By DOROTHY ARABA HAMMOND

Total Page:16

File Type:pdf, Size:1020Kb

Load more

FUNCTIONAL ANNOTATION OF ALTERNATIVELY SPLICED ISOFORMS OF HUMAN G PROTEIN-COUPLED RECEPTORS (GPCRs) by DOROTHY ARABA HAMMOND (Under the Direction of YING XU) ABSTRACT The functional differences that exist between alternatively spliced isoforms of genes can be substantial; it could be variations of the function of the “primary” full- length protein, its antagonist function or not directly related to its function. Regardless of the functions of spliced isoforms there is a need for proper annotation. G protein-coupled receptors (GPCRs) are important trans-membrane proteins with important biological and pharmaceutical implications. Incorrect alternative splicing has been associated with a number of human diseases including diabetes and cancers. In this dissertation is presented a framework and results for annotating transcripts of GPCR genes that have originated from alternative splicing of their pre-mRNA. This was achieved by first assessing the genomic landscape of the GPCRs to determine the type of alternative splicing event that exist and the localization of such events. In addition, the influences of exon-intron structures of GPCRs on the alternative splicing of the genes are evaluated. Then, the molecular level functions are ascertained via motif identification. Furthermore, the cellular state in which each isoform could function was determined using tissues of expression from RNA- sequencing data. Lastly, isoform function is inferred from cis regulatory elements predicted to influence the transcription of the isoform in the specific cellular state. The results are presented here and made publicly available in a PHP/MySQL relational database. Results from the research analyses indicate that the genomic structures of GPCRs are complex; their exon-intron structures are not arbitrarily arranged; rather they are ordered in such a manner as to ease the alternative splicing of the gene for functional purposes. Also, that GPCR isoforms expression patterns differ across tissues. Additionally it was evident that GPCR isoforms have multiple cellular pathways in which they may be involved depending on the cellular conditions. Overall, 1044 human GPCR isoforms were annotated. These results are now publicly available via the Internet in the database called the G protein-coupled receptor transcriptional annotation of genes (gpcrTAG) database. The results from these analyses offer the promise of transcriptional drug control, as well as offer the framework to study functional diversity between isoforms of other genes families. INDEX WORDS: GPCR, G protein-coupled receptor, RNA-seq, membrane protein, trans-membrane proteins, gene structure, alternative splicing, functional prediction, gene regulation, differential gene expression, next-generation sequencing, transcriptomic data analysis FUNCTIONAL ANNOTATION OF ALTERNATIVELY SPLICED ISOFORMS OF HUMAN G PROTEIN-COUPLED RECEPTORS (GPCRs) by DOROTHY ARABA HAMMOND B.A., Kwame Nkrumah University of Science and Technology, Kumasi, Ghana, 2002 M.P.H., Texas A&M University, College Station, Texas, 2006 A Dissertation Submitted to the Graduate Faculty of The University of Georgia in Partial Fulfillment of the Requirements for the Degree DOCTOR OF PHILOSOPHY ATHENS, GEORGIA 2014 © 2014 DOROTHY ARABA HAMMOND All Rights Reserved FUNCTIONAL ANNOTATION OF ALTERNATIVELY SPLICED ISOFORMS OF HUMAN G PROTEIN-COUPLED RECEPTORS (GPCRs) by DOROTHY ARABA HAMMOND Major Professor: YING XU Committee: LIMING CAI NATARAJAN KANNAN Electronic Version Approved: Julie Coffield Interim Dean of the Graduate School The University of Georgia December 2014 iv DEDICATION To my husband, for all his support, encouragement, love and patience To my boys (Jack & Joel), just because I love you To my father, for his encouragements, support, and for being my personal manuscript reviewer To my mother, for all the love and support To my Aunt Emelia, for your desire to see me succeed To my grandparents, you said it. See what we did Most importantly, to my HEAVENLY FATHER to whom I owe it all v ACKNOWLEDGEMENTS A special heartfelt appreciation goes to Prof. Ying Xu for his direction and supervision throughout my study here at the University of Georgia. Your work ethics is encouraging. I feel privileged to have benefited from your guidance and mentorship. Thank you for the knowledge and experience. Additionally, my sincere appreciation goes to my advisory committee members Liming Cai, Ph.D., David Puett, Ph.D., and Natarajan Kannan, Ph.D., for your support through it all. Another sincere appreciation also goes to Jonathan Arnold, Ph.D. for his encouragement. Lastly, to the Institute of Bioinformatics and to Ms. Joan Yantko, you are a treasure. Another heartfelt gratitude goes to Victor Olman, Ph.D., former member of the University of Georgia community for all the statistical support. Financial support came from: • The National Institute of Health – Supplementary Grant (R01 Grant # GM07533101) • The National Institute of General Medical Sciences, National Institute of Health, Ruth L. Krirschstein Predoctoral Fellowship F31 (Grant # GM089093) Trust in the Lord with all your heart and lean not in your own understanding. In all your ways acknowledge Him, and He will make your path straight Proverbs 3:5&6 vi TABLE OF CONTENTS Page ACKNOWLEDGEMENTS ................................................................................................ v LIST OF TABLES ............................................................................................................. ix LIST OF FIGURES ............................................................................................................ x CHAPTER 1 INTRODUCTION ............................................................................................ 1 1.1 RESEARCH OBJECTIVE ................................................................... 1 1.2 G PROTEIN-COUPLED RECEPTORS (GPCR) ................................ 1 FUNCTION INFERRED FROM SEQUENCE 1 1.3 ALTERNATIVE SPLICING .............................................................. 10 1.4 STATE OF THE ART IN ANNOTATING ALTERNATIVELY SPLICED ISOFORMS AND CHALLENGES FACED .......................... 14 1.5 OVERVIEW OF CHAPTERS: SUMMARY OF THE APPROACH PRESENTED IN THIS DISSERTATION ............................................... 17 REFERENCES ......................................................................................... 20 2 FUNCTIONAL UNDERSTANDING OF THE DIVERSE EXON-INTRON STRUCTURES OF THE HUMAN GPCR ..................................................... 27 ABSTRACT .............................................................................................. 28 2.1 INTRODUCTION ............................................................................. 28 2.2 DATA COLLECTION AND ANALYSIS ........................................ 30 2.3 RESULTS ........................................................................................... 34 vii 2.4 DISCUSSIONS ................................................................................... 38 2.5 CONCLUDING REMARKS .............................................................. 39 REFERENCES ......................................................................................... 41 3 FUNCTIONAL ANNOTATION OF ALTERNATIVE LY SPLICED ISOFORMS OF HUMAN G PROTEIN-COUPLED RECEPTORS ........... 43 3.1 INTRODUCTION ............................................................................. 44 3.2 GPCR DATA RETRIEVAL AND PROCESSING ............................ 45 3.3 ANNOTATION OF MOLECULAR FUNCTION ............................. 46 3.4 ANNOTATION OF CELLULAR FUNCTION ................................. 55 3.5 INTEGRATION OF MOLECULAR- AND CELLULAR-LEVEL FUNCTION .............................................................................................. 74 3.6 DISCUSSION ..................................................................................... 74 3.7 CONCLUSION ................................................................................... 79 REFERENCES ......................................................................................... 80 4 THE gpcrTAG DATABASE ........................................................................... 83 4.1 INTRODUCTION .............................................................................. 83 4.2 DATABASE CONTENT .................................................................... 84 4.3 DATABASE DESIGN ........................................................................ 85 4.4 DATABASE IMPLEMENTATION .................................................. 87 4.5 ACCESSING DATABASE ................................................................ 87 4.6 DISCUSSION ..................................................................................... 90 4.7 FUTURE IMPROVEMENTS ............................................................ 91 REFERENCES ......................................................................................... 92 viii 5 PERSPECTIVES AND CONCLUSIONS ...................................................... 93 5.1 SUMMARY ........................................................................................ 93 5.2 FUTURE DIRECTIONS .................................................................... 95 5.5 CONCLUSIONS ................................................................................. 96 APPENDICES A Appendix Tables ............................................................................................. 97 B Links to Supplementary Tables ...................................................................
Recommended publications
  • Detection of Interacting Transcription Factors in Human Tissues Using

    Detection of Interacting Transcription Factors in Human Tissues Using

    Myšičková and Vingron BMC Genomics 2012, 13(Suppl 1):S2 http://www.biomedcentral.com/1471-2164/13/S1/S2 PROCEEDINGS Open Access Detection of interacting transcription factors in human tissues using predicted DNA binding affinity Alena Myšičková*, Martin Vingron From The Tenth Asia Pacific Bioinformatics Conference (APBC 2012) Melbourne, Australia. 17-19 January 2012 Abstract Background: Tissue-specific gene expression is generally regulated by combinatorial interactions among transcription factors (TFs) which bind to the DNA. Despite this known fact, previous discoveries of the mechanism that controls gene expression usually consider only a single TF. Results: We provide a prediction of interacting TFs in 22 human tissues based on their DNA-binding affinity in promoter regions. We analyze all possible pairs of 130 vertebrate TFs from the JASPAR database. First, all human promoter regions are scanned for single TF-DNA binding affinities with TRAP and for each TF a ranked list of all promoters ordered by the binding affinity is created. We then study the similarity of the ranked lists and detect candidates for TF-TF interaction by applying a partial independence test for multiway contingency tables. Our candidates are validated by both known protein-protein interactions (PPIs) and known gene regulation mechanisms in the selected tissue. We find that the known PPIs are significantly enriched in the groups of our predicted TF-TF interactions (2 and 7 times more common than expected by chance). In addition, the predicted interacting TFs for studied tissues (liver, muscle, hematopoietic stem cell) are supported in literature to be active regulators or to be expressed in the corresponding tissue.
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer

    Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer

    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
  • Podocyte Specific Knockdown of Klf15 in Podocin-Cre Klf15flox/Flox Mice Was Confirmed

    Podocyte Specific Knockdown of Klf15 in Podocin-Cre Klf15flox/Flox Mice Was Confirmed

    SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1: Podocyte specific knockdown of Klf15 in Podocin-Cre Klf15flox/flox mice was confirmed. (A) Primary glomerular epithelial cells (PGECs) were isolated from 12-week old Podocin-Cre Klf15flox/flox and Podocin-Cre Klf15+/+ mice and cultured at 37°C for 1 week. Real-time PCR was performed for Nephrin, Podocin, Synaptopodin, and Wt1 mRNA expression (n=6, ***p<0.001, Mann-Whitney test). (B) Real- time PCR was performed for Klf15 mRNA expression (n=6, *p<0.05, Mann-Whitney test). (C) Protein was also extracted and western blot analysis for Klf15 was performed. The representative blot of three independent experiments is shown in the top panel. The bottom panel shows the quantification of Klf15 by densitometry (n=3, *p<0.05, Mann-Whitney test). (D) Immunofluorescence staining for Klf15 and Wt1 was performed in 12-week old Podocin-Cre Klf15flox/flox and Podocin-Cre Klf15+/+ mice. Representative images from four mice in each group are shown in the left panel (X 20). Arrows show colocalization of Klf15 and Wt1. Arrowheads show a lack of colocalization. Asterisk demonstrates nonspecific Wt1 staining. “R” represents autofluorescence from RBCs. In the right panel, a total of 30 glomeruli were selected in each mouse and quantification of Klf15 staining in the podocytes was determined by the ratio of Klf15+ and Wt1+ cells to Wt1+ cells (n=6 mice, **p<0.01, unpaired t test). Supplementary Figure 2: LPS treated Podocin-Cre Klf15flox/flox mice exhibit a lack of recovery in proteinaceous casts and tubular dilatation after DEX administration.
  • Supplementary Materials

    Supplementary Materials

    Supplementary Materials: Supplemental Table 1 Abbreviations FMDV Foot and Mouth Disease Virus FMD Foot and Mouth Disease NC Non-treated Control DEGs Differentially Expressed Genes RNA-seq High-throughput Sequencing of Mrna RT-qPCR Quantitative Real-time Reverse Transcriptase PCR TCID50 50% Tissue Culture Infective Doses CPE Cytopathic Effect MOI Multiplicity of Infection DMEM Dulbecco's Modified Eagle Medium FBS Fetal Bovine Serum PBS Phosphate Buffer Saline QC Quality Control FPKM Fragments per Kilo bases per Million fragments method GO Gene Ontology KEGG Kyoto Encyclopedia of Genes and Genomes R Pearson Correlation Coefficient NFKBIA NF-kappa-B Inhibitor alpha IL6 Interleukin 6 CCL4 C-C motif Chemokine 4 CXCL2 C-X-C motif Chemokine 2 TNF Tumor Necrosis Factor VEGFA Vascular Endothelial Growth Gactor A CCL20 C-C motif Chemokine 20 CSF2 Macrophage Colony-Stimulating Factor 2 GADD45B Growth Arrest and DNA Damage Inducible 45 beta MYC Myc proto-oncogene protein FOS Proto-oncogene c-Fos MCL1 Induced myeloid leukemia cell differentiation protein Mcl-1 MAP3K14 Mitogen-activated protein kinase kinase kinase 14 IRF1 Interferon regulatory factor 1 CCL5 C-C motif chemokine 5 ZBTB3 Zinc finger and BTB domain containing 3 OTX1 Orthodenticle homeobox 1 TXNIP Thioredoxin-interacting protein ZNF180 Znc Finger Protein 180 ZNF36 Znc Finger Protein 36 ZNF182 Zinc finger protein 182 GINS3 GINS complex subunit 3 KLF15 Kruppel-like factor 15 Supplemental Table 2 Primers for Verification of RNA-seq-detected DEGs with RT-qPCR TNF F: CGACTCAGTGCCGAGATCAA R:
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation

    4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation

    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
  • 22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung

    22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung

    22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung Ultra-conserved elements in an alignment of multiple genomes are consecutive nucleotides that are in perfect agreement across all the genomes. For aligned vertebrate and fly genomes, we give descriptive statistics of ultra-conserved elements, explain their biological relevance, and show that the existence of ultra-conserved elements is highly improbable in neutrally evolving regions. 22.1 The data Our analyses of ultra-conserved elements are based on multiple sequence align- ments produced by MAVID [Bray and Pachter, 2004]. Prior to the alignment of multiple genomes, homology mappings (from Mercator [Dewey, 2005]) group into bins genomic regions that are anchored together by neighboring homolo- gous exons. A multiple sequence alignment is then produced for each of these alignment bins. MAVID is a global multiple alignment program, and therefore homologous regions with more than one homologous hit to another genome may not be found aligned together. Table 22.1 shows an example of Merca- tor’s output for a single region along with the beginning of the resulting MAVID multiple sequence alignment. Species Chrom. Start End Alignment Dog chrX 752057 864487 + A----AACCAAA--------- Chicken chr1 122119382 122708162 − TGCTGAGCTAAAGATCAGGCT Zebrafish chr9 19018916 19198136 + ------ATGCAACATGCTTCT Pufferfish chr2 7428614 7525502 + ---TAGATGGCAGACGATGCT Fugufish asm1287 21187 82482 + ---TCAAGGG----------- Table 22.1. Mercator output for a single bin, giving the position and orientation on the chromosome. Notice that the Fugu fish genome has not been fully assembled into chromosomes (cf. Section 4.2). The vertebrate dataset consists of 10,279 bins over 9 genomes (Table 22.2).
  • A Flexible Microfluidic System for Single-Cell Transcriptome Profiling

    A Flexible Microfluidic System for Single-Cell Transcriptome Profiling

    www.nature.com/scientificreports OPEN A fexible microfuidic system for single‑cell transcriptome profling elucidates phased transcriptional regulators of cell cycle Karen Davey1,7, Daniel Wong2,7, Filip Konopacki2, Eugene Kwa1, Tony Ly3, Heike Fiegler2 & Christopher R. Sibley 1,4,5,6* Single cell transcriptome profling has emerged as a breakthrough technology for the high‑resolution understanding of complex cellular systems. Here we report a fexible, cost‑efective and user‑ friendly droplet‑based microfuidics system, called the Nadia Instrument, that can allow 3′ mRNA capture of ~ 50,000 single cells or individual nuclei in a single run. The precise pressure‑based system demonstrates highly reproducible droplet size, low doublet rates and high mRNA capture efciencies that compare favorably in the feld. Moreover, when combined with the Nadia Innovate, the system can be transformed into an adaptable setup that enables use of diferent bufers and barcoded bead confgurations to facilitate diverse applications. Finally, by 3′ mRNA profling asynchronous human and mouse cells at diferent phases of the cell cycle, we demonstrate the system’s ability to readily distinguish distinct cell populations and infer underlying transcriptional regulatory networks. Notably this provided supportive evidence for multiple transcription factors that had little or no known link to the cell cycle (e.g. DRAP1, ZKSCAN1 and CEBPZ). In summary, the Nadia platform represents a promising and fexible technology for future transcriptomic studies, and other related applications, at cell resolution. Single cell transcriptome profling has recently emerged as a breakthrough technology for understanding how cellular heterogeneity contributes to complex biological systems. Indeed, cultured cells, microorganisms, biopsies, blood and other tissues can be rapidly profled for quantifcation of gene expression at cell resolution.
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K

    Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K

    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
  • A Web-Platform for Analysis of Host Factors Involved in Viral Infections Discovered by Genome Wide Rnai Screen

    A Web-Platform for Analysis of Host Factors Involved in Viral Infections Discovered by Genome Wide Rnai Screen

    Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is © The Royal Society of Chemistry 2017 vhfRNAi: A web-platform for analysis of host factors involved in viral infections discovered by genome wide RNAi screen Anamika Thakur#, Abid Qureshi# and Manoj Kumar* Bioinformatics Centre, Institute of Microbial Technology, Council of Scientific and Industrial Research, Sector 39A, Chandigarh-160036, India #Equal contribution * To whom correspondence should be addressed. Tel, 91-172-6665453; Fax, 91-172- 2690585; 91-172-2690632; Email, [email protected] Supplementary Tables Table S1: Statistics of unique and duplicate host factors in each virus Table S2: Table denoting genes common among different viruses Table S3: Statistics of GWAS analysis Table S1. Statistics of unique and duplicate host factors in each virus S. No. Virus Unique-Entries Duplicate-Entries 1. Adeno-associated virus (AAV) 926 533 2. Avian influenza virus (AIV) 0 11 3. Borna disease virus (BDV) 14 20 4. Dengue virus 2 (DEN-2) 27 13 5. Hepatitis C virus (HCV) 236 213 6. Human immunodeficiency virus 1 (HIV) 1388 857 7. Human parainfluenza virus 3 (HPIV-3) 0 27 8. Human herpesvirus 1 (HSV-1) 34 38 9. Influenza A virus (IAV) 700 513 10. Lymphocytic choriomeningitis virus (LCMV) 0 54 11. Marburgvirus (MARV) 0 11 12. Poliovirus (PV) 3340 1035 13. Rotavirus (RV) 347 175 14. Sendai virus (SeV) 32 27 15. Sindbis virus (SIV) 70 41 16. Vaccinia virus (VACV) 482 296 17. Vesicular stomatitis virus (VSV) 9 78 18. West Nile virus (WNV) 313 137 Table S1. Statistics of unique host factors for each virus having overlapping and unique factors in different viruses Non-overlap – Overall- S.
  • High-Resolution Analysis of Chromosomal Breakpoints and Genomic Instability Identifies PTPRD As a Candidate Tumor Suppressor Gene in Neuroblastoma

    High-Resolution Analysis of Chromosomal Breakpoints and Genomic Instability Identifies PTPRD As a Candidate Tumor Suppressor Gene in Neuroblastoma

    Research Article High-Resolution Analysis of Chromosomal Breakpoints and Genomic Instability Identifies PTPRD as a Candidate Tumor Suppressor Gene in Neuroblastoma Raymond L. Stallings,1 Prakash Nair,1 John M. Maris,2 Daniel Catchpoole,3 Michael McDermott,4 Anne O’Meara,5 and Fin Breatnach5 1Children’s Cancer Research Institute and Department of Pediatrics, University of Texas Health Science Center at San Antonio, San Antonio, Texas; 2Division of Oncology, Children’s Hospital of Philadelphia and Department of Pediatrics, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania; 3The Tumor Bank, Children’s Hospital at Westmead, Sydney, New South Wales, Australia; and Departments of 4Pathology and 5Oncology, Our Lady’s Hospital for Sick Children, Dublin, Ireland Abstract and death from disease. Patient age, tumor stage, and several Although neuroblastoma is characterized by numerous different genetic abnormalities are important factors that influence clinical outcome. Loss of 1p and 11q, gain of 17q, and amplification recurrent, large-scale chromosomal imbalances, the genes MYCN targeted by such imbalances have remained elusive. We have of the oncogene are particularly strong genetic indicators of poor disease outcome (2–5). Two of these abnormalities, loss of 11q applied whole-genome oligonucleotide array comparative MYCN genomic hybridization (median probe spacing 6 kb) to 56 and amplification, form the basis for dividing advanced- stage neuroblastomas into genetic subtypes due to their rather neuroblastoma tumors and cell lines to identify genes involved with disease pathogenesis. This set oftumors was selected for striking inverse distribution in tumors (6, 7). Many other recurrent having either 11q loss or MYCN amplification, abnormalities partial chromosomal imbalances, including loss of 3p, 4p, 9p, and that define the two most common genetic subtypes of 14q and gain of 1q, 2p, 7q, and 11p, have been identified by metastatic neuroblastoma.
  • Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories

    Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories

    Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002)