Genetic Analysis of Saccharomyces Cerevisiae Strains Isolated from Palm Wine in Eastern Nigeria

Genetic analysis of Saccharomyces cerevisiae strains isolated from Palm Wine in Eastern Nigeria. Comparison with other African strains. O.U. Ezeronye, Jean Luc Legras

To cite this version:

O.U. Ezeronye, Jean Luc Legras. Genetic analysis of Saccharomyces cerevisiae strains isolated from Palm Wine in Eastern Nigeria. Comparison with other African strains.. Journal of Applied Microbi- ology, Wiley, 2009, 106 (5), pp.1569-1578. 10.1111/j.1365-2672.2008.04118.x. hal-02668435

HAL Id: hal-02668435 https://hal.inrae.fr/hal-02668435 Submitted on 31 May 2020

HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Journal of Applied Microbiology ISSN 1364-5072

ORIGINAL ARTICLE Genetic analysis of Saccharomyces cerevisiae strains isolated from palm wine in eastern Nigeria. Comparison with other African strains O.U. Ezeronye1 and J.-L. Legras2

1 Michael Okpara University of Agriculture, Umudike, Nigeria 2 INRA ⁄ ULP, UMR Sante´ de la Vigne et Qualite´ du Vin, Colmar, France

Keywords Abstract microsatellite, molecular polymorphism, palm wine, yeast. Aims: To study the yeast diversity of Nigerian palm wines by comparison with other African strains. Correspondence Methods and Results: Twenty-three Saccharomyces cerevisiae strains were Jean-Luc Legras, INRA ⁄ ULP, UMR Sante´ de la obtained from palm wine samples collected at four locations in eastern Nigeria, Vigne et Qualite´ du Vin, 28 rue de and characterized using different molecular techniques: internal transcribed Herrlisheim, BP 20507, Colmar Cedex 68021, spacer restriction fragment length polymorphism and sequence analysis, pulsed France. E-mail: [email protected] field gel electrophoresis, inter delta typing and microsatellite multilocus analy- This paper is dedicated to the memory of sis. These techniques revealed that palm wine yeasts represent a group of Prof. O.U. Ezeronye (1954–2007). closely related strains that includes other West African isolates (CBS400, NCYC110, DVPG6044). Population analysis revealed an excess of homozygote 2008 ⁄ 0975: received 9 June 2008, revised 11 strains and an allelic richness similar to wine suggestive of local domestication. October 2008 and accepted 17 October 2008 Several other African yeast strains were not connected to this group. Ghana doi:10.1111/j.1365-2672.2008.04118.x sorghum beer strains and other African strains (DBVPG1853 and MUCL28071) displayed strikingly high relatedness with European bread, beer or wine strains, and the genome of strain MUCL30909 contained African and wine-type alleles, indicating its hybrid origin. Conclusions: Nigerian palm wine yeast represents a local specific yeast flora, whereas a European origin or hybrid was suspected for several other Africa isolates. Significance and Impact of the Study: This study presents the first genetic characterization of an autochthonous African palm wine yeast population and confirms the idea that human intervention has favoured yeast migration.

incision into the phloem vessel of the tree. The palm sap Introduction is transparent and contains fermentable sugars at levels Palm wine is an alcoholic drink obtained by fermenting up to 90 g ⁄ l (Faparusi 1981; Eze and Ogan 1988; the sugary sap of the oil palm tree Elaeis guianeensis or of Obahiagbon and Osagie 2007), whereas palm wine is raffia palms (Raphia hookeri and Raphia vinifera). This milky-white and effervescent because of the presence of alcoholic beverage is extremely popular in Nigeria and live bacteria and yeasts (Okafor 1975) resulting from West and Central Africa, where it plays an important role natural spontaneous fermentation. Palm wine contains up in popular culture. to 3–4% alcohol, depending on the stage of fermentation Raffia palm sap is obtained by tapping the palm, which at which it is consumed. leads to the death of the tree. When the Raffia palm Numerous studies have been carried out on different begins to blossom, the palm wine tapper climbs up the aspects of palm wine production, microbiological quality tree and excises the new inflorescence, making a deep and preservation (Okafor 1978; Ojimelukwe 2001; Morah

ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 1 Genetic analysis of palm wine Saccharomyces cerevisiae O.U. Ezeronye and J.-L. Legras

1995; Agu et al. 1999; Uzochukwu et al. 1999; Amoa- the genetic diversity of palm wine yeasts that were briefly Awua et al. 2007; Ogbulie et al. 2007). These studies described by Legras et al. (2007). Twenty-three isolates revealed considerable diversity amongst yeast species, were obtained from 13 palm wine fermentations and resulting from the natural flora of the palms, visiting identified using internal transcribed spacer PCR-restric- insects such as Drosophilia melanogaster and the tapping tion fragment length polymorphism (ITS PCR-RFLP) and equipment employed (Faparusi 1973). Faparusi (1973) sequencing. Electrophoretic karyotyping, interdelta typing showed that yeasts are present in the stalk, spathe and and microsatellite (SSRs) typing (Blondin and Vezinhet floret of palm trees. Some of the yeasts and fungi identi- 1988; Yamamoto et al. 1991; Ness et al. 1993 modified by fied in palm wine include Schizosaccharomyces pombe, Legras and Karst 2003; Legras et al. 2005) were used to Pichia pastoris, Candida species (Faparusi 1974) and assess the diversity of yeast isolates. These analyses members of the Saccharomyces sensu stricto group. How- allowed us to draw some conclusions concerning yeast ever, by comparison with other yeasts, Saccharomyces populations in palm wine from various parts of eastern cerevisiae strains were rarely found on the floret (Faparusi Nigeria, compared with some other African strains. 1973). As well as the fungal microflora, bacteria also contribute significantly to the final quality of palm wine. Material and methods Lactic acid bacteria are responsible for the lowering the pH from about 7–4 (thus gradually souring the taste) and Yeast strains also for synthesis of the gums that give palm wine its specific texture. Twenty-three Nigerian palm wine yeast isolates were A similar, marked diversity of yeast genera has been obtained from 13 fresh palm wine samples collected ran- reported in the context of traditional wine making and domly from different locations in the eastern states of cider fermentation in Europe. Furthermore, the large Nigeria during the years 2002 and 2004, on the first day number of studies carried out during the past 20 years of alcoholic fermentation. Conventional mycological have also revealed the broad diversity of S. cerevisiae techniques were used to isolate the yeasts (Beech and strains isolated during fermentation (Versavaud et al. Davenport 1971; Barnett et al. 1983). Table 1 shows the 1995; Esteve-Zarzoso et al. 2000; Sabate et al. 2002; different yeast strains used during the study and their Morrissey et al. 2004) that may explain their variable origins. The other strains analysed (wine, laboratory or physiological properties. However, only a few genetic beer strains) were obtained from our own collection, studies have so far focused on yeast strains isolated from institutional collections (MUCL, CBS) or from Prof. from palm wine, revealing a degree of diversity with Ed J. Louis’ laboratory, Nottingham University (strains respect to genetic and physiological properties (Owu- from the Saccharomyces Genome Resequencing Project ama and Saunders 1990; Ezeronye and Okerentugba (SGRP), http://www.sanger.ac.uk/Teams/Team71/durbin/ 2000, 2002). sgrp/index.shtml). We performed microsatellite multilo- Understanding the biological process of palm wine cus typing on four clones of MUCL30909 and obtained fermentation is essential if improvements are to be the same profile, thus confirming the purity of the strain. made to traditional technologies. As a consequence, assessing the diversity of the local yeasts responsible for DNA extraction alcoholic fermentation is a prerequisite. All taxonomic studies to date on palm wine yeast microflora have Yeast cultures were grown in 10 ml YPD medium for been performed using conventional yeast identification 24 h in a shake flask incubator at 28C, and DNA methods based on the morphology, sporulation and extraction was performed as described by Legras and physiological activity of yeasts. The recent development Karst 2003. of PCR-based techniques has provided opportunities for yeast strain identification and enables a substantial Species identification reduction in the time required when compared to other molecular techniques (Legras and Karst 2003; Lopez Species were identified by amplification and RFLP anal- et al. 2003). And despite the global trends and develop- ysis of the 5Æ8S-ITS region (Esteve-Zarzoso et al. 1999). ments in yeast taxonomy, little molecular work has PCR products were digested without further purification been done on palm wine yeast (Fay and Benavides with three restriction enzymes: HaeIII, Hinf1 and Dra1 2005). (MBI Fermentas, Lithuania). Amplified PCR products In a recent study (Legras et al. 2007), we described the and their restriction fragments were separated by importance of the technological and geographic origins of electrophoresis on 2% agarose gels subjected to 150 V yeast to its genetic make-up. This study thus focuses on for 1 h in a 1x Tris-Borate-EDTA buffer (TBE:

ª 2009 The Authors 2 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology O.U. Ezeronye and J.-L. Legras Genetic analysis of palm wine Saccharomyces cerevisiae

Table 1 Strains analyzed during this study (CBS: Centraalbureau voor Schimmelcultures (CBS)- Netherlands; MUCL: Louvain, Belgium, DVPBG: Industrial Yeasts Collection, Dipartimento di Biologia Vegetale e Biotecnologia Agroambientale, Universita di Perugia, Italy.)

Origin Location ⁄ Special quality ITS Accession No

Yeast strains NPA30, NPA31, NPA33 Palm wine sample 3 Aba, Abia State 2002, AM900396 NPA041 Palm wine sample 4 Nigeria NPA5a1, NPA5b1, Palm wine sample 5 NPA5d1, NPA5d2 NPA61, NPA62 Palm wine sample 6 NPA71, NPA72 Palm wine sample 7 NPA81 Palm wine sample 8 NPAB21, NPAB22 Palm wine sample nB2 Isiala Ngwa, Abia State NPAB33, NPAB314 Palm wine sample B3 2004, Nigeria NPCR27 Palm wine sample C2 Uyo, Cross River AM900394 NPCR414, NPCR415 Palm wine sample C4 State 2004, Nigeria NPCR51 Palm wine sample C5 NPDR234 Palm wine sample D2 Ikwuano ⁄ Oboro, Abia AM900395 NPDR47 Palm wine sample D4 State 2004, Nigeria Other African strains CBS8856, CBS8857, Sorghum Beer Ghana AM900399 CBS8858, CBS8859 MUCL28071 Banana wine Burundi AM900403 MUCL27815 ⁄ CBS 400 Palm wine Ivory Coast AM900397 MUCL30909 Fermented Cassava Burundi AM900400, AM900401, AM900402 DBVPG1853 White Tecc Ethiopia DBVPG6044 Bili wine West Africa NCYC110 Ginger beer from Z. ofﬁcinale West Africa DBVPG1853 White Tecc Ethiopia Strains from other sources FL100 ( = ATCC 28383) Laboratory strain UMRSVQV, Colmar, France S288C ( = ATCC 26108 Laboratory strain UMRSVQV, Colmar, France CLIB227 ( = CBS1171 Beer. Neo type strain Netherlands AM900404, AM900405, AM900406 CLIB319 Bakery France AM900398 CIVC8130 Wine Champagne, France AM900407 58W3 Wine Alsace, France AM900408, AM900409 Eg12 Wine Alsace, France

) ) 90 mmol l 1 Tris-Borate, 2 mmol l 1 EDTA). ITS products were analysed by electrophoresis in 2% weight sequences were obtained after direct amplification. In per volume (w ⁄ v) agarose gel in 1· TBE buffer. the case of mixtures of several sequences, the PCR products were cloned using the CloneJet Kit (MBI Fer- Microsatellite analysis mentas) and four clones were sequenced. All sequences can be obtained from Genebank (AM900394 to To achieve this analysis, 12 microsatellite loci (Legras et al. AM900409). 2007) were combined in two sets of six loci (Table 2) and amplified using a multiplex PCR kit (Qiagen, Courtaboeuf, France). PCR reactions were run in a final volume of Interdelta sequence analysis 12Æ5 ll containing 10–250 ng yeast DNA. Amplification PCR amplification reactions were performed in a final was performed using a Stratagene thermal cycler under a volume of 25 ll using a Stratagene thermal cycler three-stage temperature programme: stage one: 95 – (Amsterdam, the Netherlands), as described by Legras 15 min, stage two (34 cycles): 94 –30s,57 – 2 min, 72 and Karst (2003). The primer sequences used for – 1 min, stage three: 60 – 30 min. The matrix of Dc chord PCR were delta 12(-5¢TCAACAATGGAATCCCAAC-3¢) distances between strain pairs and trees were obtained as and delta 21(-5¢-CATCTTAACACCGTATATGA-3¢). PCR described previously (Legras et al. 2007).

ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 3 Genetic analysis of palm wine Saccharomyces cerevisiae O.U. Ezeronye and J.-L. Legras

Table 2 Characteristics of the 12 loci and primers used in the study

Locus name Motif ORF or coordinates Primers Dye Primer conc. lM

Mix 1 C5 GT VI-210250 ⁄ 210414 Fw: tgacacaatagcaatggccttca HEX 0Æ1 Rv: gcaagcgactagaacaacaatcaca C3 CAA YGL139w Fw: ctttttatttacgagcgggccat NED 0Æ3 Rv: aaatctcatgcctgtgaggggtat C8 TAA YGL014c Fw: caggtcgttctaacgttggtaaaatg FAM 0Æ1 Rv: gctgttgctgttggtagcattactgt C9 TAA YOR156c Fw: aagggttcgtaaacatataactggca FAM 0Æ1 Rv: tataagggaaaagagcacgatggc C11 GT X-518870 ⁄ 519072 Fw: ttccatcataaccgtctgggatt FAM 0Æ2 Rv: tgcctttttcttagatgggctttc YOR267c GTT YOR267c Fw: tactaacgtcaacactgctgccaa HEX 0Æ3 Rv: ggatctacttgcagtatacggg Mix 2 C4 TAA+ TAG XV-110701 ⁄ 110935 Fw: aggagaaaaatgctgtttattctgacc NED 0Æ3 Rv: ttttcctccgggacgtgaaata C6 GT XVI-485898 ⁄ 485996 Fw:gtggcatcatatctgtcaattttatcac HEX 0Æ1 Rv: caatcaagcaaaagatcggcct SCAAT1 TAA XIII-86902 ⁄ 87140 Fw: aaagcgtaagcaatggtgtagatactt HEX 0Æ1 Rv: caagcctcttcaagcatgaccttt SCAAT5 TAA XVI-897051 ⁄ 8970210 Fw: agcataattggaggcagtaaagca NED 0Æ2 Rv: tctccgtcttttttgtactgcgtg YKL172w CTT YKL172w Fw: caggacgctaccgaagctcaaaag FAM 0Æ1 Rv: acttttggccaatttctcaagat YPL009c CTT YPL009c Fw: aacccattgacctcgttactatcgt FAM 0Æ1 Rv: gctcaacttgtgatgggttttgga

FAM, 6-carboxyfluorescein; HEX, hexachlorofluorescein; NED, benzofluorotrichlorocarboxy-fluorescein (Applied Biosystem, Foster City, USA).

distances between strains. A unweighted pair group Electrophoretic karyotyping method with arithmetic average (UPGMA) tree was built Yeast cultures grown for 18 h were embedded in agarose with neighbour from the phylip package, and drawn with and subsequently digested with lyticase and proteinase K, mega (Kumar et al. 2004). as described by Blondin and Vezinhet (1988). Yeast chro- mosomes were separated by pulsed ﬁeld gel electrophore- Sequence analysis sis (PFGE) (Geneline2, Beckman), in 2% agarose gel (Fast Lane, FMC Biowhitaker). Gels were run for 6 h at 300 V Sequences were aligned with ClustalWinmega4; the with a switching interval of 30 s, and then for 18 h at distance matrix and neighbours joining tree were also 350 V, with a switching pulse of 55 s in 0Æ25x TBE buffer obtained from mega 4. at 15C. Population analysis Gel analysis Population analyses were performed on a set of 20 differ- All gels were stained after electrophoresis with ethidium ent palm wine strains that were diploid at nine loci. The bromide and subsequently scanned with a Gel Doc 1000 Hardy–Weinberg test was performed, and palm wine alle- system (Bio-Rad, Richmond, USA). Molecular weights lic richness was calculated using Fstat by comparison with were estimated by comparison with a DNA length stan- four French wine yeast groups (Alsace, Rhoˆne Valley, dard marker (PUC mix 8 Ladder, MBI Fermentas) for Montpellier, Nantes, France), as described previously interdelta typing and ITS RFLP. RFLP fragment sizes were (Legras et al. 2007). For this latter test, palm wine yeast calculated using Quantity one software (Bio-Rad). Molec- strains were separated in two groups as a function of ular analysis ﬁngerprinting software (Bio-Rad) was used sampling area (Aba and Isiala Ngwa, or Uyo and Ikwu- to compare interdelta gels and PFGE and calculate matrix ano ⁄ Oboro).

ª 2009 The Authors 4 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology O.U. Ezeronye and J.-L. Legras Genetic analysis of palm wine Saccharomyces cerevisiae

Results Strain differentiation Comparisons of these 23 palm wine strains using three Species characterization techniques (microsatellite, interdelta and karyotype typ- Restriction analysis of the 23 palm wine isolates, per- ing) allowed us to distinguish 20 genotypes. The three formed using three restriction enzymes (Hae III, DraI, techniques differed in their ability to achieve this: PFGE Hinf1) from the 5Æ8-ITS region, according to the method distinguished fewer isolates (17 ⁄ 23; Fig. 2), by compari- described by Esteve-Zarsoso et al. (1999), produced a typ- son with 20 for interdelta and microsatellite typing. Inter- ical S. cerevisiae profile, identical to S288C. In addition, delta typing generated specific profiles containing a larger the ITS sequence of three palm wine strains (NPCr415, number of bands for palm wine strains. NPDr47, NPA31) suggested that these strains were close A clustering of palm wine strains was observed with to the Ivory Coast palm wine isolate CBS400 and to other interdelta (Fig. 3) and microsatellite typing (Fig. 4), West African strains (NCYC110 and DVPG6044). How- suggesting a common genetic origin for all palm wine ever, they differed from the other S. cerevisiae strains yeasts, including both CBS 400 from Ivory Coast and analysed at the same time (Fig. 1). By contrast with these NCYC110 and DVPG6044 from West Africa. However, West African strains, we observed that the ITS sequence other African yeast strains were more distant. Ghana of Ghana sorghum strain CBS8856 ITS was close to the sorghum beer strains were close to bread strains, as ITS sequences of beer, wine and bread strains. Of the seen from interdelta PCR or microsatellite typing as three remaining Central or East Africa strains well as from PFGE. Two other strains, MUCL28071 (MUCL28071 and DVPG1853), two presented ITS and DVPG1853, were seen to be related to wine yeast sequences close to wine or beer strains. Finally, we using at least one technique (PFGE and microsatellite detected two different copies of ITS in the last African typing for DVPG28071, and microsatellite typing for MUCL30909 strain after subcloning: one was close to the DVPG1853). wine isolate ITS whereas the other was closer to the other The final African strain, MUCL30909, exhibited some palm wine ITS (Fig. 1), suggesting a hybrid nature for specific features: its interdelta typing profile was similar this strain. It should also be noted that a mixture of to that of palm wine strains, whilst PFGE suggested that sequences was observed for CBS1171, and these two ITS this strain could be closer to other European strains; sequences obtained after cloning differed from those pre- finally, its microsatellite profile was intermediary between viously described by Montrocher et al. (1998). the African or fermented milk strains and other

Capa1 (bread, France) 58W3 clone2 (wine, CBS1171 clone4 (beer) 58W3 clone1 (wine, France) MUCL30909 clone1 (cassava, Burundi) DVPG1853 (White Tecc, Ethiopia) CBS1171 clone1 (beer) CBS1171 clone7 (beer) MUCL28071 (banana wine, Burundi) RM11·1 (wine, California) CIVC8130 (wine, France) CBS8856 clone1 (sorghum beer, Ghana) Figure 1 Dendrogram based on the ITS Kyokai4 (sake, Japan) sequence, rooted with Saccharomyces NPDR47 (palm wine, Nigeria) paradoxus NRRL Y-17217, showing the NPA031 (palm wine, Nigeria) taxonomic positions of palm wine yeast MUCL30909 clone3 (cassava, Burundi) strains by comparison with other Saccharo- MUCL30909 clone2 (cassava, Burundi) myces cerevisiae strains: kyokai4 (AB180468, NPCR 4·15 (palm wine, Nigeria) Kawahata et al. 2007) and DVPG1853, DVPG6044 (bili wine, West Africa) DVPG6044, NCYC110 (SGRP). When different CBS400 (palm wine, Ivory Coast) sequences were obtained for a single strain NCYC 110 (ginger beer, West Africa) after cloning in Escherichia coli, they are NRRL Y-17217 indicated as ‘clone No’ corresponding to the Escherichia coli clone. Strains are listed in Table 1. Bar, d value of 0Æ001. 0·001

ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 5 Genetic analysis of palm wine Saccharomyces cerevisiae O.U. Ezeronye and J.-L. Legras

NPA05b1 NPA033 NPA031 NPA071 NPA021 NPA05a1 NPA05d1 NPA022 NPCr27 NPCr415 NPDr47 NPA5d2 CBS400 NCYC110 Palm Wine, DBVPG6044 and west African strains NPA041 NPA030 NPAb33 NPAb314 NPDr234 Eg12 NPAb22 NPA061 NPA062 NPCr51 Fl100 NPCr414 S288C CBS8858 CBS8856 Sorghum beer CBS8859 Capa1 NPA072 58W3 Figure 2 Dendrogram based on karyotypes MUCL30909 determined by pulsed field gel electrophoresis CBS8857 (PFGE) presenting the genetic relationships CIVC8130 between 38 strains. The tree was built using MUCL28071 the UPGMA method and the scale bar shows dissimilarities calculated from the Dice coeffi- 0·05 cient. wine strains. This strain presented a high degree of palm wine fermentation could be initiated by a mixture heterozygosity, with eight heterozygote loci out of 12, and of several clones. Moreover, very similar strains were three of these heterozygote loci displayed one typical found at different sampling sites from the Port Harcourt ‘wine allele’ and one allele most frequently found area. amongst African strains or strains not originating from wine (Table 3), reinforcing our previous hypothesis of a Microsatellite analysis of palm wine strains and other hybrid status for this strain. African strains Microsatellite analysis of this yeast group revealed that Comparison of strains from different sites amongst the 20 genotypes found, 14 strains appeared to Identical isolates were only found in samples collected at be diploid at all loci, and six of these seemed to be the same site and time. In five of the seven samples in homozygous. These strains formed a homogenous family, which at least two strains were characterized, a minimum as can be seen from the molecular data. We then applied of two genotypes could be identified. This demonstrated a Hardy–Weinberg exact test to assess the sexual the diversity of palm wine strains, and suggested that reproduction of palm wine yeasts, and this revealed a

ª 2009 The Authors 6 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology O.U. Ezeronye and J.-L. Legras Genetic analysis of palm wine Saccharomyces cerevisiae

NPA05d1 NPCr414 NPCr27 NPA021 NPA031 NPA033 NPDr234 NPA072 NPA071 NPA05b1 NPA030 NPCr51 NPDr47 CBS400 Palm wine NPAB22 NPA05a1 NPA022 NPAB314 NPAB33 MUC28071 NPCr415 MUC30909 NPA062 NPA061 NPA05d2 NPA041 NCYC110 DBVPG6044 West African DVPG1853 strains Fl100 S288C CHP Eg12 Wine 58W3 CBS8858 Figure 3 Dendrogram based on interdelta CBS8857 Sorghum beer proﬁles presenting the genetic relationships CBS8859 between 39 strains. The tree was built using CBS8856 the UPGMA method and the scale bar shows Capa1 Bread dissimilarities calculated from the Dice coefﬁ- cient. 0·001

significant excess of homozygous strains for each locus. diversity observed amongst wine or sake strains is indic- The allelic richness of palm wine yeast was 4Æ56 alleles for ative of two domestication events (Fay and Benavides nine strains, a significantly lower value than the mean 2005). Our results demonstrated the variability of strains allelic richness calculated simultaneously with Fstat after isolated from Nigerian palm wine, a typical African bev- resampling for four French wine yeast groups that had erage. Microsatellite typing of these Nigerian palm wine previously been genotyped (Legras et al. 2007): 5Æ89 alleles strains revealed that they belonged to a specific group. for nine strains. Their allelic richness was less marked than wine yeasts, which suggests that the palm wine yeast population resulted from the domestication of a local population of Discussion yeast, such as that for wine or sake. Moreover, several Unlike other beverages such as beer, wine or sake, little of these palm wine strains were found to be homozy- is known about the diversity of African palm wine yeast gous and their proportion exceeded that expected under strains. However, it was recently discovered that the the Hardy–Weinberg equilibrium, and comparable to diversity of S. cerevisiae is related to the technological what had previously been observed for wine strains origin of strains (Legras et al. 2007), and the limited (Legras et al. 2007). Individual strain analysis also

ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 7 Genetic analysis of palm wine Saccharomyces cerevisiae O.U. Ezeronye and J.-L. Legras

NPA041 NPA22 NPA21 NPA31 NPA33 NPAB22 NPCR415 NPDR47 NPA71 NPA5a1 NPA72 NPA5d1 NPA5b1 NPA5d2 Palm Wine, NPA030 and west African NPA81 strains NPCR414 NPCR 27 NPCR51 NPA62 NPA61 fl100 S288C DBVPG6044 NCYC110 NPDR234 NPAB33 NPAB314 MUCL30909 Burundi strains MUCL28071 CIVC8130 Eg12 Wine strains DBVPG1853 Ethiopia strains 58W3 CBS8857 CBS8858 Bread and Figure 4 Dendrogram based on microsatel- capa1 sorghum beer lite genotypes, presenting the genetic rela- CBS8856 strains tionships between 39 strains. The tree was CBS8859 built using the UPGMA method and the scale bar shows dissimilarities calculated from the 0·1 Dc chord distance.

suggested that palm wine fermentations are triggered by similarity of their ITS sequences, the polyploidy of the a mixture of different clones, as is the case in wine strains and also by the similarity of the COX2 and (Versavaud et al. 1995). These palm wine yeast strains ACT1 sequences (Glover et al. 2005). This suggests that also presented interdelta profiles with a large number of these strains could have originated from European beer. bands (8–11) when compared with other strains, except Similarly, the two other African isolates (DBVPG1853 for S288C. All these features were suggestive of geo- and MUCL28071), were also very close to other Euro- graphic and or ecological isolation resulting in a specific pean isolates in terms of their ITS sequence and interde- population of S. cerevisiae. Two other African strains lta and microsatellite profiles. Finally, MUCL30909 (NCYC110 and DVPG6044) appeared to be quite closely strains presented two types of ITS sequence and a com- related to this African group of strains, as indicated by plex microsatellite profile that included typical wine their microsatellite and ITS sequences. In contrast, the alleles and ‘African (or other origins than wine) alleles’. phylogenic position of other African isolates was more As a consequence, we could hypothesize that this strain complex. The closeness of ale beer strains and the had a hybrid origin. These two features would suggest Ghana sorghum beer strains tested here using microsat- that the European colonization of Africa led to the ellite typing (Legras et al. 2007) was confirmed by the introduction of S. cerevisiae in the same way as has been

ª 2009 The Authors 8 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology O.U. Ezeronye and J.-L. Legras Genetic analysis of palm wine Saccharomyces cerevisiae

Table 3 Origin of the alleles encountered in strain MUCL30909 isolated from fermented cassava in Burundi. (data from: Legras et al. 2007). For each origin, the number of strains in which this allele has been encountered and the total number of strains of this group are given between brackets

Locus Allele size Origin of strains where this allele was encountered

C3 111 wine (4 ⁄ 341), rum (Brazil, 6 ⁄ 10), fermented milk (10 ⁄ 14), bread (1 ⁄ 28), rice wine (China, 1 ⁄ 19) C4 391 wine (1 ⁄ 341) C4 394 fermented milk (1 ⁄ 14) C5 112 wine (114 ⁄ 341), rum (Brazil, 1 ⁄ 10 ), fermented milk (8 ⁄ 14), bread (12 ⁄ 28), rice wine (China, 14 ⁄ 19), palm wine (Nigeria, 11 ⁄ 19) C6 100 wine (21 ⁄ 341), fermented milk (6 ⁄ 14, beer (4 ⁄ 8), bread (10 ⁄ 28), rice wine (China,1 ⁄ 19), Sake (Japan, 1 ⁄ 11), rum (French Indies, 5 ⁄ 13) C6 116 palm wine (Nigeria, 3 ⁄ 19), wine (9 ⁄ 341), rum (Brazil and French Indies, 3 ⁄ 23), Bread (1 ⁄ 28) C8 124 palm wine (Nigeria, 6 ⁄ 19) , fermented milk (12 ⁄ 14), rum (French Indies 3 ⁄ 13) C9 87 palm wine (Nigeria, 19 ⁄ 19), wine (5 ⁄ 341), rice wine and sake (Japan, 2 ⁄ 11), rum (French Indies, 2 ⁄ 13) C9 96 wine (45 ⁄ 341), distillery (Brazil, 1 ⁄ 10), bread (11 ⁄ 28), fermented milk (2 ⁄ 14) C11 201 wine (12 ⁄ 341), beer (1 ⁄ 8), rum (French Indies, 2 ⁄ 13) C11 219 wine (7 ⁄ 341) SCAAT1 189 wine (22 ⁄ 341), palm wine (2 ⁄ 19), bread (4 ⁄ 28) SCAAT1 246 wine (18 ⁄ 341) SCAAT5 168 palm wine (Nigeria, 7 ⁄ 19) wine (12 ⁄ 341), rice wine (China, 2 ⁄ 19) SCAAT5 174 rice wine (China 1 ⁄ 19) YKL172w 124 wine (275 ⁄ 341) YOR267c 288 wine (1 ⁄ 341) and sake (Japan, 1 ⁄ 11) YOR267c 330 wine (25 ⁄ 341), rum (French Indies, 3), sake (Japan, 1 ⁄ 11), bread (6 ⁄ 28) YPL009c 269 palm wine (8 ⁄ 19), rice wine (China, 10 ⁄ 19) rum (French indies 3 ⁄ 13), wine (9 ⁄ 341) YPL009c 290 wine (2 ⁄ 341), rum (French Indies, 1 ⁄ 13)

Bold type indicates typical African alleles. shown for wine yeast (Legras et al. 2007), reinforcing and to Dr I. Roberts and Dr S. James who sent us the the status of S. cerevisiae as a yeast associated with ITS sequence of NCYC110, DVPG1853, and DVPG6044. human activities. References Conclusion Agu, R.C., Okenchi, M.U., Ude, C.M., Onyia, A.I., Onwumelu, The microsatellite and interdelta characterizations of these A.H. and Ajiwe, V.I.E. (1999) Fermentation Kinetic Studies Nigerian palm wine isolates revealed the genetic features of Nigerian palm wine-Elaeis guineensis and Raphia hookeri of a specific and autochthonous West African population. for preservation by bottling. J Food Sci Technol 36, 205– These strains were mainly diploid with an excess of 209. homozygosity, as had previously been described for wine Amoa-Awua, W.K., Sampson, E. and Tano-Debrah, K. (2007) yeasts (Bradbury et al. 2006; Legras et al. 2007). In con- Growth of yeasts, lactic and acetic acid bacteria in palm trast, the other African strains isolated from other sources wine during tapping and fermentation from felled oil presented different genetic characteristics. Two ideas palm (Elaeis guineensis) in Ghana. J Appl Microbiol 102, could be deduced from their ITS sequences and microsat- 599–606. Barnett, J.A., Payne, R.W. and Yarrow, D. (1983) Yeast: char- ellite genotyping: the Ghana sorghum beer strains analy- acterisation and identification. pp. 352–362. Cambridge: sed here originated from European beer strains and University Press. MUCL30909 Burundi isolated from fermented Cassava in Beech, R.W. and Davenport, R.R. (1971) Isolation, purification Burundi was a hybrid resulting from a wine-type strain and maintenance of yeast. In Methods in Microbiology ed. and another strain of African origin. Booth, C. pp. 153–182. London: Academic Press; Vol 4. Blondin, B. and Vezinhet, F. (1988) Identification de souches Acknowledgements de levures oenologiques par leurs caryotypes en e´lectro- phore`se en champ pulse. Rev Fr Oenol 115, 7–11. The authors would like to thank A. Alais Perot for her Bradbury, J.E., Richards, K.D., Niederer, H.A., Lee, S.A., Dun- helpful technical assistance. The authors are grateful to bar, P.R. and Gardner, R.C. (2006) A homozygous diploid Prof. Ed Louis and Dr G. Liti for providing yeast strains,

ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 9 Genetic analysis of palm wine Saccharomyces cerevisiae O.U. Ezeronye and J.-L. Legras

subset of commercial wine yeast strains. Antonie Van Leeu- Legras, J.L., Merdinoglu, D., Cornuet, J.M. and Karst, F. wenhoek 89, 27–37. (2007) Bread, Beer and Wine, Saccharomyces cerevisiae Esteve-Zarzoso, B., Belloch, C., Uruburu, F. and Querol, A. diversity reflects human history. Mol Ecol 16, 2091–2102. (1999) Identification of yeasts by RFLP analysis of the 5.8S Lopez, V., Fernandez-Espinar, T., Barrio, E., Ramon, D. and rRNA gene and the two ribosomal internal transcribed Querol, A. (2003) A new PCR–based method for monitor- spacers. Int J Syst Bacteriol 49, 1329–1337. ing inoculated wine fermentations. Int J Food Microbiol 81, Esteve-Zarzoso, B., Gostincar, A., Bobet, R., Uruburu, F. and 63–71. Querol, A. (2000) Selection and molecular characterisation Montrocher, R., Verner, M.C., Briolay, J., Gautier, C. and of wine yeast isolated from the EL Penedes area (Spain). Marmeisse, R. (1998) Phylogenetic analysis of the Food Microbiol 17, 553–532. Saccharomyces cerevisiae group based on polymorphisms Esteve-Zarzoso, B., Gostincar, A., Bobet, R., Uruburu, F. and of rDNA spacer sequences. Int J Syst Bacteriol 48, Querol, A. (2002) Selection and molecular characterisation 1295–1303. of wine yeast isolated from the EL Penedes area (Spain). Morah, F.N. (1995) Effect of metabisulphite on alcohol Food Microbiol 17, 553–532. production in palm wine. Food Chem 53, 153–156. Eze, M.O. and Ogan, U. (1988) Sugars of the unfermented sap Morrissey, W.F., Davenport, B., Querol, A. and Dobson, and the wine from the oil palm Elaeis guineensis tree. Plant A.D.W. (2004) The role of indigenous yeast in traditional Food Hum Nutr 38, 121–126. Irish Cider fermentations. J Appl Microbiol 97, 647–655. Ezeronye, O.U. (2004) Nutrient utilization profile of Saccharo- Ness, F., Lavallee, F., Dubourdieu, D., Aigle, M. and Dulau, L. myces cerevisiae from palm wine in tropical fruit fermenta- (1993) Identification of yeast strains using the polymerase tion. Antonie Van Leeuwenhoek 86, 235–240. chain reaction. J Sci Food Agric 62, 89–94. Ezeronye, O.U. and Okerentugba, P.O. (2000) Genetic and Obahiagbon, F.I. and Osagie, A.U. (2007) Sugar and macromi- physiological variants of yeast selected from palm wine. nerals composition of sap produced by Raphia hookeri Mycopathologia 152, 85–89. palms. Afr J Biotechnol 6, 744–750. Ezeronye, O.U. and Okerentugba, P.O. (2002) Flocculation Ogbulie, T.E., Ogbulie, J.N. and Njoku, H.O. (2007) Compara- and mating behaviour in Saccharomyces yeast from palm tive study on the microbiology and shelf life stability of wine. Niger J Experiment Appl Biol 3, 83–88. palm wine from Elaeis guineensis and Raphia hookeri Faparusi, S.I. (1973) Origin of initial microflora of oil palm obtained from Okigwe, Nigeria. Afr J Biotechnol 6, 914– wine tree (Elaeis guineensis). J Appl Bacteriol 36, 559–565. 922. Faparusi, S.I. (1974) Microorganisms from oil palm tree (Elaeis Ojimelukwe, P.C. (2001) Effects of preservation with Sacoglot- guineensis) taap holes. J Food Sci 39, 755–757. tis gabonensis on the biochemistry and sensory attribute of Faparusi, S.I. (1981) Sugars identified in Raphia palm wine. fermenting palm wine. J Food Biochem 25, 411–424. Food Chem 7, 81–86. Okafor, N. (1975) Microbiology of Nigerian palm wine with Fay, J.C. and Benavides, J.A. (2005) Evidence for domesticated particular reference to bacteria. J Appl Bacteriol 38, 81–88. and wild populations of Saccharomyces cerevisiae. PLoS Okafor, N. (1978) Microbiology and Biochemistry of oil palm Genet 1, 66–71. wine. Adv Appl Microbiol 24, 237–256. Glover, R.L.K., Abaidoo, R.C., Jakobsen, M. and Jespersen, L. Owuama, C.I. and Saunders, J.R. (1990) Physiological vari- (2005) Biodiversity of Saccharomyces cerevisiae isolated ants of Saccharomyces cerevisiae and Klockera apiculata from a survey of pito production sites in various parts of from palm wine and cashew juice. J Appl Microbiol 68, Ghana. Syst Appl Microbiol 28, 755–761. 491–494. Kawahata, M., Fujii, T. and Hiefuji, H. (2007) Intraspecies Sabate, J., Cano, J., Esteve-Zarzoso, B. and Guillamon, J.M. diversity of the industrial yeast stains Saccharomyces cerevi- (2002) Isolation and identification of yeast associated siae and Saccharomyces pastorianus based on analysis of the with vineyard and winery by RFLP analysis of ribosomal sequences of the internal transcribed spacer (ITS) regions genes and mitochondrial DNA. Microbiol Res 157, 267– and the D1 ⁄ D2 region of 26S rDNA. Biosci Biotechnol Bio- 274. chem 71, 1616–1620. Uzochukwu, S., Balogh, E., Tucknot, O.G, Lewis, M.J. and Kumar, S., Tamura, K. and Nei, M. (2004) MEGA3: integrated Ngoddy, P.O. (1999) Role of palm wine yeast and bacteria software for molecular evolutionary genetic analysis and in palm wine aroma. J Food Sci Technol 36, 301–304. sequence alignment. Brief Bioinform 5, 150–163. Versavaud, A, Courcoux, P, Roulland, C, Dulau, L. and Hallet, Legras, J.L. and Karst, F. (2003) Optimisation of interdelta J.N. (1995) Genetic diversity and geographical distribution analysis for Saccharomyces cerevisiae strain characterisation. of wild Saccharomyces cerevisiae strains from the wine- FEMS Microbiol Lett 221, 249–255. producing area of Charentes, France. Appl Environ Micro- Legras, J.L., Ruh, O., Merdinoglu, D. and Karst, F (2005) biol 61, 3521–3529. Selection of hypervariable Microsatellite loci for the char- Yamamoto, N., Yamamoto, N., Ameniya, H., Yakomori, Y., acterisation of Saccharomyces cerevisiae strains. Int J Food Shimizu, K. and Totsuka, A. (1991) Electrophoretic Microbiol 102, 73–83. karyotypes of wine yeasts. Am J Enol Vitic 42, 358–363.

ª 2009 The Authors 10 Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology