DOCSLIB.ORG

A Functional Polymorphism of the Vasoactive Intestinal Peptide Receptor 1 Gene Correlates with the Presence of HLA-B *2705 in Sardinia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Functional Polymorphism of the Vasoactive Intestinal Peptide Receptor 1 Gene Correlates with the Presence of HLA-B *2705 in Sardinia Genes and Immunity (2008) 9, 659–667 & 2008 Macmillan Publishers Limited All rights reserved 1466-4879/08 $32.00 www.nature.com/gene ORIGINAL ARTICLE A functional polymorphism of the vasoactive intestinal peptide receptor 1 gene correlates with the presence of HLA-B *2705 in Sardinia F Paladini1, E Cocco1, A Cauli2, I Cascino3, A Vacca2, F Belfiore3, MT Fiorillo1, A Mathieu2 and R Sorrentino1,4 1Department of Cell Biology and Development, ‘Sapienza’ University of Rome, Roma, Italy; 2Department of Medical Sciences, University of Cagliari, Cagliari, Italy; 3Cell Biology Institute, CNR, Monterotondo Scalo, Roma, Italy and 4Istituto Pasteur-Fondazione Cenci Bolognetti, ‘Sapienza’ University of Rome, Roma, Italy The association of HLA-B27 with ankylosing spondylitis (AS) is the strongest among all inflammatory diseases. However, the exact role of these molecules in disease pathogenesis is still unknown. The existence of HLA-B27 variants rarely found in patients introduces a further level of complexity. It is now accepted that other genes of minor impact contribute to modify disease susceptibility and these genes might be diverse in different populations depending on the genetic background. We report here a study performed in Sardinia, an outlier population in which two major HLA-B27 subtypes are present, B *2705 strongly associated with AS and B *2709 which is not, and show the co-occurrence of the B *2705 allele with a single nucleotide polymorphism (SNP) mapping at 3 0-UTR of the receptor 1 (VIPR1) for the vasoactive intestinal peptide (VIP), a neuropeptide with anti-inflammatory properties. This same SNP is associated with a different kinetics of down-modulation of the VIPR1 mRNA in monocytes after exposure to lipopolysaccharide (P ¼ 0.004). This particular setting, HLA-B *2705 and a functional polymorphism in VIPR1 gene, might be due to a founder effect or might be the result of a selective pressure. Irrespectively, the consequent downregulation of this receptor in the presence of a ‘danger’ signal might influence susceptibility to AS. Genes and Immunity (2008) 9, 659–667; doi:10.1038/gene.2008.60; published online 31 July 2008 Keywords: HLA-B27; ankylosing spondylitis; VIP-receptor; Sardinia; polymorphism; 3 0-UTR Introduction The human type 1 receptor for VIP (VIPR1) gene maps on human chromosome 3 and is highly conserved Vasoactive intestinal peptide (VIP) is a 28mer pleiotropic through species.2 Interestingly, VIPR1 has been reported neuropeptide involved in the maintenance of neuroen- to be down-modulated in cells of the immune system docrine immune systems communication.1 VIP exerts a after activation.11 This is compatible with a role for this broad range of biological functions through specific molecule in hampering the correct order of events receptors also present on immune cells. These receptors orchestrating the inflammatory response. belong to the group II of G-protein-coupled receptors, Ankylosing spondylitis (AS) is a chronic inflammatory the secretin receptor family.2 VIP, when released in the rheumatic disease exhibiting a strong genetic compo- lymphoid organs by nerve stimuli and by activated nent.12 The major susceptibility factor is HLA-B27, whose immune cells, modulates the function of inflammatory role in pathogenesis has not been fully understood.13,14 cells through its receptors, thus affecting both innate and Moreover, although HLA-B27 is present in the high adaptive immunity.3,4 Accordingly, VIP has been de- majority of patients with AS, it has been reported that the scribed as an effective therapeutic agent in several animal HLA region accounts for only 20–50% of the genetic models of inflammatory/autoimmune diseases, such as contribution calculated in more than 90% by twin inflammatory bowel disease, collagen-induced arthritis, variance model.15 Accordingly, the effect of additional experimental autoimmune encephalomyelitis, endotoxic genes of minor impact within and outside the HLA shock, Parkinson’s disease and Sjogren’s disease.5–10 region is generally acknowledged.16 However, its translation to the clinic and its application Sardinian population is considered an outlier popula- in the corresponding human diseases is still far off. tion with genetic features making it highly informative for association studies.17,18 Accordingly, AS in Sardinia co-segregates with a highly conserved HLA haplotype Correspondence: Dr R Sorrentino, Department of Cell Biology and (A2, B *2705, DR16) shared by 92% of patients.19 A Development, ‘Sapienza’ University of Rome, via dei Sardi 70, further reason that makes Sardinian population particu- Roma 00185, Italy. E-mail: [email protected] larly amenable to study AS, is the presence of two major Received 4 April 2008; revised 2 July 2008; accepted 2 July 2008; HLA-B27 alleles, B *2705 and B *2709. The latter, that published online 31 July 2008 segregates with a different haplotype, has been rarely Vasoactive intestinal peptide receptor 1 and HLA-B27 F Paladini et al 660 found in patients.20,21 Interestingly, the two HLA-B27 the same PCR fragment: rs896 and rs9677. In this case as molecules, B *2705 and B *2709, bind differently a peptide well, genotype distribution was not significantly differ- derived from VIPR1 (pVIPR1 aa 400–408)22 that could ent from that in the random controls. explain the pVIPR1-specific autoreactivity present in As a measure of whether the differences reported here B *2705 but not in B *2709-positive individuals23 (MT were not due to population stratification, genotype Fiorillo, unpublished data). Therefore VIPR1 represents distribution of an SNP mapping at 50 end (position an interesting candidate gene for association studies in –13910; rs4988235) of the gene for lactase was also AS although, in a genome-wide map, no linkage has analysed. This polymorphism has been reported to vary been found between AS and p22 region of chromosome 3 considerably from northwestern to southeastern Europe where VIPR1 gene maps.2 Accordingly, we have ana- and differences in allele frequencies between cases and lysed VIPR1 single nucleotide polymorphisms (SNPs) controls indicate population stratification.24 The results frequencies in HLA-B *2705 positive both patients with (Table 3) do not show a significant difference in the allelic AS and controls versus random controls in Sardinia. The frequencies of this SNP between random controls and the results indicate that HLA-B *2705, independently from HLA-B27 cohorts and the frequency of the C allele is the disease, co-occurs more frequently with allele T at the around 0.9 as already reported for the Sardinian SNP rs896 in the 30 UTR of VIPR1 gene (72% of HLA- population.25 B *2705 individuals possess at least one T at rs896 vs 58% of random controls, P ¼ 0.001). These data prompted us Down-modulation of VIPR1 mRNA correlates with a 30-UTR to verify whether this polymorphism correlates with a polymorphism function. The results show that the presence of allele T at VIPR1 is known to be down-modulated in immune cells rs896 strongly influences the kinetics of downregulation such as T lymphocytes or monocytes after stimulation. of the VIP receptor 1 in monocytes exposed to lipopo- Monocytes have a relevant role in inflammation and lysaccharide (LPS). respond quickly to bacterial exposure. Moreover they express VIPR1 as the only receptor for VIP.11 LPS, an endotoxin expressed by Gram-negative bacteria, is a Results powerful activator of the inflammatory response in monocytes. Monocytes from five donors were then Co-occurrence of HLA-B *2705 with allele T at SNP rs896 of exposed to LPS for 0, 3, 6, 9 and 12 h. Afterwards, the VIPR1 gene amount of VIPR1-specific mRNA has been evaluated by Allele frequencies of four SNPs mapping in the VIPR1 quantitative PCR. A high variability of VIPR1 mRNA in gene were analysed in a Sardinian control population untreated monocytes from different subjects has been (N ¼ 261). Genotype distribution was in Hardy–Wein- noticed, probably reflecting the basal activation of berg equilibrium for all SNPs. Linkage disequilibrium monocytes (Figure 1). However, two kinetics by which (LD) values of adjacent SNPs were the highest for rs896- VIPR1 mRNA was downregulated after LPS stimulation rs342511: (r2 ¼ 0.64), lower for rs437876-rs896 (r2 ¼ 0.17) could be envisaged: one in which a reasonable high level and the lowest for rs896-rs9677 (r2 ¼ 0.09). Allele and (450%) of mRNA was maintained through time (sub- genotype frequencies at the four SNPs in HLA-B *2705- jects A and C) and a second one in which the decrease of positive patients with AS (N ¼ 110) and in B *2705 the mRNA was pronounced (B, D and E). After 12 h, in controls (N ¼ 104) were similar with the only exception some cases there is a trend to restore the amount of of genotype T/T at rs9677 that is 19% in the B *2705 mRNA to the level before LPS treatment (A, D), in some controls and 30% in the patients with AS (P ¼ NS). We others remains low. The experiments were repeated therefore considered the two B *2705-positive cohorts as using monocytes from 53 donors that had been typed for a single one in the statistical analysis. Allele distribution the four SNPs along the VIPR1 gene. Nine hours time at rs896 is different in the B *2705-positive cohort point was chosen as the most representative to evaluate compared to random controls (allele C at rs896: 55 the percentage of down-modulation of the VIPR1 mRNA versus 65%; P ¼ 0.001, pc ¼ 0.01, OR ¼ 0.65; 95% CI ¼ 0.5– after LPS exposure. Depending on the number of 0.85) (Table 1). Genotype distribution at rs896 is also monocytes rescued, in some cases (n ¼ 27) the evaluation different with a significant Cochrane–Armitage test for has been performed also at 3 h time point.
Load more

Recommended publications
  • The Activation of the Glucagon-Like Peptide-1 (GLP-1) Receptor by Peptide and Non-Peptide Ligands
    The Activation of the Glucagon-Like Peptide-1 (GLP-1) Receptor by Peptide and Non-Peptide Ligands Clare Louise Wishart Submitted in accordance with the requirements for the degree of Doctor of Philosophy of Science University of Leeds School of Biomedical Sciences Faculty of Biological Sciences September 2013 I Intellectual Property and Publication Statements The candidate confirms that the work submitted is her own and that appropriate credit has been given where reference has been made to the work of others. This copy has been supplied on the understanding that it is copyright material and that no quotation from the thesis may be published without proper acknowledgement. The right of Clare Louise Wishart to be identified as Author of this work has been asserted by her in accordance with the Copyright, Designs and Patents Act 1988. © 2013 The University of Leeds and Clare Louise Wishart. II Acknowledgments Firstly I would like to offer my sincerest thanks and gratitude to my supervisor, Dr. Dan Donnelly, who has been nothing but encouraging and engaging from day one. I have thoroughly enjoyed every moment of working alongside him and learning from his guidance and wisdom. My thanks go to my academic assessor Professor Paul Milner whom I have known for several years, and during my time at the University of Leeds he has offered me invaluable advice and inspiration. Additionally I would like to thank my academic project advisor Dr. Michael Harrison for his friendship, help and advice. I would like to thank Dr. Rosalind Mann and Dr. Elsayed Nasr for welcoming me into the lab as a new PhD student and sharing their experimental techniques with me, these techniques have helped me no end in my time as a research student.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • MONOCLONAL ANTI-VASOACTIVE INTESTINAL PEPTIDE RECEPTOR 1 (VIPR 1, VPAC1) Clone AS58 Purified Mouse Immunoglobulin
    MONOCLONAL ANTI-VASOACTIVE INTESTINAL PEPTIDE RECEPTOR 1 (VIPR 1, VPAC1) Clone AS58 Purified Mouse Immunoglobulin Product Number V1631 Product Description Although structurally related, VIPR1 and VIPR2 exhibit Monoclonal Anti-Vasoactive Intestinal Peptide differences in expression and function and VIP has a Receptor 1 (VIPR1) (mouse IgG2a isotype) is derived 3-10 fold preference for VIPR1 over VIPR2 receptors. from the hybridoma produced by the fusion of mouse myeloma cells and splenocytes from a BALB/c mouse VIPR1 is expressed throughout the central nervous immunized with a unique peptide corresponding to a system (predominantly in the cerebral cortex and portion of human Vasoactive Intestinal Peptide hippocampus), in peripheral tissues including liver, lung Receptor 1 (VIPR1). The antibody was purified from and intestine and in T lymphocytes.14 VIPR1 mediates tissue culture supernatant using immobilized Protein G. suppression of chemotaxis and matrix metalloprotein- ase expression elicited by some cytokines and chemo- Monoclonal Anti-Vasoactive Intestinal Peptide kines, tumor cell migration induced by VIP, and vaso- Receptor 1 (VIPR1) recognizes VIPR1 protein from dilation. human and rat tissue by immunoblotting and by flow cytometric analysis of human cells using indirect VIPR2 is expressed throughout the central nervous immunofluorescence. The antibody does not recognize system, but to varying degrees. The highest expression VIPR2 protein. levels are in the thalamus and suprachiasmatic nucleus, but VIPR2 is also present in the hippocampus,
    [Show full text]
  • G Protein-Coupled Receptors
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2015/16: G protein-coupled receptors. British Journal of Pharmacology (2015) 172, 5744–5869 THE CONCISE GUIDE TO PHARMACOLOGY 2015/16: G protein-coupled receptors Stephen PH Alexander1, Anthony P Davenport2, Eamonn Kelly3, Neil Marrion3, John A Peters4, Helen E Benson5, Elena Faccenda5, Adam J Pawson5, Joanna L Sharman5, Christopher Southan5, Jamie A Davies5 and CGTP Collaborators 1School of Biomedical Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK, 2Clinical Pharmacology Unit, University of Cambridge, Cambridge, CB2 0QQ, UK, 3School of Physiology and Pharmacology, University of Bristol, Bristol, BS8 1TD, UK, 4Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK, 5Centre for Integrative Physiology, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2015/16 provides concise overviews of the key properties of over 1750 human drug targets with their pharmacology, plus links to an open access knowledgebase of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. The full contents can be found at http://onlinelibrary.wiley.com/doi/ 10.1111/bph.13348/full. G protein-coupled receptors are one of the eight major pharmacological targets into which the Guide is divided, with the others being: ligand-gated ion channels, voltage-gated ion channels, other ion channels, nuclear hormone receptors, catalytic receptors, enzymes and transporters. These are presented with nomenclature guidance and summary information on the best available pharmacological tools, alongside key references and suggestions for further reading.
    [Show full text]
  • Multi-Functionality of Proteins Involved in GPCR and G Protein Signaling: Making Sense of Structure–Function Continuum with In
    Cellular and Molecular Life Sciences (2019) 76:4461–4492 https://doi.org/10.1007/s00018-019-03276-1 Cellular andMolecular Life Sciences REVIEW Multi‑functionality of proteins involved in GPCR and G protein signaling: making sense of structure–function continuum with intrinsic disorder‑based proteoforms Alexander V. Fonin1 · April L. Darling2 · Irina M. Kuznetsova1 · Konstantin K. Turoverov1,3 · Vladimir N. Uversky2,4 Received: 5 August 2019 / Revised: 5 August 2019 / Accepted: 12 August 2019 / Published online: 19 August 2019 © Springer Nature Switzerland AG 2019 Abstract GPCR–G protein signaling system recognizes a multitude of extracellular ligands and triggers a variety of intracellular signal- ing cascades in response. In humans, this system includes more than 800 various GPCRs and a large set of heterotrimeric G proteins. Complexity of this system goes far beyond a multitude of pair-wise ligand–GPCR and GPCR–G protein interactions. In fact, one GPCR can recognize more than one extracellular signal and interact with more than one G protein. Furthermore, one ligand can activate more than one GPCR, and multiple GPCRs can couple to the same G protein. This defnes an intricate multifunctionality of this important signaling system. Here, we show that the multifunctionality of GPCR–G protein system represents an illustrative example of the protein structure–function continuum, where structures of the involved proteins represent a complex mosaic of diferently folded regions (foldons, non-foldons, unfoldons, semi-foldons, and inducible foldons). The functionality of resulting highly dynamic conformational ensembles is fne-tuned by various post-translational modifcations and alternative splicing, and such ensembles can undergo dramatic changes at interaction with their specifc partners.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • GPCR Expression Profiles Were Determined Using
    Supplemental Figures and Tables for Tischner et al., 2017 Supplemental Figure 1: GPCR expression profiles were determined using the NanoString nCounter System in 250 ng of pooled cell RNA obtained from freshly isolated CD4 T cells from naïve lymph nodes (CD4ln), spinal cord infiltrating CD4 T cells at peak EAE disease (CD4sc), and primary lung endothelial cells (luEC). Supplemental Figure 2: Array design and quality controls. A, Sorted leukocytes or endothelial cells were subjected to single‐cell expression analysis and re‐evaluated based on the expression of various identity‐defining genes. B, Expression of identity‐defining and quality control genes after deletion of contaminating or reference gene‐negative cells. Expression data are calculated as 2(Limit of detection(LoD) Ct – sample Ct) ; LoD Ct was set to 24. Supplemental Figure 3: Overview over GPCR expression frequencies in different freshly isolated immune cell populations and spinal cord endothelial cells as determined by single cell RT‐PCR. Abbreviations: CD4ln‐Tcon/CD4ln‐Treg, conventional (con) and regulatory (reg) CD4 T cells from lymph nodes (CD4ln) of naïve mice; CD4dr/CD4sc, CD4 T cells from draining lymph nodes (dr) or spinal cord (sc) at peak EAE disease; CD4spn2D/ CD4spn2DTh1/ CD4spn2DTh17, splenic CD4 T cells from 2D2 T cell receptor transgenic mice before (2D) and after in vitro differentiation towards Th1 (2DTh1) or Th17 (2DTh17); MonoSpn, splenic monocytes; CD11b_sc, spinal cord infiltrating CD11b‐ positive cells; sc_microglia, Ccr2neg,Cx3cr1pos microglia from spinal cord at peak disease; sc_macrophages, CCr2pos;Cx3cr1lo/neg macrophages from spinal cord at peak disease; BMDM_M1/BMDM_M2, bone marrow‐derived macrophages differentiated towards M1 or M2; ECscN and ECscEAE, spinal cord endothelial cells from naïve mice (N) and at peak EAE disease (EAE); SMC, smooth muscle cells from various vessel types (included as positive control to ascertain primer functionality).
    [Show full text]
  • Kenneth Martin Rosenberg Email: [email protected], [email protected] 660 West Redwood Street, Howard Hall Room 332D, Baltimore, MD, 21201
    The impact of the non-immune chemiome on T cell activation Item Type dissertation Authors Rosenberg, Kenneth Publication Date 2020 Abstract T cells are critical organizers of the immune response and rigid control over their activation is necessary for balancing host defense and immunopathology. It takes 3 signals provided by dendritic cells (DC) to fully activate a T cell response – T ce... Keywords signaling; T cell; T-Lymphocytes--immunology Download date 02/10/2021 13:41:58 Link to Item http://hdl.handle.net/10713/14477 Kenneth Martin Rosenberg Email: [email protected], [email protected] 660 West Redwood Street, Howard Hall Room 332D, Baltimore, MD, 21201 EDUCATION MD, University of Maryland, Baltimore, MD Expected May 2022 PhD, University of Maryland, Baltimore, MD December 2020 Graduate Program: Molecular Microbiology and Immunology (MMI) BS, University of Maryland, College Park, MD May 2013 Major: Bioengineering, cum laude University Honors Citation, Gemstone Citation RESEARCH EXPERIENCE UMSOM Microbiology and Immunology Baltimore, MD July 2016-present PhD Candidate Principal Investigator: Dr. Nevil Singh Thesis: The impact of the non-immune chemiome on T cell activation Examined environmental stimuli from classically “non-immune” sources – growth factors, hormones, neurotransmitters, etc. – act to modulate T cell signaling pathways and the functional effects of activating encounters with dendritic cells. UMSOM Anatomy and Neurobiology Baltimore, MD May-August 2015 Rotating student Principal Investigator: Dr. Asaf Keller Studied the role of descending modulation pathways on affective pain transmission. Performed tract- tracing experiments using targeted injection of Cholera toxin subunit B into the lateral parabrachial nucleus and ventrolateral periaqueductal gray of anesthetized transgenic mice.
    [Show full text]
  • Structure of the Human Glucagon Class B G-Protein-Coupled Receptor
    ARTICLE doi:10.1038/nature12393 Structure of the human glucagon class B G-protein-coupled receptor Fai Yiu Siu1, Min He2, Chris de Graaf3, Gye WonHan1, Dehua Yang2, Zhiyun Zhang2, Caihong Zhou2, Qingping Xu4, Daniel Wacker1, Jeremiah S. Joseph1, Wei Liu1, Jesper Lau5, Vadim Cherezov1, Vsevolod Katritch1, Ming-Wei Wang2 & Raymond C. Stevens1 Binding of the glucagon peptide to the glucagon receptor (GCGR) triggers the release of glucose from the liver during fasting; thus GCGR plays an important role in glucose homeostasis. Here we report the crystal structure of the seven transmembrane helical domain of human GCGR at 3.4 A˚ resolution, complemented by extensive site-specific mutagenesis, and a hybrid model of glucagon bound to GCGR to understand the molecular recognition of the receptor for its native ligand. Beyond the shared seven transmembrane fold, the GCGR transmembrane domain deviates from class A G-protein-coupled receptors with a large ligand-binding pocket and the first transmembrane helix having a ‘stalk’ region that extends three alpha-helical turns above the plane of the membrane. The stalk positions the extracellular domain ( 12 kilodaltons) relative to the membrane to form the glucagon-binding site that captures the peptide and facilitates the insertion of glucagon’s amino terminus into the seven transmembrane domain. The glucagon receptor (GCGR) is one of the 15 members of the secretin- that the conformation of the 7TM domain of BRIL–GCGR(DECD/ like (class B) family of G-protein-coupled receptors (GPCRs)1 in humans. DC) is similar to wild-type GCGR. The structure of the BRIL– GCGR is activated by the 29 amino acid hormonal peptide glucagon GCGR(DECD/DC) was determined at 3.4 A˚ resolution (Methods (Supplementary Fig.
    [Show full text]
  • Mechanism of VIPR1 Gene Regulating Human Lung Adenocarcinoma H1299 Cells
    Medical Oncology (2019) 36:91 https://doi.org/10.1007/s12032-019-1312-y ORIGINAL PAPER Mechanism of VIPR1 gene regulating human lung adenocarcinoma H1299 cells Lufeng Zhao1 · Zipu Yu1 · Baiqin Zhao1 Received: 5 June 2019 / Accepted: 29 August 2019 / Published online: 27 September 2019 © Springer Science+Business Media, LLC, part of Springer Nature 2019 Abstract The vasoactive intestinal peptide receptor-1(VIPR1) has prominent growth efects on a number of common neoplasms. How- ever, there were contradictions in the efect cross diferent cancers. We aimed to explore the efect of VIPR1 overexpression on a human lung adenocarcinoma cell line H1299. GEO dataset was used to screen diferentially expressed genes in lung adenocarcinoma tissues. The expression of VIPR1 mRNA was determined in the cancer Genome Atlas (TCGA). Immuno- histochemical analysis was performed to determine VIPR1 protein expression in lung adenocarcinoma and corresponding adjacent tissues (n = 22). Fluorescence real-time quantitative PCR detected the expression of VIPR1 in human normal lung epithelial cell line BEAS-2B and lung adenocarcinoma cell line H1299. Overexpression strategies were employed to assess functions of VIPR1 expression on several malignant phenotypes in H1299. The expression of VIPR1 was lower in lung adenocarcinoma tissues than that in adjacent tissues. Compared with the normal lung epithelial cells BEAS-2B, VIPR1 was down-regulated in lung cancer cells H1299 (P < 0.05). After the overexpression of VIPR1, we found that VIPR1 signifcantly inhibited growth, migration, and invasion of H1299 cells (P < 0.05). Our fndings point out the tumor suppressor roles of VIPR1 in human LUAD pathogenesis. Keywords VIPR1 · Lung adenocarcinoma · Proliferation · Migration and invasion Introduction physiology and mainly functions via two receptor subtypes VAPC1 and VAPC2 [3].
    [Show full text]
  • An Integrative Analysis of Gene Expression Profiles
    Int J Clin Exp Pathol 2020;13(7):1698-1706 www.ijcep.com /ISSN:1936-2625/IJCEP0107763 Original Article Identification of transcriptomic markers for developing idiopathic pulmonary fibrosis: an integrative analysis of gene expression profiles Diandian Li1, Yi Liu2, Bo Wang1 1Department of Respiratory and Critical Care Medicine, West China Hospital of Sichuan University, Chengdu 610041, China; 2West China School of Medicine, Sichuan University, Chengdu 610041, China Received January 12, 2020; Accepted March 6, 2020; Epub July 1, 2020; Published July 15, 2020 Abstract: Idiopathic pulmonary fibrosis (IPF) remains a lethal disease with unknown etiology and unmet medical need. The aim of this study was to perform an integrative analysis of multiple public microarray datasets to inves- tigate gene expression patterns between IPF patients and healthy controls. Moreover, functional interpretation of differentially expressed genes (DEGs) was performed to assess the molecular mechanisms underlying IPF progres- sion. DEGs between IPF and normal lung tissues were picked out by GEO2R tool and Venn diagram software. Data- base for Annotation, Visualization and Integrated Discovery (DAVID) was applied to analyze gene ontology (GO) and Kyoto Encyclopedia of Gene and Genome (KEGG) pathway. Protein-protein interaction (PPI) of these DEGs was visu- alized by Cytoscape with Search Tool for the Retrieval of Interacting Genes (STRING). 5520 DEGs were identified in IPF based on six profile datasets, including 3714 up-regulated genes and 1806 down-regulated genes. Using Venn software, a total of 367 commonly altered DEGs were revealed, including 259 up-regulated genes mostly enriched in collagen catabolic process, heparin binding, and the extracellular region.
    [Show full text]
  • (VIPR1) (NM 004624) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG209036 VIP Receptor 1 (VIPR1) (NM_004624) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: VIP Receptor 1 (VIPR1) (NM_004624) Human Tagged ORF Clone Tag: TurboGFP Symbol: VIPR1 Synonyms: HVR1; II; PACAP-R-2; PACAP-R2; RDC1; V1RG; VAPC1; VIP-R-1; VIPR; VIRG; VPAC1; VPAC1R; VPCAP1R Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 VIP Receptor 1 (VIPR1) (NM_004624) Human Tagged ORF Clone – RG209036 ORF Nucleotide >RG209036 representing NM_004624 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCGCCCGCCAAGTCCGCTGCCCGCCCGCTGGCTATGCGTGCTGGCAGGCGCCCTCGCCTGGGCCCTTG GGCCGGCGGGCGGCCAGGCGGCCAGGCTGCAGGAGGAGTGTGACTATGTGCAGATGATCGAGGTGCAGCA CAAGCAGTGCCTGGAGGAGGCCCAGCTGGAGAATGAGACAATAGGCTGCAGCAAGATGTGGGACAACCTC ACCTGCTGGCCAGCCACCCCTCGGGGCCAGGTAGTTGTCTTGGCCTGTCCCCTCATCTTCAAGCTCTTCT CCTCCATTCAAGGCCGCAATGTAAGCCGCAGCTGCACCGACGAAGGCTGGACGCACCTGGAGCCTGGCCC GTACCCCATTGCCTGTGGTTTGGATGACAAGGCAGCGAGTTTGGATGAGCAGCAGACCATGTTCTACGGT TCTGTGAAGACCGGCTACACCATCGGCTACGGCCTGTCCCTCGCCACCCTTCTGGTCGCCACAGCTATCC
    [Show full text]