Wounding and Insect Feeding Trigger Two Independent MAPK Pathways with Distinct 25 Regulation and Kinetics

1 Title Page

2 Author names and affiliations at the time the work was done 3 Cécile Sözen1,2, Sebastian T. Schenk1,2, Marie Boudsocq1,2, Camille Chardin3, Marilia 4 Almeida-Trapp4, Anne Krapp3, Heribert Hirt5,6, Axel Mithöfer4,7, Jean Colcombet1,2 5 6 1. Institute of Plant Sciences Paris-Saclay IPS2, Centre National de la Recherche Scientifique, Institut 7 National de la Recherche Agronomique, Université Paris-Sud, Université Evry, Université Paris- 8 Saclay, Orsay, France 9 2. Institute of Plant Sciences Paris-Saclay IPS2, Paris Diderot, Sorbonne Paris-Cité, Orsay, France 10 3. Institut Jean-Pierre Bourgin, INRA, AgroParisTech, Université Paris Saclay, 78000, Versailles, 11 France 12 4. Department of Bioorganic Chemistry, Max Planck Institute for Chemical Ecology, Jena, Germany 13 5. Center for Desert Agriculture, King Abdullah University of Science and Technology, Thuwal, 14 Saudi Arabia 15 6. Max F. Perutz Laboratories, University of Vienna, Dr. Bohrgasse 9, 1030 Vienna, Austria 16 7. Research Group Plant Defense Physiology, Max Planck Institute for Chemical Ecology, Jena, 17 Germany

18 Present addresses 19 Sebastian T. Schenk, Albert-Ludwigs-Universität Freiburg, Fakultät für Biologie, 20 Arbeitsgruppe: Zellbiologie, Schänzlestraße 1, 79104 Freiburg, Germany

21 Corresponding author 22 [email protected]

23 Title 24 Wounding and insect feeding trigger two independent MAPK pathways with distinct 25 regulation and kinetics

26 Short title 27 Independent MAPK modules in wound signaling

28 Material distribution footnote 29 The author(s) responsible for distribution of materials integral to the findings presented in this 30 article in accordance with the policy described in the Instructions for Authors 31 (www.plantcell.org) is Jean Colcombet ([email protected]).

1 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

32 One sentence summary 33 Wounding induces the parallel activation of a rapid signaling module (MKK4/5-MPK3/6) and 34 a JA-dependent slow one (MAP3K14-MKK3-MPK1/2/7/14) to restrict insect feeding.

35 Abstract (154 words) 36 Wounding is caused by abiotic and biotic factors and triggers complex short- and long- 37 term responses at the local and systemic level. These responses are under the control of 38 complex signaling pathways, which are still poorly understood. Here, we show that the rapid 39 activation of MKK4/5-MPK3/6 by wounding is independent of jasmonic acid (JA) signaling 40 and that, contrary to what happens in tobacco, this fast module does not control wound- 41 triggered JA accumulation in Arabidopsis. We also demonstrate that a second MAPK module, 42 constituted by MKK3 and the clade-C MAPKs MPK1/2/7, is activated by wounding in an 43 independent manner. We provide evidence that the activation of this MKK3-MPK1/2/7 44 module occurs mainly through wound-induced JA production via the transcriptional 45 regulation of upstream clade-III MAP3Ks and particularly MAP3K14. We show that mkk3 46 mutant plants are more susceptible to the larvae of the generalist lepidopteran herbivore 47 Spodoptera littoralis, indicating that the MKK3-MPK1/2/7 module is involved in 48 counteracting insect feeding.

49 Introduction 50 Wounding is a common stress for plants that can be caused by abiotic factors such as 51 wind, heavy rain, hail and snow or during biotic interactions, mostly with herbivorous 52 organisms such as insects. Injury may cause harsh damages to plant tissues and facilitate the 53 entry of pathogens (Savatin et al., 2014). Plants respond to these challenges by activating 54 several mechanisms to rapidly heal tissues and restrict potential pathogen entry. The cuticle 55 and trichomes are important constitutive structures involved in the prevention of wounding. 56 Once wounding occurred, intracellular molecules released from dead cells or damaged cell 57 wall components act as signaling molecules named DAMP (for Damage Associated 58 Molecular Pattern) (Maffei et al., 2012). Additionally, in the vicinity of wound sites, living 59 cells sense the mechanical disturbance through the activation of mechanosensitive channels 60 which trigger intracellular signaling pathways and local responses (Farmer et al., 2014). Such 61 responses are mediated by efficient and complex intracellular signaling mechanisms involving 62 phosphorylation, lipid, ROS (Reactive Oxygen Species) and Ca2+ signaling, and the 63 production of phytohormones leading to important gene expression reprogramming and long 64 distance signaling (Savatin et al., 2014). Among the phytohormones, jasmonates, members of

2 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

65 the oxylipin family, seem to play an overriding role (Wasternack and Hause, 2013). 66 Jasmonates and in particular JA are produced very rapidly by herbivory-induced wounding 67 and regulate a large number of wound-induced genes (Reymond et al., 2004). The isoleucine 68 conjugate of JA, (+)-7-iso-jasmonoyl-L-isoleucine (JA-Ile), is the bioactive form of 69 jasmonates (Fonseca et al., 2009). 70 Mitogen-Activated Protein Kinase (MAPK) modules are very well conserved signaling 71 pathways found in all eukaryotes (Colcombet and Hirt, 2008). A MAPK module is minimally 72 constituted of three kinases, a MAP3K (or MAP2K Kinase), a MAP2K (or MAPK Kinase) 73 and a MAPK, which are able to phosphorylate and thereby activate each other sequentially. 74 These kinases are encoded by large gene families, for which we have incomplete functional 75 information (Colcombet and Hirt, 2008). Since their discovery in plants several decades ago, 76 a number of the MAPK components have been involved in biotic and abiotic stress signal 77 transductions as well as developmental processes (for review (Xu and Zhang, 2015; Suarez- 78 Rodriguez et al., 2010)). They have notably been shown to function at an early step of wound 79 signaling. For example, alfalfa MMK4 and tobacco WIPK are activated within minutes by 80 leaf wounding (Bogre et al., 1997; Seo et al., 1999). Generally, after a peak at 15 minutes, 81 their activities decline to basal levels within one hour after wounding (Bogre et al., 1997; Seo 82 et al., 1995, 1999; Usami et al., 1995). In Arabidopsis, wounding was first shown to activate 83 both MPK4 and MPK6 (Ichimura et al., 2000). More recently, a more complete module, 84 namely MKK4/5-MPK3/6, was identified to stimulate ethylene production in response to 85 wounding (Li et al., 2017). Interestingly, several early studies suggested that this MAPK 86 activation also controls JA production (Ahmad et al., 2016). Indeed, tobacco lines in which 87 WIPK has been either silenced or overexpressed have lower and higher JA amounts after 88 wounding, respectively (Seo et al., 2007, 1999, 1995). Additionally, JA was also shown to be 89 a modulator of MPK6 activity, suggesting a feedback loop to fine-tune JA homeostasis 90 (Takahashi et al., 2007). These MAPKs belong to clades A and B, which code for the well 91 characterized iconic “stress-activated MAPKs”, but data also suggest that less studied 92 members of the family also transduce wound signals. For example, MPK8, a clade-D MAPK, 93 as well as the clade-C MAPKs MPK1/2 were shown to be activated by wounding (Takahashi 94 et al., 2011; Ortiz-Masia et al., 2007). 95 Arabidopsis MPK1 and MPK2, together with MPK7 and MPK14, define the clade-C 96 MAPKs, which were shown to function downstream of the atypical MAP2K MKK3 97 (Colcombet et al., 2016). The MKK3-MPK7 module was for example reported to play a role 98 during plant–pathogen interactions as well as during drought perception; in particular, MPK1

3 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

99 is activated by ROS produced during the interaction with pathogenic bacteria and the drought- 100 induced phytohormone abscisic acid (ABA) (Danquah et al., 2015; Dóczi et al., 2007). 101 Coherently, an mkk3 mutant is hypersensitive to infection by Pseudomonas syringae DC3000 102 and also more sensitive to water deficit. In the context of ABA signaling, the MKK3-MPK1 103 module is activated by the clade-III MAP3Ks MAP3K17 and MAP3K18 through 104 transcriptional regulation which induces a delay in the activation of the module (Danquah et 105 al., 2015; Boudsocq et al., 2015). In this present study, we characterized the MAPK- 106 dependent phosphorylation cascades in response to tissue lesions. We unveil the coexistence 107 of two independent MAPK modules, which are activated by wounding with different kinetics. 108 We also revisited the knowledge about the JA-MAPK relationship and provide evidence that 109 JA production is not controlled by stress-activated iconic MAPKs in Arabidopsis. 110

4 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

111 Results

112 Clade-C MAPK activation by wounding strictly depends on MKK3 113 Some clade-C MAPKs were previously shown to be activated by wounding and to act

114 downstream of MKK3 in response to H2O2 and ABA (Danquah et al., 2014; Ortiz-Masia et 115 al., 2007; Dóczi et al., 2007). To investigate whether MPK2 also acts downstream of MKK3 116 in the wounding response, MPK2 was immunoprecipitated using a specific antibody from 117 wounded leaves of WT and mkk3 KO plants and its activity assayed as the ability to 118 phosphorylate the heterologous substrate Myelin Basic Protein (MBP). As clade-C activation 119 by ABA occurs slowly, we performed a long kinetics up to 4 hours (Danquah et al., 2015). In 120 Col-0 plants, MPK2 was activated from 30 minutes to 2 hours after wounding (fig. 1A). This 121 activation was totally abolished in mkk3-1 and mkk3-2 mutants (fig. 1A and S1A) and 122 recovered in mkk3-1 plants transformed with the whole genomic MKK3 locus C-terminally 123 fused to Yellow Fluorescent Protein (YFP) (mkk3-1 MKK3-YFP) (fig. S1B). Because the 124 MPK2-specific antibody is unable to detect MPK2 protein in western blot (Ortiz-Masia et al., 125 2007), we cannot exclude that the increase of MPK2 activity in response to wounding is due 126 to a wound-dependent accumulation of MPK2. To challenge this hypothesis, plants 127 expressing the MPK2 locus C-terminally fused to a Human influenza hemagglutinin (HA) 128 sequence were generated in both WT and mkk3-1 genetic backgrounds. HA- 129 immunoprecipitation from WT, but not from mkk3-1 wounded leaves, revealed a transient 130 increase of MPK2-HA activity with a similar kinetics as endogenous MPK2, and without any 131 variation in protein amounts (fig. 1B). MPK2 together with MPK1, MPK7 and MPK14 132 belong to the clade-C MAPKs. In protoplasts, MPK1/2/7/14 seem to function in a similar 133 module downstream of MKK3 (Danquah et al., 2015). To monitor if other clade-C MAPKs 134 are activated by wounding, plants expressing the MPK1 and MPK7 loci fused to an HA tag 135 were generated and subjected to wounding. Both MPK1-HA and MPK7-HA were transiently 136 activated by wounding following the same kinetics as MPK2 (fig. S2A and S2B). MPK7-HA 137 activation was also dependent on MKK3 as it did not occur in the mkk3-1 MPK7-HA 138 background (fig. S2B). In addition, MPK1-HA and MPK7-HA proteins amounts were 139 unaffected by wounding (fig. S2A and S2B). Altogether, these results demonstrate that clade- 140 C MAPKs are activated by wounding in an MKK3-dependent manner with a kinetics that is 141 considerably slower when compared to flg22-induced activation of the well-studied MPK3/6, 142 which occurs in less than 2 minutes with a peak around 10-15 minutes (fig. S3) (Ranf et al., 143 2011).

5 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

144 MKK3 and clade-III MAP3Ks interact and constitute a functional module when expressed 145 in Arabidopsis mesophyll protoplasts 146 We previously formulated the hypothesis that the MKK3-MPK1/2/7/14 module 147 functions downstream of clade-III MAP3Ks, namely MAP3K13-20 (Colcombet et al., 2016). 148 MKK3 was indeed shown to interact in Yeast 2-hybrid (Y2H) assays with MAP3K15-20 but 149 with none of the 8 tested clade-I and clade-II MAP3Ks (fig. S4). However, MKK3 did not 150 interact neither with MAP3K13 and MAP3K14 that are the only clade-III MAP3Ks predicted 151 to possess transmembrane domains at their carboxyl-termini (Schwacke et al., 2003). As 152 transmembrane domains may trigger Y2H false negatives, we generated truncations of 153 Activation Domain (AD)-MAP3K13 and AD-MAP3K14 fusions missing their 143 and 116 154 C-terminal amino acids, respectively, corresponding to the putative transmembrane domains. 155 Indeed, both truncated forms of MAP3K13 and MAP3K14 were able to interact with MKK3 156 in Y2H (fig. 2A). 157 To test whether these MKK3-interacting MAP3Ks are able to activate MKK3-MPK2 in 158 planta, we took advantage of the transient expression system in Arabidopsis mesophyll 159 protoplasts. YFP-tagged versions of the 8 clade-III MAP3Ks were co-expressed with MPK2- 160 HA in protoplasts generated from mkk3-1 leaves in the absence or presence of MKK3-Myc 161 (fig. 2B). The activity of MPK2 was assayed after immunoprecipitation with anti-HA 162 antibodies. MPK2-HA was activated only when both MKK3 and one of the tested MAP3Ks 163 were co-expressed together. Surprisingly, MAP3K13/14/15/16-YFP proteins were not or 164 barely detectable, despite their ability to activate MPK2 in an MKK3-dependent way. In the 165 case of MAP3K14, we confirmed that the module activation is dependent on kinase activity as 166 MAP3K14D140A , mutated in its active site, could not activate the MKK3-MPK2 module (fig 167 S5). Overall, these results indicate that clade-III MAP3Ks-MKK3-MPK2 and other clade-C 168 MAPKs form functional modules in planta.

169 Wounding induces clade-III MAP3K transcriptional regulation 170 We have shown that the slow ABA-induced activation of MPK7, a close homolog of 171 MPK2, was dependent on de novo protein synthesis (Danquah et al., 2015). To check whether 172 a similar mechanism is involved in the wound-induced activation of MPK2, the protein 173 biosynthesis inhibitor cycloheximide (CHX; 100 µM) was sprayed onto plants expressing 174 HA-tagged versions of MAPKs prior to wounding. After immunoprecipitation and kinase 175 assays, MPK1/2/7-HA were not activated by wounding anymore, whereas the protein 176 amounts of the MAPKs were unchanged (fig. 3A, S6A and S6B). Additionally, MKK3-YFP

177 levels were only weakly affected by spraying CHX onto mkk3-1 MKK3-YFP plants prior to 178 wounding (fig. 3B). These results suggest that the wound-induced activation of clade-C 179 MAPKs requires the de novo synthesis of proteins acting upstream of MKK3. Based on these 180 results, we hypothesized that transcriptional regulation could be a conserved regulation 181 feature of clade-III MAP3Ks and could be a requirement to activate clade-C MAPKs. Using 182 RT-qPCR, expression of clade-III MAP3K genes in WT leaves was analyzed in a wounding 183 time-course (fig. 3C). We observed that MAP3K14 transcript levels highly increased from 15 184 minutes post-wounding with a peak at 30 minutes. MAP3K15/17/18/19 were also induced, but 185 later and at more moderate levels. Additionally, using map3k17map3k18 plants 186 complemented with a YFP-tagged MAP3K18 locus (Danquah et al., 2015), MAP3K18-YFP 187 protein accumulated with a corresponding slow kinetics (fig. S7). Overall, these expression 188 data are compatible with the slow MPK2 activation by wounding and suggest that MAP3K14 189 and other clade-III MAP3Ks could play a role in the wound-triggered MKK3-MPK1/2/7/14 190 activation.

191 MAP3K14 contribute to MPK2 activation by wounding 192 To obtain genetic evidence that MAP3K14 plays a role in wound-dependent MKK3 193 module activation, we first identified plants carrying a homozygous T-DNA insertion in the 194 MAPK14 gene (fig. S8A). Surprisingly, in this background, MPK2 activation was higher than 195 in WT plants (fig. S8B). We then realized that the T-DNA insertion at position 1041 after the 196 start codon was predicted to truncate the C-terminal tail without affecting the kinase domain. 197 Expression of the predicted truncated protein MAP3K14-1 in mkk3-1 mesophyll protoplasts 198 was indeed able to activate the MKK3-MPK2 module (fig. S8C). Importantly, whereas 199 MAP3K14 was not detected in western-blots, MAP3K14-1 showed a strong accumulation, 200 potentially explaining the MPK2 over-activation in map3k14-1 and suggesting that the 201 MAP3K14 C-terminus could contain a regulatory domain for protein stability. In order to 202 consolidate the gain-of-function role of MAP3K14-1, we used CRISPR/Cas9 technology to 203 create two loss-of-function lines, referred to as map3k14-CR1 and map3k14- CR2, which show 204 a single base pair insertion (A and T, respectively) at position 550 after the start codon. The 205 resulting frame shift generates an early stop codon leading to a truncation in the MAP3K14 206 kinase domain (fig. 4A). map3k14-CR1 and –CR2 plants subjected to wounding showed a 207 reduction of MPK2 activation particularly at 30 min (fig. 4B and fig. S9). This result is in 208 agreement with MAP3K14 being the only clade-III MAP3K transcriptionally induced at early 209 time points after wounding (fig. 3C). Overall, these data support the hypothesis that

7 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

210 MAP3K14 initiates the wound-activation of the MKK3-MPK2 module but also indicates that 211 other MAP3Ks take over MPK2 activation at later time points.

212 Jasmonic acid regulates wound-triggered MKK3 module activation 213 As shown in Figure 5A, Jasmonic acid (JA) is an important phytohormone that is 214 rapidly produced upon wounding in an MKK3-independent manner, as well as its isoleucine 215 conjugate, JA-Ile, and its biosynthetic precursor, cis-OPDA. We further investigated whether 216 JA plays a role in the wound-triggered MAPK activation. Upon JA treatment (50 µM) of 10- 217 day-old plantlets, the activity of endogenous MPK2 increased with a rather slow kinetics 218 (peaking at 30-60 min depending on the experiments) in WT but not in mkk3-1 (fig. 5B). 219 Similarly, JA activated MPK2-HA, MPK1-HA and MPK7-HA without affecting protein 220 amounts (fig. S10). 221 JA is sensed by CORONATINE INSENSITIVE1 (COI1) and coi1 mutants are 222 insensitive to JA (JA-Ile) (Katsir et al., 2008b, 2008a). To test whether the JA-induced 223 activation of MPK2 is dependent on the COI1 receptor, we treated coi1 mutant lines with JA 224 and monitored subsequent MPK2 activity. JA-triggered MPK2 activation was reduced in the 225 two mutant alleles, coi1-34 and coi1-16 (fig. S11). Moreover, in response to wounding, 226 MPK2 activation was reduced in both coi1-34 and opr3, a mutant impaired in JA biosynthesis 227 (fig. 5C and 5D). Coherent with a role of JA in the signaling pathway, wound-triggered 228 upregulation of clade-III MAP3Ks was also partially impaired in coi1-34 (fig. S12). Taken 229 together, these results indicate that JA synthesis and signaling, likely through the modulation 230 of MAP3K expression, activate the MKK3-MPK2 module upon wounding.

231 Rapid wound-induced activation of MPK3 and MPK6 is independent of MKK3 232 Classical stress-responsive MAPKs, such as Medicago SIMK and SAMK, tobacco 233 SIPK and WIPK, and their Arabidposis homologs MPK3 and MPK6, are known to define 234 functional modules which are activated by wounding (Meskiene et al., 2003; Seo et al., 2007; 235 Li et al., 2017). In our conditions, an antibody raised against the ERK2 phospho-motif pT-E- 236 pY (referred as anti-pTpY), detected two bands (around 40-45 KD) in Arabidopsis leaves 237 rapidly after wounding (fig. 6A and S13A). In 15-minutes wounded leaves of mpk6-2 and 238 mpk3-1 mutants, the higher and lower bands disappeared, respectively, confirming that MPK6 239 and MPK3 are activated by wounding (fig. S13B). Importantly, the wound-induced activation 240 of MPK3 or MPK6 was not affected in mkk3-1, mkk3-2, map3k14-1 or map3k14-CR1 lines 241 (fig 6A, S13D, S13E and S13F) but strongly impaired in the double mutant mkk4mkk5 (fig. 242 6B, S13C) as previously described (Li et al., 2017). Moreover, MPK3 and MPK6 were not

8 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

243 activated by JA and the wound-induced activation of MPK3/6 was not compromised in the 244 JA-sensing-deficient coi1-34 mutant (fig. S14). Overall, these data show that two MAPK 245 modules are activated by wounding with different kinetics, a rapid MKK4/5-MPK3/6 module 246 that is independent of JA, and a slower MKK3-MPK2 module that depends on JA signaling.

247 MKK3-MPK2 and MKK4/5-MPK3/6 modules are activated by wounding independently of 248 each other 249 The fact that the MKK4/5-MPK3/6 module is activated rapidly might suggest that it 250 could function upstream of MKK3-MPK2. This idea is supported by the finding that, in 251 tobacco, SIPK and WIPK, which are homologues of Arabidopsis MPK3 and MPK6, were 252 proposed to play a role in wound-induced JA synthesis (Seo et al., 1999; Heinrich et al., 2018; 253 Seo et al., 1995, 2007) and we show here that JA is an important signal of wound-induced 254 MKK3-MPK2 activation in Arabidopsis. To test whether the MKK4/5-MPK3/6 module acts 255 upstream of MKK3-MPK2, MPK2 activation by wounding was compared in Col-0 and 256 mkk4mkk5 plants (fig. 6B). Although wound activation of MPK3 and MPK6 was barely 257 detected in mkk4mkk5 leaves, MPK2 activation was virtually unchanged. This result indicates 258 that MPK2 activation does not rely on MKK4/5-MPK3/6 function. Although homologs of 259 MPK3/6 in other species were proposed to control JA production, our results suggest that 260 MPK3/6 are not involved in JA-mediated activation of MPK2 by wounding. To clarify this 261 conundrum, we tested whether JA hormone synthesis was regulated identically in tobacco and 262 Arabidopsis. For this purpose, we measured JA levels in Col-0 and mkk4mkk5 plants at 263 various time points after wounding (fig. 6C and fig. S15). JA, JA-Ile and cis-OPDA levels 264 strongly and rapidly increased upon wounding but were unaffected in mkk4mkk5 mutants, 265 indicating that the MKK4/5-MPK3/6 module is not involved in wound-induced JA 266 accumulation.

267 The MKK3-MPK2 module is activated by Spodoptera littoralis feeding 268 Mechanical wounding partly mimics attacks by herbivorous insects. To test whether 269 insects are able to activate the MAPK pathways with similar kinetics, starved S. littoralis 270 larvae were allowed to feed on WT leaves for 15 minutes before removal. MAPK activation 271 was subsequently monitored for 4h (fig. 7A). Under these conditions, MPK2 was activated 272 after 30 minutes with a peak at 1 hour. MPK3 and MPK6 were only weakly activated at 5 and 273 15 min (fig. 7A). The MPK2 activation was dependent on MKK3 (fig. 7B) and COI1 (fig. 274 7C), like in wounding, suggesting that JA also plays a prominent role in the S. littoralis- 275 triggered MPK2 activation.

9 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

276 To test whether the MKK3 module was necessary to restrict insect herbivory, we 277 compared the growth of S. littoralis larvae on Col-0 and mkk3-1 plants and observed a 278 significant increase in larval weight when fed on mkk3-1 leaves (fig. 7D). These results show 279 that the MKK3 module can restrict S. littoralis growth. 280

10 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

281 Discussion 282 We report in this study the activation of two independent MAPK modules by wounding 283 in Arabidopsis plants (fig. 8). The first module is defined by MKK4/5-MPK3/6. The second 284 module, defined by MKK3-clade-C MAPKs, was suspected from previous preliminary 285 information (Ortiz-Masia et al., 2007). These two modules are activated independently of 286 each other with very distinct kinetics. We also demonstrated that jasmonic acid, which is 287 produced in response to wounding and herbivores, is an important mediator of the activation 288 of the MKK3 module. Overall, this work provides insight into wound signaling of 289 Arabidopsis.

290 MAP3K13/14/15/16/17/18/19/20-MKK3-MPK1/2/7/14: general late responsive MAPK 291 modules? 292 Our data suggest that the MKK3-MPK2 module is activated through the JA- and 293 wound-induced transcription of several clade-III MAP3Ks. Among them, MAP3K14 shows 294 the highest and earliest expression upon wounding. Coherently, we observed a reduction of 295 MPK2 activation by wounding specifically at early time points in the loss-of-function 296 map3k14 CRISPR lines. We also observed a stronger wound-induced MPK2 activation in 297 map3k14-1, which expresses a truncated and more stable form of MAP3K14. In addition, 298 other members of the clade-III MAP3Ks, such as MAP3K18, MAP3K17, MAP3K19 and 299 MAP3K20, which are induced by wounding at a later time point, may maintain MPK2 activity 300 after MAP3K14-triggered initial activation. Among the 8 clade-III MAP3K proteins, only 301 MAP3K13 and MAP3K14 have a carboxyl-terminal extension which could correspond to a 302 transmembrane domain, possibly suggesting a particular role at the membrane, a location 303 thought to play a role in cellular wound sensing (Farmer et al., 2014). Unfortunately, we did 304 not succeed to see any fluorescent signal in lines expressing MAP3K14::YFP after wounding, 305 suggesting a very low expression level of MAP3K14 or alternatively that the YFP fusion at 306 the C-terminus may reduce MAP3K14 stability (data not shown). As expected in a process 307 requiring de novo protein production, the general inhibitor of protein synthesis, 308 cycloheximide, fully abolished the wound-induced MPK2 activation. In the past, de novo 309 synthesis of MAP3Ks has been well documented in the case of the MKK3-MPK7 activation 310 by drought which requires ABA-dependent MAP3K18 protein accumulation (Danquah et al., 311 2015; Boudsocq et al., 2015). Here we describe another stress triggering MKK3 module 312 activation by de novo protein synthesis of MAP3Ks via transcriptional regulation. This new 313 result comforts this model, suggesting that the late responsive signaling MAPK pathways are

11 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

314 more general than first thought. Therefore the module could broadly regulate a second layer 315 of events in response to environmental constraints (Colcombet et al., 2016). 316 MKK3 modules have been by far less characterized than the iconic stress-activated 317 module MKK4/5-MPK3/6. An obvious explanation lies in its rather atypical slow activation, 318 which was unexpected; textbooks often teach that MAPK modules are early/rapid signaling 319 actors. Additionally, clade-C MAPKs have never been detected so far by in-gel kinase assays. 320 Nevertheless, phosphorylated activation motifs of clade-C MAPKs have been found in 321 phosphoproteomic approaches suggesting that they are often activated. For example, MPK1/2 322 phosphorylation was reported in response to ABA (Umezawa et al., 2013) and DNA damage- 323 inducing irradiations (Roitinger et al., 2015). Interestingly, in map3k14-1 that over-activates 324 MPK2 in response to wounding, the anti-pT-E-pY antibody detected a new band appearing 325 below MPK3 and MPK6 with a kinetics fitting clade-C MAPK activation (Fig. S13E). This 326 suggests that clade-C MAPKs are tightly controlled to avoid full activation. More 327 exhaustively, transcriptional regulation of clade-III MAP3Ks by stresses seems to occur very 328 often based on expression databases (Winter et al., 2007; Zimmermann et al., 2004), and 329 suggests important roles of MKK3 modules in environmental perception. Notably, 330 MAP3K13, MAP3K18 and MAP3K20 are induced by a large number of environmental 331 signals including osmotic, salt and drought stresses. Whereas MKK3 is a hub of the module, 332 the related MAP3Ks and MAPKs are encoded by multigenic families. The input signal 333 specificity is conferred by the transcriptional regulation of the MAP3K genes but we cannot 334 exclude that MAP3K activity is also directly modulated by input stresses, as suggested in 335 ABA signalling (Matsuoka et al., 2015; Mitula et al., 2015). The situation is less clear for 336 MAPKs: MPK1/2/7/14 seem to be activated identically by a stress, based on protoplast 337 experiments and immunoprecipitation from organs (Danquah et al., 2015). Our hypothesis to 338 explain this functional redundancy is that they may be expressed in different 339 cells/compartments or target specific substrates. This should be an important point to address 340 in the future. 341 Last, MKK3 has also been proposed to function upstream of MPK6 and MPK8 in 342 various contexts such as blue light, dark-light transition and ROS homeostasis (Sethi et al., 343 2014; Takahashi et al., 2007, 2011; Lee, 2015). We previously reported that these functional 344 connections were not found when combining these kinases in protoplast expression systems 345 (Danquah et al., 2015). Additionally, in the present work, we did not see any MKK3-MPK6 346 functional connection in the context of wounding. Nonetheless, it is possible that such

12 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

347 connections exist in other physiological contexts in specific cell types or organs (Colcombet 348 et al., 2016).

349 Is wound-induced JA production connected to MAPK modules? 350 The phytohormone JA plays a critical role in the wound response (Wasternack, 2018). It 351 is massively produced in a few minutes after wounding by chloroplast- and perixisome- 352 localized biosynthetic enzymes and is involved both in local and long-distance responses 353 (Wasternack and Hause, 2013; Koo et al., 2009). Plants impaired in JA synthesis and 354 signaling have weakened responses to wounding and are much more susceptible to chewing 355 insects (Howe and Jander, 2008). The JA core signaling module is well described (Thines et 356 al., 2007; Chini et al., 2007): JASMONATE ZIM DOMAIN (JAZ) proteins sequester 357 transcription factors, notably basic helix-loop-helix (bHLH) factors such as MYC2 to prevent 358 them from activating JA-responsive genes. The binding of JA-Ile to COI1 receptor, which is 359 an F-Box E3 ligase, increases COI1 affinity for JAZ proteins, triggering their ubiquitination 360 and consequent proteasome-dependent degradation. The released transcription factors become 361 free to modulate gene expression (Thines et al., 2007). In this article, we report a reduction of 362 wound-triggered MPK2 activation in opr3 and coi1 mutants, which are impaired in JA 363 synthesis and signaling, respectively. Therefore we can conclude that the activation of the 364 MKK3-MPK1/2/7/14 module is downstream of JA signaling and synthesis. The remaining 365 activation in these mutants could be explained either by the existence of JA-independent 366 pathways controlling MAP3K transcriptional regulation in response to wounding or by the 367 fact that they are not total loss-of-function mutants. opr3 mutant was reported to still produce 368 some JA-Ile (Chini et al., 2018) and coi1-34 is not a full loss-of-function allele (Acosta et al., 369 2013). Surprisingly, the wound-triggered up-regulation of MAP3K transcripts is only mildly 370 impaired in the JA mutants whereas the MAPK activation is strongly reduced. It is possible 371 that the active MAP3K amount is limiting, titrated by competition. Alternatively, beside 372 transcriptional induction, MAP3Ks may also require a JA-dependent modification (i.e. 373 phosphorylation) for their activation, and the two impaired regulations would lead to a strong 374 reduction of MPK2 activation. This last hypothesis is supported by the fact that MAP3K18 375 intrinsic activity increases upon ABA treatment (Matsuoka et al., 2015; Mitula et al., 2015). 376 These results add a new layer of complexity in the chain of events triggered by JA 377 perception. The question of what is controlled by the JA-activated MKK3 module remains 378 open. MKK3-related modules had been shown to regulate ROS homeostasis in response to 379 wounding, but was then proposed to work upstream of the clade-D MAPK MPK8 (Takahashi

13 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

380 et al., 2011). Recently, the MAP2K inhibitor PD98059 was shown to reduce JA-triggered 381 activation of enzymes involved in ascorbate and glutathione metabolism in maize leaves 382 (Shan and Sun, 2018). Overall, these results point to redox homeostasis as a putative target of 383 MKK3 module in the general response to wounding and JA. 384 The signaling pathway from wound signaling to JA production is largely unknown. One 385 known event is the transient increase of cytosolic Ca2+ (Maffei et al., 2004; Kiep et al., 2015) 386 which must be decoded by Ca2+-sensing proteins. Two calmodulin-like-proteins, CML37 and 387 CML42, have been identified as positive and negative regulators, respectively, of JA- 388 mediated defense in Arabidopsis plants after herbivore attack (Vadassery et al., 2012; Scholz 389 et al., 2014). While CML42 very likely affects the binding of JA-Ile to the receptor, CML37 390 regulates the expression of JAR1, the enzyme catalyzing the JA-Ile formation. Our work 391 shows that JA synthesis is not under the control of MPK3/6. This is surprising as the 392 homologs of MPK3 and MPK6, WIPK and SIPK, respectively, were shown to modulate JA 393 levels in response to wounding in tobacco (Seo et al., 1999, 1995, 2007; Heinrich et al., 394 2018). This apparent discrepancy might be explained by different approaches used in the 395 studies. Notably, we took advantage of a unique mkk4mkk5 mutant issued from a tilling 396 screen (Zhao et al., 2014), in which the wound-induced activation of MPK3/6 is strongly 397 reduced but not fully abolished. It is possible that the remaining weak activation of MPK3/6 is 398 sufficient to trigger downstream events such as the hormonal production. Nevertheless, this 399 hypothesis is unlikely as this mutant is clearly impaired in wound-induced ethylene 400 production (Li et al., 2017). Alternatively, and more interestingly, these results suggest that 401 homologous MAPKs may not regulate the same responses in various plant species, despite 402 being activated similarly by a given stress. This might correspond to diverging adaptation 403 strategies in tobacco and Arabidopsis. 404 MPK3 and MPK6 are very well-known stress-responsive MAPKs. Many of their 405 substrates have been identified in the context of Microbe-Associated Molecular Pattern 406 (MAMP) signaling (Bigeard et al., 2015; Rayapuram et al., 2018; Bigeard and Hirt, 2018). 407 However, very little is known about their functions in response to other stresses and notably 408 in response to wounding. The recent discovery that the MKK4/5-MPK3/6 module is involved 409 in wound-induced ethylene production through the transcriptional regulation of ACS genes 410 was the first report of their role in wound signaling in Arabidopsis (Li et al., 2017). 411 Interestingly, the same module is involved in ethylene production in response to flg22 and 412 Botrytis (Li et al., 2012; Liu and Zhang, 2004). This regulation occurs through both a direct 413 phosphorylation-dependent stabilization of the ACS6 enzyme and the up-regulation of ACS

14 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

414 genes by the phosphorylation-dependent activation of the WRKY33 transcription factor. In 415 rice, OsMPK1, the closest homolog of AtMPK6, was also shown to interact with and 416 phosphorylate WRKYs in vitro (Yoo et al., 2014). Interestingly, cycloheximide, which is a 417 potent blocker of MKK3 module activation (fig. 3), is a strong activator of MPK3/6 (fig. S16) 418 and triggers the transcriptional up-regulation of a large set of MAMP-regulated genes 419 (Navarro et al., 2004). Overall, these data suggest that the MKK4/5-MPK3/6 module may be 420 involved in the control of gene expression in response to wounding as for other stresses (Frei 421 dit Frey et al., 2014).

422 Roles of the MAPKs in the interaction with herbivores 423 MAPKs also play an important role in plant-herbivore interactions (Hettenhausen et al., 424 2017). Early studies in Nicotiana tabaccum showed that WIPK is activated rapidly by 425 wounding and that WIPK-silenced plants have reduced levels in defense-related genes and JA 426 (Seo et al., 1995). In Nicotiana attenuata, mechanical wounding and oral secretion of the 427 herbivore Manduca sexta activate SIPK and WIPK within 5 minutes (Wu et al., 2007). In 428 Arabidopsis, grasshopper oral secretion increases the wound-induced activation of MPK3 and 429 MPK6 (Schäfer et al., 2011). In Solanum lycopersicum, M. sexta feeding also activates WIPK 430 and SIPK homologs SlMPK3 and SlMPK1/2, respectively, and silencing SlMPK1/2 reduces 431 herbivory-induced JA levels resulting in enhanced larval growth (Kandoth et al., 2007). 432 However, other studies in N. tabaccum and N. attenuata reveals more complexity in the JA- 433 MAPKs relationship depending on herbivores. In response to wounding, tobacco MPK4 is 434 activated in minutes and silencing NtMPK4 compromises JA-responsive gene induction 435 (Gomi et al., 2005). By contrast, silencing NaMPK4 does not affect JA production nor 436 resistance to the generalist herbivore Spodoptera littoralis, but increases resistance to M. sexta 437 (Hettenhausen et al., 2017). This indicates that some functions of MPK4 are specific to 438 particular herbivore interactions and that further studies will be necessary to clarify the role of 439 different MAPK modules in wound- and herbivory-induced JA signaling. 440

15 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

441 Methods 442 Primer sequences for plant genotyping, molecular cloning and expression analysis are 443 provided in the supplemental table 1.

444 Plant material 445 mkk3-1, coi1-34 (Acosta et al., 2013), opr3, mpk3-1, mpk6-2 (Galletti et al., 2011), 446 mkk4mkk5 (Su et al., 2017) and map3k17map3k18:MAP3K18locus-YFP (Danquah et al., 447 2015) were published previously. mkk3-2 (Salk_208528) and map3k14-1 (Gabi_653B01) 448 were identified in public databases in the frame of this work. 449 To generate CRIPSR/Cas9 mutants of MAP3K14 gene, CRISPR guide sgRNA targeting 450 MAP3K14 was generated by cloning Cs9-3K14-F/Cs9-3K14-R primers into pDGE65 451 according to Ordon et al. (2016). The vector was transformed into Agrobacterium tumefaciens 452 C58C1 and used to transform Arabidopsis Col-0 plants using floral dipping (Clough and Bent, 453 1998). The number of inserted T-DNA in 20 independent Basta-resistant lines were identified 454 by segregation of T1 seeds in vitro. To eliminate the Cas9 endonuclease, the Basta-sensitive 455 plantlets were rescued by careful transfer on pots and, after recovery, genotyped for mutations 456 in MAP3K14, for the absence of mutations in the closest homologue gene MAP3K13 and for 457 the absence of the pDGE65 T-DNA in the genome. Two independent and homozygous lines 458 (MAP3K14–CR1 and MAP3K14–CR2) were identified. MPK1, MPK2, MPK7 and MKK3 459 loci upstream of the STOP codon and containing 5’UTR, introns and exons as well as a large 460 part of promoters were amplified using appropriate primers (Table S1) and the iProof enzyme 461 (Bio-Rad), digested with appropriate restriction enzymes and fused in frame with HA or YFP 462 tags in home-made binary vectors derived from pGREEN0229, referred as pGREEN0229- 463 MPK1-HA, pGREEN0229-MPK2-HA, pGREEN0229-MPK7-HA and pGREEN0229- 464 MKK3-YFP. Vector sequences are provided as table S2. Vectors were transformed into A. 465 tumefaciens strain C58C1 containing pSOUP helper plasmid (Hellens et al., 2000). 466 Kanamycin-resistant Agrobacteria were then used to transform Col-0 or mkk3-1 Arabidopsis 467 plants using the floral dipping method (Clough and Bent, 1998). Segregation analysis of 468 Basta-resistance was used to identify homozygous lines.

469 Wounding experiments 470 A detailed protocol for wounding is provided (text S1). Briefly, single plants were 471 grown on pellets (Jiffy-7 38mm Pellet-Pack, Ref # 32204011, Jiffy Products International AS, 472 Norway) in a Percival growth chamber with 12 hours dark/12 hours light at 22°C and 70% 473 humidity for 4 weeks before experiments. Three fully-expended leaves of an Arabidopsis

16 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

474 rosette were wounded three times using tweezers (5 mm round tip with line serrated surfaces). 475 Wounding was performed at proper time to obtain the expected incubation duration with the 476 harvesting of samples (3 leaves X 3 plants) at 3-4 pm. For cycloheximide treatments, a 477 solution containing 100 µM CHX (Sigma-Aldrich, Ref# C4859) in 0.03% DMSO as well as a 478 mock (0.03% DMSO) were sprayed equally onto rosettes 150 min before collecting samples. 479 Samples were frozen in liquid nitrogen, grinded either using pestles and mortars or 480 homogenizer (SIGMA) and kept at -80°C before further investigation. Experiments were 481 typically repeated 3 times with plants grown independently.

482 JA experiments 483 For JA-treated samples, seeds were sterilized (15 min in 70% EtOH) and 20-30 plantlets 484 were grown in small petri dishes (diameter 6 cm) containing 8 mL ½ MS + 1% sucrose for 10 485 days with 16 h light/8 h night at 22°C. Then plantlets were treated with 0.1% ethanol (mock) 486 or 50 µM JA (Sigma-Aldrich, ref # J2500). To stop treatments, plantlets were rapidly dried 487 and frozen in liquid nitrogen.

488 Insect experiments 489 Larvae of the generalist lepidopteran species Spodoptera littoralis were reared as 490 previously published (Vadassery et al., 2012). To monitor MPK2 activation or measure 491 oxylipin production in response to insect, 4th instar larvae were starved overnight prior to 492 plant feeding for 1h and 3h. To monitor MPK3/MPK6 activation, larvae were removed after 493 15 minutes. For long-term feeding assays (8 days), first instar larvae were used according to 494 Vadassery et al. (2012). When different plant lines were used at the same time, they were kept 495 separated from each other to avoid any kind of contact and placed randomly in the 496 experimental setup.

497 Kinase Assays 498 A detailed kinase assay protocol is provided (text S1). Kinase assays using α-MPK2 499 (Ortiz-Masia et al., 2007), α-HA (SIGMA A2095), α-MPK3 (SIGMA M8318) and α-MPK6 500 (SIGMA A7104) antibodies as well as western-blots were performed as previously described 501 (Danquah et al., 2015; Ortiz-Masia et al., 2007). It should be noted that α-MPK2 antibodies 502 can specifically immunoprecipitate MPK2 although they fail to detect the protein on western- 503 blots of total proteins (Ortiz-Masia et al., 2007).

504 Other assays

17 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

505 For gene expression analysis, plants were collected at indicated times and frozen in 506 liquid nitrogen. RNA extraction, cDNA synthesis and qRT-PCR analysis were performed as 507 previously described using primers in table S1 (Danquah et al., 2015). Yeast 2-hybrid assays 508 were performed as previously described except that the selective medium was generated with 509 0.2% dropout-T-L-U [US Biological] (Berriri et al., 2012). Jasmonate contents in Arabidopsis 510 thaliana leaves were analyzed by LC-MS as described previously (Almeida-Trapp et al., 511 2014).

512 Accession Numbers 513 Sequence data from this article can be found in the Arabidopsis Genome Initiative or 514 GenBank/EMBL databases under the following accession numbers: At1g10210 (MPK1), 515 At1g59580 (MPK2), At3g45640 (MPK3), At2g43790 (MPK6), At2g18170 (MPK7), 516 At5g40440 (MKK3), At1g51660 (MKK4), At3g21220 (MKK5), At1g07150 (MAP3K13), 517 At2g30040 (MAP3K14), At5g55090 (MAP3K15), At4g26890 (MAP3K16), At2g32510 518 (MAP3K17), At1g05100 (MAP3K18), At5g67080 (MAP3K19) and At3g50310 (MAP3K20).

519 Author Contributions and Acknowledgments 520 C.S., H.H., and J.C. designed the research. C.S., S.T.S., M.B., C.C., A.K., M.A-T., 521 A.M. and J.C. performed research. All the authors contributed to the manuscript. 522 We thank the Stress Signaling group for critical discussion of this work. We also thank 523 Shuqun Zhang and Edward Farmer for providing mkk4mkk5 and coi1-34 seeds. This work has 524 benefited from a French State grant (LabEx Saclay Plant Sciences-SPS, ANR-10-LABX- 525 0040-SPS), managed by the French National Research Agency under an "Investments for the 526 Future" program (ANR-11-IDEX-0003-02). C.S. and C.C. were funded by SPS PhD 527 fellowships. Marilia Almeida-Trapp gratefully acknowledges financial support by a Capes- 528 Humboldt Research Fellowship. This publication has been written with the support of the 529 AgreenSkills+ fellowship program which has received funding from the EU’s Seventh 530 Framework Program under grant agreement No. FP7-609398 (AgreenSkills+ contract) to 531 STS.

532 Figure legends 533 534 Fig. 1 - MPK2 activation by wounding depends on MKK3 535 A. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 specific 536 antibody from Col-0 and mkk3-1 leaves following wounding at the indicated times.

18 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

537 B. Kinase activity of MPK2 after immunoprecipitation with an anti-HA antibody from 538 leaves of plants expressing an HA-tagged version of MPK2 in Col-0 and mkk3-1 leaves 539 following wounding at the indicated times. Protein amount is monitored by western-blot using 540 anti-HA antibody. Equal loading is controlled by Coomassie staining. 541 542 Fig. 2 - Functional reconstitution of MKK3 modules 543 A. Yeast two-hybrid analysis of the interaction between MKK3 and WT and C-terminal 544 truncated forms (Δ) of MAP3K13 and MAP3K14. EV stands for Empty Vector. 545 B. Kinase activity of HA-immunoprecipitated MPK2 transiently expressed in mkk3-1 546 mesophyll protoplasts in the presence or absence of MKK3 and clade-III MAP3Ks. Western- 547 blots show protein expression levels. Equal loading is controlled by Coomassie staining. 548 549 Fig. 3 - MPK2 activation by wounding requires protein synthesis 550 A and B. Kinase activity of MPK2 after immunoprecipitation with anti-HA (A) and 551 anti-MPK2 (B) antibodies from leaves of indicated genetic background following 100µM 552 CHX and MOCK (DMSO) spraying prior to wounding. Protein amount is monitored by 553 western-blot using anti-HA (A) and anti-GFP (B) antibodies. Equal loading is controlled by 554 Coomassie staining. 555 C. qRT-PCR analysis of clade-III MAP3K genes in response to wounding. Transcript 556 levels are expressed relative to ACTIN2 reference gene. Values are mean±SE of 3 biological 557 replicates. 558 559 Fig. 4 – MAP3K14 plays a role in the activation of MPK2 by wounding 560 A. Genomic structure of MAP3K14 and CRISPR lines used in this work. 561 B. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 antibody 562 from WT and map3k14-CR1 and -CR2 leaves following wounding. 563 564 Fig. 5 – JA is involved in MKK3-MPK2 activation by wounding 565 A. JA, JA-Isoleucine and Cis-OPDA contents in wounded leaves of indicated genetic 566 backgrounds. Values are mean±SE of 3 biological replicates. 567 B. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 specific 568 antibody from Col-0 and mkk3-1 in vitro plantlets following 50µM JA or MOCK (EtOH) 569 treatments.

19 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

570 C and D. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 571 specific antibody leaves of indicated genetic backgrounds following wounding at indicated 572 times. 573 574 Fig. 6 – MKK4/5-MPK3/6 are not involved in wound-induced JA production 575 A and B. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 576 specific antibody from Col-0 (A, B) and mkk3-1 (A) and mkk4mkk5 (B) leaves following 577 wounding at indicated times. MPK3/6 activation was monitored by western-blot using 578 antibody raised against the phosphorylated form of ERK2 (anti-pTpY). Equal loading is 579 controlled by Coomassie staining. 580 C. JA, JA-Isoleucine and Cis-OPDA contents in wounded leaves of Col-0 and 581 mkk4mkk5. Values are mean±SE of 3 biological replicates. 582 583 Fig. 7 – MKK3-MPK2 module is activated by Spodoptera littoralis feeding 584 A. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 specific 585 antibody from leaves on which S. littoralis fed during 15 minutes before to be removed (at 586 t=15’). MPK3/6 activation was monitored by western-blot using antibody raised against the 587 phosphorylated form of ERK2 (anti-pTpY). Equal loading is controlled by Coomassie 588 staining. 589 B and C. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 590 specific antibody from leaves on which S. littoralis fed for 1 and 3 hours in Col-0 and coi1- 591 34. 592 D. Weight of S. littoralis caterpillars after feeding for 8 days on Col-0 and mkk3-1 593 rosettes. Box plot shows distribution of caterpillar weight (n>120 in 5 biological replicates). 594 Crosses show averages of biological replicates (39.5±5.2 and 54.4±6.6 mg for Col-0 and 595 mkk3-1, respectively [n=5]; statistical difference based on the Mann-Whitney test with 596 p<0.025). 597 598 Fig. 8 – Working model of MAPK activation by wounding 599 Wounding and insect feeding activate two MAPK modules: a rapid one composed of 600 MKK4/5-MPK3/6 which regulates notably ethylene production and a slow one composed of 601 clade-III MAP3Ks-MKK3-MPK1/2/7/14 whose activation is under the control of a JA- 602 dependent production of MAP3Ks. Drought also activates MAP3Ks-MKK3-MPK1/2/7/14 603 through an ABA-dependent step.

20 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

604

A Col-0 mkk3-2 Wounding 0 15’ 30’ 1h 2h 0 15’ 30’ 1h 2h MPK2 activity MBP (IP α-MPK2)

B Wounding 0 1h 0 1h 0 1h MPK2 activity MBP (IP α-MPK2)

Fig. S1 – MPK2 activation by wounding depends on MKK3 A and B. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 specific antibody from leaves of Col-0 and mkk3-2 KO (A) and Col-0, mkk3-1 KO and mkk3-1 MKK3-YFP complemented line (B) following wounding at the indicated times. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

A MPK1-HA

Wounding 0 30’ 1h 2h MPK1-HA activity MBP (IP α-HA)

MPK1-HA amount MPK1-HA (WB α-HA) RbcL

mkk3-1 B MPK7-HA MPK7-HA

Wounding 0 30’ 1h 2h 0 30’ 1h 2h MPK7-HA activity MBP (IP α-HA)

MPK7-HA amount MPK7-HA (WB α-HA) RbcL

Fig. S2 - MPK1 and MPK7 are activated by wounding A and B. Kinase activity of MPK1 (A) and MPK7 (B) after immunoprecipitation with an anti-HA antibody from leaves of plants expressing a HA-tagged version of MPK1/7 following wounding at the indicated times. Protein amount is monitored by western-blot using anti-HA antibody. Equal loading is controlled by Coomassie staining. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

flg22 500 nM MOCK 0’ 5’ 10’ 15’ 30’ 1h 2h 4h 5’ 10’ 15’ 30’ 1h 2h MPK6 total MPK3 phospho-MAPK (WB α-pTpY) RbcL

Fig. S3 – Flg22 rapidly and transiently activates MPK3 and MPK6 in leaf punches Punches from Col-0 leaves were equilibrated over night in water and then treated for the indicated time with 500 nM flg22 or water (MOCK). MPK3 and MPK6 phosphorylation is monitored by western-blot using an antibody raised against the phosphorylated form of ERK2 (anti-pTpY). Equal loading is controlled by Coomassie staining. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

AD-MAP3K01 AD-MAP3K02

AD-MAP3K03 II and clade I AD-MAP3K04 AD-MAP3K05 AD-MAP3K08

AD-MAP3K10 AD-MAP3K12 AD-MAP3K13 AD-MAP3K14 AD-MAP3K15 clade III AD-MAP3K16 AD-MAP3K17

AD-MAP3K18 AD-MAP3K19 AD-MAP3K20 AD-EV

-Leu -Leu -Trp -Trp -Ura

Fig. S4 – MKK3 and clade-III MAP3Ks interact in yeast 2-hybrid assay Yeast 2-hybrid experiment showing the interaction of MEKK-like MAPKs with MKK3. 16 of the 20 MEKK-like kinases of Arabidopsis and MKK3 were respectively fused to the activation domain (AD) and the DNA binding domain (BD) of a transcription factor allowing the growth of yeast on a selective medium. EV stands for Empty Vector. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

MAP3K - - - MKK3 - - + + + + + MPK2 - + + + + + +

MPK2-HA activity MBP (IP α-HA)

MAP3K-YFP amount MAP3K-YFP (WB α-GFP) RbcL

MKK3-Myc amount MKK3-Myc (WB α-myc) RbcL

MPK2-HA amount MPK2-HA (WB α-HA) RbcL

Fig. S5 – MAP3K14 activity is necessary for MKK3-MPK2 activation Kinase activity of HA-immunoprecipitated MPK2 expressed in mkk3-1 mesophyll protoplasts in the presence or absence of MKK3 and indicated versions of MAP3K14. MAP3K14-1 is a truncated and more stable form of MAP3K14 (see fig. S8). The detection of MAP3K14-1 and MAP3K14-1D140A by western-blot strengthens the results obtained with MAP3K14. Western-blots show protein expression levels. Equal loading is controlled by Coomassie staining. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

MPK1-HA A DMSO CHX Wounding 0 15’ 1h 0 15’ 1h MPK1-HA activity MBP (IP α-HA)

MPK1-HA amount MPK1-HA (WB α-HA) RbcL

MPK7-HA B DMSO CHX Wounding 0 15’ 1h 0 15’ 1h MPK7-HA activity MBP (IP α-HA)

MPK7-HA amount MPK7-HA (WB α-HA) RbcL

Fig. S6 – MPK1 and MPK7 activations by wounding require protein synthesis A and B. Kinase activity of MPK1 (A) and MPK7 (B) after immunoprecipitation with an anti-HA antibody from leaves of indicated genetic background following 100µM CHX and MOCK (DMSO) spraying prior to wounding. Protein amount is monitored by western-blot using an anti-HA antibody. Equal loading is controlled by Coomassie staining. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

map3k17map3k18 MAP3K18-YFP Wounding 0 15’ 30’ 1h 2h 4h MAP3K18-YFP amount MAP3K18-YFP (WB α-GFP) RbcL

Fig. S7 – MAP3K18 accumulates in response to wounding Western-blot using anti-GFP antibody showing MAP3K18-YFP protein level expressed under its own promoter in wounded leaves. Equal loading is controlled by Coomassie staining. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Gabi_653B01 ATG LB STOP At2g30040 gDNA (bp) 0 1041 1389

0 347 463 A Protein (aa) Kinase domain

E S E A K K E V L V S P R V E MAP3K14 GAGTCAGAGGCAAAAAAGGAAGTTCTTGTTTCTCCAAGGGTAGAA MAP3K14-1 GAGTCAGAGGCAAAAAAGGAAATCTACATGTAAATGGCTTCATGT E S E A K K E I Y M *

B Col-0 map3k14-1 Wounding 0 15’ 30’ 1h 2h 4h 0 15’ 30’ 1h 2h 4h MPK2 activity MBP (IP α-MPK2)

MAP3K - - - C MKK3 - - + - + - + - + MPK2 - + + + + + + + + MPK2-HA activity (IP α-HA) MBP

MAP3K-YFP amount MAP3K-YFP (WB α-GFP) MKK3-Myc amount MKK3-Myc (WB α-myc) MPK2-HA amount (WB α-HA) MPK2-HA

Fig. S8 – MPK2 Activation by wounding is higher in map3k14-1 A. Genomic structure of T-DNA insertion in map3k14-1. The resulting protein MAP3K14-1 is shorter of 116 amino acids. B. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 antibody from WT and map3k14-1 leaves following wounding. C. Kinase activity of HA-immunoprecipitated MPK2 expressed in mkk3-1 mesophyll protoplasts in the presence or absence of MKK3 and MAP3K14wt and MAP3K14-1. Western-blots show protein expression levels. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Col-0 map3k14-CR1 map3k14-CR2 1.2

0.8

0.6 * 0.4 *

Relative activity Relative MPK2 0.2 (activity/activity in (activity/activity 1h WT) at

0 0 15' 30' 1h 2h 4h Time after wounding

Fig. S9 – Quantification of MPK2 activation by wounding in map3k14-CR1 and -CR2 lines Quantification of MPK2 activity in response to wound in Col-0 and 2 independent map3k14-CR lines. For each experiment (such as in fig 4B), phosphorylation values were normalized to the phosphorylation value at 1 hr in WT. Values are mean±SE of 4 biological replicates. Stars indicate statistical differences with Col-0 (Mann and Whitney test; α=5%).

A MPK2-HA mkk3-1 MPK2-HA JA 50µM MOCK JA 50µM MOCK 0 0 5’ 30’ 1h 2h 5’ 30’ 1h 2h 0 0 5’ 30’ 1h 2h 5’ 30’ 1h 2h MPK2-HA activity MBP (IP α-HA)

MPK2-HA amount MPK2-HA (WB α-HA) RbcL

mkk3-1 MPK1-HA MPK7-HA MPK7-HA B C 30’ 30’ 30’ 30’ 30’ 30’ 0 MOCK JA 0 MOCK JA 0 MOCK JA MPK1-HA activity MPK7-HA activity MBP MBP (IP α-HA) (IP α-HA)

MPK1-HA amount MPK1-HA MPK7-HA amount MPK7-HA (WB α-HA) (WB α-HA) RbcL RbcL

Fig. S10 – MPK1, MPK2 and MPK7 are activated by JA A to C. Kinase activity of MPK2 (A), MPK1 (B) and MPK7 (C) after immunoprecipitation with an anti-HA antibody from leaves of WT (A, B, C) and mkk3-1 (A, C) plants expressing a HA-tagged version of MPK2 (A), MPK1 (B) and MPK7 (C) following 50µM JA or MOCK (EtOH) treatments for indicated times. Protein amount is monitored by western-blot using anti-HA antibody. Equal loading is controlled by Coomassie staining. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

A Col-0 coi1-16 30’ 30’ 30’ 30’ MOCK JA MOCK JA MPK2 activity MBP (IP α-MPK2)

Col-0 coi1-34 B MOCK JA 50µM MOCK JA 50µM 0 15’ 30’ 1h 15’ 30’ 1h 0 15’ 30’ 1h 15’ 30’ 1h MPK2 activity MBP (IP α-MPK2)

Fig. S11 – JA triggered MPK2 activation is impaired in mutants of JA receptor A and B. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 specific antibody from Col-0 (A, B) coi1-16 (A) and coi1-34 (B) plantlets following 50µM JA or MOCK (EtOH) treatments. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Col-0 coi1-34

10 2 MAP3K14 MAP3K15 8 1.5 6 1 4 * 0.5 2 * *

0 0 0 50 100 150 200 250 0 50 100 150 200 250

0.8 8 MAP3K16 MAP3K17 0.6 6

0.4 4

0.2 2 * 0 0 * Relative transcript abundance transcript Relative 0 50 100 150 200 250 0 50 100 150 200 250

2 1.5 MAP3K18 MAP3K19 1.5 1 1 * 0.5 0.5 * * 0 0 * 0 50 100 150 200 250 0 50 100 150 200 250

Times after wounding (min)

Fig. S12 – coi1-34 mutation reduces the expression of some wounding-induced MAP3Ks qRT-PCR analysis of clade-III MAP3Ks in response to wounding in Col-0 and coi1-34 leaves. Transcript levels are expressed relative to ACTIN2 reference gene. Values are mean±SE of 3 biological replicates. Stars indicate statistical differences between WT and coi1-34 (Mann and Whitney test; α= 1%). bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Col-0 mkk3-1 Wounding 0 5’ 15’ 30’ 1h 2h 4h 0 5’ 15’ 30’ 1h 2h 4h A

total phospho-MAPK MPK6 (WB α-pTpY) MPK3

250 130 95 72 55 RbcL 36 28 17

Col-0 mkk4mkk5 B C Wounding 15’ 15’ 15’ 15’ Wounding 0 15’ 1h 0 15’ 1h MPK2 activity (IP α-MPK2) MBP

total MPK3 activity MBP phospho-MAPK (IP α-MPK3) MPK6 (WB α-pTpY) MPK3 MPK6 activity MBP (IP α-MPK6)

total MPK6 MPK3 250 phospho-MAPK 130 (WB α-pTpY) RbcL 95 72 MPK3 amount MPK3 55 (WB α-MPK3) RbcL RbcL 36 MPK6 amount MPK6 28 (WB α-MPK6) RbcL 17 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

D Col-0 mkk3-1 mkk3-2 Wounding 0 15’ 30’ 0 15’ 30’ 0 15’ 30’ MPK6 total MPK3 phospho-MAPK RbcL (WB α-pTpY)

Col-0 map3k14-1 E 0 15’ 30’ 1h 0 15’ 30’ 1h total MPK6 MPK3 phospho-MAPK (WB α-pTpY) ? RbcL

F Col-0 map3k14-CR1 Wounding 0 15’ 30’ 1h 2h 4 h 0 15’ 30’ 1h 2h 4h

total MPK6 phospho-MAPK MPK3 (WB α-pTpY) RbcL

Fig. S13 – MPK3 and MPK6 activation depends on MKK4/MKK5 but not on MKK3 A and B. Western-blot using antibody raised against the phosphorylated form of ERK2 (anti-pTpY) in indicated genetic backgrounds after wounding. Equal loading is controlled by Coomassie staining. Figure S13A is an un-cropped version of western blot shown in figure 6A. C. Kinase activity of MPK2, MPK3, MPK6 after immunoprecipitation with an appropriate specific antibody from wounded leaves of Col-0 and mkk4mkk5 plants. MPK3/6 activation was monitored by western-blot using antibody raised against the phosphorylated form of ERK2 (anti-pTpY). Equal loading is controlled by Coomassie staining. D to F. Western-blots using antibody raised against the phosphorylated form of ERK2 (anti-pTpY) in indicated genetic backgrounds. “?” (D) referred to a map3k14-1 specific band which could correspond to the over activation of clade-C MAPKs. Equal loading is controlled by Coomassie staining. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

MOCK JA 50µM Flg22 1µM

A 0 15’ 30’ 1h 2h 15 ’ 30’ 1h 2h 15’ 30’ 1h MPK6 total MPK3 phospho-MAPK MPK4 Col-0 (WB α-pTpY) RbcL MPK6 total MPK3 mkk3-1 phospho-MAPK MPK4 (WB α-pTpY) RbcL

B Col-0 coi1-34 Wounding 0 15’ 30’ 1h 0 15’ 30’ 1h total MPK6 MPK3 phospho-MAPK (WB α-pTpY) RbcL

Fig. S14 – MPK3 and MPK6 activity is independent of JA A. Western-blots using antibody raised against the phosphorylated form of ERK2 (anti-pTpY) in in vitro Col-0 and mkk3-1 plantlets treated with 50µM JA, 1µM flg22 and MOCK (EtOH). Equal loading is controlled by Coomassie staining. B. Western-blots using antibody raised against the phosphorylated form of ERK2 (anti-pTpY) in Col-0 and coi1-34 in response to wounding. Equal loading is controlled by Coomassie staining. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Col-0 mkk4mkk5 5000 600 700 JA JA-Ile Cis-OPDA 600 4000 500 500

400 3000 400 300 /g FW 2000 300 ng 200 200 1000 100 100 0 0 0 0 15 30 0 15 30 0 15 30 Time after wounding

Fig. S15 – Oxylipin contents in mkk4mkk5 JA, JA-Isoleucine and Cis-OPDA contents in wounded leaves of Col-0 WT and mkk4mkk5. Values are mean±SE of 3 biological replicates. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

A Col-0 mkk3-1 mkk3 MKK3-YFP

MOCK CHX MOCK CHX MOCK CHX Wounding 0 15’ 1h 0 15’ 1h 0 15’ 1h 0 15’ 1h 0 15’ 1h 0 15’ 1h MPK6 total MPK3 phospho-MAPK (WB α-pTpY) RbcL

B Col-0 MOCK CHX

Wounding 0 15’ 1h 0 15’ 1h

MPK3 activity MBP (IP α-MPK3) MPK6 activity MBP (IP α-MPK6)

MPK6 amount (WB α-MPK6) MPK6

MPK6 amount MPK3 (WB α-MPK6)

Fig. S16 – MPK3 and MPK6 are activated by cycloheximide A. Western-blots using antibody raised against the phosphorylated form of ERK2 (anti- pTpY) from leaves of indicated genetic backgrounds following 100µM CHX and MOCK (DMSO) spraying prior to wounding. Equal loading is controlled by Coomassie staining. B. Kinase activity of MPK3 and MPK6 after immunoprecipitation with specific antibodies from Col-0 leaves following 100µM CHX and MOCK (DMSO) spraying prior to wounding. Western-blots show MAPK amount.

A Col-0 mkk3-1 Wounding 0 15’ 30’ 1h 2h 4h 0 15’ 30’ 1h 2h 4h MPK2 activity MBP (IP α-MPK2)

B Col-0 MPK2-HA mkk3-1 MPK2-HA Wounding 0 0 5’ 15’ 30’ 1h 2h 4h 0 5’ 15’ 30’ 1h 2h 4h MPK2-HA activity (IP α-HA) MBP

MPK2-HA amount MPK2-HA (WB α-HA) RbcL

Fig. 1 - MPK2 activation by wounding depends on MKK3 A. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 specific antibody from Col-0 and mkk3-1 leaves following wounding at the indicated times. B. Kinase activity of MPK2 after immunoprecipitation with an anti-HA antibody from leaves of plants expressing an HA-tagged version of MPK2 in Col-0 and mkk3-1 leaves following wounding at the indicated times. Protein amount is monitored by western-blot using anti-HA antibody. Equal loading is controlled by Coomassie staining. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

EV -Leu -Trp BD-MKK3

EV -Leu -Trp -Ura BD-MKK3

MAP3K - - - 13 14 15 16 17 18 19 20 B MKK3 - - + - + - + - + - + - + - + - + - + MPK2 - + + + + + + + + + + + + + + + + + +

MPK2-HA activity MBP (IP α-HA)

MAP3K-YFP amount MAP3K-YFP (WB α-GFP) RbcL

MKK3-Myc amount MKK3-Myc (WB α-myc) RbcL

MPK2-HA amount MPK2-HA (WB α-HA) RbcL

Fig. 2 - Functional reconstitution of MKK3 modules A. Yeast two-hybrid analysis of the interaction between MKK3 and WT and C-terminal truncated forms (Δ) of MAP3K13 and MAP3K14. EV stands for Empty Vector. B. Kinase activity of HA-immunoprecipitated MPK2 transiently expressed in mkk3-1 mesophyll protoplasts in the presence or absence of MKK3 and clade-III MAP3Ks. Western-blots show protein expression levels. Equal loading is controlled by Coomassie staining.

MPK2-HA A DMSO CHX Wounding 0 15’ 1h 0 15’ 1h MPK2-HA activity MBP (IP α-HA)

MPK2-HA amount MPK2-HA (WB α-HA) RbcL

mkk3 MKK3-YFP B DMSO CHX Wounding 0 15’ 1h 0 15’ 1h MPK2 activity MBP (IP α-MPK2)

MKK3-YFP amount MKK3-YFP (WB α-GFP) RbcL

C 1 MAP3K14 0.8 MAP3K18 MAP3K17 MAP3K15 abundance 0.6 MAP3K19 MAP3K13 0.4 MAP3K16 MAP3K20 0.2 Relative transcript transcript Relative 0 0 50 100 150 200 250 Time after wounding (min)

Fig. 3 - MPK2 activation by wounding requires protein synthesis A and B. Kinase activity of MPK2 after immunoprecipitation with anti-HA (A) and anti-MPK2 (B) antibodies from leaves of indicated genetic background following 100µM CHX and MOCK (DMSO) spraying prior to wounding. Protein amount is monitored by western-blot using anti-HA (A) and anti-GFP (B) antibodies. Equal loading is controlled by Coomassie staining. C. qRT-PCR analysis of clade-III MAP3K genes in response to wounding. Transcript levels are expressed relative to ACTIN2 reference gene. Values are mean±SE of 3 biological replicates. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

ATG STOP At2g30040 gDNA (bp) 0 550 1389

A 0 149 463 Protein (aa) Kinase domain

MAP3K14 CTTTGGATGGCTCCGGAGGTGGTTAGAAGAGAG L W M A P E V V R R E MAP3K14-CR1 CTTTGGATGGCTCACGGAGGTGGTTAGAAGAGAG L W M A H G G G * MAP3K14-CR2 CTTTGGATGGCTCTCGGAGGTGGTTAGAAGAGAG L W M A L G G G *

B Col-0 map3k14-CR1 Wounding 0 15’ 30’ 1h 2h 4h 0 15’ 30’ 1h 2h 4h MPK2 activity MBP (IP α-MPK2) Col-0 map3k14-CR2 Wounding 0 15’ 30’ 1h 2h 4h 0 15’ 30’ 1h 2h 4h MPK2 activity MBP (IP α-MPK2)

Fig. 4 – MAP3K14 plays a role in the activation of MPK2 by wounding A. Genomic structure of MAP3K14 and CRISPR lines used in this work. B. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 antibody from WT and map3k14-CR1 and -CR2 leaves following wounding. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

A Col-0 mkk3-1 mkk3-1 MKK3-YFP 1000 100 350 JA JA-Ile Cis-OPDA 300 800 80 250

600 60 200

/g FW 400 40 150 ng 100 200 20 50 0 0 0 0 1h 3h 0 1h 3h 0 1h 3h Time after wounding

B JA 50 µM MOCK 0 10’ 30’ 1h 2h 4h 10’ 30’ 1h 2h 4h MBP MPK2 activity Col-0 (IP α-MPK2) mkk3-1 MBP

C Col-0 coi1-34 Wounding 0 15’ 30’ 1h 2h 4h 0 15’ 30’ 1h 2h 4h MPK2 activity MBP (IP α-MPK2)

D WS opr3 Wounding 0 15’ 30’ 1h 2h 0 15’ 30’ 1h 2h MPK2 activity MBP (IP α-MPK2)

Fig. 5 – JA is involved in MKK3-MPK2 activation by wounding A. JA, JA-Isoleucine and Cis-OPDA contents in wounded leaves of indicated genetic backgrounds. Values are mean±SE of 3 biological replicates. B. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 specific antibody from Col-0 and mkk3-1 in vitro plantlets following 50µM JA or MOCK (EtOH) treatments. C and D. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 specific antibody leaves of indicated genetic backgrounds following wounding at indicated times. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

A Col-0 mkk3-1 Wounding 0 5’ 15’ 30’ 1h 2h 4h 0 5’ 15’ 30’ 1h 2h 4h MPK2 activity (IP α-MPK2) MBP

total phospho-MAPK MPK6 (WB α-pTpY) MPK3 RbcL

Col-0 mkk4mkk5

B Wounding 0 15’ 30’ 1h 2h 4h 0 15’ 30’ 1h 2h 4h MPK2 activity MBP (IP α-MPK2)

MPK6 total phospho-MAPK MPK3 (WB α-pTpY) RbcL

C Col-0 mkk4mkk5 2500 300 250 JA JA-Ile Cis-OPDA 2000 250 200

200 1500 150 150 /g FW 1000 100 ng 100 500 50 50 0 0 0 0 1h 3h 0 1h 3h 0 1h 3h Time after wounding

Fig. 6 – MKK4/5-MPK3/6 are not involved in wound-induced JA production A and B. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 specific antibody from Col-0 (A, B) and mkk3-1 (A) and mkk4mkk5 (B) leaves following wounding at indicated times. MPK3/6 activation was monitored by western-blot using antibody raised against the phosphorylated form of ERK2 (anti-pTpY). Equal loading is controlled by Coomassie staining. C. JA, JA-Isoleucine and Cis-OPDA contents in wounded leaves of Col-0 and mkk4mkk5. Values are mean±SE of 3 biological replicates. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

C A Col-0 coi1-34 Col-0 Insect feeding 0 1h 3h 0 1h 3h Insect feeding MPK2 activity MBP (removed after 15’) 0 5’ 15’ 30’ 1h 2h 4h (IP α-MPK2) MPK2 activity MBP (IP α-MPK2) total MPK6 phospho-MAPK MPK3 D 0.15 (WB α-pTpY) RbcL

0.10 mkk3-1 B Col-0 mkk3-1 MKK3-YFP 0.05

Insect feeding 0 1h 3h 0 1h 3h 0 1h 3h (g) weight Larval MPK2 activity MBP (IP α-MPK2) 0.00

Fig. 7 – MKK3-MPK2 module is activated by Spodoptera littoralis feeding A. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 specific antibody from leaves on which S. littoralis fed during 15 minutes before to be removed (at t=15’). MPK3/6 activation was monitored by western-blot using antibody raised against the phosphorylated form of ERK2 (anti-pTpY). Equal loading is controlled by Coomassie staining. B and C. Kinase activity of MPK2 after immunoprecipitation with an anti-MPK2 specific antibody from leaves on which S. littoralis fed for 1 and 3 hours in Col-0 and coi1-34. D. Weight of S. littoralis caterpillars after feeding for 8 days on Col-0 and mkk3-1 rosettes. Box plot shows distribution of caterpillar weight (n>120 in 5 biological replicates). Crosses show averages of biological replicates (39.5±5.2 and 54.4±6.6 mg for Col-0 and mkk3-1, respectively [n=5]; statistical difference based on the Mann-Whitney test with p<0.025). bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Wounding/insect Drought

JA ABA PYR/PYL MKK4/5 PP2C COI1 SnRK2 ABF MPK3/6 MAP3K14/? MAP3K17/18

ACS MAP3K14/? MAP3K17/18 ethylene production MKK3

MPK1/2/7/14

Fig. 8 – Working model of MAPK activation by wounding Wounding and insect feeding activate two MAPK modules: a rapid one composed of MKK4/5- MPK3/6 which regulates notably ethylene production and a slow one composed of clade-III MAP3Ks-MKK3-MPK1/2/7/14 whose activation is under the control of a JA-dependent production of MAP3Ks. Drought also activates MAP3Ks-MKK3-MPK1/2/7/14 through an ABA-dependent step.

5 6 A. PREPARATION OF THE WOUND SAMPLES 7 8 4-5 weeks before: preparation of plants 9 - Keep seeds in water at 4°C for 1-2 days to homogenize germination. 10 - Rehydrate the pellets in their holder (Jiffy-7 38mm Pellet-Pack, Ref # 32204011, Jiffy Products 11 International AS, Norway) kept on a tray for 1h by bathing with tap water. Remove the extra water 12 by draining it out of the tray. 13 - Identify the pellets which will receive the seeds of each genotype by writing on the plastic holder. 14 Genotypes have to be randomized. Typically for two genotypes (A and B), we alternate the plants of 15 each genotypes (see tray map). 16 - Sow 2-5 seeds per pellet. 17 - After 7-10 days, remove plantlets to keep a single healthy one per pellet. 18 - Grow plants during 4-5 weeks at 12h/12h light (µmol m-2s-1/dark, 70% humidity and 22°C. They are 19 watered on Monday, Wednesday and Friday by filling the tray with 2 cm tap water. Extra water that 20 has not been sucked by pellets is removed after 1 hour. 21 22 Wounding experiment (Example of the comparison of two genotypes (WT versus mutant) for 23 MAPK activation at 0’, 15’, 30’, 1h, 2h and 4h) 24 - Prepare the appropriate number (12) of 2mL tubes, each containing a 4-5 mm iron bead. - In the 25 morning, prepare the experiment, by deciding which plants will be in the samples (typical tray map 26 provided as example, W=wounding). We use usually 3 plants per sample, each plant being wounded 27 on 3 fully developed leaves. 28 - Following the time scale, wound 3 fully grown leaves per plant. 29 - Harvest rapidly the 9 leaves (3 plants x 3 leaves/plant) in 2mL tube and freeze them in liquid 30 nitrogen. 31 - Keep at -80°C until use. 32

33 34

bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available 35 B. KINASE ASSAY FOR PLANT CLADE-Cunder a MAPKSCC-BY-NC-ND 4.0 International license. 36 Adapted from Ortiz-Masia et al. (2007 FEBS letter) by Cécile Sözen and Jean Colcombet 37 38 Day0 – Prepare day 1 39 - Label 7 sets of 1.5 mL tubes with sample number/names. 40 - Grind frozen samples either using iron beads/homogenizer. Keep at -80°C. 41 42 Day1 – Before to start 43 - Prepare the extraction buffer and cool on ice. 44 For 100 mL OB (Ortiz-Masia Buffer) (25-30 samples): 45 10 mL Buffer E 10X (see stock preparation on the last page) 46 2 mL NaF 1M 47 2 mL β-glycerophosphate 1M 48 500 µL DTT 1M 49 2 tabs of EDTA-free protease inhibitors cocktail (Roche 04 693 132001) 50 - Cool down the bench microfuge at 4°C 51 52 Day1 – Extract soluble proteins 53 - Add 1 mL of OB to 300-350 mg of plant powder and keep on ice. 54 - Vortex several times to ensure mixing the powder and the buffer. 55 - Centrifuge 5 min at 14000 rpm at 4°C. 56 - Transfer on ice the supernatant to a new tube (set 1) and centrifuge again 5 min at 4°C. 57 - Transfer on ice the supernatant to a new tube (set 2) and centrifuge again 5 min at 4°C. 58 - The supernatant, which constitutes the protein extract, is transferred on ice to a new tube (set 3). 59 60 Day1 – Protein quantification using Bradford 61 - In new tubes (set 4) at RT, dilute your samples 20 times with OB. 62 - Fill the necessary wells of a 96 wells flat-bottom transparent plate with 250 µL Bradford reagent 63 (Coomassie Protein Assay Kit, Thermo Scientific). 64 - All measurements are performed in triplicate. Drop 3x 10µL of the BSA standards in the left part of 65 the plate from A1 to A3 (0.5 µg/10 µL) to F1 to F3 (2.5 µg/10 µL). 66 - Drop 3 x 10 µL of your samples starting from A4. Do not forget OB alone for reference. 67 - Wait few minutes before reading the results in the plate reader at 595nm. 68 - Determine protein concentration in each sample and calculate the dilution to obtain 0.5 µg.µL-1. In 69 new tubes (set 5), prepare this dilution for each sample and keep on ice. 70 71 Day1 – Immunoprecipitation 72 - To prepare protein A-sepharose beads (Invitrogen, ref 101042), pipette 30 µL of the slurry per 73 reaction in a 2 mL tube. 74 - Wash 3 times with 1 ml OB using the bench microfuge. 75 - Adjust the final volume of bead slurry with OB to get 60 µL per sample. 76 - Add the antibody to the bead slurry: 2 µL anti-MPK1/2/7 crude sera or 0.5 µL anti-HA (SIGMA 77 H6908) per reaction 78 - Transfer 200 µL (100 µg of protein) of normalized samples from Set 5 to new tubes (Set 6). Keep on 79 ice both set of tubes. 80 - Add 60 µL of bead-antibody slurry using a cut tip. Homogenize the slurry before each pipetting. 81 - Incubate the tubes on a wheel at 4°C for 2-3 hours. 82 - Transfer 50 µL of normalized samples (Set 5) to new tubes (Set 7). Add 50 µL Laemmli buffer 2X, 83 heat at 95°C for 5 minutes and freeze for later western-blot. 84 85 Day1 - Washing 86 - Prepare 40 mL of kinase buffer

bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available 87 1.2 mL Tris-HCl pH7.5 1Munder (final a CC-BY-NC-ND30 mM) 4.0 International license. 88 80 µL EGTA 0.5M (final 1 mM) 89 400 µL MgCl2 1M (final 10 mM) 90 40 µL DTT 1M (final 1 mM) 91 800 µL β-glycerophosphate 1M (final 20 mM) 92 - Centrifuge samples 20 sec at 10000 rpm at 4°C. 93 - Keep the tubes on ice. Discard the supernatant but leave 50 µL including beads in the bottom. 94 - Add 1 mL OB, mix by inverting, centrifuge 20 sec at 10000 rpm at 4°C and discard supernatant. 95 - Repeat 1 additional wash with OB then wash once with 1 mL kinase buffer. 96 - Keep the tubes on ice. Discard supernatant but leave 50 µL including beads in the bottom. 97 - Centrifuge again samples 20 sec at 10000 rpm at 4°C to pull down droplets. 98 99 Day1 – Kinase assay 100 - Keep tubes on ice while preparing the kinase reaction buffer. Premix per reaction: 101 15 µL Kinase Buffer 102 1.5 µL MBP 10mg/mL 103 0.15 µL ATP 10mM 104 - Use 200µL tips to remove the remaining supernatant from beads. 105 - In the radioactive area, transfer the sample tubes and kinase reaction premix in plexiglass holder at 106 RT. 107 - Add the 33P [ATP] (2µCi per reaction) to the premix. Mix carefully by pipetting. 108 - Transfer 15 µL of radioactive kinase reaction buffer premix to each sample. 109 - Incubate for 30 minutes at RT. 110 - Stop the reaction by adding 15 µL Laemmli buffer 2X, mix carefully by pipetting and heat 5 minutes 111 at 95°C. 112 - Freeze the samples 113 114 Day1 – Prepare day 2 115 - Prepare an appropriate number of SDS-PAGE gels (15% acrylamide, 1 mm thick) to run the kinase 116 assay reaction. Keep them at 4°C overnight. 117 - If necessary, prepare an appropriate number of SDS-PAGE gels (10% acrylamide, 1 mm thick) to 118 perform western-blot. Keep them at 4°C overnight. 119 120 Day2 – Kinase assay 121 - In the radioactive room, run the reaction samples (10 µl) on 15% SDS-PAGE until the migration front 122 (which contains free radiolabelled nucleotides) runs out of the gel. 123 - Stain the gels using Coomassie solution for 1 h followed by washes in destaining buffer (2 h or over- 124 night). 125 - Dry gels using a gel dryer and expose to a PhosphorScreen for 3 days. Detect radioactive bands with 126 a Typhoon Imaging system (GE Healthcare). 127 - Take a picture of the gel for Coomassie loading control. 128 129 Preparation of the stock solutions 130

Name Sequence Remark Creation of Cs9-3K14-F ATTGTCCGCTTTGGATGGCTCCGG binary vector Cs9-3K14-R AAACCCGGAGCCATCCAAAGCGGA to generate CRISPR/Cas9 mutants Cloning of MPK1ocus-F CCGGAATTCAGAAACAAAACCAATATATGTTATCGATC GATGGAG EcoR1 underlined MPK1 locus MPK1locus-R CGCGGATCCGAGCTCAGTGTTTAAGGTTGAAGCTTGTG BamH1 underlined Cloning of MPK2locus-F CCGGAATTCCTTTTAACAATCAAAATAGTATTGGTCAA EcoR1 underlined MPK2 locus ACAATATTTC MPK2locus-R CGCGGATCCAAACTCAGAGACCTCATTGTTGTTTATGG BamH1 underlined Cloning of MPK7locus-F CGGGGTACCCTTGGCAACAAGTACCAAAGCAAGTTGC Kpn1 underlined MPK7 locus MPK7locus_R CCGGAATTCGGCATTTGAGATTTCAGCTTCAGGGTG EcoR1 underlined Cloning of MKK3locusF NNNNNNCTGCAGATCTAAGTTTGTAATATAAAGCTCTTGC Pst1 underlined MKK3 locus MKK3locusR CGGGGTACCTACCTTATCAAGAGTTGGCTCATAACCCTTATTAG Kpn1 underlined q-RTPCR on MAP3K13-F CGCGGTGAGATGAGATCGAG MAP3K13 MAP3K13-R ACAACTATTTGGCTGTAAACGAGA q-RTPCR on MAP3K14-F ACCAGCTTGGGAAGATCACG MAP3K14 MAP3K14-R GAGTTCCGATAACCCCACCG q-RTPCR on MAP3K15-F GTCGAGGCTCAACAGCTACT MAP3K15 MAP3K15-R CGATGAAGAAAACTCGGCGG q-RTPCR on MAP3K16-F CGGCTGATCGGATCGAGAAA MAP3K16 MAP3K16-R ATCCATCCGCCATCGTCTTC q-RTPCR on MAP3K17-F TACTCGGAGAGGATCGGACG MAP3K17 MAP3K17-R TGTTCCTTCACACCTCGCTC q-RTPCR on MAP3K18-F TTCACCGGTCGGAGTTCTTG MAP3K18 MAP3K18-R TGTGGAAGGGCTCTCTCGTA q-RTPCR on MAP3K19-F CGCCGTTAAGATTGCGGATT MAP3K19 MAP3K19-R TTAACAGATTCCGGCGCCAT q-RTPCR on MAP3K20-F TATCGCAGTGTGCAAACCCT MAP3K20 MAP3K20-R GAAACTCCGGCGACTTTCCT q-RTPCR on ACTIN2-F CGTTTCTATGATGCACTTGTGTG ACTIN2 ACTIN2-R GGGAACAAAAGGAATAAAGAGG 2 3 Supplemental table 2 – Sequences of plasmids used to generate complemented transgenic lines

>pGREEN0229 ggacaatgcgctacgcgcaccggctccgcccgtggacaaccgcaagcggttgcccaccgtcgagcgccagcgcctttgcccacaacccggcggccggccgcaaunder aCC-BY-NC-ND 4.0 International license. cagatcgttttataaatttttttttttgaaaaagaaaaagcccgaaaggcggcaacctctcgggcttctggatttccgatccccggaattagagatcttggca ggatatattgtggtgtaacgttatcagcttgcatgccggtcgatctagtaacatagatgacaccgcgcgcgataatttatcctagtttgcgcgctatattttg ttttctatcgcgtattaaatgtataattgcgggactctaatcataaaaacccatctcataaataacgtcatgcattacatgttaattattacatgcttaacgt aattcaacagaaattatatgataatcatcgcaagaccggcaacaggattcaatcttaagaaactttattgccaaatgtttgaacgatctgcttgactctaggg gtcatcagatttcggtgacgggcaggaccggacggggcggcaccggcaggctgaagtccagctgccagaaacccacgtcatgccagttcccgtgcttgaagcc ggccgcccgcagcatgccgcggggggcatatccgagcgcctcgtgcatgcgcacgctcgggtcgttgggcagcccgatgacagcgaccacgctcttgaagccc tgtgcctccagggacttcagcaggtgggtgtagagcgtggagcccagtcccgtccgctggtggcggggggagacgtacacggtcgactcggccgtccagtcgt

- aggcgttgcgtgccttccagggacccgcgtaggcgatgccggcgacctcgccgtccacctcggcgacgagccagggatagcgctcccgcagacggacgaggtc MPK1 gtccgtccactcctgcggttcctgcggctcggtacggaagttgaccgtgcttgtctcgatgtagtggttgacgatggtgcagaccgccggcatgtccgcctcg gtggcacggcggatgtcggccgggcgtcgttctgggctcatggtagatcccctcgatcgagttgagagtgaatatgagactctaattggataccgaggggaat ttatggaacgtcagtggagcatttttgacaagaaatatttgctagctgatagtgaccttaggcgacttttgaacgcgcaataatggtttctgacgtatgtgct

- tagctcattaaactccagaaacccgcggctcagtggctccttcaacgttgcggttctgtcagttccaaacgtaaaacggcttgtcccgcgtcatcggcggggg HA tcataacgtgactcccttaattctccgctcatgatcgataacattaacgcttacaatttccattcgccattcaggctgcgcaactgttgggaagggcgatcgg

tgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgaTTAAGTTGGGTAACGCCAGGgttttcccagtcacgacgttgtaaaac gacggccagtgagcgcgcgtaatacgactcactatagggcgaattgggtaccgggccccccctcGAGAGAAACAAAACCAATATATGTTATCGATCGATGGAG AAGTAGTGACTCTTTTGATTCTTCGATAGTCAAAATCATCCCAGAGAGATTGAATTGTTTCTTTAAGCAGCGACGACTTTGTCCTTGGCGGCATTCTCTCCTC CTCCTTCGAGCTGGCTCAAGTTTCCTTTCTCCTTGATCAGCTGAATATGATGATGCTTGCAATATAGCTTACCCTCGTGAGCTATGTAATTCGAAGGGCTTAT CGTGCAGCCTCCATGTGTACACTTGAAGCAGCTCTTGTGGTACAATGTTCCATTCACCGATACCTACACAAAGTCCACATTATAAGCAATGTTTCAGCTCTGG TTTAAGCCAAGAACAGATCAGATTCGTTATGGAAACAATCTAACAATCTTCTTTGACACAACTTGATTCTGATCAGGAAAGATTTGAGATTGGATACCTTCTC AATTGGATACACGGTTTTGTCGCAACCAACGCATTTCTCTCGTGTTCCACCAAACATATTCGAAACTTTGGTTCCAGCAGGTCTCTGTTAAACTTCTCTCATG TTAAATGTTAAAAAAATTCAAGAACCTCAAAAACAGAAAAAGGGTTTTGTTCTGCTGTCCGAAAGTACCTCTCCCTCCAAAGGCCTATCAGGTTTCCCAATCT TTGGTGTCCCTGTACATATATATGAATCAAACTTTAGATAGATAATTCCAAATTTGAAATCCCCACTCACAAAGCTTTTCACATTTTGATCTGTTTTTGGTAA TTTACCTTCGAAGCTTTTCTCAAGACTTCCAGTTCTCTTGAAGTTTTGATCGAAATGTGGTCTGCAGTAGAGAACTCCTTCAAAGGAGTTGTAATTGCTAAGC TGACTCATCAAGAAGAAGAAGAAGAAGAAGAAGAAACAGAACAGTCAAATCTTTAGACCAATCAGTTTCCATAGCCAAAAATTCAAAGATTTCTACTTAATTG ATTGGACTTCTTCATCTACATATATATCTACTAGATCTACTTCTGGATTAATGAGAAATCATCACAAACTAGAATCAAAGATCAAACCTTGAGAGTTCCTTTG CAATGGTGACATCGGAAACAAGCTTTGTGGTAGACCCGGTTATCGGCGGTTAACTTGTCGACAAGATAAACTGTTTTGTCACATGCCATGCATTTCTGGGTTG TTCCTGCGAACGCCATTCTTGTAAGAGATCAGACTAAAAGACTCAGGAAAAAAGAAAGAAGCTCAATAGTCTTGAGAGAGAGAGAGAGATAAAGAAGAATAAG ATGAAGATGAAAGAAAGAGATTGTCAATTATTGTTGCTTGTTTTAATATGGGGACCAGATATATTGAAAAATGAACATGCTTCTTCTTTTTAAATATTTAAAG TAAAATTCTTTTAGGAAAAATTGAAATTTTTAATAAAATGTCACAAACAAAAAAGTTCAAGATGAGTATCGAATTTTGGATGCAAATTCGAATATTTGGTGTT TCTGACAACCCTAGCATTGTTTTTCGTGGTTGTCTAATCCACAAAACAAGATAAGCGATGAATAAATAAATAATTTGAACGTTAGCAACAAAACTAAAAACTG TACTACAAAAAGAAAAGGTTTCAACGGCATTTTTTGTGTTCTTAATTATTTTTGTCCAAACTTGAAGTAACCCGTCAATATCTGTCTCCTAGATATTTTGCTT ATATTTTTTTTACATTAATTCAGTTCTTTTATATCTAGAGTCAGGTAATTATTTAGAGAATGCATGCAGTTGCTTGACAGTGCGTAAGATTTACACAAATTTT TCTCAACAGTGAAGGCAATGCTCAATAGTCAATAACTGTTTGTAAGGAAATAGAACAGGGAAAACCAACTGGAAAGAATCTTTGTCTGGTTTTAGATAATGAT TAAAAGCTGTATTGGTTATGTTGAATTAGTTGGAAATCTCTAAATATCTATACACTATTTATTTTCTTTAATACTATATGTTGTGTAGTGTGTATATGAATAA TGAAAATATCTGAAACATGCTTTACCATAAAGGCTTTTGATGAGCTGTAGTATTGACATAATTGGTTGAAGAGAATGAGTGATCATAATGATACCTAACATCT TTTATTTAATCAAAAATACCTAACGTTATTTTTATTTGCTACTATAATAGACTCCAACCAATTTATTAGTATCATTTTATACAGTTTCTAACATTTTTGCCAC TGCTTAGATTTATGGGCTTTCCCTTTCTGTCTGCATGGGCCTCCTCTCTTATATTAATAATCTGACTTAATGAAAACTTTTAAATCTTTTGTAGTTTATTTTC CTCTAGATGCTAATTTTAGCAAAATGAAAAGATGTGTGATGGAAACGTAAAGTTAAAGCAAAAGAAGATGGTGAATTGGTGATGCAATATTTTAGTCATGTGT CATTGTTTACATTTATGATATATTTTACTTTAAAATACTTTTCTTCATTTTCAATTTTTATAAATCTTCGTAGAACACATATTCACAAATGATGCTACTTTGG TGATCAGTTACTAAAAAATACCGAAATTGATTTTAGAAGATAGAGACGTGAATCTGTTTGCCAATATTAATTGGGCTCAACTTAAGCCCAAATTATATAAGGA AAGACTACCTAGTAACGAACAAGTAGCAGGTCAACTGTCCGAGCGTTGGCCAAATCTCTCTCACTTCCACAGGTTTCTCTCTCCGGCCAAATCTAACCTCCGG GGAACGTCGTTGGTCACTTATCACCGGTTAGAATTTCCTTCCCGCTTTATCCCGTAAACTTTTTTCCCATTGATTCCGATCGTTTATGTTCCTTCACCAAATC GATAAAGTTTGATCTTTTTCCTTTTCACTATTATTAACAGACCAATCTGTTTACACAAGAAATCTACAGTAACTTATCACTTGAAAAGTTTTGATAAATAGTT AGTATAATAATTTGTTAATTGTGTGTGTAAATTTGATTTCTTGATTGTGTGTGAATTGTGATGAAGAGGGAAAACAAAAAATGGCGACTTTGGTTGATCCTCC TAATGGGATAAGGAATGAAGGGAAGCATTACTTCTCAATGTGGCAAACTCTGTTCGAGATCGACACTAAGTACATGCCTATCAAGCCTATTGGTCGTGGAGCT TACGGTGTTGTCTGCTCCTCTGTTAACAGTGACACCAACGAGAAAGTTGCTATCAAGAAGATTCACAATGTTTATGAGAATAGGATCGATGCGTTGAGGACTC TTCGGGAGCTCAAGCTTCTACGCCATCTTCGACATGAGAATGTCATTGCTTTGAAAGATGTCATGATGCCAATTCATAAGATGAGCTTCAAGGATGTTTATCT TGTTTATGAGCTCATGGACACTGATCTCCACCAGATTATCAAGTCTTCTCAAGTTCTTAGTAACGATCATTGCCAATACTTCTTGTTCCAGGTGTGTGGTTGA TCCCGTTCATTTACTGTTGGTTCTAGCTTTGCTTTCTCCTGAAATTTTGCTTTGCTTTGTTCTTTTTGTGTAGTTGCTTCGAGGGCTCAAGTATATTCATTCA GCCAATATCCTGCACCGAGATTTGAAACCTGGTAACCTTCTTGTCAACGCAAACTGCGATTTAAAGATATGCGATTTTGGACTAGCGCGTGCGAGCAACACCA AGGGTCAGTTCATGACTGAATATGTTGTGACTCGTTGGTACCGAGCCCCAGAGCTTCTCCTCTGTTGTGACAACTATGGAACATCCATTGATGTTTGGTCTGT TGGTTGCATTTTCGCCGAGCTTCTTGGTAGGAAACCGATATTCCAAGGAACGGAATGTCTTAACCAGCTGAAGCTCATTGTCAACATTCTCGGAAGCCAAAGA GAAGAAGATCTTGAGTTCATAGATAACCCGAAAGCTAAAAGATACATTAGATCACTTCCGTACTCACCTGGGATGTCTTTATCCAGACTTTACCCGGGCGCTC ATGTTTTGGCCATCGACCTTCTGCAGAAAATGCTTGTTTTTGATCCGTCAAAGAGGATTAGTGTCTCTGAAGCACTCCAGCATCCATACATGGCGCCTCTATA TGACCCGAATGCAAACCCTCCTGCTCAAGTTCCTATCGATCTCGATGTAGATGAGGATTTGAGAGAGGAGATGATAAGAGAAATGATGTGGAATGAGATGCTT CACTACCATCCACAAGCTTCAACCTTAAACACTGAGCTCCTCgagaggccttacccatacgacgttccagactacgctggttacccatacgacgttccagact acgcttgactgcagatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattac gttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaaca aaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgcggccgccaccgcggtggagctccagcttttgttccctttag tgagggttaattgcgcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataa agtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcatta atgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcg gtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgaaggccttgacaggatatattggcgggtaaacta agtcgctgtatgtgtttgtttgagatctcatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccg cccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtg cgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagtt cggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggt aagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactac ggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaagaagagttggtagctcttgatccggcaaacaaaccaccgctg gtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaa cgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtata tatgtgtaacattggtctagtgattagaaaaactcatcgagcatcaaatgaaactgcaatttattcatatcaggattatcaataccatatttttgaaaaagcc gtttctgtaatgaaggagaaaactcaccgaggcagttccataggatggcaagatcctggtatcggtctgcgattccgactcgtccaacatcaatacaacctat taatttcccctcgtcaaaaataaggttatcaagtgagaaatcaccatgagtgacgactgaatccggtgagaatggcaaaagtttatgcatttctttccagact tgttcaacaggccagccattacgctcgtcatcaaaatcactcgcatcaaccaaaccgttattcattcgtgattgcgcctgagcgagacgaaatacgcgatcgc tgttaaaaggacaattacaaacaggaatcgaatgcaaccggcgcaggaacactgccagcgcatcaacaatattttcacctgaatcaggatattcttctaatac ctggaatgctgttttccctgggatcgcagtggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcggaagaggcataaattccgtcagc cagtttagtctgaccatctcatctgtaacaacattggcaacgctacctttgccatgtttcagaaacaactctggcgcatcgggcttcccatacaatcggtaga ttgtcgcacctgattgcccgacattatcgcgagcccatttatacccatataaatcagcatccatgttggaatttaatcgcggccttgagcaagacgtttcccg ttgaatatggctcataacaccccttgtattactgtttatgtaagcagacagttttattgttcatgatgatatatttttatcttgtgcaatgtaacatcagaga ttttgagacacaacgtggctttgttgaataaatcgaacttttgctgagttgaaggatcagatcacgcatcttcccgacaacgcagaccgttccgtggcaaagc aaaagttcaaaatcaccaactggtccacctacaacaaagctctcatcaaccgtggctccctcactttctggctggatgatggggcgattcaggcgatccccat ccaacagcccgccgtcgagcgggcttttttatccccggaagcctgtggatagagggtagttatccacgtgaaaccgctaatgccccgcaaagccttgattcac ggggctttccggcccgctccaaaaactatccacgtgaaatcgctaatcagggtacgtgaaatcgctaatcggagtacgtgaaatcgctaataaggtcacgtga aatcgctaatcaaaaaggcacgtgagaacgctaatagccctttcagatcaacagcttgcaaacacccctcgctccggcaagtagttacagcaagtagtatgtt caattagcttttcaattatgaatatatatatcaattattggtcgcccttggcttgt

>pGREEN0229 ggacaatgcgctacgcgcaccggctccgcccgtggacaaccgcaagcggttgcccaccgtcgagcgccagcgcctttgcccacaacccggcggccggccgcaacunder aCC-BY-NC-ND 4.0 International license. agatcgttttataaatttttttttttgaaaaagaaaaagcccgaaaggcggcaacctctcgggcttctggatttccgatccccggaattagagatcttggcagg atatattgtggtgtaacgttatcagcttgcatgccggtcgatctagtaacatagatgacaccgcgcgcgataatttatcctagtttgcgcgctatattttgttt tctatcgcgtattaaatgtataattgcgggactctaatcataaaaacccatctcataaataacgtcatgcattacatgttaattattacatgcttaacgtaatt caacagaaattatatgataatcatcgcaagaccggcaacaggattcaatcttaagaaactttattgccaaatgtttgaacgatctgcttgactctaggggtcat cagatttcggtgacgggcaggaccggacggggcggcaccggcaggctgaagtccagctgccagaaacccacgtcatgccagttcccgtgcttgaagccggccgc ccgcagcatgccgcggggggcatatccgagcgcctcgtgcatgcgcacgctcgggtcgttgggcagcccgatgacagcgaccacgctcttgaagccctgtgcct ccagggacttcagcaggtgggtgtagagcgtggagcccagtcccgtccgctggtggcggggggagacgtacacggtcgactcggccgtccagtcgtaggcgttg

- cgtgccttccagggacccgcgtaggcgatgccggcgacctcgccgtccacctcggcgacgagccagggatagcgctcccgcagacggacgaggtcgtccgtcca MPK2 ctcctgcggttcctgcggctcggtacggaagttgaccgtgcttgtctcgatgtagtggttgacgatggtgcagaccgccggcatgtccgcctcggtggcacggc ggatgtcggccgggcgtcgttctgggctcatggtagatcccctcgatcgagttgagagtgaatatgagactctaattggataccgaggggaatttatggaacgt cagtggagcatttttgacaagaaatatttgctagctgatagtgaccttaggcgacttttgaacgcgcaataatggtttctgacgtatgtgcttagctcattaaa

- ctccagaaacccgcggctcagtggctccttcaacgttgcggttctgtcagttccaaacgtaaaacggcttgtcccgcgtcatcggcgggggtcataacgtgact HA cccttaattctccgctcatgatcgataacattaacgcttacaatttccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcg

ctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcg cgcgtaatacgactcactatagggcgaattgggtaccgggccccccctcGACCTTTTAACAATCAAAATAGTATTGGTCAAACAATATTTCTGCATTAATTAGT TTTTTCATATTTAGCAAAAAAGAATTAATTAAAAAATTCATCCCTATTCGACTTCACTTTCTCTCTCTGCCTGAAAATTTTGATCGGTTTCTGGTTTCTCGGCG AAAGAAGTAAAGTGGCCGACAAATAGTGATCTCGTGAAGGAATCAGTGTGTACAGTGGAAGAAGATGATACATTTGGCTGGATTTACATGTTGCTTAGGCGGCG TCGCTCTTTATCTTCTTACCAGGAGCACAGGCAGGTTAGGTTTTTTTTCTTGTCTTTACTATTTACGAATTACGATAACTAGGGTTTACTGTTATTCGGTGGTA ATGTTCTTCTTTCGTGGGACAGAGATATCAAATCAATCACTAGGGTTTACCAACTCAAGGATTTGGGTAATGTTCCTGCATTGTTCTGCATTTCAATTTTAGGT GGATGGGTTTTGGTTATGTGTTTGATATCATTCGTTTTTATTCAGAACAATTAGTAGAAGTAGAGAGCAAGGTGGTACCTTTGATCATCGCAGTATCAGGAGAT GTTGGCTCTGAGACTCCTATTAAGTGTGAGCATAGTTATGTTCTCGGTGTATTTCTCAAGAGAACGGTATGTATGAATTGGATTAGATAATCTAGTTTTTCGTT TCTGTGATTTTGGATATGTTAAAAAGAAACGATTTTTTTCAGGCAGAACAACAGGTTTTGAGACGTAATTGGAGATTTTCATGGGTTCGAAATAGTACATTGAT GCAGCCGATGACTAAGGAAGTCCCCTGGTATCTGGTATGTCTGTTGGACTTTGATTGGAGTGTATTACTTTCTAAAGTCATTTACAAAATATGATATTGGTTGC CTATAGGACGACGGGACAGGTCGTGTGAATGTAGATGTATCTCAAGGTGAATTAGGCTTGGCGTTGACGGTTGGTAGTGATGTATTTGAAAAGGCAGAGCCGGT ATCGCTTGTTCAAGGAGCGTTGGGTTATCTTAAAGGCTTTAAGGTCTTTTCTTTTCCTTTCCTACCACTTTTCATTGATTTGCTTTTGTTTTGACAATGCTTAT ACATTGTGGCACCATTGTTGTCTATAGATACTTGGAGTAAGACACGTTGAGCGTGTTGTCCCAATTGGTACACCGCTTACAGTTGTTGGTGAGGTATGTCTTTT ATCTGTTAGCGGTCCAAAATACGTTTTATATCTCTCTTTGTTATGTTGCTTACCATGTTAACAGGCTGTTAGGGATGGCATGGGGAATGTCAGGATTCAAAAAC CTGAGCAAGGACCTTTCTACGTCACTTATATACCGCTAGATCAGCTCATCTCTAAATTGGGAGATTTGTCAAGGTTGTTTCTTTTCTCTGTTTTTGCCTATTCT TTTCTTCGAAAACTATGATTGAAAAAAATTCTAAAAGATCTCTTTCTTTTGGCAGGAGGTTCAAGTATGCCTCCATGGGTTTAACTGTTCTTGGTGTGATTCTT ATTTCAAAGCCTGTGATTGAATATATTCTAAAGAGAATTGAAGATACTCTAGAAAGAAGGCGGCGACAATTCGCACTGAAAAGGTATGACGCACCCTAACCACA GCCACGTATGAAGTATTCATTGCGAGTTGCGAGTTGCGAGTTAAGTGTTGGGTAACTTGTTGCAGAGTTGTTGATGCAGCTGCTAGGAGAGCCAAACCAGTAAC TGGAGGTAGTAATAGTATCTATCCATTAGAGTTTGTACTTTGTAGTAGTAACATGTGAATCCTTTTTCTGCATACACTTGGAATTGCTCTGCTTACAAAAACGT CTTACCAGGTGGTACAAGCAGAGATGGTGATACACCTGATCTCTGTGTGGTTTGCCTTGACCAGAAGTATAACACCGCTTTTGTTGAGTAAGTATAAGACCGCT TTTCTTCTAAAAGCTCTTGAAAACCCTCTCACTGATCAAACATGGCATCTTTTGATTCCTCTTTTTGTTTGGTTTGGACTTGTAGGTGTGGTCATATGTGCTGC TGCACACCATGCTCCTTGCAACTAAGGACCTGTCCTCTTTGCCGGGAACGAATACAACAAGTTTTGAAAATTTACCGCCATTGAAGGACAAAACTCAGAACGAT TTTTACAAGCGAACAATTACTAGTCTTGTACATATAGTAAAGCCTTTGTATCATGAGTTTTTGACTAGAAATTTTTTTGCATTGATAGATTGTGATTGAACAAA TGCTAATATAAATTTCAAGCTTAGATTTACATTTACTAATGAAGTTATATAATCACGTTTCGATGTTAAAATAAGAAGTGAAAAAACGTGAACGGCAGGATTCG AACCTGCGCGGGCAAAGCCCACATGATTTCTAGTCATGCCCGATAACCACTCCGGCACGTCCACTTTTTGTTAATTCCTCACTATCTTAAATATCTAATTACCG TTAATTATTACAAATCAGGTTGGGCTTAATTAAGCCCAAAGTTAAAGACAGATTAGTGAAGGAGACAGAGAAAGAAACAGCTCTAAAATGGTAATGAACGAGAA ACTAGAGAGTCAACGGTCATAGCGTTGACCAAATCTCTCACTCTCACCAGCCAAATCTCTCCAACTTCCTCTTTCTCTCCACCCAAATCTCGCCGGCGATCGTC ACTGACGAATCTGATTCGTCCCCAACACTCAACGGGTAAGCTCTCTCTGCAAAATTCAGATCGTTCTAGCTCAATCTCAACATCGGATCAAGATTCAACTTTTG TTCTTTTCTCTTAAACAAAGCTTTTGATCATTAGTGAAATCTAAAATATTAACCTTTGAATCTGTAAACTTAAGCTTAGAGAACCCTAAGATCAAAACTAAAAA TTTGATCTTTCATTGTCACTTGTTGGAAGCAATTCAAAATTCTGTGTTGTGTATATTTTCAAATTTGTGGATTGTTCCAATTTCGATAAAGTTTTGATTTTTAT TCCTTTTGTTGTGTGTTTTTATAAGGAGGTAGAAGAATGGCGACTCCTGTTGATCCACCTAATGGAATTAGGAATCAAGGGAAGCATTACTTCTCAATGTGGCA AACACTTTTCGAGATCGATACCAAATACGTGCCTATCAAACCGATAGGCCGAGGCGCGTACGGTGTGGTTTGCTCTTCGGTTAACAGAGAGAGTAATGAGAGAG TGGCGATCAAGAAGATCCACAATGTGTTTGAGAATAGGATTGATGCGTTGAGGACTCTTAGGGAGCTCAAGCTTCTACGTCATCTTCGACATGAGAATGTGGTT GCTCTTAAAGATGTAATGATGGCTAATCATAAGAGAAGCTTTAAGGATGTTTATCTTGTTTATGAGCTTATGGATACTGATCTTCATCAGATTATTAAGTCTTC TCAAGTTCTAAGTAATGACCATTGCCAATACTTCTTGTTCCAGGTATGTGATTTGTTTGCATTTGCTTTTACCATTAGTGTGTGTTGTTTGCATTTGGTGTTTG CATTTACTTGCTTTTTATTTCTTTTGCATAGTTGCTTCGAGGGCTCAAGTATATTCATTCAGCAAACATTCTCCATCGGGATCTGAAACCCGGTAACCTCCTTG TGAATGCAAACTGCGACTTAAAGATATGTGACTTTGGGCTAGCGAGGACGAGCAACACCAAAGGTCAGTTCATGACTGAATATGTTGTGACTAGATGGTACCGA GCACCAGAGCTACTCCTCTGTTGTGACAACTATGGAACCTCCATTGATGTCTGGTCAGTCGGTTGCATATTCGCCGAGCTTCTTGGAAGAAAACCAGTATTCCC GGGAACAGAATGTCTAAACCAGATTAAACTCATCATTAACATTTTGGGTAGCCAGAGAGAGGAAGATCTCGAGTTTATAGATAACCCAAAAGCCAAAAGATACA TAGAATCACTCCCTTACTCACCAGGGATATCATTCTCTCGTCTTTACCCGGGTGCAAATGTTTTAGCCATTGATCTGCTTCAGAAAATGCTCGTTCTTGACCCT TCGAAAAGGATTAGTGTCACGGAAGCGCTTCAACATCCTTACATGGCGCCTTTATATGACCCGAGTGCAAATCCTCCTGCTCAAGTTCCTATTGATCTCGATGT AGATGAAGACGAGGATTTGGGAGCAGAGATGATAAGAGAATTAATGTGGAAGGAAATGATTCATTATCATCCAGAAGCTGCTACCATAAACAACAATGAGGTCT CTGAGTTTGTCGAGAGGCCTTACCCATACGACGTTCCAGACTACGCTGGTTACCCATACGACGTTCCAGACTACGCTTGACTGCAGATCGTTCAAACATTTGGC AATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATG ACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCG CGCGGTGTCATCTATGTTACTAGATCGCGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTC ATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAAC TCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGT ATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCAC AGAATCAGGGGATAACGCAGGAAAGAACATGAAGGCCTTGACAGGATATATTGGCGGGTAAACTAAGTCGCTGTATGTGTTTGTTTGAGATCTCATGTGAGCAA AAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAG AGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTC CGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAAC CCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCactggtaacagg attagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaa gccagttaccttcggaagaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaa aaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaagg atcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgtgtaacattggtctagtgattagaaaaactcatcgagcatcaa atgaaactgcaatttattcatatcaggattatcaataccatatttttgaaaaagccgtttctgtaatgaaggagaaaactcaccgaggcagttccataggatgg caagatcctggtatcggtctgcgattccgactcgtccaacatcaatacaacctattaatttcccctcgtcaaaaataaggttatcaagtgagaaatcaccatga gtgacgactgaatccggtgagaatggcaaaagtttatgcatttctttccagacttgttcaacaggccagccattacgctcgtcatcaaaatcactcgcatcaac caaaccgttattcattcgtgattgcgcctgagcgagacgaaatacgcgatcgctgttaaaaggacaattacaaacaggaatcgaatgcaaccggcgcaggaaca ctgccagcgcatcaacaatattttcacctgaatcaggatattcttctaatacctggaatgctgttttccctgggatcgcagtggtgagtaaccatgcatcatca ggagtacggataaaatgcttgatggtcggaagaggcataaattccgtcagccagtttagtctgaccatctcatctgtaacaacattggcaacgctacctttgcc atgtttcagaaacaactctggcgcatcgggcttcccatacaatcggtagattgtcgcacctgattgcccgacattatcgcgagcccatttatacccatataaat cagcatccatgttggaatttaatcgcggccttgagcaagacgtttcccgttgaatatggctcataacaccccttgtattactgtttatgtaagcagacagtttt attgttcatgatgatatatttttatcttgtgcaatgtaacatcagagattttgagacacaacgtggctttgttgaataaatcgaacttttgctgagttgaagga tcagatcacgcatcttcccgacaacgcagaccgttccgtggcaaagcaaaagttcaaaatcaccaactggtccacctacaacaaagctctcatcaaccgtggct ccctcactttctggctggatgatggggcgattcaggcgatccccatccaacagcccgccgtcgagcgggcttttttatccccggaagcctgtggatagagggta gttatccacgtgaaaccgctaatgccccgcaaagccttgattcacggggctttccggcccgctccaaaaactatccacgtgaaatcgctaatcagggtacgtga aatcgctaatcggagtacgtgaaatcgctaataaggtcacgtgaaatcgctaatcaaaaaggcacgtgagaacgctaatagccctttcagatcaacagcttgca aacacccctcgctccggcaagtagttacagcaagtagtatgttcaattagcttttcaattatgaatatatatatcaattattggtcgcccttggcttgt

> ggacaatgcgctacgcgcaccggctccgcccgtggacaaccgcaagcggttgcccaccgtcgagcgccagcgcctttgcccacaacccggcggccggccgcaacunder aCC-BY-NC-ND 4.0 International license. pGREEN0229 agatcgttttataaatttttttttttgaaaaagaaaaagcccgaaaggcggcaacctctcgggcttctggatttccgatccccggaattagagatCTTGGCAGG ATATATTGTGGTGTAACGTTATCAGCTTGCATGCCGGTCGATCTAGTAACATAGATGACACCGCGCGCGATAATTTATCCTAGTTTGCGCGCTATATTTTGTTT TCTATCGCGTATTAAATGTATAATTGCGGGACTCTAATCATAAAAACCCATCTCATAAATAACGTCATGCATTACATGTTAATTATTACATGCTTAACGTAATT CAACAGAAATTATATGATAATCATCGCAAGACCGGCAACAGGATTCAATCTTAAGAAACTTTATTGCCAAATGTTTGAACGATCTGCTTGACTCTAGGGGTCAT CAGATTTCGGTGACGGGCAGGACCGGACGGGGCGGCACCGGCAGGCTGAAGTCCAGCTGCCAGAAACCCACGTCATGCCAGTTCCCGTGCTTGAAGCCGGCCGC CCGCAGCATGCCGCGGGGGGCATATCCGAGCGCCTCGTGCATGCGCACGCTCGGGTCGTTGGGCAGCCCGATGACAGCGACCACGCTCTTGAAGCCCTGTGCCT CCAGGGACTTCAGCAGGTGGGTGTAGAGCGTGGAGCCCAGTCCCGTCCGCTGGTGGCGGGGGGAGACGTACACGGTCGACTCGGCCGTCCAGTCGTAGGCGTTG

- CGTGCCTTCCAGGGACCCGCGTAGGCGATGCCGGCGACCTCGCCGTCCACCTCGGCGACGAGCCAGGGATAGCGCTCCCGCAGACGGACGAGGTCGTCCGTCCA MPK7 CTCCTGCGGTTCCTGCGGCTCGGTACGGAAGTTGACCGTGCTTGTCTCGATGTAGTGGTTGACGATGGTGCAGACCGCCGGCATGTCCGCCTCGGTGGCACGGC GGATGTCGGCCGGGCGTCGTTCTGGGCTCATGGTAGATCCCCTCGATCGAGTTGAGAGTGAATATGAGACTCTAATTGGATACCGAGGGGAATTTATGGAACGT CAGTGGAGCATTTTTGACAAGAAATATTTGCTAGCTGATAGTGACCTTAGGCGACTTTTGAACGCGCAATAATGGTTTCTGACGTATGTGCTTAGCTCATTAAA

- CTCCAGAAACCCGCGGCTCAGTGGCTCCTTCAACGTTGCGGTTCTGTCAGTTCCAAACGTAAAACGGCTTGTCCCGCGTCATCGGCGGGGGTCATAACGTGACT H

A CCCTTAATTCTCCGCTCATGATCGATAACATTAACGCTTACAATTTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCG

CTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAGCG CGCGTAATACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGcttggcaacaagtaccaaagcaagttgcttgaaataattgatgctaggtgag ctctgcaaaaagtttctgcatgaacactcaaaagattagtatttctcgaatgacagacttctcatttttctttgtatcagtgagctgcctgagttcttgggagg ttcttgtacttgtgctgacaatgggggttgcatgcgctcggacaaaggaccatggaacaatccagatattatgaaggtttgttttctacaacttctttgatcta gtaaagcaacaacaacactcatagttagtttctttctttctatatgaaaactaagatgattgtcaccgtaaacctaacagagagttaataatggtgaccacata tgctcaaagagatctcaagctgataatgctggagagaatattatctctcaggggaataactctgcagttgaggaagctcctgaaactgaccagtcacagccctc tccttgtcaaaatgtaagaatgacactattttccttcatgaggcttgtattctccttatatttcttcccacatctcaggtcgtggttgctcatccagcttggaa cataccagaagctcacaaattttccctctcaaaaagtataagagatcatgtgcaaattacactactaaagagacaaatactactcctttttaaaagaacttgaa tttaagtacttctctgtttttgaacaggggatgtttacgccattcaagaagcttgcaaagctacaaatgaaagtggaaggtctcctattttcactggagtcatg gcttttgtaatgggtgtagtcaccatgattagagtgactaaaaacgttccaaggaagctaaccgagtcaactatatactctagcccggtttactgcgacgaaaa ctcgatgaacaagagctcgatgcatgggaagaaaatggcaacaacaaccatctcaggggaagatttcatggcggtcatgaaacgaatggctgagcttgagcaga aagtcacaaacttgagtgcacagccagcaactatgcctcctgaaaaggaagagatgcttaatgctgccattagccgagccgatttcttggaacaagaacttgct gcaaccaagaaggtaacacaaaacaaaaaaaactttcatatatattactgatttgttctcagctttcactatctcacactaaagagttgttgtatcttcacagg ctcttgatgattctcttacccgacaagaggaccttgtggcatacgttgagagaaagaagaagaagaagaagctggtccgctttcaaatcaatgcctacttaact aatttttgttttggtgtttaaaatggtgttctgttttactttttatctccatgtgcagttcacttggtaagtgaggaacatgaggaagaagaagcctctagtgg agttagaggtggccaatgcactcatgtcattaacttaaatcttacagtcacattaaaattaagagaatctccaaagaaagaattttgttatgtctctgtatata tatatcatccttagatgttaccacttatccgcatcatatgcgagatcatgtttgatttgtacaaaagaaaacaatgaatttataagaaatatattttgtaaagt agttttgtacaaaagattagtgtgcaaacatttttaacatcaacgtataaaattcaagtacactttatataaactaaattactagggttgaagatgaattgggg cttgatggtttggagagacagaatcttcgaagatctatggagaaactcaaagttgattgataatctgcgttcgtcaactgataggtttactcaaccatttgcca ctcaaattagttatgtcatcatctgatgttaaatccatcagccacacttatcctttttttaatctaatcctcaaacctctccgaaagagacagaaggtcttcaa accaagagtggttttgtagttgaccactttttgaggcttttaagttaggtttaactacacccagtggaaacttcggttcggacaacaacaagaagttgctccca atctacgtttaccacgtgtcactttttcagtccacccacgtgcttagccggttacttgatccatttaaatcctcaatttctgtattcgtgtacgtatattatac caagacaaattctacttaataaatatcttactcaatctttttaattaattacaaaaattcctatgcattatttttttctaattaccaaatatagtaataacaat cctgatttgtatgcaaaaaaaaaacatgaagagtccattaaactttagagattttttaattaaagatagtttgtaactgaagttttgttacacaaaaaatatct aatctaaaaagaatgtcgttttcgtaattagaAGACTTTGTAATTTGTTTTTTTCCTAAAAAACGAAAAGAAGTAACCAAAGCTTCTTCATCAACCAACGTATT TTGCTTCCTTTCTTCTTCTTCTTCTTCCTCTTCCCCTAACATTCCATTCCCCGTATGGGTCTCACCACTTCCTAACTCTTCTCTCTCTTATCTCTTCTTGTTTT AGCTATGAAGAAGCAATCTCAATTCAGATCCAATCATACCCTTCTCTTCTTTCATCTCTGATCATTAACAACAACAACAACGACTCGGGTTCTGTAAATTCAGT TATTGGGTATGTTCGATCTCTTGTTCTGTTTCTTCTCTTTATTCATTTAGCTTGTTTTAACTCTTAATTTTTGAGTTTTGATTATGATTAATCAAGAGTTATCA TATTAAAAAGAGAATTTTTATAACCAAAGTTTGCTTTTTTCTTATGGAGTAGTAAGATTGATAGCTAAGTAAAGGAAACGATATTAAAAAGAGAATTTTTCTTA GTTGAATTTCACTTTTTGGAGACGTAAAGGAGAAAAAAGCTTCAATGATTCATAAATCGAAAATTCTCTATAAACCCTTTTCCAAAATCTTACCAATTTAGGGG AAAAATACTGAAAGTTTTGGTTTTTGCAGAGAGAAAATGGCGATGTTAGTTGAGCCACCAAATGGGATTAAGCAACAAGGGAAACATTACTACTCCATGTGGCA AACATTGTTCGAAATCGATACAAAGTATGTTCCGATTAAACCCATTGGAAGAGGAGCTTATGGTGTGGTTTGTTCTTCTATCAATCGTGAGACTAATGAGAGAG TTGCTATTAAAAAGATTCACAATGTGTTTGAGAATCGTGTTGATGCTTTGAGAACGTTGAGGGAACTTAAACTTCTTAGGCATGTGAGGCATGAGAATGTGATC GCGCTTAAAGATGTTATGTTGCCTGCTAATAGATCCAGTTTCAAGGATGTTTATTTGGTTTATGAGCTAATGGATACTGATCTTCATCAGATTATTAAATCCTC TCAGTCTCTTTCTGATGATCACTGCAAGTACTTCTTGTTTCAGGTAACTTTAAGTCCTTCCTCGGTAACTCTATGTTTCGAGTTTTGTATGTTTAGTTATTGAA ATAAGTCTTGTTCTTGTTGTTGTGTTTAGTTGCTTAGAGGGTTGAAGTATCTTCATTCTGCAAACATACTTCACCGGGATTTGAAGCCCGGGAACCTCTTAGTT AATGCGAACTGCGATCTCAAGATTTGTGATTTCGGGTTGGCGAGAACGAGCCAAGGTAATGAACAGTTCATGACTGAGTATGTGGTTACACGTTGGTACAGAGC ACCTGAGCTTCTTCTTTGTTGTGATAACTATGGAACCTCCATTGATGTATGGTCGGTTGGTTGCATATTCGCGGAGATTCTTGGTAGGAAACCGATTTTTCCAG GAACAGAATGCTTGAATCAGCTTAAGCTAATCATCAACGTTGTTGGTAGCCAACAAGAATCTGATATTCGGTTCATAGACAACCCGAAAGCTCGAAGGTTTATA AAGTCTCTTCCGTACTCAAGAGGAACTCATCTCTCCAATCTTTATCCACAAGCCAATCCTCTAGCTATAGATTTGTTACAGAGGATGCTTgtgtttgatccaac caagagaatctctgtaaccgatgcgctcttacacccgtatatggcggggttgtttgatcctggatccaatccgcctgcacatgtcccaatctctctggacatag atgaaaacatggaggaaccagtgataagagagatgatgtggaatgagatgctttattaccaccctgaagctgaaatctcaaatgccCTCGAGAGGCCTTACCCA TACGACGTTCCAGACTACGCTGGTTACCCATACGACGTTCCAGACTACGCTTGACTGCAGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCT GTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTAT GATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATC GCGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTT ATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTG CCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCT CACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGA ACATGAAGGCCTTGACAGGATATATTGGCGGGTAAACTAAGTCGCTGTATGTGTTTGTTTGAGATCTCATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGT AAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATA AAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGG CGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCC TTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCactggtaacaggattagcagagcgaggtatgtaggcgg tgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaagaagagttg gtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttg atcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaatta aaaatgaagttttaaatcaatctaaagtatatatgtgtaacattggtctagtgattagaaaaactcatcgagcatcaaatgaaactgcaatttattcatatcag gattatcaataccatatttttgaaaaagccgtttctgtaatgaaggagaaaactcaccgaggcagttccataggatggcaagatcctggtatcggtctgcgatt ccgactcgtccaacatcaatacaacctattaatttcccctcgtcaaaaataaggttatcaagtgagaaatcaccatgagtgacgactgaatccggtgagaatgg caaaagtttatgcatttctttccagacttgttcaacaggccagccattacgctcgtcatcaaaatcactcgcatcaaccaaaccgttattcattcgtgattgcg cctgagcgagacgaaatacgcgatcgctgttaaaaggacaattacaaacaggaatcgaatgcaaccggcgcaggaacactgccagcgcatcaacaatattttca cctgaatcaggatattcttctaatacctggaatgctgttttccctgggatcgcagtggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggt cggaagaggcataaattccgtcagccagtttagtctgaccatctcatctgtaacaacattggcaacgctacctttgccatgtttcagaaacaactctggcgcat cgggcttcccatacaatcggtagattgtcgcacctgattgcccgacattatcgcgagcccatttatacccatataaatcagcatccatgttggaatttaatcgc ggccttgagcaagacgtttcccgttgaatatggctcataacaccccttgtattactgtttatgtaagcagacagttttattgttcatgatgatatatttttatc ttgtgcaatgtaacatcagagattttgagacacaacgtggctttgttgaataaatcgaacttttgctgagttgaaggatcagatcacgcatcttcccgacaacg cagaccgttccgtggcaaagcaaaagttcaaaatcaccaactggtccacctacaacaaagctctcatcaaccgtggctccctcactttctggctggatgatggg gcgattcaggcgatccccatccaacagcccgccgtcgagcgggcttttttatccccggaagcctgtggatagagggtagttatccacgtgaaaccgctaatgcc ccgcaaagccttgattcacggggctttccggcccgctccaaaaactatccacgtgaaatcgctaatcagggtacgtgaaatcgctaatcggagtacgtgaaatc gctaataaggtcacgtgaaatcgctaatcaaaaaggcacgtgagaacgctaatagccctttcagatcaacagcttgcaaacacccctcgctccggcaagtagtt acagcaagtagtatgttcaattagcttttcaattatgaatatatatatcaattattggtcgcccttggcttgt

> ggacaatgcgctacgcgcaccggctccgcccgtggacaaccgcaagcggttgcccaccgtcgagcgccagcgcctttgcccacaacccggcggccggccgcaacunder aCC-BY-NC-ND 4.0 International license. pGREEN0229 agatcgttttataaatttttttttttgaaaaagaaaaagcccgaaaggcggcaacctctcgggcttctggatttccgatccccggaattagagatcttggcagg atatattgtggtgtaacgttatcagcttgcatgccggtcgatctagtaacatagatgacaccgcgcgcgataatttatcctagtttgcgcgctatattttgttt tctatcgcgtattaaatgtataattgcgggactctaatcataaaaacccatctcataaataacgtcatgcattacatgttaattattacatgcttaacgtaatt caacagaaattatatgataatcatcgcaagaccggcaacaggattcaatcttaagaaactttattgccaaatgtttgaacgatctgcttgactctaggggtcat cagatttcggtgacgggcaggaccggacggggcggcaccggcaggctgaagtccagctgccagaaacccacgtcatgccagttcccgtgcttgaagccggccgc ccgcagcatgccgcggggggcatatccgagcgcctcgtgcatgcgcacgctcgggtcgttgggcagcccgatgacagcgaccacgctcttgaagccctgtgcct ccagggacttcagcaggtgggtgtagagcgtggagcccagtcccgtccgctggtggcggggggagacgtacacggtcgactcggccgtccagtcgtaggcgttg

- cgtgccttccagggacccgcgtaggcgatgccggcgacctcgccgtccacctcggcgacgagccagggatagcgctcccgcagacggacgaggtcgtccgtcca MKK3 ctcctgcggttcctgcggctcggtacggaagttgaccgtgcttgtctcgatgtagtggttgacgatggtgcagaccgccggcatgtccgcctcggtggcacggc ggatgtcggccgggcgtcgttctgggctcatggtagatcccctcgatcgagttgagagtgaatatgagactctaattggataccgaggggaatttatggaacgt cagtggagcatttttgacaagaaatatttgctagctgatagtgaccttaggcgacttttgaacgcgcaataatggtttctgacgtatgtgcttagctcattaaa

- ctccagaaacccgcggctcagtggctccttcaacgttgcggttctgtcagttccaaacgtaaaacggcttgtcccgcgtcatcggcgggggtcataacgtgact YFP cccttaattctccgctcatgatcgataacattaacgcttacaatttccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcg ctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcg

cgcgtaatacgactcactatagggcgaattgggtacctaccttatcaagagttggctcataacccttattagtcagttcttcattgtgtacaatctcattccct atagtgtattcctgcaaatcatgaaaattttcgaatatacccttagggtttgcaaaaattgggggattatcgatcatatggatttttccgttgttgactatgtt attcatagattgctcaagagtatcaatatttgagtaggatttgatactcatgaatgggtagtttgatggaatttcataggaggaagagttgtaaaccaaatggt tttgattagtatccaaattctgattttgagaatcataatttgggatcaaaggtataagattttggtggtgctgattagagatatcagtcagatctggtgaaaaa gaccatccagtacgagaagattgacctaaattgtcattgaaaaagttaagattattttttggtatatgcgatgcatcatcattaacaggacatcgatgagcatc gtttaagatgaaattttcatcggagatcaatgagaattccatttaaacaccaacttgaattgaaatgatgattctaaaatggaaaactgattaaatctcgatat gaatctaagaagtacaaagatcgagtgcagaaatccgtaaaacaaatattgaaacccaaagatgggcggaaagttatagaaaatcttagaaagaacgatactca gataagacgataagaagtgagtggttataaaaaagtgtacttcaaataattaaataaaacaaaaaaggtaaaaatctatttaaaaggtaacaaatgtattaatg aattttgtagaaattgagtggcaaagactttgacttgtcaaatatttttacaagtcattaattttaacaaatcattgttttcacgttttatagataataaaagt gagttaaatataaaaccatgggccaaaaaaccaaaaaagtacacactataattagttagataattggatgtaattaaagatagtactttagatattgttctaat tttaagattttgagatgaggagttatacaatatcaacttgaggataaaatagacatttatattcttaaattgtaataaataattatgaaattataatgatttat gagagcgtttgtgtttaaaagagaaaatttgacatattacaacacgtgtcatacatgtcatgaatttatttctgttagataaaatttattttattttcttgagc actgaagatagttttttaataatatatttaggttgagtccattaatacttgaatttaagtactcaattgtttagactcaactagttctcaattcaccatccata gaaaactcgtttattttaacatttttcctatgaaaaaatgccaaccatattatgttttttaattattaaaatagtataatttctcgttaaacattttgataaag taacgttcgtattttcagaaataacatattttatattcctttaaaaaacaaagattatagtaaagaacattaaattaactaataactactctacttttccatag aatactaaattcctacgctttctattaatctttagtgtttttaccgctaaagatatcactatatcactttgtcaaaaaatctcaattttccatacatacaaaaa gattatgtttagaagtcatcaaatccataatttggttcacttaaatacaagttggtgattatttgattttgttcgatttaatgtcattttggtttcattttgtt ttctaaaatcagttcagtgttggttaaaataatataaaatacttctaaataataattcaaccataattatataaaagcaagaaaaaaaattctgaaattaaatt tcaaattattctaggcatgttctccaatgtggctgcatccgtcttgttggttcaagatgagtgctcttctgttaggtcctctatctaaacatcttcaactccat ttcgtggatcgatcacccaatccttcccagctgatccgtattttagtggtccttgtcgccgacgagaagtttagtctagtttctccatggtttgtgtagctatt gagatgttaactctcatgctttcagcctccttttcgctgtctctatttgagctgctcatgtctccacactacctatgaagtccgatctctacgactttggtgtg agctaccccctcagacctccagatccgccccctcaggccccaagttgaccattcgttccaatttgtgggagttttctccggtgttatgacctatggtccttcct tttctaccacctcacctagcagcatctcctccattcacccttgtttggataatgatctttgtgtcttccacttgcctccttgcgatctattattgttgtgtgca gttcatggtactaaatctttcctctagcgcatatgtgcaattaactggatacttctctggtttatctttgtttgcatttcaggctagtctactttgtttctaat ctagaatcacctttgttagtttattttctgtccaaatttggcagagtttgttcaccgaatacttctttagaatcttcgtgtctagggttaagaaaaatcaaact tttgcctagatccatcaaaatttgctcaccctatacatctccagcgtctccatgcatatgtctacggttgatccttcttgggtgcatcatcagagatcctttca tggtgcaacgaccacctccgcctcactgttgaatgaatgggagagaatgagtattattttcgtccttcatctatggtggagaaatatctctgattttgaaaaca aattagaaccgaagagactttgcacaagttttaaacaGTTTTGGACACTAACGATTATATGCTAACAAAATATATAATTAGTAAATTTTAAGTTTTGAATATAA TTTACGAATATTTTTTAATCCATGAAAAACTTTAAAGAAAATATCTTATGTTGACTTGACACTTTATGAGTCTAATTAAAAATGTACATACAAGTAACATCATA AGTAATTTGATTCCAGAACATCAAGAACCAGGTTTCAGGTTTCACACTTTCGCCCATCATGAAAAGTGGACAAAAATCAAATATTTTATTTGGCATGTTTTGCT TTGATTCTTTTTGAATGAATGTTATTCATCCTAAAACATATTTTGTATAATAAATGTAACCTTATACTTTTTTCCGCCAATGTAACCTTATGCTAAAAGTTCAG AACGTTTATAAATAAAAAGACACCAAAGACAAACAGTAGGGCCTTCAAGCACCAAAGACAAACACTAGGGCCTTCACCAAACCAAATTCTTAAGACATCCTCGA ATTTGGTTGTGGTTTCCTTTTGACTTGAAAGTCTGTTCTAGAGTTCGGACGATACGCTCAATGAAAGAAGACATGAGTGAAGGAGACAAGTTTTGTTCCCCATG TCTACGTCTAGGTTTATTTCTTTCGGACCATATGGAATGCACACAAACTTGGAACACATACCGTACGAGGTAGTAAACTGACTTTTATGTTAAAGATGGTTTAT GTAATTATGTTACTTTAATTGTTAAATAGTTTTTACGTTTCCATGAATTGGATCAAACGTAATCAAGTAAAAAAAAAAACCTATACTTATAATCCTTCCTTGTT TCATTTGATTTCCTTGCCTTTAAACCACAATATTATTTCTTTTGAGTTTCATTGATGGTGTCTCAATTGTAAATTGGGGTTTAGGGACATTATACAGATGGTTG TAAATTCCTGGAACTGACTGAGAAAAAATAAACTTATGGGCCTGGAGGAGATAGTTGTTGGGCCACTTCTTAATATATATTGGCCCACGAAAACACAATTAACT CTTCGTTTCAAATTTACAAACTAAACTTCGTGCTATCTAATACTTTTAAAACGGCACGTAATTTAGTTTTCAAAACATAGAACGACACAGGGTTATTGTCGGAG TTGCTTCTTCAGAGAGAAACATTAGAGAGGGGTGTTCATCTTCCACATCTCAAGGAGACACCCAAAAAGAAAAACCAAACCTTTGAAGAACGAAAAGGGTTATT AAAAAAGCAACAAACTTTGAGAGTAACAAAGGTAAGTTTTTATCTGTAATTCTAAGAGTTATATCATTTTGGTTTTGTATGATTTTTTTGAATTTGTGAATTTG ATCCGTTGATTTAATTCTGAATTTTCTACGATTAGTTCACTGTTATGTTTTGTGAATTATAACTGTTTTATTGACTAATCACGACTTTGAATCCAATTCTATTG AAGGGCTATAAGAAAAACTGAAATTAATTTATAGAAACTTGAAAATTTTGGGGACTTTTCATGTTTTGTTAAGTAAGAAATCTTCTTTTTTAGCTAAATTAGTT TCTTCTAAATAGAAAGTTTTCGAATTTAGAAAAAGGTTGGGGTTTTTTCATTGACTCTTGTCTGTGTTACAGAAAAAGTAGTTATCATGGCGGCATTGGAGGAG CTAAAGAAGAAGCTGTCTCCATTGTTTGATGCTGAGAAGGGTTTTTCTTCATCTTCATCTTTGGATCCAAACGATTCATATTTAGTAAGATTCCTGTGATTTTC GTTGTTAAGAAGTTTTGTTATGTTTCTGGTTTGTTTACTTTTATCTTCTTTTTGTTTGTTTGTGAAGTTATCTGATGGTGGGACTGTGAATTTACTTAGTAGAT CATATGGAGTTTATAATTTTAACGAGCTCGGGTTACAAAAATGTACATCTTCTCATGTGGATGAGTCTGAAAGTTCCGAGACGACGTATCAATGTGCTTCTCAC GAAATGCGGGTTTTTGGAGCTATAGGAAGCGGAGCTAGCAGCGTTGTTCAACGAGCTATTCATATCCCTAATCATAGAATTTTAGCGTTGAAGAAGATTAATAT CTTTGAAAGGGTAATGTTAATCTCTTTTGCTAGTTTAAAGAGAAAAATGTGACTCCATTTAGTATGTGTTTTTGAATATGTACTGATTTTGGTGAGCAGGAGAA AAGGCAGCAATTGCTTACAGAGATACGGACATTGTGTGAAGCTCCTTGTCATGAAGGACTTGTGGATTTTCACGGAGCGTTTTATAGTCCAGACTCGGGACAAA TCAGCATAGCTCTTGAATATATGAATGGAGGATCTCTTGCTGATATTTTAAAAGTAACAAAGAAGATACCTGAGCCGGTTCTTTCATCATTGTTCCACAAACTT TTGCAAGTAAAGATACTTAACTCTCTCTATAATGTGCAACATATATATGCGTTATGTTTTAAGTGTATATAAATTCATTCTTAGTGATGTGATTTCATTTTAAG GGATTGAGCTACTTGCATGGAGTGAGACATCTTGTTCATAGAGACATTAAACCTGCTAATTTGCTTATAAATCTCAAAGGGGAACCGAAGATAACCGATTTTGG CATAAGTGCTGGCCTTGAGAATTCAATGGCTATGGTTAGTGATTGTATCTCAGTCTTTCACTCCTTATTAATCCAGTAATCCTTTTTTGATGAGTTTTTAACTT GTATTATCTGAAAATGATGGTTGCAAAGTGTGCTACTTTTGTTGGAACTGTCACCTACATGTCACCAGAGAGGATAAGGAATGACAGTTATTCTTATCCAGCTG ATATATGGAGCCTTGGTCTCGCTCTTTTTGAATGCGGCACTGGAGAGTTTCCGTATATAGCTAATGAAGGGCCTGTTAATCTTATGTTGCAGGTTAATCAACTT GTCCCCAAATCCTTTCTTCCGATATATTATTTATATTTACACTAATTACTGTTATGTGAATGAAGATATTGGATGATCCTTCACCAACACCACCAAAACAAGAA TTCTCACCAGAGTTCTGTTCCTTCATTGATGCTTGCCTCCAGAAGGATCCAGATGCTCGACCAACAGCTGACCAGGTTGGTAAAACTGAAATGTCATACATTTA CCAGTCTAGTACTTTACTGAAATAAGTCATTTTTAGAGCAAATTGTGGTTAAAAGTTTGGTGCTTCTCTTAGTATTCGTCTGTTTGTTAGAAGTTCGATGCATT TCTTTGTATTTATTTGTTTTAATACAAGTCTGGTTAAGAATTGGATTCTTTCTGTTGAATTTATTAGATAATTCCTATAAAGCTTTGCTTTGATTCAAGTCTGA TGGTGTTTCCTCTGCTACTTGAACAGCTCTTGTCACACCCTTTTATTACAAAACACGAGAAGGAAAGAGTAGATTTGGCGACTTTTGTTCAAAGCATCTTTGAT CCAACTCAGAGATTGAAAGATTTAGCTGATGTAAGTATATGATGATCTTATCAGACTTTTCTTAGTTCGAAAATACCAAATTAAAGTTAACATTAATGATCTTA TTGGATTTTTGTTCAGATGCTCACCATACATTATTACTCCCTCTTTGATGGATTTGATGATCTTTGGCACCACGCAAAATCGCTCTACACTGAAACTTCAGTTT TCAGTTTCTCTGGGAAACATAACACAGGATCAACTGAAATCTTCTCAGCATTATCAGACATTCGTAACACATTAACAGGAGATTTACCGAGTGAGAAACTTGTT CATGTCGTTGAGAAGCTTCATTGCAAACCTTGCGGCAGTGGTGGAGTCATAATTCGTGCTGTTGGATCGTTTATTGTTGGAAATCAGTTTCTGATCTGTGGTGA TGGAGTCCAAGCAGAAGGGCTTCCGAGTTTCAAAGATCTTGGCTTCGATGTCGCAAGTAGACGTGTTGGCCGATTTCAAGAACAGTTTGTTGTTGAATCTGGTG ATCTTATTGGAAAGTATTTTCTTGCTAAGCAAGAGCTTTATATTACAAACTTAGATCTGCAGCCCGGGGGATCCATGGTGAGCAAGGGCGAGGAGCTGTTCACC GGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCT GAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCGGCTACGGCCTGAAGTGCTTCGCCCGCTACCCCGACCACATGA AGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAG TTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCA CAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACC AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCTACCAGTCCAAGCTGAGCAAAGACCCCAACGAGAAGCGCGATCAC ATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAAGCTTGCTCTTAAGGCGGCTGGAGCTGATGCTTAAGATCcact agttctagacgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagca tgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagc gcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgcggccgccaccgcggtggagctccagcttttgttccctttagtgagggttaa ttgcgcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcc tggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggcca5 acgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcact caaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgaaggccttgacaggatatattggcgggtaaactaagtcgctgtatgtg tttgtttgagatctcatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagca tcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccga ccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgc

6 7 8 9

6 bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Parsed Citations Acosta, I.F., Gasperini, D., Chételat, A., Stolz, S., Santuari, L., and Farmer, E.E. (2013). Role of NINJA in root jasmonate signaling. Proc. Natl. Acad. Sci. U. S. A. 110: 15473–15478. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Ahmad, P., Rasool, S., Gul, A., Sheikh, S.A., Akram, N.A., Ashraf, M., Kazi, A.M., and Gucel, S. (2016). Jasmonates: Multifunctional roles in stress tolerance. Front. Plant Sci. 7. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Almeida-Trapp, M., Souza, G.D. De, Rodrigues-Filho, E., Boland, W., and Mithöfer, A. (2014). Validated method for phytohormone quantification in plants. Front. Plant Sci. 5: 1–11. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Berriri, S., Garcia, a. V., Frei dit Frey, N., Rozhon, W., Pateyron, S., Leonhardt, N., Montillet, J.J.-L., Leung, J., Hirt, H., and Colcombet, J. (2012). Constitutively Active Mitogen-Activated Protein Kinase Versions Reveal Functions of Arabidopsis MPK4 in Pathogen Defense Signaling. Plant Cell 24: 4281–4293. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Bigeard, J., Colcombet, J., and Hirt, H. (2015). Signaling mechanisms in pattern-triggered immunity (PTI). Mol. Plant 8: 521–539. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Bigeard, J. and Hirt, H. (2018). Nuclear Signaling of Plant MAPKs. Front. Plant Sci. 9: 1–18. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Bogre, L., Ligterink, W., Meskiene, I., Barker, P., Heberle-Bors, E., Huskisson, N., and Hirt, H. (1997). Wounding Induces the Rapid and Transient Activation of a Specific MAP Kinase Pathway. Plant Cell 9: 75–83. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Boudsocq, M., Danquah, A., de Zélicourt, A., Hirt, H., and Colcombet, J. (2015). Plant MAPK cascades: Just rapid signaling modules? Plant Signal. Behav. 10: e1062197. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Chini, A., Fonseca, S., Fernández, G., Adie, B., Chico, J., Lorenzo, O., García-Casado, G., López-Vidriero, I., Lozano, F., Ponce, M., Micol, J., and Solano, R. (2007). The JAZ family of repressors is the missing link in jasmonate signalling. Nature 448: 666–671. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Chini, A., Monte, I., Zamarreño, A.M., Hamberg, M., Lassueur, S., Reymond, P., Weiss, S., Stintzi, A., Schaller, A., Porzel, A., García-mina, J.M., and Solano, R. (2018). didehydrojasmonate for jasmonate synthesis. Nat. Publ. Gr. 14: 171–178. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Clough, S.J. and Bent, A.F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16: 735–43. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Colcombet, J. and Hirt, H. (2008). Arabidopsis MAPKs: a complex signalling network involved in multiple biological processes. Biochem. J. 413: 217–226. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Colcombet, J., Sözen, C., and Hirt, H. (2016). Convergence of Multiple MAP3Ks on MKK3 Identifies a Set of Novel Stress MAPK Modules. Front. Plant Sci. 07: 1–7. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Danquah, A. et al. (2015). Identification and characterization of an ABA-activated MAP kinase cascade in Arabidopsis thaliana. Plant J. 82: 232–244. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Danquah, A., de Zelicourt, A., Colcombet, J., and Hirt, H. (2014). The role of ABA and MAPK signaling pathways in plant abiotic stress responses. Biotechnol. Adv. 32: 40–52. Pubmed: Author and Title bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Google Scholar: Author Only Title Only Author and Title Dóczi, R., Brader, G., Pettkó-Szandtner, A., Rajh, I., Djamei, A., Pitzschke, A., Teige, M., and Hirt, H. (2007). The Arabidopsis Mitogen- Activated Protein Kinase Kinase MKK3 Is Upstream of Group C Mitogen-Activated Protein Kinases and Participates in Pathogen Signaling. Plant Cell 19: 3266–3279. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Farmer, E.E., Gasperini, D., and Acosta, F. (2014). The squeeze cell hypothesis for the activation of jasmonate synthesis in response to wounding. New Phytol. 204: 282–288. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Fonseca, S., Chini, A., Hamberg, M., Adie, B., Porzel, A., Kramell, R., Miersch, O., Wasternack, C., and Solano, R. (2009). (+)-7-iso- Jasmonoyl-L-isoleucine is the endogenous bioactive jasmonate. Nat. Chem. Biol. 5: 344–350. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Frei dit Frey, N. et al. (2014). Functional analysis of Arabidopsis immune-related MAPKs uncovers a role for MPK3 as negative regulator of inducible defences. Genome Biol. 15: R87. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Galletti, R., Ferrari, S., Lorenzo, G. De, Bolognetti, I.P.C., and Charles, B. (2011). Arabidopsis MPK3 and MPK6 Play Different Roles in Basal and Oligogalacturonide- or Flagellin-Induced Resistance against Botrytis cinerea. Plant Physiol. 157: 804–814. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Heinrich, M., Baldwin, I.T., and Wu, J. (2018). Two mitogen-activated protein kinase kinases, MKK1 and MEK2, are involved in wounding- and specialist lepidopteran herbivore Manduca sexta -induced responses in Nicotiana attenuata. J. Exp. Bot. 62: 4355–4365. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Hellens, R.P., Edwards, E.A., Leyland, N.R., Bean, S., and Mullineaux, P.M. (2000). pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol. Biol. 42: 819–832. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Hettenhausen, C., Schuman, M.C., and Wu, J. (2017). MAPK signaling – a key element in plant defense response to insects. Insect Sci. 22: 157–164. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Howe, G.A. and Jander, G. (2008). Plant Immunity to Insect Herbivores. Annu. Rev. Plant Biol. 59: 41–66. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Ichimura, K., Mizoguchi, T., Yoshida, R., Yuasa, T., and Shinozaki, K. (2000). Various abiotic stresses rapidly activate Arabidopsis MAP kinase ATMPK4 and ATMPK6. Plant J. 24: 655–665. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Kandoth, P.K., Ranf, S., Pancholi, S.S., Jayanty, S., Walla, M.D., Miller, W., Howe, G.A., Lincoln, D.E., and Stratmann, J.W. (2007). Tomato MAPKs LeMPK1, LeMPK2, and LeMPK3 function in the systemin-mediated defense response against herbivorous insects. Proc. Natl. Acad. Sci. U. S. A. 104: 12205–12210. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Katsir, L., Chung, H.S., Koo, A.J.K., and Howe, G.A. (2008a). Jasmonate signaling : a conserved mechanism of hormone sensing. Curr. Opin. Plant Biol. 11: 428–435. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Katsir, L., Schilmiller, A.L., Staswick, P.E., He, S.Y., and Howe, G.A. (2008b). COI1 is a critical component of a receptor for jasmonate and the bacterial virulence factor coronatine. Proc. Natl. Acad. Sci. U. S. A. 105: 7100–7105. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Kiep, V., Vadassery, J., Lattke, J., Boland, W., Peiter, E., and Mithöfer, A. (2015). Rapid report Systemic cytosolic Ca2+ elevation is activated upon wounding and herbivory in Arabidopsis. New Phytol. 207: 996–1004. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Koo, A.J.K., Gao, X., Jones, A.D., and Howe, G.A. (2009). A rapid wound signal activates the systemic synthesis of bioactive jasmonates in Arabidopsis. Plant J. 59: 974–986. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Lee, H. (2015). Mitogen-Activated Protein Kinase Kinase 3 Is Required for Regulation during Dark-Light Transition. Mol. Cells 38: 651– 656. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Li, G., Meng, X., Wang, R., Mao, G., Han, L., and Liu, Y. (2012). Dual-Level Regulation of ACC Synthase Activity by MPK3 / MPK6 Cascade and Its Downstream WRKY Transcription Factor during Ethylene Induction in Arabidopsis. PLoS Genet. 8: e1002767. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Li, S., Han, X., Yang, L., Deng, X., Wu, H., Zhang, M., Liu, Y., Zhang, S., and Xu, J. (2017). Mitogen-activated protein kinases and calcium- dependent protein kinases are involved in wounding-induced ethylene biosynthesis in Arabidopsis thaliana. Plant. Cell Environ. 41: 134–147. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Liu, Y. and Zhang, S. (2004). Phosphorylation of 1-aminocyclopropane-1-carboxylic acid synthase by MPK6, a stress-responsive mitogen-activated protein kinase, induces ethylene biosynthesis in Arabidopsis. Plant Cell 16: 3386–99. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Maffei, M., Bossi, S., Spiteller, D., Mithöfer, A., and Boland, W. (2004). Effects of Feeding Spodoptera littoralis on Lima Bean Leaves. I. Membrane Potentials, Intracellular Calcium Variations, Oral Secretions, and Regurgitate Components. Plant Physiol. 134: 1752–1762. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Maffei, M.E., Arimura, G.I., and Mithöfer, A. (2012). Natural elicitors, effectors and modulators of plant responses. Nat. Prod. Rep. 29: 1288–1303. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Matsuoka, D., Yasufuku, T., Furuya, T., and Nanmori, T. (2015). An abscisic acid inducible Arabidopsis MAPKKK, MAPKKK18 regulates leaf senescence via its kinase activity. Plant Mol. Biol.: 565–575. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Meskiene, I., Baudouin, E., Schweighofer, A., Liwosz, A., Jonak, C., Rodriguez, P.L., Jelinek, H., and Hirt, H. (2003). Stress-induced protein phosphatase 2C is a negative regulator of a mitogen-activated protein kinase. J. Biol. Chem. 278: 18945–18952. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Mitula, F., Tajdel, M., Cies̈ la, A., Kasprowicz-Malus̈ ki, A., Kulik, A., Babula-Skowrońska, D., Michalak, M., Dobrowolska, G., Sadowski, J., and Ludwików, A. (2015). Arabidopsis ABA-Activated Kinase MAPKKK18 is Regulated by Protein Phosphatase 2C ABI1 and the Ubiquitin-Proteasome Pathway. Plant Cell Physiol. 56: 2351–2367. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Navarro, L., Zipfel, C., Rowland, O., Keller, I., Robatzek, S., Boller, T., and Jones, J.D.G. (2004). The Transcriptional Innate Immune Response to flg22. Interplay and Overlap with Avr Gene-Dependent Defense Responses and Bacterial Pathogenesis. Plant Physiol. 135: 1113–1128. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Ordon, J., Gantner, J., Kemna, J., Schwalgun, L., Reschke, M., Streubel, J., Boch, J., and Stuttmann, J. (2016). Generation of chromosomal deletions in dicotyledonous plants employing a user-friendly genome editing toolkit. Plant J.: 155–168. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Ortiz-Masia, D., Perez-Amador, M.A., Carbonell, J., and Marcote, M.J. (2007). Diverse stress signals activate the C1 subgroup MAP kinases of Arabidopsis. FEBS Lett. 581: 1834–1840. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Ranf, S., Eschen-Lippold, L., Pecher, P., Lee, J., and Scheel, D. (2011). Interplay between calcium signalling and early signalling elements during defence responses to microbe- or damage-associated molecular patterns. Plant J. 68: 100–113. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Rayapuram, N., Bigeard, J., Alhoraibi, H., Bonhomme, L., Hesse, A., Hirt, H., Pflieger, D., and Arabidopsis, I. (2018). Quantitative Phosphoproteomic Analysis Reveals Shared and Specific Targets of Arabidopsis Mitogen-Activated Protein Kinases (MAPKs) MPK3, MPK4, and MPK6. Mol. Cell. Proteomics 17: 61–80. bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Reymond, P., Bodenhausen, N., Van Poecke, R.M.P., Krishnamurthy, V., Dicke, M., and Farmer, E.E. (2004). A Conserved Transcript Pattern in Response to a Specialist and a Generalist Herbivore. Plant Cell 16: 3132–3147. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Roitinger, E., Hofer, M., Ko, T., Pichler, P., Novatchkova, M., Yang, J., Schlo, P., and Mechtler, K. (2015). Quantitative Phosphoproteomics of the Ataxia Telangiectasia-Mutated (ATM) and Ataxia Telangiectasia-Mutated and Rad3-related (ATR) Dependent DNA Damage Response in Arabidopsis thaliana. Mol. Cell. Proteomics 14: 556–571. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Savatin, D. V, Gramegna, G., Modesti, V., and Cervone, F. (2014). Wounding in the plant tissue: the defense of a dangerous passage. Front. Plant Sci. 5: 1–11. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Schäfer, M., Fischer, C., Meldau, S., Seebald, E., Oelmüller, R., and Baldwin, I.T. (2011). Lipase activity in insect oral secretions mediates defense responses in arabidopsis. Plant Physiol. 156: 1520–1534. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Scholz, S.S., Vadassery, J., Heyer, M., Reichelt, M., Bender, K.W., Snedden, W.A., Boland, W., and Mithöfer, A. (2014). Mutation of the Arabidopsis Calmodulin-Like Protein CML37 Deregulates the Jasmonate Pathway and Enhances Susceptibility to Herbivory. Mol. Plant 7: 1712–1726. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Schwacke, R., Schneider, A., Graaff, E. Van Der, Fischer, K., Catoni, E., Desimone, M., Frommer, W.B., Flu, U., and Kunze, R. (2003). ARAMEMNON, a Novel Database for Arabidopsis Integral Membrane Proteins. Plant Physiol. 131: 16–26. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Seo, S., Katou, S., Seto, H., Gomi, K., and Ohashi, Y. (2007). The mitogen-activated protein kinases WIPK and SIPK regulate the levels of jasmonic and salicylic acids in wounded tobacco plants. Plant J. 49: 899–909. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Seo, S., Okamoto, M., Seto, H., Ishizuka, K., Sano, H., and Ohashi, Y. (1995). Tobacco MAP Kinase : Possible Mediator in Wound Signal Transduction Pathways. Science (80-. ). 270: 1988–1992. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Seo, S., Sano, H., and Ohashi, Y. (1999). Jasmonate-based wound signal transduction requires activation of WIPK, a tobacco mitogen- activated protein kinase. Plant Cell 11: 289–298. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Sethi, V., Raghuram, B., Sinha, A.K., and Chattopadhyay, S. (2014). A mitogen-activated protein kinase cascade module, MKK3-MPK6 and MYC2, is involved in blue light-mediated seedling development in Arabidopsis. Plant Cell 26: 3343–57. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Shan, C. and Sun, H. (2018). Jasmonic acid-induced NO activates MEK1/2 in regulating the metabolism of ascorbate and glutathione in maize leaves. Protoplasma 255: 977–983. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Su, J., Zhang, M., Zhang, L., Sun, T., Liu, Y., Lukowitz, W., Xu, J., and Zhang, S. (2017). Regulation of Stomatal Immunity by Interdependent Functions of a Pathogen-responsive MPK3/MPK6 Cascade and Abscisic Acid. Plant Cell 29: 526–542. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Suarez-Rodriguez, M.C., Petersen, M., and Mundy, J. (2010). Mitogen-Activated Protein Kinase Signaling in Plants. Annu. Rev. Plant Biol. 61: 621–649. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Takahashi, F., Mizoguchi, T., Yoshida, R., Ichimura, K., and Shinozaki, K. (2011). Calmodulin-Dependent Activation of MAP Kinase for ROS Homeostasis in Arabidopsis. Mol. Cell 41: 649–660. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title bioRxiv preprint doi: https://doi.org/10.1101/855098; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Takahashi, F., Yoshida, R., Ichimura, K., Mizoguchi, T., Seo, S., Yonezawa, M., Maruyama, K., Yamaguchi-Shinozaki, K., and Shinozaki, K. (2007). The mitogen-activated protein kinase cascade MKK3-MPK6 is an important part of the jasmonate signal transduction pathway in Arabidopsis. Plant Cell 19: 805–818. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., Nomura, K., He, S.Y., Howe, G.A., and Browse, J. (2007). JAZ repressor proteins are targets of the SCF/COI1 complex during jasmonate signalling. Nature 448: 661–666. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Umezawa, T., Sugiyama, N., Takahashi, F., Anderson, J.C., Ishihama, Y., Peck, S.C., and Shinozaki, K. (2013). Genetics and phosphoproteomics reveal a protein phosphorylation network in the abscisic acid signaling pathway in Arabidopsis thaliana. Sci. Signal. 6: rs8. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Usami, S., Banno, H., Nishihama, R., and Machida, Y. (1995). Cutting activates a 46-kilodalton protein kinase in plants. Proc. Natl. Acad. Sci. U. S. A. 92: 8660–8664. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Vadassery, J., Reichelt, M., Hause, B., Gershenzon, J., Boland, W., and Mithöfer, A. (2012). CML42-Mediated Calcium Signaling Coordinates Responses to Spodoptera Herbivory and Abiotic Stresses. Plant Physiol. 159: 1159–1175. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Wasternack, C. (2018). Jasmonates : An Update on Biosynthesis, Signal Transduction and Action in Plant Stress Response, Growth and Development. Ann. Bot. 100: 681–697. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Wasternack, C. and Hause, B. (2013). Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Ann. Bot. 111: 1021–1058. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Winter, D., Vinegar, B., Nahal, H., Ammar, R., Wilson, G. V, and Provart, N.J. (2007). An '"Electronic Fluorescent Pictograph"' Browser for Exploring and Analyzing Large-Scale Biological Data Sets. PLoS One 2: e718. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Wu, J., Hettenhausen, C., Meldau, S., and Baldwin, I.T. (2007). Herbivory Rapidly Activates MAPK Signaling in Attacked and Unattacked Leaf Regions but Not between Leaves of Nicotiana attenuata. Plant Cell 19: 1096–1122. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Xu, J. and Zhang, S. (2015). Mitogen-activated protein kinase cascades in signaling plant growth and development. Trends Plant Sci. 20: 56–64. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Yoo, S.J., Kim, S., Kim, M., Ryu, C., Kim, Y.C., Cho, B.H., and Yang, K. (2014). Involvement of the OsMKK4-OsMPK1 Cascade and its Downstream Transcrip- tion Factor OsWRKY53 in the Wounding Response in Rice. Plant Pathol J 30: 168–177. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Zhao, C., Nie, H., Shen, Q., Zhang, S., Lukowitz, W., and Tang, D. (2014). EDR1 Physically Interacts with MKK4/MKK5 and Negatively Regulates a MAP Kinase Cascade to Modulate Plant Innate Immunity. PLoS Genet. 10: e1004389. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L., and Gruissem, W. (2004). GENEVESTIGATOR. Arabidopsis Microarray Database and Analysis Toolbox. Plant Physiol. 136: 2621–2632. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title