DOCSLIB.ORG

Map3k14 As a Regulator of Innate and Adaptive Immune Response During Acute Viral Infection

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Map3k14 As a Regulator of Innate and Adaptive Immune Response During Acute Viral Infection pathogens Article Map3k14 as a Regulator of Innate and Adaptive Immune Response during Acute Viral Infection Thamer A. Hamdan 1,*, Hilal Bhat 1, Lamin B. Cham 1 , Tom Adomati 1, Judith Lang 1 , 1 1 1 2 1,3, , Fanghui Li , Ali Murtaza , Cornelia Hardt , Philipp A. Lang , Vikas Duhan * y and 1, Karl S. Lang y 1 Institute of Immunology, Medical Faculty, University of Duisburg-Essen, Hufelandstraße 55, 45147 Essen, Germany; [email protected] (H.B.); [email protected] (L.B.C.); [email protected] (T.A.); [email protected] (J.L.); [email protected] (F.L.); [email protected] (A.M.); [email protected] (C.H.); [email protected] (K.S.L.) 2 Department of Molecular Medicine II, Medical Faculty, Heinrich Heine University, Universitätsstrasse 1, 40225 Düsseldorf, Germany; [email protected] 3 Immunology in Cancer and Infection Laboratory, QIMR Berghofer Medical Research Institute, Herston, QLD 4006, Australia * Correspondence: [email protected] (T.A.H.); [email protected] (V.D.) These authors jointly supervised this work. y Received: 6 December 2019; Accepted: 31 January 2020; Published: 4 February 2020 Abstract: The replication of virus in secondary lymphoid organs is crucial for the activation of antigen-presenting cells. Balanced viral replication ensures the sufficient availability of antigens and production of cytokines, and both of which are needed for virus-specific immune activation and viral elimination. Host factors that regulate coordinated viral replication are not fully understood. In the study reported here, we identified Map3k14 as an important regulator of enforced viral replication in the spleen while performing genome-wide association studies of various inbred mouse lines in a model of lymphocytic choriomeningitis virus (LCMV) infection. When alymphoplasia mice (aly/aly, Map3k14aly/aly, or Nikaly/aly), which carry a mutation in Map3k14, were infected with LCMV or vesicular stomatitis virus (VSV), they display early reductions in early viral replication in the spleen, reduced innate and adaptive immune activation, and lack of viral control. Histologically, scant B cells and the lack of CD169+ macrophages correlated with reduced immune activation in Map3k14aly/aly mice. The transfer of wildtype B cells into Map3k14aly/aly mice repopulated CD169+ macrophages, restored enforced viral replication, and resulted in enhanced immune activation and faster viral control. Keywords: viral infection; lymphocytic choriomeningitis virus; vesicular stomatitis virus; genome-wide association study; Alymphoplasia mice; marginal zone 1. Introduction The spleen is a highly organized lymphoid organ that harbors a discrete population of immune cells with versatile functions [1]. Microanatomically, the spleen is composed of two distinct compartments, the red pulp and the white pulp, which are separated by a specialized interface, called the marginal zone (MZ) in rodents and the perifollicular zone in humans [2]. The red pulp zone plays a crucial role in filtering the blood, recycling iron and producing antibodies from plasmablasts and plasma cells. The white pulp zone contains B- and T-cell compartments as sheaths. Between these compartments, the MZ mainly contains B cells and macrophages [3]. Marrginal zone B cells (MZ B) cells are described as innate-like lymphocytes, because they can generate an antibody response against commensal and foreign pathogens much more rapidly than Pathogens 2020, 9, 96; doi:10.3390/pathogens9020096 www.mdpi.com/journal/pathogens Pathogens 2020, 9, 96 2 of 16 follicular B cells. MZ B cells can mount T cell dependent and independent antigens, and they express non-mutated immunoglobulin-variable (IgV) genes, some of which encode B-cell receptors (BCRs). MZ B cells are professional antigen (Ag)-presenting cells (APCs) that can present Ag to activate naïve CD4+ T cells after reactivity [4–7]. Being strategically located in the marginal interface, the marginal zone macrophages (MZMs) and marginal metallophilic macrophages (MMMs) are key components during type I interferon (IFN-I)–mediated containment of the virus after phagocytosis, which results in viral clearance. Nevertheless, these cells can prime the adaptive immune response by presenting the antigens directly to B cells [8] or by capturing the antigen via resident dendritic cells (DCs) from the conduits that connect the MZ and the white pulp, culminating in presenting these antigens to T cells [9,10]. These macrophages play a prominent role in protection against fulminant infection with vesicular stomatitis virus (VSV) or lymphocytic choriomeningitis virus (LCMV) [11]. For instance, the ablation of MZMs by clodronate leads to the dissemination of virus to the peripheral organs and to T-cell exhaustion during LCMV infection [12]. Similarly, mice that are devoid of MZMs are highly prone to VSV infection [13]. Moreover, studies using MZM-depleted mice showed that MZMs contribute in controlling Listeria monocytogenes infections [11]. Maintaining intact splenic architecture is important in guaranteeing immune surveillance. The orchestration between B cells and MZMs is crucial for the architecture and quality of the MZ [14]. For example, the absence of B cells results in the ablation of MMMs and MZMs [15]. Another study showed that the integrity and function of organized MZ critically depend on the existence of B cells, as documented in studies using CD70TG mice, in which the B cells were steadily depleted because the high expression of the tumor necrosis factor (TNF) family member CD70, and subsequent loss of splenic marginal zone [16]. On the other hand, the disruption of Src homology 2–containing inositol 5-phosphatase (SHIP) in myeloid cells demonstrates that MZMs are necessary for the retention and trafficking of MZ Bs [14,17]. A mouse strain called alymphoplasia (aly/aly) mice, mitogen-activated protein kinase 14 (Map3k14aly/aly) mice, or NF-κB–inducing kinase (NIKaly/aly) mice is defined by the complete absence of lymph nodes (LN) and Peyer’s patches (PP). These mice have no MZ and they exhibit disorganized splenic and thymic architecture and, thus, immune intolerance against viral infections. The atrophic lymphoid structure in these murine models is caused by an autosomal recessive point mutation in the aly locus situated on chromosome 11, which encodes Nik. Nik is a key mediator of Nf-κB activation by the TNF receptor family and it is essential in the development and maintenance of B cells. Nik interacts with the TNF receptor–associated factor (TRAF) family of proteins and its downstream molecules, such as lymphotoxin-β receptor (Ltβr) and CD40 [18–22]. We implemented a genome-wide association study (GWAS) of inbred mouse strains to determine the mechanisms that regulate early viral replication in the spleen. We found that Map3k14 is a key mediator of immune surveillance during viral infection, as it promotes the immune activation, which is dependent on viral replication in the spleen. Map3k14aly/aly mice showed limited early replication of LCMV and VSV and had a blunted innate and adaptive immune activation. We attributed the underlying mechanism to the deficiency of marginal zone B cells, which are prominent regulators of the integrity of lymphoid organ architecture, with the help of transfer experiments and generation of bone marrow chimeric mice. 2. Results 2.1. Genome-Wide Association Study Shows That Map3k14 Is a Regulator of Viral Replication in the Spleen We executed genome-wide association study (GWAS) using different inbred mouse lines which have genetic variations due to single nucleotide polymorphisms (SNPs) present in introns and exons of various genes to gain insight about the novel host factors that determine immune activation during virus infection [23]. We infected these inbred mouse lines with lymphocytic choriomeningitis virus Pathogens 2020, 9, 96 3 of 16 (LCMV) and determined the early viral titers in the spleen after three days. We observed remarkable differences in the virus replication between the tested mouse lines (Figure1A). Next, we correlated the biological response (viral titers) and genotype (SNPs) for these mouse lines while using efficient mixed-model association (EMMA), as described previously [24,25]. EMMA analysis revealed the SNP mm37-11-103083091 at position 11:103,089.4k in mitogen-activated protein kinase 14 (Map3k14) gene Pathogens 2020, 9, x FOR PEER REVIEW 4 of 17 as one of the top rank candidates among all of the SNPs (Figure1B,C). Figure 1. Inbred mouse strains infected intravenously (i.v) with 200 plaque-forming units (PFU) of Figure 1. Inbred mouse strains infected intravenously (i.v) with 200 plaque-forming units (PFU) of lymphocytic choriomeningitis virus (LCMV) strain WE. (A) Viral titers in spleen three days after infection (n = 5–8 per group, pooled from two independent experiments). (B) Manhattan plot showing the distribution of single-nucleotide polymorphisms (SNPs) on each chromosome (x-axis) and the Pathogens 2020, 9, 96 4 of 16 lymphocytic choriomeningitis virus (LCMV) strain WE. (A) Viral titers in spleen three days after infection (n = 5–8 per group, pooled from two independent experiments). (B) Manhattan plot showing the distribution of single-nucleotide polymorphisms (SNPs) on each chromosome (x-axis) and the associated P values (y-axis) as determined by enhanced mismatch mutation analysis (EMMA) analysis based on the viral titers in spleens from tested inbred mouse strains. (C) Shown is the distribution of SNPs in chromosome 11. (D) Map3k14aly/+ mice and Map3k14aly/aly mice were infected with 2 106 PFU × of LCMV strain WE and were killed 24 hours after infection (n = 5 per group). Right panel: representative immunofluorescence of spleen histologic sections from the mouse groups and stained for LCMV (green), CD169+ cells (red), and F4/80 antibodies (blue). Each image is representative of images from 5 mice per group. Scale bar, 200 µm. Left panel: viral titers in spleen after LCMV infection. (E) Left panel: viral titers in the spleen of WT mice and Map3k14aly/aly mice that were infected with 2 107 PFU of × vesicular stomatitis virus (VSV) and killed seven hours (h) after infection (n = 4 per group).
Load more

Recommended publications
  • Significant Shortest Paths for the Detection of Putative Disease Modules
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.01.019844; this version posted April 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. SIGNIFICANT SHORTEST PATHS FOR THE DETECTION OF PUTATIVE DISEASE MODULES Daniele Pepe1 1Department of Oncology, KU Leuven, LKI–Leuven Cancer Institute, Leuven, Belgium Email address: DP: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.04.01.019844; this version posted April 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Keywords Structural equation modeling, significant shortest paths, pathway analysis, disease modules. Abstract Background The characterization of diseases in terms of perturbated gene modules was recently introduced for the analysis of gene expression data. Some approaches were proposed in literature, but many times they are inductive approaches. This means that starting directly from data, they try to infer key gene networks potentially associated to the biological phenomenon studied. However they ignore the biological information already available to characterize the gene modules. Here we propose the detection of perturbed gene modules using the combination of data driven and hypothesis-driven approaches relying on biological metabolic pathways and significant shortest paths tested by structural equation modeling.
    [Show full text]
  • Interactions Between the Parasite Philasterides Dicentrarchi and the Immune System of the Turbot Scophthalmus Maximus.A Transcriptomic Analysis
    biology Article Interactions between the Parasite Philasterides dicentrarchi and the Immune System of the Turbot Scophthalmus maximus.A Transcriptomic Analysis Alejandra Valle 1 , José Manuel Leiro 2 , Patricia Pereiro 3 , Antonio Figueras 3 , Beatriz Novoa 3, Ron P. H. Dirks 4 and Jesús Lamas 1,* 1 Department of Fundamental Biology, Institute of Aquaculture, Campus Vida, University of Santiago de Compostela, 15782 Santiago de Compostela, Spain; [email protected] 2 Department of Microbiology and Parasitology, Laboratory of Parasitology, Institute of Research on Chemical and Biological Analysis, Campus Vida, University of Santiago de Compostela, 15782 Santiago de Compostela, Spain; [email protected] 3 Institute of Marine Research, Consejo Superior de Investigaciones Científicas-CSIC, 36208 Vigo, Spain; [email protected] (P.P.); antoniofi[email protected] (A.F.); [email protected] (B.N.) 4 Future Genomics Technologies, Leiden BioScience Park, 2333 BE Leiden, The Netherlands; [email protected] * Correspondence: [email protected]; Tel.: +34-88-181-6951; Fax: +34-88-159-6904 Received: 4 September 2020; Accepted: 14 October 2020; Published: 15 October 2020 Simple Summary: Philasterides dicentrarchi is a free-living ciliate that causes high mortality in marine cultured fish, particularly flatfish, and in fish kept in aquaria. At present, there is still no clear picture of what makes this ciliate a fish pathogen and what makes fish resistant to this ciliate. In the present study, we used transcriptomic techniques to evaluate the interactions between P. dicentrarchi and turbot leucocytes during the early stages of infection. The findings enabled us to identify some parasite genes/proteins that may be involved in virulence and host resistance, some of which may be good candidates for inclusion in fish vaccines.
    [Show full text]
  • Modulation of NF-Κb Signalling by Microbial Pathogens
    REVIEWS Modulation of NF‑κB signalling by microbial pathogens Masmudur M. Rahman and Grant McFadden Abstract | The nuclear factor-κB (NF‑κB) family of transcription factors plays a central part in the host response to infection by microbial pathogens, by orchestrating the innate and acquired host immune responses. The NF‑κB proteins are activated by diverse signalling pathways that originate from many different cellular receptors and sensors. Many successful pathogens have acquired sophisticated mechanisms to regulate the NF‑κB signalling pathways by deploying subversive proteins or hijacking the host signalling molecules. Here, we describe the mechanisms by which viruses and bacteria micromanage the host NF‑κB signalling circuitry to favour the continued survival of the pathogen. The nuclear factor-κB (NF-κB) family of transcription Signalling targets upstream of NF‑κB factors regulates the expression of hundreds of genes that NF-κB proteins are tightly regulated in both the cyto- are associated with diverse cellular processes, such as pro- plasm and the nucleus6. Under normal physiological liferation, differentiation and death, as well as innate and conditions, NF‑κB complexes remain inactive in the adaptive immune responses. The mammalian NF‑κB cytoplasm through a direct interaction with proteins proteins are members of the Rel domain-containing pro- of the inhibitor of NF-κB (IκB) family, including IκBα, tein family: RELA (also known as p65), RELB, c‑REL, IκBβ and IκBε (also known as NF-κBIα, NF-κBIβ and the NF-κB p105 subunit (also known as NF‑κB1; which NF-κBIε, respectively); IκB proteins mask the nuclear is cleaved into the p50 subunit) and the NF-κB p100 localization domains in the NF‑κB complex, thus subunit (also known as NF‑κB2; which is cleaved into retaining the transcription complex in the cytoplasm.
    [Show full text]
  • Differential and Overlapping Immune Programs Regulated by IRF3 and IRF5 in Plasmacytoid Dendritic Cells
    Differential and Overlapping Immune Programs Regulated by IRF3 and IRF5 in Plasmacytoid Dendritic Cells This information is current as Kwan T. Chow, Courtney Wilkins, Miwako Narita, Richard of September 28, 2021. Green, Megan Knoll, Yueh-Ming Loo and Michael Gale, Jr. J Immunol published online 8 October 2018 http://www.jimmunol.org/content/early/2018/10/05/jimmun ol.1800221 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2018/10/05/jimmunol.180022 Material 1.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2018 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published October 8, 2018, doi:10.4049/jimmunol.1800221 The Journal of Immunology Differential and Overlapping Immune Programs Regulated by IRF3 and IRF5 in Plasmacytoid Dendritic Cells Kwan T. Chow,*,† Courtney Wilkins,* Miwako Narita,‡ Richard Green,* Megan Knoll,* Yueh-Ming Loo,* and Michael Gale, Jr.* We examined the signaling pathways and cell type–specific responses of IFN regulatory factor (IRF) 5, an immune-regulatory transcription factor.
    [Show full text]
  • Table 1 the Primers Sequences Used for Real-Time Quantitative RT-PCR
    Table 1 The Primers Sequences used for Real-Time quantitative RT-PCR Analysis Gene symbol Sense Primer Antisense Primer Size (bp) p21WAF1/Cip1 CTTTGACTTCGTCACGGAGAC AGGCAGCGTATATCAGGAGAC 150 Max CGAAAACGTAGGGACCACAT TGCTGGTGTGTGGTTTTT 200 APC GATGAAATAGGATGTAATCAGACGAC GCTAAACATGAGTGGGGTCTC 350 BCL-2 CAGCTGCACCTGACG ATGCACCTACCCAGC 320 p53 GGAGGTTGTGAGGCGCTGG CACGCACCTCAAAGCTGTTC 330 Bax TGCAGAGGATGATTGCTGAC GAGGACTCCAGCCACAAAGA 270 Syndecan-1 TCTGACTCGGTTTCTCCAA ATTGCTGTCTCCCGACCAA 360 Syndecan-3 TTTGGGGCAGACCCCACTA ATCCCTAAACCCTGAACCT 550 Perlecan ACAGTGCAACAAGTGCAAGG CTGAAAGTGACCAGGCTCCTC 450 Vitronectin ACTTCTTCAAGGGGAAACAG TATGGCTGCGTCCACTTTG 400 PCAF TTTTTTTAATCCAGCTTCC AAGAAACAGGGTTTCTCCAAG 750 APO1A CAAGAACGGCGGCGCCAGA GCTCTCCAGCACGGGCAGGCA 220 β-Actin CCTTCTACAATGAGC ACGTCACACTTCATG 260 EGR-1 GCCAAACAGTCACTTTGTT GAAAGTGTTTTTTCTTCGTCG 400 MAPK3 ACCTGCGACCTTAAGATTTGT GAAAAGCTTGGCCCAAGCC 300 TIMP-1 CCCTGATGACGAGGTCGGAA AGATCCAGCGCCCAGAGAGA 220 Caspase-3 ATGGAGAACACTGAAAACTCA TTAGTGATAAAAATAGAGTTC 200 TIMP-3 CCCCATGTGCAGTACATCCA GCACAGCCCCGTGTACATCT 180 Biglycan GATGGCCTGAAGCTCAA GGTTTGTTGAAGAGGCTG 460 Stat3 TTTCTCTATTTTTAAAAGTGC AAGTATTGTCGGCCAGAGAGC 460 TIMP2 CAAGAGGATCCAGTATGAGAT GCCCGTGTAGATAAACTCTAT 570 CCRK ACCTGCAGATGCTGCTCAAG GAAATGAACCCAACAAACCA 200 GAPDH CCACCCATGGCAAATTCCATGGGA TCTAGACGGCAGGTCAGGTCCACC 500 Table 2. Genes with Altered Expression in Cleaved vs. Native Antithrombin-Treated HUVECs Gene Fold Changes Gene Symbol Gene Description Cluster ID (ATC/ATN) Adhesion/ECM ARGN Agrin Hs.273330 2.18 CDH24 Caderhrin-like
    [Show full text]
  • Molecular Signatures of Membrane Protein Complexes Underlying Muscular Dystrophy*□S
    crossmark Research Author’s Choice © 2016 by The American Society for Biochemistry and Molecular Biology, Inc. This paper is available on line at http://www.mcponline.org Molecular Signatures of Membrane Protein Complexes Underlying Muscular Dystrophy*□S Rolf Turk‡§¶ʈ**, Jordy J. Hsiao¶, Melinda M. Smits¶, Brandon H. Ng¶, Tyler C. Pospisil‡§¶ʈ**, Kayla S. Jones‡§¶ʈ**, Kevin P. Campbell‡§¶ʈ**, and Michael E. Wright¶‡‡ Mutations in genes encoding components of the sar- The muscular dystrophies are hereditary diseases charac- colemmal dystrophin-glycoprotein complex (DGC) are re- terized primarily by the progressive degeneration and weak- sponsible for a large number of muscular dystrophies. As ness of skeletal muscle. Most are caused by deficiencies in such, molecular dissection of the DGC is expected to both proteins associated with the cell membrane (i.e. the sarco- reveal pathological mechanisms, and provides a biologi- lemma in skeletal muscle), and typical features include insta- cal framework for validating new DGC components. Es- bility of the sarcolemma and consequent death of the myofi- tablishment of the molecular composition of plasma- ber (1). membrane protein complexes has been hampered by a One class of muscular dystrophies is caused by mutations lack of suitable biochemical approaches. Here we present in genes that encode components of the sarcolemmal dys- an analytical workflow based upon the principles of pro- tein correlation profiling that has enabled us to model the trophin-glycoprotein complex (DGC). In differentiated skeletal molecular composition of the DGC in mouse skeletal mus- muscle, this structure links the extracellular matrix to the cle. We also report our analysis of protein complexes in intracellular cytoskeleton.
    [Show full text]
  • SNP Gene Chr* Region P Value Odd Ratios Minor Allele Major Allele Rs11184708 PRMT6 1 Upstream 6.447× 10−13 6.149 T a Rs108025
    Supplementary Table S1. Detailed information on scrub typhus-related candidate SNPs with a p value < 1 × 10−4. Odd Minor Major SNP Gene Chr* Region p value Ratios Allele Allele rs11184708 PRMT6 1 upstream 6.447× 10−13 6.149 T A rs10802595 RYR2 1 intron 0.00008738 2.593 A G downstream, intron, rs401974 LINC00276,LOC100506474 2 0.0000769 0.3921 T C upstream rs1445126 MIR4757,NT5C1B 2 upstream 0.00004819 3.18 A G LOC101930107,MIR4435-1,PLGLB rs62140478 2 downstream, upstream 7.404 × 10−8 9.708 T C 2 rs35890165 CPS1,ERBB4 2 downstream 0.00003952 0.373 A G rs34599430 ZNF385D,ZNF385D-AS2 3 intron, upstream 0.00002317 2.767 G A rs6809058 RBMS3,TGFBR2 3 downstream, upstream 0.00002507 3.094 G A rs3773683 SIDT1 3 intron 0.00006635 0.3543 C T rs11727383 CRMP1,EVC 4 intron 0.0000803 0.3459 A G rs17338338 NUDT12,RAB9BP1 5 upstream 0.00006987 0.3746 G A rs2059950 DTWD2,LOC102467225 5 downstream 0.000008739 2.911 G A rs72663337 DTWD2,LOC102467225 5 downstream 0.00009856 2.566 T C rs6882516 LSM11 5 UTR-3 0.00007553 2.968 A C rs76949230 TENM2 5 intron 0.00006305 3.048 G C rs3804468 LY86,LY86-AS1 6 intron 0.00003155 0.202 C T rs3778337 DSP 6 exon,intron 0.00007311 0.3897 G A rs16883596 MAP3K7,MIR4643 6 upstream 0.00005186 4.274 A G rs35144103 CCT6P3,ZNF92 7 downstream, upstream 0.00004885 3.422 A G rs13244090 LOC407835,TPI1P2 7 downstream, upstream 0.00004505 2.638 G A rs17167553 LRGUK 7 missense 0.00008788 2.75 T G rs6583826 IDE,KIF11 10 upstream 0.00006894 0.2846 G A rs10769111 LOC221122,PRDM11 11 downstream, upstream 0.0000619 0.3816 T G rs10848921
    [Show full text]
  • Targeting the Hsp90-Cdc37-Client Protein Interaction to Disrupt Hsp90 Chaperone Machinery Ting Li1, Hu-Lin Jiang2, Yun-Guang Tong3,4 and Jin-Jian Lu1*
    Li et al. Journal of Hematology & Oncology (2018) 11:59 https://doi.org/10.1186/s13045-018-0602-8 REVIEW Open Access Targeting the Hsp90-Cdc37-client protein interaction to disrupt Hsp90 chaperone machinery Ting Li1, Hu-Lin Jiang2, Yun-Guang Tong3,4 and Jin-Jian Lu1* Abstract Heat shock protein 90 (Hsp90) is a critical molecular chaperone protein that regulates the folding, maturation, and stability of a wide variety of proteins. In recent years, the development of Hsp90-directed inhibitors has grown rapidly, and many of these inhibitors have entered clinical trials. In parallel, the functional dissection of the Hsp90 chaperone machinery has highlighted the activity disruption of Hsp90 co-chaperone as a potential target. With the roles of Hsp90 co-chaperones being elucidated, cell division cycle 37 (Cdc37), a ubiquitous co-chaperone of Hsp90 that directs the selective client proteins into the Hsp90 chaperone cycle, shows great promise. Moreover, the Hsp90-Cdc37-client interaction contributes to the regulation of cellular response and cellular growth and is more essential to tumor tissues than normal tissues. Herein, we discuss the current understanding of the clients of Hsp90-Cdc37, the interaction of Hsp90-Cdc37-client protein, and the therapeutic possibilities of targeting Hsp90-Cdc37-client protein interaction as a strategy to inhibit Hsp90 chaperone machinery to present new insights on alternative ways of inhibiting Hsp90 chaperone machinery. Keywords: Hsp90 chaperone machinery, Cdc37, Kinase client, Protein interaction Background chloroplast HSP90C, mitochondrial TNFR-associated protein, Heat shock protein 90 (Hsp90) is a critically conserved and bacterial high-temperature protein G [2, 8]. In this protein and one of the major molecular chaperones within review,weusethetermHsp90torefertotheseHsp90 eukaryotic cells [1].
    [Show full text]
  • Risk of Ovarian Cancer and the NF-Kb Pathway: Genetic Association with IL1A and TNFSF10
    Published OnlineFirst November 22, 2013; DOI: 10.1158/0008-5472.CAN-13-1051 Cancer Prevention and Epidemiology Research Risk of Ovarian Cancer and the NF-kB Pathway: Genetic Association with IL1A and TNFSF10 Bridget Charbonneau1, Matthew S. Block2, William R. Bamlet3, Robert A. Vierkant3, Kimberly R. Kalli2, Zachary Fogarty3, David N. Rider3, Thomas A. Sellers6, Shelley S. Tworoger7,9, Elizabeth Poole7,9, Harvey A. Risch10, Helga B. Salvesen11,12, Lambertus A. Kiemeney14,15,17, Laura Baglietto18,19, Graham G. Giles18,19,22, Gianluca Severi18,19, Britton Trabert26, Nicolas Wentzensen26, Georgia Chenevix-Trench25, for AOCS/ACS group23,25, Alice S. Whittemore27, Weiva Sieh27, Jenny Chang-Claude33, Elisa V. Bandera42, Irene Orlow43, Kathryn Terry9,8, Marc T. Goodman28, Pamela J. Thompson28, Linda S. Cook46, Mary Anne Rossing47,48, Roberta B. Ness49, Steven A. Narod53, Jolanta Kupryjanczyk59, Karen Lu50, Ralf Butzow63,64, Thilo Dork€ 34, Tanja Pejovic65,66, Ian Campbell20,21,24, Nhu D. Le54, Clareann H. Bunker67, Natalia Bogdanova34, Ingo B. Runne- baum35, Diana Eccles70, James Paul71, Anna H. Wu30, Simon A. Gayther30, Estrid Hogdall81,82, Florian Heitz36,38, Stanley B. Kaye72, Beth Y. Karlan29, Hoda Anton-Culver32, Jacek Gronwald61, Claus K. Hogdall83, Diether Lambrechts84,85, Peter A. Fasching31,39, Usha Menon74,75,76, Joellen Schildkraut87,89, Celeste Leigh Pearce30, Douglas A. Levine44, Susanne Kruger Kjaer81,83, Daniel Cramer8,9, James M. Flanagan77, Catherine M. Phelan6, Robert Brown77, Leon F.A.G. Massuger16, Honglin Song79, Jennifer A. Doherty90, Camilla Krakstad11,12, Dong Liang52, Kunle Odunsi45, Andrew Berchuck88, Allan Jensen81, Jan Lubinski 61, Heli Nevanlinna63, Yukie T. Bean65,66, Galina Lurie91, Argyrios Ziogas32, Christine Walsh29, Evelyn Despierre86, Louise Brinton26, Alexander Hein39, Anja Rudolph33, Agnieszka Dansonka-Mieszkowska59, Sara H.
    [Show full text]
  • Gene Symbol Accession Alias/Prev Symbol Official Full Name AAK1 NM 014911.2 KIAA1048, Dkfzp686k16132 AP2 Associated Kinase 1
    Gene Symbol Accession Alias/Prev Symbol Official Full Name AAK1 NM_014911.2 KIAA1048, DKFZp686K16132 AP2 associated kinase 1 (AAK1) AATK NM_001080395.2 AATYK, AATYK1, KIAA0641, LMR1, LMTK1, p35BP apoptosis-associated tyrosine kinase (AATK) ABL1 NM_007313.2 ABL, JTK7, c-ABL, p150 v-abl Abelson murine leukemia viral oncogene homolog 1 (ABL1) ABL2 NM_007314.3 ABLL, ARG v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) (ABL2) ACVR1 NM_001105.2 ACVRLK2, SKR1, ALK2, ACVR1A activin A receptor ACVR1B NM_004302.3 ACVRLK4, ALK4, SKR2, ActRIB activin A receptor, type IB (ACVR1B) ACVR1C NM_145259.2 ACVRLK7, ALK7 activin A receptor, type IC (ACVR1C) ACVR2A NM_001616.3 ACVR2, ACTRII activin A receptor ACVR2B NM_001106.2 ActR-IIB activin A receptor ACVRL1 NM_000020.1 ACVRLK1, ORW2, HHT2, ALK1, HHT activin A receptor type II-like 1 (ACVRL1) ADCK1 NM_020421.2 FLJ39600 aarF domain containing kinase 1 (ADCK1) ADCK2 NM_052853.3 MGC20727 aarF domain containing kinase 2 (ADCK2) ADCK3 NM_020247.3 CABC1, COQ8, SCAR9 chaperone, ABC1 activity of bc1 complex like (S. pombe) (CABC1) ADCK4 NM_024876.3 aarF domain containing kinase 4 (ADCK4) ADCK5 NM_174922.3 FLJ35454 aarF domain containing kinase 5 (ADCK5) ADRBK1 NM_001619.2 GRK2, BARK1 adrenergic, beta, receptor kinase 1 (ADRBK1) ADRBK2 NM_005160.2 GRK3, BARK2 adrenergic, beta, receptor kinase 2 (ADRBK2) AKT1 NM_001014431.1 RAC, PKB, PRKBA, AKT v-akt murine thymoma viral oncogene homolog 1 (AKT1) AKT2 NM_001626.2 v-akt murine thymoma viral oncogene homolog 2 (AKT2) AKT3 NM_181690.1
    [Show full text]
  • A Meta-Learning Approach for Genomic Survival Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.21.053918; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. A meta-learning approach for genomic survival analysis Yeping Lina Qiu1;2, Hong Zheng2, Arnout Devos3, Olivier Gevaert2;4;∗ 1Department of Electrical Engineering, Stanford University 2Stanford Center for Biomedical Informatics Research, Department of Medicine, Stanford University 3School of Computer and Communication Sciences, Swiss Federal Institute of Technology Lausanne (EPFL) 4Department of Biomedical Data Science, Stanford University ∗To whom correspondence should be addressed: [email protected] Abstract RNA sequencing has emerged as a promising approach in cancer prognosis as sequencing data becomes more easily and affordably accessible. However, it remains challenging to build good predictive models especially when the sample size is limited and the number of features is high, which is a common situation in biomedical settings. To address these limitations, we propose a meta-learning framework based on neural networks for survival analysis and evaluate it in a genomic cancer research setting. We demonstrate that, compared to regular transfer- learning, meta-learning is a significantly more effective paradigm to leverage high-dimensional data that is relevant but not directly related to the problem of interest. Specifically, meta-learning explicitly constructs a model, from abundant data of relevant tasks, to learn a new task with few samples effectively. For the application of predicting cancer survival outcome, we also show that the meta- learning framework with a few samples is able to achieve competitive performance with learning from scratch with a significantly larger number of samples.
    [Show full text]
  • Mitogen Activated Protein Kinase (MAPK) Pathway Mutations and Drug Resistance
    Author Manuscript Published OnlineFirst on February 13, 2013; DOI: 10.1158/1078-0432.CCR-12-0383 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Molecular Pathways: Mitogen Activated Protein Kinase (MAPK) Pathway Mutations and Drug Resistance Antonia L. Pritchard 1 and Nicholas K. Hayward 1* 1. Oncogenomics Research Group, CBCRC Building, Queensland Institute of Medical Research, 300 Herston Road, Herston, Brisbane, QLD 4006, Australia *Corresponding Author: Nicholas K. Hayward Oncogenomics Research Group, Queensland Institute of Medical Research, 300 Herston Road, Herston, Brisbane, QLD 4006, Australia [email protected] Conflict of Interest Statement: No relationship that could be construed as resulting in an actual, potential, or perceived conflict of interest are declared by either Dr. Pritchard or Prof. Hayward. Word counts: Abstract: 243 Background + Clinical translational advances: 3320 Number of References: 98 Downloaded from clincancerres.aacrjournals.org on October 6, 2021. © 2013 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 13, 2013; DOI: 10.1158/1078-0432.CCR-12-0383 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. ABSTRACT Receptor tyrosine kinases are a diverse family of transmembrane proteins that can activate multiple pathways upon ligation of the receptor, one of which is the series of mitogen- activated protein kinase (MAPK) signalling cascades. The MAPK pathways play critical roles in a wide variety of cancer types, from haematological malignancies, to solid tumours. Aberrations include altered expression levels and activation states of pathway components, which can sometimes be attributable to mutations in individual members.
    [Show full text]