Loss of the Neural-Specific BAF Subunit ACTL6B Relieves Repression of Early Response Genes and Causes Recessive Autism
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Table S1. List of Proteins in the BAHD1 Interactome
Table S1. List of proteins in the BAHD1 interactome BAHD1 nuclear partners found in this work yeast two-hybrid screen Name Description Function Reference (a) Chromatin adapters HP1α (CBX5) chromobox homolog 5 (HP1 alpha) Binds histone H3 methylated on lysine 9 and chromatin-associated proteins (20-23) HP1β (CBX1) chromobox homolog 1 (HP1 beta) Binds histone H3 methylated on lysine 9 and chromatin-associated proteins HP1γ (CBX3) chromobox homolog 3 (HP1 gamma) Binds histone H3 methylated on lysine 9 and chromatin-associated proteins MBD1 methyl-CpG binding domain protein 1 Binds methylated CpG dinucleotide and chromatin-associated proteins (22, 24-26) Chromatin modification enzymes CHD1 chromodomain helicase DNA binding protein 1 ATP-dependent chromatin remodeling activity (27-28) HDAC5 histone deacetylase 5 Histone deacetylase activity (23,29,30) SETDB1 (ESET;KMT1E) SET domain, bifurcated 1 Histone-lysine N-methyltransferase activity (31-34) Transcription factors GTF3C2 general transcription factor IIIC, polypeptide 2, beta 110kDa Required for RNA polymerase III-mediated transcription HEYL (Hey3) hairy/enhancer-of-split related with YRPW motif-like DNA-binding transcription factor with basic helix-loop-helix domain (35) KLF10 (TIEG1) Kruppel-like factor 10 DNA-binding transcription factor with C2H2 zinc finger domain (36) NR2F1 (COUP-TFI) nuclear receptor subfamily 2, group F, member 1 DNA-binding transcription factor with C4 type zinc finger domain (ligand-regulated) (36) PEG3 paternally expressed 3 DNA-binding transcription factor with -
Uncovering the Signaling Landscape Controlling Breast Cancer Cell Migration Identifies Novel Metastasis Driver Genes
ARTICLE https://doi.org/10.1038/s41467-019-11020-3 OPEN Uncovering the signaling landscape controlling breast cancer cell migration identifies novel metastasis driver genes Esmee Koedoot1,4, Michiel Fokkelman 1,4, Vasiliki-Maria Rogkoti1,4, Marcel Smid2, Iris van de Sandt1, Hans de Bont1, Chantal Pont1, Janna E. Klip1, Steven Wink 1, Mieke A. Timmermans2, Erik A.C. Wiemer2, Peter Stoilov3, John A. Foekens2, Sylvia E. Le Dévédec 1, John W.M. Martens 2 & Bob van de Water1 1234567890():,; Ttriple-negative breast cancer (TNBC) is an aggressive and highly metastatic breast cancer subtype. Enhanced TNBC cell motility is a prerequisite of TNBC cell dissemination. Here, we apply an imaging-based RNAi phenotypic cell migration screen using two highly motile TNBC cell lines (Hs578T and MDA-MB-231) to provide a repository of signaling determinants that functionally drive TNBC cell motility. We have screened ~4,200 target genes individually and discovered 133 and 113 migratory modulators of Hs578T and MDA-MB-231, respectively, which are linked to signaling networks predictive for breast cancer progression. The splicing factors PRPF4B and BUD31 and the transcription factor BPTF are essential for cancer cell migration, amplified in human primary breast tumors and associated with metastasis-free survival. Depletion of PRPF4B, BUD31 and BPTF causes primarily down regulation of genes involved in focal adhesion and ECM-interaction pathways. PRPF4B is essential for TNBC metastasis formation in vivo, making PRPF4B a candidate for further drug development. 1 Division of Drug Discovery and Safety, LACDR, Leiden University, Einsteinweg 55, Leiden 2333 CC, Netherlands. 2 Department of Medical Oncology and Cancer Genomics Netherlands, Erasmus MC Cancer Institute, Erasmus University Medical Center, Rotterdam 3008 AE, Netherlands. -
Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L. -
Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. -
Supplementary Materials
Supplementary Materials: Supplemental Table 1 Abbreviations FMDV Foot and Mouth Disease Virus FMD Foot and Mouth Disease NC Non-treated Control DEGs Differentially Expressed Genes RNA-seq High-throughput Sequencing of Mrna RT-qPCR Quantitative Real-time Reverse Transcriptase PCR TCID50 50% Tissue Culture Infective Doses CPE Cytopathic Effect MOI Multiplicity of Infection DMEM Dulbecco's Modified Eagle Medium FBS Fetal Bovine Serum PBS Phosphate Buffer Saline QC Quality Control FPKM Fragments per Kilo bases per Million fragments method GO Gene Ontology KEGG Kyoto Encyclopedia of Genes and Genomes R Pearson Correlation Coefficient NFKBIA NF-kappa-B Inhibitor alpha IL6 Interleukin 6 CCL4 C-C motif Chemokine 4 CXCL2 C-X-C motif Chemokine 2 TNF Tumor Necrosis Factor VEGFA Vascular Endothelial Growth Gactor A CCL20 C-C motif Chemokine 20 CSF2 Macrophage Colony-Stimulating Factor 2 GADD45B Growth Arrest and DNA Damage Inducible 45 beta MYC Myc proto-oncogene protein FOS Proto-oncogene c-Fos MCL1 Induced myeloid leukemia cell differentiation protein Mcl-1 MAP3K14 Mitogen-activated protein kinase kinase kinase 14 IRF1 Interferon regulatory factor 1 CCL5 C-C motif chemokine 5 ZBTB3 Zinc finger and BTB domain containing 3 OTX1 Orthodenticle homeobox 1 TXNIP Thioredoxin-interacting protein ZNF180 Znc Finger Protein 180 ZNF36 Znc Finger Protein 36 ZNF182 Zinc finger protein 182 GINS3 GINS complex subunit 3 KLF15 Kruppel-like factor 15 Supplemental Table 2 Primers for Verification of RNA-seq-detected DEGs with RT-qPCR TNF F: CGACTCAGTGCCGAGATCAA R: -
2017.08.28 Anne Barry-Reidy Thesis Final.Pdf
REGULATION OF BOVINE β-DEFENSIN EXPRESSION THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF DUBLIN FOR THE DEGREE OF DOCTOR OF PHILOSOPHY 2017 ANNE BARRY-REIDY SCHOOL OF BIOCHEMISTRY & IMMUNOLOGY TRINITY COLLEGE DUBLIN SUPERVISORS: PROF. CLIONA O’FARRELLY & DR. KIERAN MEADE TABLE OF CONTENTS DECLARATION ................................................................................................................................. vii ACKNOWLEDGEMENTS ................................................................................................................... viii ABBREVIATIONS ................................................................................................................................ix LIST OF FIGURES............................................................................................................................. xiii LIST OF TABLES .............................................................................................................................. xvii ABSTRACT ........................................................................................................................................xix Chapter 1 Introduction ........................................................................................................ 1 1.1 Antimicrobial/Host-defence peptides ..................................................................... 1 1.2 Defensins................................................................................................................. 1 1.3 β-defensins ............................................................................................................. -
Histone-Binding of DPF2 Mediates Its Repressive Role in Myeloid Differentiation
Histone-binding of DPF2 mediates its repressive role in myeloid differentiation Ferdinand M. Hubera,1, Sarah M. Greenblattb,1, Andrew M. Davenporta,1, Concepcion Martinezb,YeXub,LyP.Vuc, Stephen D. Nimerb,2, and André Hoelza,2 aDivision of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena, CA 91125; bSylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL 33136; and cMolecular Pharmacology Program, Memorial Sloan Kettering Cancer Center, New York, NY 10065 Edited by Douglas C. Rees, Howard Hughes Medical Institute, California Institute of Technology, Pasadena, CA, and approved April 26, 2017 (received for review January 6, 2017) Double plant homeodomain finger 2 (DPF2) is a highly evolution- RUNX1 form a methylation-dependent repressive complex in arily conserved member of the d4 protein family that is ubiqui- AML, although it remains unclear whether the two proteins bind tously expressed in human tissues and was recently shown to each other directly or act concertedly as part of a larger complex. inhibit the myeloid differentiation of hematopoietic stem/progen- Here, we present the crystal structure of the human DPF2 itor and acute myelogenous leukemia cells. Here, we present the tandem PHD finger domain at a 1.6-Å resolution. We demon- crystal structure of the tandem plant homeodomain finger domain strate that the DPF2 tandem PHD finger domain binds acetylated of human DPF2 at 1.6-Å resolution. We show that DPF2 interacts H3 and H4 histone tails, identify the primary determinants of with the acetylated tails of both histones 3 and 4 via bipartite histone recognition, and confirm these interactions in vivo. -
Watsonjn2018.Pdf (1.780Mb)
UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7 -
Bioinformatics Studies Provide Insight Into Possible Target and Mechanisms of Action of Nobiletin Against Cancer Stem Cells
DOI:10.31557/APJCP.2020.21.3.611 Bioinformatics Studies Provide Insight into Possible Target and Mechanisms of Action of Nobiletin against Cancer Stem Cells RESEARCH ARTICLE Editorial Process: Submission:05/08/2019 Acceptance:03/06/2020 Bioinformatics Studies Provide Insight into Possible Target and Mechanisms of Action of Nobiletin against Cancer Stem Cells Adam Hermawan1*, Herwandhani Putri2 Abstract Objective: Nobiletin treatment on MDA-MB 231 cells reduces the expression of CXC chemokine receptor type 4 (CXCR4), which is highly expressed in cancer stem cell populations in tumor patients. However, the mechanisms of nobiletin in cancer stem cells (CSCs) remain elusive. This study was aimed to explore the potential target and mechanisms of nobiletin in cancer stem cells using bioinformatics approaches. Methods: Gene expression profiles by public COMPARE predicting the sensitivity of tumor cells to nobiletin. Functional annotations on gene lists are carried out with The Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.8, and WEB-based GEne SeT Analysis Toolkit (WebGestalt). The protein-protein interaction (PPI) network was analyzed by STRING-DB and visualized by Cytoscape. Results: Microarray analyses reveal many genes involved in protein binding, transcriptional and translational activity. Pathway enrichment analysis revealed breast cancer regulation of estrogen signaling and Wnt/ß-catenin by nobiletin. Moreover, three hub genes, i.e. ESR1, NCOA3, and RPS6KB1 and one significant module were filtered out and selected from the PPI network. Conclusion: Nobiletin might serve as a lead compound for the development of CSCs-targeted drugs by targeting estrogen and Wnt/ß-catenin signaling. Further studies are needed to explore the full therapeutic potential of nobiletin in cancer stem cells. -
Drosophila Valosin-Containing Protein Is Required for Dendrite Pruning Through a Regulatory Role in Mrna Metabolism
Drosophila Valosin-Containing Protein is required for dendrite pruning through a regulatory role in mRNA metabolism Sebastian Rumpfa,b,c,1,2, Joshua A. Bagleya,b,c, Katherine L. Thompson-Peera,b,c, Sijun Zhua,b,c,3, David Gorczycaa,b,c, Robert B. Becksteadd, Lily Yeh Jana,b,c, and Yuh Nung Jana,b,c,2 aHoward Hughes Medical Institute and Departments of bPhysiology and cBiochemistry, University of California, San Francisco, CA 94158; and dPoultry Science Department, University of Georgia, Athens, GA 30602 Contributed by Yuh Nung Jan, April 16, 2014 (sent for review December 20, 2013) The dendritic arbors of the larval Drosophila peripheral class IV for pruning (2, 7, 8), as well as the ATPase associated with di- dendritic arborization neurons degenerate during metamorphosis verse cellular activities (AAA) ATPase Valosin-Containing in an ecdysone-dependent manner. This process—also known as Protein (VCP) (CDC48 in yeast, p97 in vertebrates, also known dendrite pruning—depends on the ubiquitin–proteasome system as TER94 in Drosophila) (11), which acts as a chaperone for (UPS), but the specific processes regulated by the UPS during prun- ubiquitylated proteins (12). Interestingly, autosomal dominant ing have been largely elusive. Here, we show that mutation or mutations in the human VCP gene cause hereditary forms of inhibition of Valosin-Containing Protein (VCP), a ubiquitin-depen- ubiquitin-positive frontotemporal dementia (FTLD-U) (13) and dent ATPase whose human homolog is linked to neurodegenera- amyotrophic lateral sclerosis (ALS) (14). A hallmark of these tive disease, leads to specific defects in mRNA metabolism and that diseases is the occurrence of both cytosolic and nuclear ubiq- this role of VCP is linked to dendrite pruning.