Kinases That Are Currently Stored in the Phospho.ELM Database
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
Aurora Kinase a in Gastrointestinal Cancers: Time to Target Ahmed Katsha1, Abbes Belkhiri1, Laura Goff3 and Wael El-Rifai1,2,4*
Katsha et al. Molecular Cancer (2015) 14:106 DOI 10.1186/s12943-015-0375-4 REVIEW Open Access Aurora kinase A in gastrointestinal cancers: time to target Ahmed Katsha1, Abbes Belkhiri1, Laura Goff3 and Wael El-Rifai1,2,4* Abstract Gastrointestinal (GI) cancers are a major cause of cancer-related deaths. During the last two decades, several studies have shown amplification and overexpression of Aurora kinase A (AURKA) in several GI malignancies. These studies demonstrated that AURKA not only plays a role in regulating cell cycle and mitosis, but also regulates a number of key oncogenic signaling pathways. Although AURKA inhibitors have moved to phase III clinical trials in lymphomas, there has been slower progress in GI cancers and solid tumors. Ongoing clinical trials testing AURKA inhibitors as a single agent or in combination with conventional chemotherapies are expected to provide important clinical information for targeting AURKA in GI cancers. It is, therefore, imperative to consider investigations of molecular determinants of response and resistance to this class of inhibitors. This will improve evaluation of the efficacy of these drugs and establish biomarker based strategies for enrollment into clinical trials, which hold the future direction for personalized cancer therapy. In this review, we will discuss the available data on AURKA in GI cancers. We will also summarize the major AURKA inhibitors that have been developed and tested in pre-clinical and clinical settings. Keywords: Aurora kinases, Therapy, AURKA inhibitors, MNL8237, Alisertib, Gastrointestinal, Cancer, Signaling pathways Introduction stage [9-11]. Furthermore, AURKA is critical for Mitotic kinases are the main proteins that coordinate ac- bipolar-spindle assembly where it interacts with Ran- curate mitotic processing [1]. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
Outlier Kinase Expression by RNA Sequencing As Targets for Precision Therapy
Published OnlineFirst February 5, 2013; DOI: 10.1158/2159-8290.CD-12-0336 RESEARCH ARTICLE Outlier Kinase Expression by RNA Sequencing as Targets for Precision Therapy Vishal Kothari 1 , Iris Wei 2 , Sunita Shankar 1 , 3 , Shanker Kalyana-Sundaram 1 , 3 , 8 , Lidong Wang 2 , Linda W. Ma 1 , Pankaj Vats 1 , Catherine S. Grasso 1 , Dan R. Robinson 1 , 3 , Yi-Mi Wu 1 , 3 , Xuhong Cao 7 , Diane M. Simeone 2 , 4 , 5 , Arul M. Chinnaiyan 1 , 3 , 4 , 6 , 7 , and Chandan Kumar-Sinha 1 , 3 ABSTRACT Protein kinases represent the most effective class of therapeutic targets in cancer; therefore, determination of kinase aberrations is a major focus of cancer genomic studies. Here, we analyzed transcriptome sequencing data from a compendium of 482 cancer and benign samples from 25 different tissue types, and defi ned distinct “outlier kinases” in individual breast and pancreatic cancer samples, based on highest levels of absolute and differential expression. Frequent outlier kinases in breast cancer included therapeutic targets like ERBB2 and FGFR4 , distinct from MET , AKT2 , and PLK2 in pancreatic cancer. Outlier kinases imparted sample-specifi c depend- encies in various cell lines, as tested by siRNA knockdown and/or pharmacologic inhibition. Outlier expression of polo-like kinases was observed in a subset of KRAS -dependent pancreatic cancer cell lines, and conferred increased sensitivity to the pan-PLK inhibitor BI-6727. Our results suggest that outlier kinases represent effective precision therapeutic targets that are readily identifi able through RNA sequencing of tumors. SIGNIFICANCE: Various breast and pancreatic cancer cell lines display sensitivity to knockdown or pharmacologic inhibition of sample-specifi c outlier kinases identifi ed by high-throughput transcrip- tome sequencing. -
Stem Cell Factor Is Selectively Secreted by Arterial Endothelial Cells in Bone Marrow
ARTICLE DOI: 10.1038/s41467-018-04726-3 OPEN Stem cell factor is selectively secreted by arterial endothelial cells in bone marrow Chunliang Xu1,2, Xin Gao1,2, Qiaozhi Wei1,2, Fumio Nakahara 1,2, Samuel E. Zimmerman3,4, Jessica Mar3,4 & Paul S. Frenette 1,2,5 Endothelial cells (ECs) contribute to haematopoietic stem cell (HSC) maintenance in bone marrow, but the differential contributions of EC subtypes remain unknown, owing to the lack 1234567890():,; of methods to separate with high purity arterial endothelial cells (AECs) from sinusoidal endothelial cells (SECs). Here we show that the combination of podoplanin (PDPN) and Sca-1 expression distinguishes AECs (CD45− Ter119− Sca-1bright PDPN−) from SECs (CD45− Ter119− Sca-1dim PDPN+). PDPN can be substituted for antibodies against the adhesion molecules ICAM1 or E-selectin. Unexpectedly, prospective isolation reveals that AECs secrete nearly all detectable EC-derived stem cell factors (SCF). Genetic deletion of Scf in AECs, but not SECs, significantly reduced functional HSCs. Lineage-tracing analyses suggest that AECs and SECs self-regenerate independently after severe genotoxic insults, indicating the per- sistence of, and recovery from, radio-resistant pre-specified EC precursors. AEC-derived SCF also promotes HSC recovery after myeloablation. These results thus uncover heterogeneity in the contribution of ECs in stem cell niches. 1 The Ruth L. and David S. Gottesman Institute for Stem Cell and Regenerative Medicine Research, Albert Einstein College of Medicine, New York, NY 10461, USA. 2 Department of Cell Biology, Albert Einstein College of Medicine, New York, NY 10461, USA. 3 Department of Systems and Computational Biology, Albert Einstein College of Medicine, New York, NY 10461, USA. -
Survival Pathways That Regulate Macrophage Tec and Btk in M-CSF
Essential Roles for the Tec Family Kinases Tec and Btk in M-CSF Receptor Signaling Pathways That Regulate Macrophage Survival This information is current as of September 26, 2021. Martin Melcher, Bernd Unger, Uwe Schmidt, Iiro A. Rajantie, Kari Alitalo and Wilfried Ellmeier J Immunol 2008; 180:8048-8056; ; doi: 10.4049/jimmunol.180.12.8048 http://www.jimmunol.org/content/180/12/8048 Downloaded from References This article cites 36 articles, 18 of which you can access for free at: http://www.jimmunol.org/content/180/12/8048.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 26, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Essential Roles for the Tec Family Kinases Tec and Btk in M-CSF Receptor Signaling Pathways That Regulate Macrophage Survival1 Martin Melcher,2* Bernd Unger,2† Uwe Schmidt,3* Iiro A. -
RASSF1A Interacts with and Activates the Mitotic Kinase Aurora-A
Oncogene (2008) 27, 6175–6186 & 2008 Macmillan Publishers Limited All rights reserved 0950-9232/08 $32.00 www.nature.com/onc ORIGINAL ARTICLE RASSF1A interacts with and activates the mitotic kinase Aurora-A L Liu1, C Guo1, R Dammann2, S Tommasi1 and GP Pfeifer1 1Division of Biology, Beckman Research Institute, City of Hope Cancer Center, Duarte, CA, USA and 2Institute of Genetics, University of Giessen, Giessen, Germany The RAS association domain family 1A (RASSF1A) gene tumorigenesis and carcinogen-induced tumorigenesis is located at chromosome 3p21.3 within a specific area of (Tommasi et al., 2005; van der Weyden et al., 2005), common heterozygous and homozygous deletions. RASS- supporting the notion that RASSF1A is a bona fide F1A frequently undergoes promoter methylation-asso- tumor suppressor. However, it is not fully understood ciated inactivation in human cancers. Rassf1aÀ/À mice how RASSF1A is involved in tumor suppression. are prone to both spontaneous and carcinogen-induced The biochemical function of the RASSF1A protein is tumorigenesis, supporting the notion that RASSF1A is a largely unknown. The homology of RASSF1A with the tumor suppressor. However, it is not fully understood how mammalian Ras effector novel Ras effector (NORE)1 RASSF1A is involved in tumor suppression pathways. suggests that the RASSF1A gene product may function Here we show that overexpression of RASSF1A inhibits in signal transduction pathways involving Ras-like centrosome separation. RASSF1A interacts with Aurora-A, proteins. However, recent data indicate that RASSF1A a mitotic kinase. Surprisingly, knockdown of RASS- itself binds to RAS only weakly and that binding to F1A by siRNA led to reduced activation of Aurora-A, RAS may require heterodimerization of RASSF1A and whereas overexpression of RASSF1A resulted in in- NORE1 (Ortiz-Vega et al., 2002). -
Human FLT4 / VEGFR3 ELISA Kit (ARG82047)
Product datasheet [email protected] ARG82047 Package: 96 wells Human FLT4 / VEGFR3 ELISA Kit Store at: 4°C Summary Product Description Human FLT4 / VEGFR3 ELISA Kit is an Enzyme Immunoassay kit for the quantification of Human FLT4 / VEGFR3 in serum, plasma and cell culture supernatants. Tested Reactivity Hu Tested Application ELISA Target Name FLT4 / VEGFR3 Conjugation HRP Conjugation Note Substrate: TMB and read at 450 nm. Sensitivity 78 pg/ml Sample Type Serum, plasma and cell culture supernatants. Standard Range 156 - 10000 pg/ml Sample Volume 100 µl Alternate Names FLT-4; FLT41; Vascular endothelial growth factor receptor 3; VEGFR3; VEGFR-3; PCL; Tyrosine-protein kinase receptor FLT4; LMPH1A; EC 2.7.10.1; Fms-like tyrosine kinase 4 Application Instructions Assay Time 4.5 hours Properties Form 96 well Storage instruction Store the kit at 2-8°C. Keep microplate wells sealed in a dry bag with desiccants. Do not expose test reagents to heat, sun or strong light during storage and usage. Please refer to the product user manual for detail temperatures of the components. Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol FLT4 Gene Full Name fms-related tyrosine kinase 4 Background This gene encodes a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium. Mutations in this gene cause hereditary lymphedema type IA. [provided by RefSeq, Jul 2008] Function Tyrosine-protein kinase that acts as a cell-surface receptor for VEGFC and VEGFD, and plays an essential role in adult lymphangiogenesis and in the development of the vascular network and the cardiovascular system during embryonic development. -
Casein Kinase 1 Isoforms in Degenerative Disorders
CASEIN KINASE 1 ISOFORMS IN DEGENERATIVE DISORDERS DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Theresa Joseph Kannanayakal, M.Sc., M.S. * * * * * The Ohio State University 2004 Dissertation Committee: Approved by Professor Jeff A. Kuret, Adviser Professor John D. Oberdick Professor Dale D. Vandre Adviser Professor Mike X. Zhu Biophysics Graduate Program ABSTRACT Casein Kinase 1 (CK1) enzyme is one of the largest family of Serine/Threonine protein kinases. CK1 has a wide distribution spanning many eukaryotic families. In cells, its kinase activity has been found in various sub-cellular compartments enabling it to phosphorylate many proteins involved in cellular maintenance and disease pathogenesis. Tau is one such substrate whose hyperphosphorylation results in degeneration of neurons in Alzheimer’s disease (AD). AD is a slow neuroprogessive disorder histopathologically characterized by Granulovacuolar degeneration bodies (GVBs) and intraneuronal accumulation of tau in Neurofibrillary Tangles (NFTs). The level of CK1 isoforms, CK1α, CK1δ and CK1ε has been shown to be elevated in AD. Previous studies of the correlation of CK1δ with lesions had demonstrated its importance in tau hyperphosphorylation. Hence we investigated distribution of CK1α and CK1ε with the lesions to understand if they would play role in tau hyperphosphorylation similar to CK1δ. The kinase results were also compared with lesion correlation studies of peptidyl cis/trans prolyl isomerase (Pin1) and caspase-3. Our results showed that among the enzymes investigated, CK1 isoforms have the greatest extent of colocalization with the lesions. We have also investigated the distribution of CK1α with different stages of NFTs that follow AD progression. -
Profiling Data
Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8 -
Rat FLT4 / VEGFR3 ELISA Kit (ARG82090)
Product datasheet [email protected] ARG82090 Package: 96 wells Rat FLT4 / VEGFR3 ELISA Kit Store at: 4°C Component Cat. No. Component Name Package Temp ARG82090-001 Antibody-coated 8 X 12 strips 4°C. Unused strips microplate should be sealed tightly in the air-tight pouch. ARG82090-002 Standard 2 X 10 ng/vial 4°C ARG82090-003 Standard/Sample 30 ml (Ready to use) 4°C diluent ARG82090-004 Antibody conjugate 1 vial (100 µl) 4°C concentrate (100X) ARG82090-005 Antibody diluent 12 ml (Ready to use) 4°C buffer ARG82090-006 HRP-Streptavidin 1 vial (100 µl) 4°C concentrate (100X) ARG82090-007 HRP-Streptavidin 12 ml (Ready to use) 4°C diluent buffer ARG82090-008 25X Wash buffer 20 ml 4°C ARG82090-009 TMB substrate 10 ml (Ready to use) 4°C (Protect from light) ARG82090-010 STOP solution 10 ml (Ready to use) 4°C ARG82090-011 Plate sealer 4 strips Room temperature Summary Product Description ARG82090 Rat FLT4 / VEGFR3 ELISA Kit is an Enzyme Immunoassay kit for the quantification of Rat FLT4 / VEGFR3 in serum and cell culture supernatants. Tested Reactivity Rat Tested Application ELISA Specificity There is no detectable cross-reactivity with other relevant proteins. Target Name FLT4 / VEGFR3 Conjugation HRP Conjugation Note Substrate: TMB and read at 450 nm. Sensitivity 78 pg/ml Sample Type Serum and cell culture supernatants. Standard Range 156 - 10000 pg/ml Sample Volume 100 µl www.arigobio.com 1/3 Precision Intra-Assay CV: 5.2%; Inter-Assay CV: 6.2% Alternate Names FLT-4; FLT41; Vascular endothelial growth factor receptor 3; VEGFR3; VEGFR-3; PCL; Tyrosine-protein kinase receptor FLT4; LMPH1A; EC 2.7.10.1; Fms-like tyrosine kinase 4 Application Instructions Assay Time ~ 5 hours Properties Form 96 well Storage instruction Store the kit at 2-8°C. -
1 Silencing Branched-Chain Ketoacid Dehydrogenase Or
bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Silencing branched-chain ketoacid dehydrogenase or treatment with branched-chain ketoacids ex vivo inhibits muscle insulin signaling Running title: BCKAs impair insulin signaling Dipsikha Biswas1, PhD, Khoi T. Dao1, BSc, Angella Mercer1, BSc, Andrew Cowie1 , BSc, Luke Duffley1, BSc, Yassine El Hiani2, PhD, Petra C. Kienesberger1, PhD, Thomas Pulinilkunnil1†, PhD 1Department of Biochemistry and Molecular Biology, Dalhousie Medicine New Brunswick, Saint John, New Brunswick, Canada, 2Department of Physiology and Biophysics, Dalhousie University, Halifax, Nova Scotia, Canada. †Correspondence to Thomas Pulinilkunnil, PhD Department of Biochemistry and Molecular Biology, Faculty of Medicine, Dalhousie University Dalhousie Medicine New Brunswick, 100 Tucker Park Road, Saint John E2L4L5, New Brunswick, Canada. Telephone: (506) 636-6973; Fax: (506) 636-6001; email: [email protected]. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International