DOCSLIB.ORG

Risk of Ovarian Cancer and the NF-Kb Pathway: Genetic Association with IL1A and TNFSF10

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Risk of Ovarian Cancer and the NF-Kb Pathway: Genetic Association with IL1A and TNFSF10 Published OnlineFirst November 22, 2013; DOI: 10.1158/0008-5472.CAN-13-1051 Cancer Prevention and Epidemiology Research Risk of Ovarian Cancer and the NF-kB Pathway: Genetic Association with IL1A and TNFSF10 Bridget Charbonneau1, Matthew S. Block2, William R. Bamlet3, Robert A. Vierkant3, Kimberly R. Kalli2, Zachary Fogarty3, David N. Rider3, Thomas A. Sellers6, Shelley S. Tworoger7,9, Elizabeth Poole7,9, Harvey A. Risch10, Helga B. Salvesen11,12, Lambertus A. Kiemeney14,15,17, Laura Baglietto18,19, Graham G. Giles18,19,22, Gianluca Severi18,19, Britton Trabert26, Nicolas Wentzensen26, Georgia Chenevix-Trench25, for AOCS/ACS group23,25, Alice S. Whittemore27, Weiva Sieh27, Jenny Chang-Claude33, Elisa V. Bandera42, Irene Orlow43, Kathryn Terry9,8, Marc T. Goodman28, Pamela J. Thompson28, Linda S. Cook46, Mary Anne Rossing47,48, Roberta B. Ness49, Steven A. Narod53, Jolanta Kupryjanczyk59, Karen Lu50, Ralf Butzow63,64, Thilo Dork€ 34, Tanja Pejovic65,66, Ian Campbell20,21,24, Nhu D. Le54, Clareann H. Bunker67, Natalia Bogdanova34, Ingo B. Runne- baum35, Diana Eccles70, James Paul71, Anna H. Wu30, Simon A. Gayther30, Estrid Hogdall81,82, Florian Heitz36,38, Stanley B. Kaye72, Beth Y. Karlan29, Hoda Anton-Culver32, Jacek Gronwald61, Claus K. Hogdall83, Diether Lambrechts84,85, Peter A. Fasching31,39, Usha Menon74,75,76, Joellen Schildkraut87,89, Celeste Leigh Pearce30, Douglas A. Levine44, Susanne Kruger Kjaer81,83, Daniel Cramer8,9, James M. Flanagan77, Catherine M. Phelan6, Robert Brown77, Leon F.A.G. Massuger16, Honglin Song79, Jennifer A. Doherty90, Camilla Krakstad11,12, Dong Liang52, Kunle Odunsi45, Andrew Berchuck88, Allan Jensen81, Jan Lubinski 61, Heli Nevanlinna63, Yukie T. Bean65,66, Galina Lurie91, Argyrios Ziogas32, Christine Walsh29, Evelyn Despierre86, Louise Brinton26, Alexander Hein39, Anja Rudolph33, Agnieszka Dansonka-Mieszkowska59, Sara H. Olson43, Philipp Harter36,38, Jonathan Tyrer79, Allison F. Vitonis8, Angela Brooks-Wilson55,56, Katja K. Aben14,17, Malcolm C. Pike30,45, Susan J. Ramus30, Elisabeth Wik11,13, Cezary Cybulski61, Jie Lin51, Lara Sucheston45, Robert Edwards68,69, Valerie McGuire27, Jenny Lester29, Andreas du Bois36,38, Lene Lundvall83, Shan Wang- Gohrke41, Lukasz M. Szafron59, Sandrina Lambrechts86, Hannah Yang26, Matthias W. Beckmann39, Liisa M. Pelttari63, Anne M. Van Altena16, David van den Berg30, Mari K. Halle11,12, Aleksandra Gentry-Maharaj74,75,76, Ira Schwaab37, Urmila Chandran42, Janusz Menkiszak62, Arif B. Ekici40, Lynne R. Wilkens91, Arto Leminen63, Francesmary Modugno67,68,69, Grace Friel45, Joseph H. Rothstein27, Ignace Vergote86, Montserrat Garcia- Closas73,78, Michelle A.T. Hildebrandt51, Piotr Sobiczewski60, Linda E. Kelemen57,58, Paul D.P. Pharoah79,80, Kirsten Moysich45, Keith L. Knutson4, Julie M. Cunningham5, Brooke L. Fridley92, and Ellen L. Goode1 Abstract A missense single-nucleotide polymorphism (SNP) in the immune modulatory gene IL1A has been associated with ovarian cancer risk (rs17561). Although the exact mechanism through which this SNP alters risk of ovarian cancer is not clearly understood, rs17561 has also been associated with risk of endometriosis, an epidemiologic risk factor for ovarian cancer. Interleukin-1a (IL1A) is both regulated by and able to activate NF-kB, a transcription factor family that induces transcription of many proinflammatory genes and may be an important mediator in carcinogenesis. We therefore tagged SNPs in more than 200 genes in the NF-kB pathway for a total of 2,282 SNPs (including rs17561) for genotype analysis of 15,604 cases of ovarian cancer in patients of European descent, including 6,179 of high-grade serous (HGS), 2,100 endometrioid, 1,591 mucinous, 1,034 clear cell, and 1,016 low-grade serous, including 23,235 control cases spanning 40 studies in the Ovarian Cancer Association Consortium. In this large population, we confirmed the association between rs17561 and clear cell ovarian cancer [OR, 0.84; 95% confidence interval (CI), 0.76–0.93; P ¼ 0.00075], which remained intact even after excluding participants in the prior study (OR, 0.85; 95% CI, 0.75–0.95; P ¼ 0.006). Considering a multiple-testing–corrected À significance threshold of P < 2.5 Â 10 5, only one other variant, the TNFSF10 SNP rs6785617, was associated significantly with a risk of ovarian cancer (low malignant potential tumors OR, 0.85; 95% CI, 0.79–0.91; P ¼ 0.00002). Our results extend the evidence that borderline tumors may have a distinct genetic etiology. Further investigation of how these SNPs might modify ovarian cancer associations with other inflammation-related risk factors is warranted. Cancer Res; 74(3); 852–61. Ó2013 AACR. Authors' Affiliations: Departments of 1Health Sciences Research, Division Rochester, Minnesota; 6Department of Cancer Epidemiology, Division of of Epidemiology, 2Medical Oncology, 3Health Sciences Research, Division Population Sciences, Moffitt Cancer Center, Tampa, Florida; 7Channing of Biomedical Statistics and Informatics, 4Immunology, and 5Laboratory Division of Network Medicine, 8Obstetrics and Gynecology Epidemiology Medicine and Pathology, Division of Experimental Pathology, Mayo Clinic, Center, Brigham and Women's Hospital, Harvard Medical School; 852 Cancer Res; 74(3) February 1, 2014 Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2014 American Association for Cancer Research. Published OnlineFirst November 22, 2013; DOI: 10.1158/0008-5472.CAN-13-1051 NF-kB SNPs and Ovarian Cancer Risk Introduction cancer risk (12), presumably due to its proinflammatory prop- Inflammation is a known mediator of carcinogenesis and erties (13). Use of nonsteroidal anti-inflammatory drugs several risk factors associated with ovarian cancer are also (NSAID) has also been linked to reduced risk of ovarian cancer, linked to inflammatory processes (1). The inverse relationship particularly aspirin use in invasive ovarian cancer risk (14, 15). between parity (2, 3) and oral contraceptive use (3–6) and In a previous study by our group, interrogation of single- ovarian cancer risk is thought to be due to increased ovulations nucleotide polymorphisms (SNP) in several inflammation- in women with fewer pregnancies or shorter duration of oral related genes revealed an association between ovarian cancer contraceptive use. The damage and repair cycle associated risk and SNPs in IL1A and ALOX5 (16), most notable was a with each ovulation recruits immune mediators with potential missense SNP in IL1A, rs17561, which had the strongest to promote ovarian cancer initiation and growth (1, 7). Evi- associations with the rarer histologic subtypes. Interleukin- dence for a relationship between pelvic inflammatory disease 1a (IL1A), the cytokine encoded by this gene, mediates a (PID) and ovarian cancer risk has also been observed in a few number of inflammatory and immune responses, including studies (8, 9). Furthermore, endometriosis, another condition response to tissue injury (17, 18). In the present study, we associated with elevated inflammatory markers (10), has been assessed this SNP for overall and histologic subtype associa- found to increase risk of clear-cell, invasive endometrioid, and tions in a much larger population of ovarian cancer cases and low-grade serous (LGS) tumors (11). Studies of perineal talcum controls to evaluate replication. We additionally investigated powder use additionally suggest an association with ovarian SNPs in other NF-kB pathway genes, as IL1A is not only 9Department of Epidemiology, Harvard School of Public Health, Boston, medical Physiology and Kinesiology, Simon Fraser University, Burnaby, Massachusetts; 10Department of Chronic Disease Epidemiology, Yale British Columbia; 57Department of Population Health Research, Alberta School of Public Health, New Haven, Connecticut; 11Department of Clinical Health Services-Cancer Care; 58Department of Medical Genetics and Science, University of Bergen; Departments of 12Gynecology and Obstet- Oncology, University of Calgary, Calgary, Alberta, Canada;Departments rics, and 13Pathology, Haukeland University Hospital, Bergen, Norway; of 59Pathology and 60Gynecologic Oncology, The Maria Sklodowska-Curie Departments for 14Health Evidence, 15Urology, and 16Gynaecology, Rad- Memorial Cancer Center and Institute of Oncology, Warsaw; 61Department boud University Medical Centre, Nijmegen; 17Comprehensive Cancer of Genetics and Pathology, International Hereditary Cancer Center; 62Clinic Center The Netherlands, Utrecht, the Netherlands; 18Cancer Epidemiology of Gynaecological Surgery and Oncology, Pomeranian Medical University, Centre, The Cancer Council Victoria; 19Centre for Molecular, Environmen- Szczecin, Poland; Departments of 63Obstetrics and Gynecology and tal, Genetic and Analytical Epidemiology, 20Department of Pathology, and 64Pathology, Helsinki University Central Hospital, University of Helsinki, 21Sir Peter MacCallum Department of Oncology, University of Melbourne; Helsinki, Finland; 65Department of Obstetrics and Gynecology; 66Knight 22Department of Epidemiology and Preventive Medicine, Monash Univer- Cancer Institute, Oregon Health and Science University, Portland, Oregon; sity; 23Peter MacCallum Cancer Institute; 24Research Division, Peter Mac- Departments of 67Epidemiology and 68Department of Obstetrics, Gyne- Callum Cancer Centre, Melbourne, Victoria; 25Cancer Division, Queens- cology and Reproductive Sciences, University of Pittsburgh; 69Women's land Institute of Medical Research, Herston, Queensland, Australia; 26Divi- Cancer Research Program, Magee-Women's Research Institute
Load more

Recommended publications
  • Significant Shortest Paths for the Detection of Putative Disease Modules
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.01.019844; this version posted April 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. SIGNIFICANT SHORTEST PATHS FOR THE DETECTION OF PUTATIVE DISEASE MODULES Daniele Pepe1 1Department of Oncology, KU Leuven, LKI–Leuven Cancer Institute, Leuven, Belgium Email address: DP: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.04.01.019844; this version posted April 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Keywords Structural equation modeling, significant shortest paths, pathway analysis, disease modules. Abstract Background The characterization of diseases in terms of perturbated gene modules was recently introduced for the analysis of gene expression data. Some approaches were proposed in literature, but many times they are inductive approaches. This means that starting directly from data, they try to infer key gene networks potentially associated to the biological phenomenon studied. However they ignore the biological information already available to characterize the gene modules. Here we propose the detection of perturbed gene modules using the combination of data driven and hypothesis-driven approaches relying on biological metabolic pathways and significant shortest paths tested by structural equation modeling.
    [Show full text]
  • Interactions Between the Parasite Philasterides Dicentrarchi and the Immune System of the Turbot Scophthalmus Maximus.A Transcriptomic Analysis
    biology Article Interactions between the Parasite Philasterides dicentrarchi and the Immune System of the Turbot Scophthalmus maximus.A Transcriptomic Analysis Alejandra Valle 1 , José Manuel Leiro 2 , Patricia Pereiro 3 , Antonio Figueras 3 , Beatriz Novoa 3, Ron P. H. Dirks 4 and Jesús Lamas 1,* 1 Department of Fundamental Biology, Institute of Aquaculture, Campus Vida, University of Santiago de Compostela, 15782 Santiago de Compostela, Spain; [email protected] 2 Department of Microbiology and Parasitology, Laboratory of Parasitology, Institute of Research on Chemical and Biological Analysis, Campus Vida, University of Santiago de Compostela, 15782 Santiago de Compostela, Spain; [email protected] 3 Institute of Marine Research, Consejo Superior de Investigaciones Científicas-CSIC, 36208 Vigo, Spain; [email protected] (P.P.); antoniofi[email protected] (A.F.); [email protected] (B.N.) 4 Future Genomics Technologies, Leiden BioScience Park, 2333 BE Leiden, The Netherlands; [email protected] * Correspondence: [email protected]; Tel.: +34-88-181-6951; Fax: +34-88-159-6904 Received: 4 September 2020; Accepted: 14 October 2020; Published: 15 October 2020 Simple Summary: Philasterides dicentrarchi is a free-living ciliate that causes high mortality in marine cultured fish, particularly flatfish, and in fish kept in aquaria. At present, there is still no clear picture of what makes this ciliate a fish pathogen and what makes fish resistant to this ciliate. In the present study, we used transcriptomic techniques to evaluate the interactions between P. dicentrarchi and turbot leucocytes during the early stages of infection. The findings enabled us to identify some parasite genes/proteins that may be involved in virulence and host resistance, some of which may be good candidates for inclusion in fish vaccines.
    [Show full text]
  • Modulation of NF-Κb Signalling by Microbial Pathogens
    REVIEWS Modulation of NF‑κB signalling by microbial pathogens Masmudur M. Rahman and Grant McFadden Abstract | The nuclear factor-κB (NF‑κB) family of transcription factors plays a central part in the host response to infection by microbial pathogens, by orchestrating the innate and acquired host immune responses. The NF‑κB proteins are activated by diverse signalling pathways that originate from many different cellular receptors and sensors. Many successful pathogens have acquired sophisticated mechanisms to regulate the NF‑κB signalling pathways by deploying subversive proteins or hijacking the host signalling molecules. Here, we describe the mechanisms by which viruses and bacteria micromanage the host NF‑κB signalling circuitry to favour the continued survival of the pathogen. The nuclear factor-κB (NF-κB) family of transcription Signalling targets upstream of NF‑κB factors regulates the expression of hundreds of genes that NF-κB proteins are tightly regulated in both the cyto- are associated with diverse cellular processes, such as pro- plasm and the nucleus6. Under normal physiological liferation, differentiation and death, as well as innate and conditions, NF‑κB complexes remain inactive in the adaptive immune responses. The mammalian NF‑κB cytoplasm through a direct interaction with proteins proteins are members of the Rel domain-containing pro- of the inhibitor of NF-κB (IκB) family, including IκBα, tein family: RELA (also known as p65), RELB, c‑REL, IκBβ and IκBε (also known as NF-κBIα, NF-κBIβ and the NF-κB p105 subunit (also known as NF‑κB1; which NF-κBIε, respectively); IκB proteins mask the nuclear is cleaved into the p50 subunit) and the NF-κB p100 localization domains in the NF‑κB complex, thus subunit (also known as NF‑κB2; which is cleaved into retaining the transcription complex in the cytoplasm.
    [Show full text]
  • Differential and Overlapping Immune Programs Regulated by IRF3 and IRF5 in Plasmacytoid Dendritic Cells
    Differential and Overlapping Immune Programs Regulated by IRF3 and IRF5 in Plasmacytoid Dendritic Cells This information is current as Kwan T. Chow, Courtney Wilkins, Miwako Narita, Richard of September 28, 2021. Green, Megan Knoll, Yueh-Ming Loo and Michael Gale, Jr. J Immunol published online 8 October 2018 http://www.jimmunol.org/content/early/2018/10/05/jimmun ol.1800221 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2018/10/05/jimmunol.180022 Material 1.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2018 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published October 8, 2018, doi:10.4049/jimmunol.1800221 The Journal of Immunology Differential and Overlapping Immune Programs Regulated by IRF3 and IRF5 in Plasmacytoid Dendritic Cells Kwan T. Chow,*,† Courtney Wilkins,* Miwako Narita,‡ Richard Green,* Megan Knoll,* Yueh-Ming Loo,* and Michael Gale, Jr.* We examined the signaling pathways and cell type–specific responses of IFN regulatory factor (IRF) 5, an immune-regulatory transcription factor.
    [Show full text]
  • Table 1 the Primers Sequences Used for Real-Time Quantitative RT-PCR
    Table 1 The Primers Sequences used for Real-Time quantitative RT-PCR Analysis Gene symbol Sense Primer Antisense Primer Size (bp) p21WAF1/Cip1 CTTTGACTTCGTCACGGAGAC AGGCAGCGTATATCAGGAGAC 150 Max CGAAAACGTAGGGACCACAT TGCTGGTGTGTGGTTTTT 200 APC GATGAAATAGGATGTAATCAGACGAC GCTAAACATGAGTGGGGTCTC 350 BCL-2 CAGCTGCACCTGACG ATGCACCTACCCAGC 320 p53 GGAGGTTGTGAGGCGCTGG CACGCACCTCAAAGCTGTTC 330 Bax TGCAGAGGATGATTGCTGAC GAGGACTCCAGCCACAAAGA 270 Syndecan-1 TCTGACTCGGTTTCTCCAA ATTGCTGTCTCCCGACCAA 360 Syndecan-3 TTTGGGGCAGACCCCACTA ATCCCTAAACCCTGAACCT 550 Perlecan ACAGTGCAACAAGTGCAAGG CTGAAAGTGACCAGGCTCCTC 450 Vitronectin ACTTCTTCAAGGGGAAACAG TATGGCTGCGTCCACTTTG 400 PCAF TTTTTTTAATCCAGCTTCC AAGAAACAGGGTTTCTCCAAG 750 APO1A CAAGAACGGCGGCGCCAGA GCTCTCCAGCACGGGCAGGCA 220 β-Actin CCTTCTACAATGAGC ACGTCACACTTCATG 260 EGR-1 GCCAAACAGTCACTTTGTT GAAAGTGTTTTTTCTTCGTCG 400 MAPK3 ACCTGCGACCTTAAGATTTGT GAAAAGCTTGGCCCAAGCC 300 TIMP-1 CCCTGATGACGAGGTCGGAA AGATCCAGCGCCCAGAGAGA 220 Caspase-3 ATGGAGAACACTGAAAACTCA TTAGTGATAAAAATAGAGTTC 200 TIMP-3 CCCCATGTGCAGTACATCCA GCACAGCCCCGTGTACATCT 180 Biglycan GATGGCCTGAAGCTCAA GGTTTGTTGAAGAGGCTG 460 Stat3 TTTCTCTATTTTTAAAAGTGC AAGTATTGTCGGCCAGAGAGC 460 TIMP2 CAAGAGGATCCAGTATGAGAT GCCCGTGTAGATAAACTCTAT 570 CCRK ACCTGCAGATGCTGCTCAAG GAAATGAACCCAACAAACCA 200 GAPDH CCACCCATGGCAAATTCCATGGGA TCTAGACGGCAGGTCAGGTCCACC 500 Table 2. Genes with Altered Expression in Cleaved vs. Native Antithrombin-Treated HUVECs Gene Fold Changes Gene Symbol Gene Description Cluster ID (ATC/ATN) Adhesion/ECM ARGN Agrin Hs.273330 2.18 CDH24 Caderhrin-like
    [Show full text]
  • Molecular Signatures of Membrane Protein Complexes Underlying Muscular Dystrophy*□S
    crossmark Research Author’s Choice © 2016 by The American Society for Biochemistry and Molecular Biology, Inc. This paper is available on line at http://www.mcponline.org Molecular Signatures of Membrane Protein Complexes Underlying Muscular Dystrophy*□S Rolf Turk‡§¶ʈ**, Jordy J. Hsiao¶, Melinda M. Smits¶, Brandon H. Ng¶, Tyler C. Pospisil‡§¶ʈ**, Kayla S. Jones‡§¶ʈ**, Kevin P. Campbell‡§¶ʈ**, and Michael E. Wright¶‡‡ Mutations in genes encoding components of the sar- The muscular dystrophies are hereditary diseases charac- colemmal dystrophin-glycoprotein complex (DGC) are re- terized primarily by the progressive degeneration and weak- sponsible for a large number of muscular dystrophies. As ness of skeletal muscle. Most are caused by deficiencies in such, molecular dissection of the DGC is expected to both proteins associated with the cell membrane (i.e. the sarco- reveal pathological mechanisms, and provides a biologi- lemma in skeletal muscle), and typical features include insta- cal framework for validating new DGC components. Es- bility of the sarcolemma and consequent death of the myofi- tablishment of the molecular composition of plasma- ber (1). membrane protein complexes has been hampered by a One class of muscular dystrophies is caused by mutations lack of suitable biochemical approaches. Here we present in genes that encode components of the sarcolemmal dys- an analytical workflow based upon the principles of pro- tein correlation profiling that has enabled us to model the trophin-glycoprotein complex (DGC). In differentiated skeletal molecular composition of the DGC in mouse skeletal mus- muscle, this structure links the extracellular matrix to the cle. We also report our analysis of protein complexes in intracellular cytoskeleton.
    [Show full text]
  • SNP Gene Chr* Region P Value Odd Ratios Minor Allele Major Allele Rs11184708 PRMT6 1 Upstream 6.447× 10−13 6.149 T a Rs108025
    Supplementary Table S1. Detailed information on scrub typhus-related candidate SNPs with a p value < 1 × 10−4. Odd Minor Major SNP Gene Chr* Region p value Ratios Allele Allele rs11184708 PRMT6 1 upstream 6.447× 10−13 6.149 T A rs10802595 RYR2 1 intron 0.00008738 2.593 A G downstream, intron, rs401974 LINC00276,LOC100506474 2 0.0000769 0.3921 T C upstream rs1445126 MIR4757,NT5C1B 2 upstream 0.00004819 3.18 A G LOC101930107,MIR4435-1,PLGLB rs62140478 2 downstream, upstream 7.404 × 10−8 9.708 T C 2 rs35890165 CPS1,ERBB4 2 downstream 0.00003952 0.373 A G rs34599430 ZNF385D,ZNF385D-AS2 3 intron, upstream 0.00002317 2.767 G A rs6809058 RBMS3,TGFBR2 3 downstream, upstream 0.00002507 3.094 G A rs3773683 SIDT1 3 intron 0.00006635 0.3543 C T rs11727383 CRMP1,EVC 4 intron 0.0000803 0.3459 A G rs17338338 NUDT12,RAB9BP1 5 upstream 0.00006987 0.3746 G A rs2059950 DTWD2,LOC102467225 5 downstream 0.000008739 2.911 G A rs72663337 DTWD2,LOC102467225 5 downstream 0.00009856 2.566 T C rs6882516 LSM11 5 UTR-3 0.00007553 2.968 A C rs76949230 TENM2 5 intron 0.00006305 3.048 G C rs3804468 LY86,LY86-AS1 6 intron 0.00003155 0.202 C T rs3778337 DSP 6 exon,intron 0.00007311 0.3897 G A rs16883596 MAP3K7,MIR4643 6 upstream 0.00005186 4.274 A G rs35144103 CCT6P3,ZNF92 7 downstream, upstream 0.00004885 3.422 A G rs13244090 LOC407835,TPI1P2 7 downstream, upstream 0.00004505 2.638 G A rs17167553 LRGUK 7 missense 0.00008788 2.75 T G rs6583826 IDE,KIF11 10 upstream 0.00006894 0.2846 G A rs10769111 LOC221122,PRDM11 11 downstream, upstream 0.0000619 0.3816 T G rs10848921
    [Show full text]
  • Targeting the Hsp90-Cdc37-Client Protein Interaction to Disrupt Hsp90 Chaperone Machinery Ting Li1, Hu-Lin Jiang2, Yun-Guang Tong3,4 and Jin-Jian Lu1*
    Li et al. Journal of Hematology & Oncology (2018) 11:59 https://doi.org/10.1186/s13045-018-0602-8 REVIEW Open Access Targeting the Hsp90-Cdc37-client protein interaction to disrupt Hsp90 chaperone machinery Ting Li1, Hu-Lin Jiang2, Yun-Guang Tong3,4 and Jin-Jian Lu1* Abstract Heat shock protein 90 (Hsp90) is a critical molecular chaperone protein that regulates the folding, maturation, and stability of a wide variety of proteins. In recent years, the development of Hsp90-directed inhibitors has grown rapidly, and many of these inhibitors have entered clinical trials. In parallel, the functional dissection of the Hsp90 chaperone machinery has highlighted the activity disruption of Hsp90 co-chaperone as a potential target. With the roles of Hsp90 co-chaperones being elucidated, cell division cycle 37 (Cdc37), a ubiquitous co-chaperone of Hsp90 that directs the selective client proteins into the Hsp90 chaperone cycle, shows great promise. Moreover, the Hsp90-Cdc37-client interaction contributes to the regulation of cellular response and cellular growth and is more essential to tumor tissues than normal tissues. Herein, we discuss the current understanding of the clients of Hsp90-Cdc37, the interaction of Hsp90-Cdc37-client protein, and the therapeutic possibilities of targeting Hsp90-Cdc37-client protein interaction as a strategy to inhibit Hsp90 chaperone machinery to present new insights on alternative ways of inhibiting Hsp90 chaperone machinery. Keywords: Hsp90 chaperone machinery, Cdc37, Kinase client, Protein interaction Background chloroplast HSP90C, mitochondrial TNFR-associated protein, Heat shock protein 90 (Hsp90) is a critically conserved and bacterial high-temperature protein G [2, 8]. In this protein and one of the major molecular chaperones within review,weusethetermHsp90torefertotheseHsp90 eukaryotic cells [1].
    [Show full text]
  • Gene Symbol Accession Alias/Prev Symbol Official Full Name AAK1 NM 014911.2 KIAA1048, Dkfzp686k16132 AP2 Associated Kinase 1
    Gene Symbol Accession Alias/Prev Symbol Official Full Name AAK1 NM_014911.2 KIAA1048, DKFZp686K16132 AP2 associated kinase 1 (AAK1) AATK NM_001080395.2 AATYK, AATYK1, KIAA0641, LMR1, LMTK1, p35BP apoptosis-associated tyrosine kinase (AATK) ABL1 NM_007313.2 ABL, JTK7, c-ABL, p150 v-abl Abelson murine leukemia viral oncogene homolog 1 (ABL1) ABL2 NM_007314.3 ABLL, ARG v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) (ABL2) ACVR1 NM_001105.2 ACVRLK2, SKR1, ALK2, ACVR1A activin A receptor ACVR1B NM_004302.3 ACVRLK4, ALK4, SKR2, ActRIB activin A receptor, type IB (ACVR1B) ACVR1C NM_145259.2 ACVRLK7, ALK7 activin A receptor, type IC (ACVR1C) ACVR2A NM_001616.3 ACVR2, ACTRII activin A receptor ACVR2B NM_001106.2 ActR-IIB activin A receptor ACVRL1 NM_000020.1 ACVRLK1, ORW2, HHT2, ALK1, HHT activin A receptor type II-like 1 (ACVRL1) ADCK1 NM_020421.2 FLJ39600 aarF domain containing kinase 1 (ADCK1) ADCK2 NM_052853.3 MGC20727 aarF domain containing kinase 2 (ADCK2) ADCK3 NM_020247.3 CABC1, COQ8, SCAR9 chaperone, ABC1 activity of bc1 complex like (S. pombe) (CABC1) ADCK4 NM_024876.3 aarF domain containing kinase 4 (ADCK4) ADCK5 NM_174922.3 FLJ35454 aarF domain containing kinase 5 (ADCK5) ADRBK1 NM_001619.2 GRK2, BARK1 adrenergic, beta, receptor kinase 1 (ADRBK1) ADRBK2 NM_005160.2 GRK3, BARK2 adrenergic, beta, receptor kinase 2 (ADRBK2) AKT1 NM_001014431.1 RAC, PKB, PRKBA, AKT v-akt murine thymoma viral oncogene homolog 1 (AKT1) AKT2 NM_001626.2 v-akt murine thymoma viral oncogene homolog 2 (AKT2) AKT3 NM_181690.1
    [Show full text]
  • A Meta-Learning Approach for Genomic Survival Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.21.053918; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. A meta-learning approach for genomic survival analysis Yeping Lina Qiu1;2, Hong Zheng2, Arnout Devos3, Olivier Gevaert2;4;∗ 1Department of Electrical Engineering, Stanford University 2Stanford Center for Biomedical Informatics Research, Department of Medicine, Stanford University 3School of Computer and Communication Sciences, Swiss Federal Institute of Technology Lausanne (EPFL) 4Department of Biomedical Data Science, Stanford University ∗To whom correspondence should be addressed: [email protected] Abstract RNA sequencing has emerged as a promising approach in cancer prognosis as sequencing data becomes more easily and affordably accessible. However, it remains challenging to build good predictive models especially when the sample size is limited and the number of features is high, which is a common situation in biomedical settings. To address these limitations, we propose a meta-learning framework based on neural networks for survival analysis and evaluate it in a genomic cancer research setting. We demonstrate that, compared to regular transfer- learning, meta-learning is a significantly more effective paradigm to leverage high-dimensional data that is relevant but not directly related to the problem of interest. Specifically, meta-learning explicitly constructs a model, from abundant data of relevant tasks, to learn a new task with few samples effectively. For the application of predicting cancer survival outcome, we also show that the meta- learning framework with a few samples is able to achieve competitive performance with learning from scratch with a significantly larger number of samples.
    [Show full text]
  • Mitogen Activated Protein Kinase (MAPK) Pathway Mutations and Drug Resistance
    Author Manuscript Published OnlineFirst on February 13, 2013; DOI: 10.1158/1078-0432.CCR-12-0383 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Molecular Pathways: Mitogen Activated Protein Kinase (MAPK) Pathway Mutations and Drug Resistance Antonia L. Pritchard 1 and Nicholas K. Hayward 1* 1. Oncogenomics Research Group, CBCRC Building, Queensland Institute of Medical Research, 300 Herston Road, Herston, Brisbane, QLD 4006, Australia *Corresponding Author: Nicholas K. Hayward Oncogenomics Research Group, Queensland Institute of Medical Research, 300 Herston Road, Herston, Brisbane, QLD 4006, Australia [email protected] Conflict of Interest Statement: No relationship that could be construed as resulting in an actual, potential, or perceived conflict of interest are declared by either Dr. Pritchard or Prof. Hayward. Word counts: Abstract: 243 Background + Clinical translational advances: 3320 Number of References: 98 Downloaded from clincancerres.aacrjournals.org on October 6, 2021. © 2013 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 13, 2013; DOI: 10.1158/1078-0432.CCR-12-0383 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. ABSTRACT Receptor tyrosine kinases are a diverse family of transmembrane proteins that can activate multiple pathways upon ligation of the receptor, one of which is the series of mitogen- activated protein kinase (MAPK) signalling cascades. The MAPK pathways play critical roles in a wide variety of cancer types, from haematological malignancies, to solid tumours. Aberrations include altered expression levels and activation states of pathway components, which can sometimes be attributable to mutations in individual members.
    [Show full text]
  • Kinase Domain Activation Through Gene Rearrangement in Multiple Myeloma
    Leukemia (2018) 32:2435–2444 https://doi.org/10.1038/s41375-018-0108-y ARTICLE Multiple myeloma, gammopathies Kinase domain activation through gene rearrangement in multiple myeloma 1 2 1 1 1 2 Gareth J Morgan ● Jie He ● Ruslana Tytarenko ● Purvi Patel ● Owen W Stephens ● Shan Zhong ● 1 1 1 1 1 2 2 Shayu Deshpande ● Michael Bauer ● Niels Weinhold ● Carolina Schinke ● Leo Rasche ● Mark Bailey ● Siraj Ali ● 2,3 2 2 1 1 1 Jeff Ross ● Vincent A Miller ● Phillip Stephens ● Sharmilan Thanendrarajan ● Maurizio Zangari ● Frits van Rhee ● 2,4 1 1 Tariq Mughal ● Faith E Davies ● Brian A Walker Received: 3 January 2018 / Revised: 8 February 2018 / Accepted: 2 March 2018 / Published online: 23 March 2018 © The Author(s) 2018. This article is published with open access Abstract Chromosomal rearrangements that result in oncogenic kinase activation are present in many solid and hematological malignancies, but none have been reported in multiple myeloma (MM). Here we analyzed 1421 samples from 958 myeloma patients using a targeted assay and detected fusion genes in 1.5% of patients. These fusion genes were in-frame and the majority of them contained kinase domains from either receptor tyrosine kinases (ALK, ROS1, NTRK3, and FGFR1)or cytoplasmic kinases (BRAF, MAP3K14, and MAPK14), which would result in the activation of MEK/ERK, NF-κB, or 1234567890();,: 1234567890();,: inflammatory signaling pathways. Fusion genes were present in smoldering MM, newly diagnosed MM, and relapse patient samples indicating they are not solely late events. Most fusion genes were subclonal in nature, but one EML4-ALK fusion was clonal indicating it is a driver of disease pathogenesis.
    [Show full text]