DOCSLIB.ORG

Identification of Hair Shaft Progenitors That Create a Niche for Hair Pigmentation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of Hair Shaft Progenitors That Create a Niche for Hair Pigmentation Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press Identification of hair shaft progenitors that create a niche for hair pigmentation Chung-Ping Liao,1 Reid C. Booker,1 Sean J. Morrison,2,3,4,5,6 and Lu Q. Le1,4,5 1Department of Dermatology, 2Department of Pediatrics, 3Children’s Research Institute, 4Simmons Comprehensive Cancer Center, 5Hamon Center for Regenerative Science and Medicine, 6Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, Dallas, Texas 75390, USA Hair differentiates from follicle stem cells through progenitor cells in the matrix. In contrast to stem cells in the bulge, the identities of the progenitors and the mechanisms by which they regulate hair shaft components are poorly understood. Hair is also pigmented by melanocytes in the follicle. However, the niche that regulates follicular melanocytes is not well characterized. Here, we report the identification of hair shaft progenitors in the matrix that are differentiated from follicular epithelial cells expressing transcription factor KROX20. Depletion of Krox20 lin- eage cells results in arrest of hair growth, confirming the critical role of KROX20+ cells as antecedents of structural cells found in hair. Expression of stem cell factor (SCF) by these cells is necessary for the maintenance of differen- tiated melanocytes and for hair pigmentation. Our findings reveal the identities of hair matrix progenitors that regulate hair growth and pigmentation, partly by creating an SCF-dependent niche for follicular melanocytes. [Keywords: stem cell factor (SCF); hair pigmentation; hair shaft progenitor cell; hair follicle stem cell; hair matrix; KROX20] Supplemental material is available for this article. Received March 10, 2017; revised version accepted April 13, 2017. Hair is a highly keratinized tissue differentiated from hair SCF and its receptor, KIT, for hair pigmentation has follicle (HF) stem cells, which are located primarily in a been supported by the absence of hair pigment in several discrete reservoir called the bulge (Cotsarelis et al. 1990; SCF- and KIT-deprived animals (Copeland et al. 1990; Blanpain et al. 2004; Tumbar et al. 2004). The cycle of Reith et al. 1990; Kunisada et al. 1998b; Botchkareva hair growth and involution occurs in three phases: anagen et al. 2001; Nishimura et al. 2002). It is apparent that me- (growth), catagen (regression), and telogen (resting) (Blan- lanocytes are the relevant target cells in this type of hypo- pain and Fuchs 2009; Shimomura and Christiano 2010; pigmentation, as they are the melanin-producing cells as Plikus et al. 2012; Solanas and Benitah 2013; Watt 2014). well as the predominant KIT-expressing cell in the HF. Hair is commonly pigmented because of the presence However, the sources of SCF that support melanocytic ac- of melanin in hair shafts, which in turn is synthesized tivity in the HF have not been fully characterized, al- by follicular melanocytes and then transferred to the though SCF expression by cells in the dermal papilla has neighboring hair progenitors that give rise to hair shafts been suggested to promote melanocyte stem cell differen- (Nishimura et al. 2002, 2005; Lin and Fisher 2007). De- tiation (Chang et al. 2013). spite recent advances in our understanding of HF stem The HF matrix is composed of epithelial cells surround- cell biology, the mechanisms that regulate hair pigmenta- ing the dermal papilla. The HF matrix cells proliferate and tion remain poorly understood, especially with respect to differentiate into the structures of the hair shaft and inner the cellular interactions between hair progenitor cells and root sheath (Driskell et al. 2011). There are also melano- melanocytes that take place in the HF matrix. cytes residing in the same niche to provide melanin to Stem cell factor (SCF, also known as KIT ligand or Steel hair shaft progenitor cells for hair pigmentation. A domi- factor) is a growth factor that regulates multiple physio- nant population of matrix cells is transit-amplifying cells. logical homeostatic events, including the maintenance They proliferate rapidly for several divisions and then pro- of hematopoietic stem cells (Ding et al. 2012), mast cells gress upward to become committed progenitors that dif- (Lennartsson and Ronnstrand 2012), and melanocytes ferentiate into central hair shafts (the medulla, cortex, (Lennartsson and Ronnstrand 2012). The critical role of and cuticle), its surrounding channels or the inner root sheaths (the cuticle, Henle, and Huxley layers) that guide Corresponding author: [email protected] Article published online ahead of print. Article and publication date are online at http://www.genesdev.org/cgi/doi/10.1101/gad.298703.117. Free- © 2017 Liao et al. This article, published in Genes & Development,is ly available online through the Genes & Development Open Access available under a Creative Commons License (Attribution 4.0 Internation- option. al), as described at http://creativecommons.org/licenses/by/4.0/. GENES & DEVELOPMENT 31:1–13 Published by Cold Spring Harbor Laboratory Press; ISSN 0890-9369/17; www.genesdev.org 1 Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press Liao et al. hair shafts toward the skin surface, and the companion mostly absent from the proximal end (Fig. 1B). Fontana- layer (the innermost layer of the outer root sheath) Masson staining confirmed that this hypopigmentation (Hsu et al. 2011, 2014). In contrast to HF stem cells in was caused by the absence of melanin in the hair shaft cor- the bulge, the identities of the committed progenitor cells tex and medulla (the compartments housing the most that give rise directly to hair shafts (the medulla, cortex melanin in pigmented hair shaft) (Fig. 1C). We then deter- and cuticle) are currently not well characterized. In mined the time of onset of decreased pigmentation. The addition, the development of hair is also accompanied amount of pigment in individual hairs appeared normal by pigmentation that is contributed to the hair shafts at P9 (Fig. 1D), with the loss of hair pigmentation becom- by melanocytes. The reciprocal interactions between ing noticeable at P11; it progressed quickly after that (Fig. melanocytes and hair progenitor cells as well as the source 1D,E). Analysis of melanin density in the HF revealed sig- of SCF, which regulates hair pigmentation, are not well nificant reductions at P11 and P13 (P < 0.0001) (Fig. 1F), ex- characterized. plaining the early loss of hair pigmentation in Scfflox/gfp; KROX20 (also known as EGR2) is a zinc finger tran- Krox20Cre mice (Fig. 1B). Scfflox/gfp; Krox20Cre mice ex- scription factor that regulates hindbrain segmentation hibited progressive hair graying; their coat color under- (Schneider-Maunoury et al. 1993), Schwann cell mye- went a dynamic change from black to white within 9 lination (Topilko et al. 1994), and lymphocyte immune re- mo (Fig. 1A; Supplemental Fig. S1A). However, their new- sponses (Li et al. 2012). In addition, KROX20 is expressed ly synthesized hairs were already largely depigmented at in subpopulations of HF cells (Gambardella et al. 2000). P20 (Fig. 1B). These results suggested that the long period However, the role of the KROX20-expressing cells in of hair graying is due to the mixture of partly pigmented HF development is not known. We now report that the (old) and unpigmented (new) hair shafts (Supplemental transcription factor KROX20 identifies a sublineage of Fig. S1B,C) rather than the continuous production of HF epithelial cells toward the differentiation of hair shaft new gray hairs. To confirm this, gray Scfflox/gfp; Krox20Cre during HF morphogenesis. We observed that they are a mice were depilated at 2 mo to remove all hairs, including necessary source of SCF for the maintenance of mature old hairs, and stimulate new hair regeneration; as expect- melanocytes in the hair matrix to produce hair pigmen- ed, their new hairs showed a complete loss of pigmenta- tation, as evidenced by the complete loss of pigment tion (Fig. 1G). Most importantly, the fact that Scfflox/gfp; when Scf is deleted in Krox20 lineage cells. We also dem- Krox20Cre mice underwent a complete loss of hair pig- onstrate that deletion of Krox20 lineage cells in vivo mentation suggested that Krox20 lineage cells are the results in a complete arrest of new hair growth, demon- main source of SCF for follicular melanocytes to produce strating the critical role of Krox20 lineage cells in hair hair pigment. development. Hair pigmentation is dependent on SCF expression Results by epithelial keratinocytes In order to identify the cell type that produces SCF in the Mice lacking SCF in Krox20 lineage cells exhibit skin, thereby regulating hair pigmentation and being re- progressive hair graying sponsible for the hair hypopigmentation in Scfflox/gfp; While studying the role of mast cells and SCF during the Krox20Cre mice, we examined the hair color phenotype initiation of neurofibroma, a Schwann cell neoplasm, we of SCF ablation in different cell lineages in the skin by us- conditionally deleted Scf in neurofibroma neoplastic cells ing several cell type-specific Cre mouse lines, including using the Schwann cell lineage Krox20Cre mouse line. DhhCre (Schwann cell), PLPCreERT2 (Schwann cell), Tyr- Serendipitously, we found that the mice without SCF in CreERT2 (melanocyte), and K14Cre (keratinocyte). In addi- Krox20 lineage cells developed hair graying and, early in tion, CMVCreERT (all cells) was included as a control for life, lost all hair pigmentation. Invariably, all Scfflox/gfp; the inducible Cre systems. The R26-LacZ reporter was in- Krox20Cre mice (n = 20) displayed progressive hair gray- troduced into all of the above conditional knockouts to ing. The first round of hair graying occurred homoge- validate Cre expression specificity and efficiency. nously during postnatal days 30–40 (P30–P40). As the In mice lacking SCF in Schwann cells (Scfflox/gfp; mice aged, the hairs underwent further depigmentation DhhCre), we did not observe any hair color changes for in waves.
Load more

Recommended publications
  • Anatomy and Physiology of Hair
    Chapter 2 Provisional chapter Anatomy and Physiology of Hair Anatomy and Physiology of Hair Bilgen Erdoğan ğ AdditionalBilgen Erdo informationan is available at the end of the chapter Additional information is available at the end of the chapter http://dx.doi.org/10.5772/67269 Abstract Hair is one of the characteristic features of mammals and has various functions such as protection against external factors; producing sebum, apocrine sweat and pheromones; impact on social and sexual interactions; thermoregulation and being a resource for stem cells. Hair is a derivative of the epidermis and consists of two distinct parts: the follicle and the hair shaft. The follicle is the essential unit for the generation of hair. The hair shaft consists of a cortex and cuticle cells, and a medulla for some types of hairs. Hair follicle has a continuous growth and rest sequence named hair cycle. The duration of growth and rest cycles is coordinated by many endocrine, vascular and neural stimuli and depends not only on localization of the hair but also on various factors, like age and nutritional habits. Distinctive anatomy and physiology of hair follicle are presented in this chapter. Extensive knowledge on anatomical and physiological aspects of hair can contribute to understand and heal different hair disorders. Keywords: hair, follicle, anatomy, physiology, shaft 1. Introduction The hair follicle is one of the characteristic features of mammals serves as a unique miniorgan (Figure 1). In humans, hair has various functions such as protection against external factors, sebum, apocrine sweat and pheromones production and thermoregulation. The hair also plays important roles for the individual’s social and sexual interaction [1, 2].
    [Show full text]
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials: Supplemental Table 1 Abbreviations FMDV Foot and Mouth Disease Virus FMD Foot and Mouth Disease NC Non-treated Control DEGs Differentially Expressed Genes RNA-seq High-throughput Sequencing of Mrna RT-qPCR Quantitative Real-time Reverse Transcriptase PCR TCID50 50% Tissue Culture Infective Doses CPE Cytopathic Effect MOI Multiplicity of Infection DMEM Dulbecco's Modified Eagle Medium FBS Fetal Bovine Serum PBS Phosphate Buffer Saline QC Quality Control FPKM Fragments per Kilo bases per Million fragments method GO Gene Ontology KEGG Kyoto Encyclopedia of Genes and Genomes R Pearson Correlation Coefficient NFKBIA NF-kappa-B Inhibitor alpha IL6 Interleukin 6 CCL4 C-C motif Chemokine 4 CXCL2 C-X-C motif Chemokine 2 TNF Tumor Necrosis Factor VEGFA Vascular Endothelial Growth Gactor A CCL20 C-C motif Chemokine 20 CSF2 Macrophage Colony-Stimulating Factor 2 GADD45B Growth Arrest and DNA Damage Inducible 45 beta MYC Myc proto-oncogene protein FOS Proto-oncogene c-Fos MCL1 Induced myeloid leukemia cell differentiation protein Mcl-1 MAP3K14 Mitogen-activated protein kinase kinase kinase 14 IRF1 Interferon regulatory factor 1 CCL5 C-C motif chemokine 5 ZBTB3 Zinc finger and BTB domain containing 3 OTX1 Orthodenticle homeobox 1 TXNIP Thioredoxin-interacting protein ZNF180 Znc Finger Protein 180 ZNF36 Znc Finger Protein 36 ZNF182 Zinc finger protein 182 GINS3 GINS complex subunit 3 KLF15 Kruppel-like factor 15 Supplemental Table 2 Primers for Verification of RNA-seq-detected DEGs with RT-qPCR TNF F: CGACTCAGTGCCGAGATCAA R:
    [Show full text]
  • Nestin Expression in Hair Follicle Sheath Progenitor Cells
    Nestin expression in hair follicle sheath progenitor cells Lingna Li*, John Mignone†, Meng Yang*, Maja Matic‡, Sheldon Penman§, Grigori Enikolopov†, and Robert M. Hoffman*¶ *AntiCancer, Inc., 7917 Ostrow Street, San Diego, CA 92111; †Cold Spring Harbor Laboratory, 1 Bungtown Road, Cold Spring Harbor, NY 11724; §Department of Biology, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139-4307; and ‡Stony Brook University, Stony Brook, NY 11794 Contributed by Sheldon Penman, June 25, 2003 The intermediate filament protein, nestin, marks progenitor expression of the neural stem cell protein nestin in hair follicle cells of the CNS. Such CNS stem cells are selectively labeled by stem cells suggests a possible relation. placing GFP under the control of the nestin regulatory se- quences. During early anagen or growth phase of the hair Materials and Methods follicle, nestin-expressing cells, marked by GFP fluorescence in Nestin-GFP Transgenic Mice. Nestin is an intermediate filament nestin-GFP transgenic mice, appear in the permanent upper hair (IF) gene that is a marker for CNS progenitor cells and follicle immediately below the sebaceous glands in the follicle neuroepithelial stem cells (5). Enhanced GFP (EGFP) trans- bulge. This is where stem cells for the hair follicle outer-root genic mice carrying EGFP under the control of the nestin sheath are thought to be located. The relatively small, oval- second-intron enhancer are used for studying and visualizing shaped, nestin-expressing cells in the bulge area surround the the self-renewal and multipotency of CNS stem cells (5–7). hair shaft and are interconnected by short dendrites. The precise Here we report that hair follicle stem cells strongly express locations of the nestin-expressing cells in the hair follicle vary nestin as evidenced by nestin-regulated EGFP expression.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • A Web-Platform for Analysis of Host Factors Involved in Viral Infections Discovered by Genome Wide Rnai Screen
    Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is © The Royal Society of Chemistry 2017 vhfRNAi: A web-platform for analysis of host factors involved in viral infections discovered by genome wide RNAi screen Anamika Thakur#, Abid Qureshi# and Manoj Kumar* Bioinformatics Centre, Institute of Microbial Technology, Council of Scientific and Industrial Research, Sector 39A, Chandigarh-160036, India #Equal contribution * To whom correspondence should be addressed. Tel, 91-172-6665453; Fax, 91-172- 2690585; 91-172-2690632; Email, [email protected] Supplementary Tables Table S1: Statistics of unique and duplicate host factors in each virus Table S2: Table denoting genes common among different viruses Table S3: Statistics of GWAS analysis Table S1. Statistics of unique and duplicate host factors in each virus S. No. Virus Unique-Entries Duplicate-Entries 1. Adeno-associated virus (AAV) 926 533 2. Avian influenza virus (AIV) 0 11 3. Borna disease virus (BDV) 14 20 4. Dengue virus 2 (DEN-2) 27 13 5. Hepatitis C virus (HCV) 236 213 6. Human immunodeficiency virus 1 (HIV) 1388 857 7. Human parainfluenza virus 3 (HPIV-3) 0 27 8. Human herpesvirus 1 (HSV-1) 34 38 9. Influenza A virus (IAV) 700 513 10. Lymphocytic choriomeningitis virus (LCMV) 0 54 11. Marburgvirus (MARV) 0 11 12. Poliovirus (PV) 3340 1035 13. Rotavirus (RV) 347 175 14. Sendai virus (SeV) 32 27 15. Sindbis virus (SIV) 70 41 16. Vaccinia virus (VACV) 482 296 17. Vesicular stomatitis virus (VSV) 9 78 18. West Nile virus (WNV) 313 137 Table S1. Statistics of unique host factors for each virus having overlapping and unique factors in different viruses Non-overlap – Overall- S.
    [Show full text]
  • Gene Expression Profiling in the Striatum of Per2ko Mice Exhibiting
    Original Article Biomol Ther 29(2), 135-143 (2021) Gene Expression Profiling in the Striatum of Per2 KO Mice Exhibiting More Vulnerable Responses against Methamphetamine Mikyung Kim1,2,†, Se Jin Jeon3,†, Raly James Custodio1, Hyun Jun Lee1, Leandro Val Sayson1, Darlene Mae D. Ortiz1, Jae Hoon Cheong4,* and Hee Jin Kim1,* 1Uimyung Research Institute for Neuroscience, Department of Pharmacy, Sahmyook University, Seoul 01795, 2Department of Chemistry Life Science, Sahmyook University, Seoul 01795, 3School of Medicine and Center for Neuroscience Research, Konkuk University, Seoul 05029, 4School of Pharmacy, Jeonbuk National University, Jeonju 54896, Republic of Korea Abstract Drug addiction influences most communities directly or indirectly. Increasing studies have reported the relationship between circa- dian-related genes and drug addiction. Per2 disrupted mice exhibited more vulnerable behavioral responses against some drugs including methamphetamine (METH). However, its roles and mechanisms are still not clear. Transcriptional profiling analysis in Per2 knockout (KO) mice may provide a valuable tool to identify potential genetic involvement and pathways in enhanced behav- ioral responses against drugs. To explore the potential genetic involvement, we examined common differentially expressed genes (DEGs) in the striatum of drug naïve Per2 KO/wild-type (WT) mice, and before/after METH treatment in Per2 KO mice, but not in WT mice. We selected 9 common DEGs (Ncald, Cpa6, Pklr, Ttc29, Cbr2, Egr2, Prg4, Lcn2, and Camsap2) based on literature research. Among the common DEGs, Ncald, Cpa6, Pklr, and Ttc29 showed higher expression levels in drug naïve Per2 KO mice than in WT mice, while they were downregulated in Per2 KO mice after METH treatment.
    [Show full text]
  • Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals
    animals Review Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals Mohammadreza Mohammadabadi 1 , Farhad Bordbar 1,* , Just Jensen 2 , Min Du 3 and Wei Guo 4 1 Department of Animal Science, Faculty of Agriculture, Shahid Bahonar University of Kerman, Kerman 77951, Iran; [email protected] 2 Center for Quantitative Genetics and Genomics, Aarhus University, 8210 Aarhus, Denmark; [email protected] 3 Washington Center for Muscle Biology, Department of Animal Sciences, Washington State University, Pullman, WA 99163, USA; [email protected] 4 Muscle Biology and Animal Biologics, Animal and Dairy Science, University of Wisconsin-Madison, Madison, WI 53558, USA; [email protected] * Correspondence: [email protected] Simple Summary: Skeletal muscle mass is an important economic trait, and muscle development and growth is a crucial factor to supply enough meat for human consumption. Thus, understanding (candidate) genes regulating skeletal muscle development is crucial for understanding molecular genetic regulation of muscle growth and can be benefit the meat industry toward the goal of in- creasing meat yields. During the past years, significant progress has been made for understanding these mechanisms, and thus, we decided to write a comprehensive review covering regulators and (candidate) genes crucial for muscle development and growth in farm animals. Detection of these genes and factors increases our understanding of muscle growth and development and is a great help for breeders to satisfy demands for meat production on a global scale. Citation: Mohammadabadi, M.; Abstract: Farm-animal species play crucial roles in satisfying demands for meat on a global scale, Bordbar, F.; Jensen, J.; Du, M.; Guo, W.
    [Show full text]
  • Features of Mirna Binding Sites in Mrnas of Bos Taurus ZNF Family Transcription Factors
    ICBMB 2016 International Conference on Biochemistry and Molecular Biology 27-29 April 2016, Venice, Italy Best Western Hotel Bologna Hall Tercicore Via Piave, 214, 30171 Venezia Mestre, Venezia VE, Italy Features of miRNA binding sites in mRNAs of Bos taurus ZNF family transcription factors Aigul Alybayeva1*, Raigul Niyazova1, Bernard Faye2, and Anatoly Ivashchenko1 1al-Farabi KazNU, Almaty, Kazakhstan, *[email protected]. 2CIRAD-ES Campus International de Baillarguet, 34398 Montpellier Cedex 1, France Abstract: miRNA binding sites in the mRNA nucleotide sequences of 247 transcription factor (TF) genes of Bos taurus ZNF family was established. miRNAs binding sites are located in the 5'UTRs, CDSs and 3'UTRs of mRNAs. miRNA binding sites in mRNAs were selected with the value ΔG/ΔGm equal or greater than 85%. miR-574 was identified from 749 Bos taurus miRNAs, it has binding sites with mRNAs of KLF7, SNAI2, WIZ, ZFP1, ZFP91-1, ZNF175, ZNF6772, ZSCAN29-1 genes. The value ΔG/ΔGm varied from 85 to 95%. The starts of miR-574 binding sites with mRNAs of KLF7, ZFP91-1, ZNF6772 genes are located through two nucleotides. miR-574 binding sites are located in the 3'UTR. miR-1260b has binding sites with mRNAs of 29 genes (BCL11B-1, CTCF-1, DPF2-1, EGR3, FEZF2, PRDM13, PRDM14, PRDM6, SALL1, SP6-2, SP8, WIZ, ZFX-1, ZFX-2, ZKSCAN1, ZNF219, ZNF335, ZNF341, ZNF384, ZNF48, ZNF513, ZNF618-1, ZNF653, ZNF668, ZNF746, ZNF75, ZNF805, ZNF774, ZSCAN20-1) which are located in the 3'UTRs, CDSs and 5'UTRs. The value ΔG/ΔGm varied from 85 to 91%. The starts of miR- 1260b binding sites in mRNAs of ZNF618-1 target gene are located through one nucleotide in the 5'UTR and with mRNAs of ZNF384, BCL11B-1 genes through three nucleotides in the CDSs.
    [Show full text]
  • Egr2 and 3 Control Adaptive Immune Responses by Temporally Uncoupling Expansion from T Cell Differentiation
    Published Online: 9 May, 2017 | Supp Info: http://doi.org/10.1084/jem.20160553 Downloaded from jem.rupress.org on October 9, 2018 Article Egr2 and 3 control adaptive immune responses by temporally uncoupling expansion from T cell differentiation Tizong Miao,1* Alistair L.J. Symonds,1* Randeep Singh,1,2 Janine D. Symonds,3 Ane Ogbe,2 Becky Omodho,2 Bo Zhu,1,4 Suling Li,2 and Ping Wang1 1The Blizard Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT, England, UK 2Bioscience, Brunel University, Uxbridge UB8 3PH, England, UK 3Centre for Mathematics and Physics in the Life Sciences and Experimental Biology (CoMPLEX), University College London, London WC1E 6BT, England, UK 4Institute of Cancer, Xinqiao Hospital, Third Military Medical University, Chongqing 400037, People’s Republic of China Egr2 and 3 are important for maintaining immune homeostasis. Here we define a fundamental function of Egr2 and 3 oper- ating as a checkpoint that controls the transition between clonal expansion and differentiation of effector T cells. Egr2 and 3 deficiency resulted in defective clonal expansion but hyperactivation and excessive differentiation of T cells in response to viral infection. Conversely, sustained Egr2 expression enhanced expansion but severely impaired effector differentiation. Egr2 bound to and controlled the expression of genes regulating proliferation (Myc and Myb) and differentiation repressors (Bcl6, Id3), while repressing transcription factors required for effector function (Zeb2, RORa, RORc, and Bhlhe40). Egr2 and 3 ex- pression in T cells was regulated reciprocally by antigen and IFNγ, providing a mechanism for adjusting proliferation and dif- ferentiation of individual T cells.
    [Show full text]
  • The Integumentary System
    CHAPTER 5: THE INTEGUMENTARY SYSTEM Copyright © 2010 Pearson Education, Inc. OVERALL SKIN STRUCTURE 3 LAYERS Copyright © 2010 Pearson Education, Inc. Figure 5.1 Skin structure. Hair shaft Dermal papillae Epidermis Subpapillary vascular plexus Papillary layer Pore Appendages of skin Dermis Reticular • Eccrine sweat layer gland • Arrector pili muscle Hypodermis • Sebaceous (oil) gland (superficial fascia) • Hair follicle Nervous structures • Hair root • Sensory nerve fiber Cutaneous vascular • Pacinian corpuscle plexus • Hair follicle receptor Adipose tissue (root hair plexus) Copyright © 2010 Pearson Education, Inc. EPIDERMIS 4 (or 5) LAYERS Copyright © 2010 Pearson Education, Inc. Figure 5.2 The main structural features of the skin epidermis. Keratinocytes Stratum corneum Stratum granulosum Epidermal Stratum spinosum dendritic cell Tactile (Merkel) Stratum basale Dermis cell Sensory nerve ending (a) Dermis Desmosomes Melanocyte (b) Melanin granule Copyright © 2010 Pearson Education, Inc. DERMIS 2 LAYERS Copyright © 2010 Pearson Education, Inc. Figure 5.3 The two regions of the dermis. Dermis (b) Papillary layer of dermis, SEM (22,700x) (a) Light micrograph of thick skin identifying the extent of the dermis, (50x) (c) Reticular layer of dermis, SEM (38,500x) Copyright © 2010 Pearson Education, Inc. Figure 5.3a The two regions of the dermis. Dermis (a) Light micrograph of thick skin identifying the extent of the dermis, (50x) Copyright © 2010 Pearson Education, Inc. Q1: The type of gland which secretes its products onto a surface is an _______ gland. 1) Endocrine 2) Exocrine 3) Merocrine 4) Holocrine Copyright © 2010 Pearson Education, Inc. Q2: The embryonic tissue which gives rise to muscle and most connective tissue is… 1) Ectoderm 2) Endoderm 3) Mesoderm Copyright © 2010 Pearson Education, Inc.
    [Show full text]
  • Sweat Glands • Oil Glands • Mammary Glands
    Chapter 4 The Integumentary System Lecture Presentation by Steven Bassett Southeast Community College © 2015 Pearson Education, Inc. Introduction • The integumentary system is composed of: • Skin • Hair • Nails • Sweat glands • Oil glands • Mammary glands © 2015 Pearson Education, Inc. Introduction • The skin is the most visible organ of the body • Clinicians can tell a lot about the overall health of the body by examining the skin • Skin helps protect from the environment • Skin helps to regulate body temperature © 2015 Pearson Education, Inc. Integumentary Structure and Function • Cutaneous Membrane • Epidermis • Dermis • Accessory Structures • Hair follicles • Exocrine glands • Nails © 2015 Pearson Education, Inc. Figure 4.1 Functional Organization of the Integumentary System Integumentary System FUNCTIONS • Physical protection from • Synthesis and storage • Coordination of immune • Sensory information • Excretion environmental hazards of lipid reserves response to pathogens • Synthesis of vitamin D3 • Thermoregulation and cancers in skin Cutaneous Membrane Accessory Structures Epidermis Dermis Hair Follicles Exocrine Glands Nails • Protects dermis from Papillary Layer Reticular Layer • Produce hairs that • Assist in • Protect and trauma, chemicals protect skull thermoregulation support tips • Nourishes and • Restricts spread of • Controls skin permeability, • Produce hairs that • Excrete wastes of fingers and supports pathogens prevents water loss provide delicate • Lubricate toes epidermis penetrating epidermis • Prevents entry of
    [Show full text]