosus wx30 Bacteriab Streptococcus mutans wx31 Leuconostoc meserentoides wx32 Escherichia coli wx33 E. coli wx34 Streptomyces Õiolaceruber wx35 Bacillus stearothermophilus wx36 E. coli wx37 Zymomonas mobilis wx38 Aerobacter aerogenes wx39 Rhodospirillum rubrum wx40 Pseudomonas saccharophila wx41 BreÕibacterium fuscum wx42 Lower eukaryotes Euglena gracilis wx43 Saccharomyces cereÕisiae w11,44 xSac. cereÕisiae wx45 Dictyostelium discoideum wx46 Torulopsis holmii wx47 Neurospora crassa wx48 Candida sp.wx 49 Saprolegnia litoralis wx40 Entamoeba histolytica wx50 Sap. litoralis wx40 Trypanosoma equiperdum wx51 Green plants Peaswx 52 Wheat w 53,54 x Animals Lobsterwx 55 Vertebrates w 4,56 x aThe Archaea were formerly called Archaebacteria. The more recent name reflects recognition that these organisms constitute a domain of life distinct from the bacteriawx 57 . bThe Bacteria were known as Eubacteria during the period when the Archaea were regarded as members of the same kingdomwx 57 . tion 6, whereas bacteria, apart from E. coli wx33 , have 2-deoxyglucose; however, unlike them and all other no unspecific hexokinases, and all of those that have known hexokinases it uses ADP as phosphate donor been described are either highly specific or at least Ž.and hence has AMP as a product and has no more specific than the enzymes of higher animals. detectable activity with ATP or other potential donors Prokaryotes and lower eukaryotes typically contain such as GDP or pyrophosphate. The authors suggest a series of specific hexokinases that each act on one that the specificity for ADP is related to the ability of hexose only, normally glucose, mannose or fructose; the organism to activate sugars after a period of in Pse. saccharophila, for example, glucokinase, starvation, i.e., in conditions of very low energy fructokinase and mannokinase exist as separate en- charge. By contrast, the thermoacidophile Sulfolobus zymeswx 41 , and various other organisms have spe- solfataricus appears to use ATP, but the enzyme cific glucokinases, such as E. coli wx34 , Z. mobilis responsible was studied only in cell homogenates, wx38,58 , B. stearothermophilus w36,59,60 x , Myxococ- and although these homogenates could also phospho- cus coralloides wx61 , S. mutans wx31 , A. aerogenes rylate fructose there
Load more

Recommended publications
  • Fluorinated Mannosides Inhibit Cellular Fucosylation
    Fluorinated mannosides inhibit cellular fucosylation. Johan F.A. Pijnenborg[a],†, Emiel Rossing[a],†, Marek Noga[b], Willem Titulaer[a], Raisa Veizaj[c], Dirk J. Lefeber[b,c] and Thomas J. Boltje*[a] [a] J.F.A. Pijnenborg, E. Rossing, W. Titulaer, Dr. T.J. Boltje Department of Synthetic Organic Chemistry Institute for Molecules and Materials, Radboud University Heyendaalseweg 135, 6525AJ, Nijmegen, The Netherlands [email protected] [b] Dr. M. Noga, Prof. D.J. Lefeber Department of Laboratory Medicine, Translational Metabolic Laboratory Radboud Institute for Molecular Life Sciences, Radboud University Medical Center Geert Grooteplein Zuid 10, 6525GA, Nijmegen, The Netherlands [c] R. Veizaj, Prof. D.J. Lefeber Department of Neurology Donders Institute for Brain, Cognition and Behavior, Radboud University Medical Center Geert Grooteplein Zuid 10, 6525GA, Nijmegen, The Netherlands [†] These authors contributed equally to this work. Supporting information for this article is given via a link at the end of the document. Abstract: Fucose sugars are expressed on mammalian cell L-Fucose (Fuc) is a 6-deoxyhexose expressed at the termini of glycan membranes as part of glycoconjugates and mediates essential chains that decorate cell surface proteins and lipids.1 The fucose physiological processes. The aberrant expression of fucosylated residues on glycoconjugates are essential mediators of physiological glycans has been linked to pathologies such as cancer, inflammation, processes. For example, the fucose moiety in the tetrasaccharide infection, and genetic disorders. Tools to modulate fucose expression sialyl Lewisx (sLex) expressed on leukocytes is recognized by selectin on living cells are needed to elucidate the biological role of fucose receptors that regulate leukocyte recruitment and extravasation.
    [Show full text]
  • An Atpase Domain Common to Prokaryotic Cell Cycle Proteins
    Proc. Natl. Acad. Sci. USA Vol. 89, pp. 7290-7294, August 1992 Biochemistry An ATPase domain common to prokaryotic cell cycle proteins, sugar kinases, actin, and hsp7O heat shock proteins (structural comparison/property pattern/remote homology) PEER BORK, CHRIS SANDER, AND ALFONSO VALENCIA European Molecular Biology Laboratory, D-6900 Heidelberg, Federal Republic of Germany Communicated by Russell F. Doolittle, March 6, 1992 ABSTRACT The functionally diverse actin, hexokinase, and hsp7O protein families have in common an ATPase domain of known three-dimensional structure. Optimal superposition ofthe three structures and alignment ofmany sequences in each of the three families has revealed a set of common conserved residues, distributed in five sequence motifs, which are in- volved in ATP binding and in a putative interdomain hinge. From the multiple sequence aliment in these motifs a pattern of amino acid properties required at each position is defined. The discriminatory power of the pattern is in part due to the use of several known three-dimensional structures and many sequences and in part to the "property" method ofgeneralizing from observed amino acid frequencies to amino acid fitness at each sequence position. A sequence data base search with the pattern significantly matches sugar kinases, such as fuco-, glucono-, xylulo-, ribulo-, and glycerokinase, as well as the prokaryotic cell cycle proteins MreB, FtsA, and StbA. These are predicted to have subdomains with the same tertiary structure as the ATPase subdomains Ia and Ha of hexokinase, actin, and Hsc7O, a very similar ATP binding pocket, and the capacity for interdomain hinge motion accompanying func- tional state changes.
    [Show full text]
  • Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis
    Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2010 Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis Ryan Fassnacht Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Physiology Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/2246 This Thesis is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Ryan C. Fassnacht 2010 All Rights Reserved Molecular Mechanisms Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at Virginia Commonwealth University. by Ryan Christopher Fassnacht, B.S. Hampden Sydney University, 2005 M.S. Virginia Commonwealth University, 2010 Director: Valeria Mas, Ph.D., Associate Professor of Surgery and Pathology Division of Transplant Department of Surgery Virginia Commonwealth University Richmond, Virginia July 9, 2010 Acknowledgement The Author wishes to thank his family and close friends for their support. He would also like to thank the members of the molecular transplant team for their help and advice. This project would not have been possible with out the help of Dr. Valeria Mas and her endearing
    [Show full text]
  • Non-Homologous Isofunctional Enzymes: a Systematic Analysis Of
    Omelchenko et al. Biology Direct 2010, 5:31 http://www.biology-direct.com/content/5/1/31 RESEARCH Open Access Non-homologousResearch isofunctional enzymes: A systematic analysis of alternative solutions in enzyme evolution Marina V Omelchenko, Michael Y Galperin*, Yuri I Wolf and Eugene V Koonin Abstract Background: Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. Results: We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress.
    [Show full text]
  • Polymerase Ribozyme with Promoter Recognition
    In vitro Evolution of a Processive Clamping RNA Polymerase Ribozyme with Promoter Recognition by Razvan Cojocaru BSc, Simon Fraser University, 2014 Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in the Department of Molecular Biology and Biochemistry Faculty of Science © Razvan Cojocaru 2021 SIMON FRASER UNIVERSITY Summer 2021 Copyright in this work is held by the author. Please ensure that any reproduction or re-use is done in accordance with the relevant national copyright legislation. Declaration of Committee Name: Razvan Cojocaru Degree: Doctor of Philosophy Title: In vitro Evolution of a Processive Clamping RNA Polymerase Ribozyme with Promoter Recognition Committee: Chair: Lisa Craig Professor, Molecular Biology and Biochemistry Peter Unrau Supervisor Professor, Molecular Biology and Biochemistry Dipankar Sen Committee Member Professor, Molecular Biology and Biochemistry Michel Leroux Committee Member Professor, Molecular Biology and Biochemistry Mani Larijani Internal Examiner Associate Professor, Molecular Biology and Biochemistry Gerald Joyce External Examiner Professor, Jack H. Skirball Center for Chemical Biology and Proteomics Salk Institute for Biological Studies Date Defended/Approved: August 12, 2021 ii Abstract The RNA World hypothesis proposes that the early evolution of life began with RNAs that can serve both as carriers of genetic information and as catalysts. Later in evolution, these functions were gradually replaced by DNA and enzymatic proteins in cellular biology. I start by reviewing the naturally occurring catalytic RNAs, ribozymes, as they play many important roles in biology today. These ribozymes are central to protein synthesis and the regulation of gene expression, creating a landscape that strongly supports an early RNA World.
    [Show full text]
  • Supplementary Material Gram-Scale Production of Sugar Nucleotides And
    Electronic Supplementary Material (ESI) for Green Chemistry. This journal is © The Royal Society of Chemistry 2021 Supplementary Material Gram-scale production of sugar nucleotides and their derivatives Shuang Li[a]#, Shuaishuai Wang[b]#, Yaqian Wang[a], Jingyao Qu[c], Xian-wei Liu[a], Peng George Wang[d], and Junqiang Fang*[a] [a] Junqiang Fang, Shuang Li, Yaqian Wang, Xian-wei Liu National Glycoengineering Research Center, Shandong Provincial Key Laboratory of Glycochemistry and Glycobiology, Shandong University, Qingdao, Shandong 266237, People’s Republic of China *Email: [email protected] [b] Shuaishuai Wang Department of Chemistry, George State University, Atlanta, GA, 30302-4098, US [c] Jingyao Qu State Key Laboratory of Microbial Technology, Shandong University, Qingdao, Shandong 266237, People’s Republic of China [d] Peng George Wang School of Medicine, Southern University of Science and Technology, Shenzhen, Guangdong 518055, People’s Republic of China # These authors contributed equally to this paper. I. Supplementary Figures..................................................................................................................................1 Figure S1. Effects of GlcNAc substrate concentration on conversion rate of UDP-GlcNAc......................1 Figure S2. Effect of buffer sytem on enzymatic conversion rate of UDP-GlcNAc.....................................1 Figure S3. Evaluation of recovery and recyclability of enzymes for UDP-GlcNAc...................................1 Table S1. Enzymes used in this work
    [Show full text]
  • Supplementary Materials
    Supplementary Materials Figure S1. Differentially abundant spots between the mid-log phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 3. Figure S2. Differentially abundant spots between the stationary phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 4. S2 Table S1. Summary of the non-polysaccharide degrading proteins identified in the B. proteoclasticus cytosol by 2DE/MALDI-TOF. Protein Locus Location Score pI kDa Pep. Cov. Amino Acid Biosynthesis Acetylornithine aminotransferase, ArgD Bpr_I1809 C 1.7 × 10−4 5.1 43.9 11 34% Aspartate/tyrosine/aromatic aminotransferase Bpr_I2631 C 3.0 × 10−14 4.7 43.8 15 46% Aspartate-semialdehyde dehydrogenase, Asd Bpr_I1664 C 7.6 × 10−18 5.5 40.1 17 50% Branched-chain amino acid aminotransferase, IlvE Bpr_I1650 C 2.4 × 10−12 5.2 39.2 13 32% Cysteine synthase, CysK Bpr_I1089 C 1.9 × 10−13 5.0 32.3 18 72% Diaminopimelate dehydrogenase Bpr_I0298 C 9.6 × 10−16 5.6 35.8 16 49% Dihydrodipicolinate reductase, DapB Bpr_I2453 C 2.7 × 10−6 4.9 27.0 9 46% Glu/Leu/Phe/Val dehydrogenase Bpr_I2129 C 1.2 × 10−30 5.4 48.6 31 64% Imidazole glycerol phosphate synthase Bpr_I1240 C 8.0 × 10−3 4.7 22.5 8 44% glutamine amidotransferase subunit Ketol-acid reductoisomerase, IlvC Bpr_I1657 C 3.8 × 10−16
    [Show full text]
  • Yeast Genome Gazetteer P35-65
    gazetteer Metabolism 35 tRNA modification mitochondrial transport amino-acid metabolism other tRNA-transcription activities vesicular transport (Golgi network, etc.) nitrogen and sulphur metabolism mRNA synthesis peroxisomal transport nucleotide metabolism mRNA processing (splicing) vacuolar transport phosphate metabolism mRNA processing (5’-end, 3’-end processing extracellular transport carbohydrate metabolism and mRNA degradation) cellular import lipid, fatty-acid and sterol metabolism other mRNA-transcription activities other intracellular-transport activities biosynthesis of vitamins, cofactors and RNA transport prosthetic groups other transcription activities Cellular organization and biogenesis 54 ionic homeostasis organization and biogenesis of cell wall and Protein synthesis 48 plasma membrane Energy 40 ribosomal proteins organization and biogenesis of glycolysis translation (initiation,elongation and cytoskeleton gluconeogenesis termination) organization and biogenesis of endoplasmic pentose-phosphate pathway translational control reticulum and Golgi tricarboxylic-acid pathway tRNA synthetases organization and biogenesis of chromosome respiration other protein-synthesis activities structure fermentation mitochondrial organization and biogenesis metabolism of energy reserves (glycogen Protein destination 49 peroxisomal organization and biogenesis and trehalose) protein folding and stabilization endosomal organization and biogenesis other energy-generation activities protein targeting, sorting and translocation vacuolar and lysosomal
    [Show full text]
  • K319-100 Gluconokinase Activity Assay Kit (Colorimetric)
    FOR RESEARCH USE ONLY! Gluconokinase Activity Assay Kit (Colorimetric) 7/16 (Catalog # K319-100; 100 assays; Store at -20°C) I. Introduction: Gluconokinase (ATP:D-gluconate 6-phosphotransferase or Gluconate Kinase; EC:2.7.1.12) is a key enzyme for Gluconate degradation pathway. In E. coli and yeast, Gluconokinase can convert gluconate into 6-Phosphate-D-Gluconate in an ATP dependent manner. Through Hexose Monophosphate Shunt (HMS) pathway, 6-Phosphate-D-Gluconate generates ribose-6-phosphate, which is critical for nucleotides and nucleic acid synthesis. Little is known of the mechanism of gluconate metabolism in humans despite its widespread use in medicine and consumer products. BioVision’s Gluconokinase Assay kit provides a quick and easy way for monitoring Gluconokinase activity in a variety of samples. In this kit, Gluconokinase converts Gluconate into 6-Phosphate-D-Gluconate in an ATP dependent manner. 6-Phosphate-D-Gluconate and ADP in turn undergoe a series of reactions to form an intermediate, which reacts with the probe to form a colored product with strong absorbance (OD 450 nm). The assay is simple, sensitive, and high-throughput adaptable. Detection limit: < 0.1mU. Gluconokinase D-Gluconate + ATP 6-Phosphate-D-Gluconate + ADP Intermediate + Probe Color Product (OD 450 nm) II. Application: Measurement of Gluconokinase activity in various samples Mechanistic study of Pentose Phosphate Pathway III. Sample Type: Prokaryote such as: E.coli Animal tissues such as liver, kidney, etc. Adherent or suspension cells. IV. Kit Contents: Components K319-100 Cap Code Part Number Gluconokinase Assay Buffer 25 ml WM K319-100-1 Gluconokinase Substrate 1 Vial Blue K319-100-2 ATP 1 Vial Orange K319-100-3 Gluconokinase Converting Enzyme 1 Vial Purple K319-100-4 Gluconokinase Developer 1 Vial Green K319-100-5 Gluconokinase Probe 1 Vial Red K319-100-6 NADH Standard 1 Vial Yellow K319-100-7 Gluconokinase Positive Control 1 Vial Brown K319-100-8 V.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • The Role of the Salvage Pathway in Nucleotide Sugar Biosynthesis
    THE ROLE OF THE SALVAGE PATHWAY IN NUCLEOTIDE SUGAR BIOSYNTHESIS: IDENTIFICATION OF SUGAR KINASES AND NDP-SUGAR PYROPHOSPHORYLASES by TING YANG (Under the Direction of Maor Bar-Peled) ABSTRACT The synthesis of polysaccharides, glycoproteins, glycolipids, glycosylated secondary metabolites and hormones requires a large number of glycosyltransferases and a constant supply of nucleotide sugars. In plants, photosynthesis and the NDP-sugar inter-conversion pathway are the major entry points to form NDP-sugars. In addition to these pathways is the salvage pathway, a less understood metabolism that provides the flux of NDP-sugars. This latter pathway involves the hydrolysis of glycans to free sugars, sugar transport, sugar phosphorylation and nucleotidylation. The balance between glycan synthesis and recycling as well as its regulation at various plant developmental stages remains elusive as many of the molecular components are unknown. To understand how the salvage pathway contributes to the sugar flux and cell wall biosynthesis, my research focused on the functional identification of salvage pathway sugar kinases and NDP-sugar pyrophosphorylases. This research led to the first identification and enzymatic characterization of galacturonic acid kinase (GalA kinase), galactokinase (GalK), a broad UDP-sugar pyrophosphorylase (sloppy), two promiscuous UDP-GlcNAc pyrophosphorylases (GlcNAc-1-P uridylyltransferases), as well as UDP-sugar pyrophosphorylase paralogs from Trypanosoma cruzi and Leishmania major. To evaluate the salvage pathway in plant biology, we further investigated a sugar kinase mutant: galacturonic acid kinase mutant (galak) and determined if and how galak KO mutant affects the synthesis of glycans in Arabidopsis. Feeding galacturonic acid to the seedlings exhibited a 40-fold accumulation of free GalA in galak mutant, while the wild type (WT) plant readily metabolizes the fed-sugar.
    [Show full text]