CASEIN KINASE 1 ISOFORMS IN DEGENERATIVE DISORDERS
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in
the Graduate School of The Ohio State University
By
Theresa Joseph Kannanayakal, M.Sc., M.S.
* * * * *
The Ohio State University
2004
Dissertation Committee: Approved by
Professor Jeff A. Kuret, Adviser
Professor John D. Oberdick
Professor Dale D. Vandre Adviser Professor Mike X. Zhu Biophysics Graduate Program
ABSTRACT
Casein Kinase 1 (CK1) enzyme is one of the largest family of Serine/Threonine protein kinases. CK1 has a wide distribution spanning many eukaryotic families. In cells, its kinase activity has been found in various sub-cellular compartments enabling it to phosphorylate many proteins involved in cellular maintenance and disease pathogenesis.
Tau is one such substrate whose hyperphosphorylation results in degeneration of neurons in Alzheimer’s disease (AD). AD is a slow neuroprogessive disorder histopathologically characterized by Granulovacuolar degeneration bodies (GVBs) and intraneuronal accumulation of tau in Neurofibrillary Tangles (NFTs). The level of CK1 isoforms,
CK1α, CK1δ and CK1ε has been shown to be elevated in AD. Previous studies of the
correlation of CK1δ with lesions had demonstrated its importance in tau hyperphosphorylation. Hence we investigated distribution of CK1α and CK1ε with the lesions to understand if they would play role in tau hyperphosphorylation similar to CK1δ.
The kinase results were also compared with lesion correlation studies of peptidyl cis/trans
prolyl isomerase (Pin1) and caspase-3. Our results showed that among the enzymes
investigated, CK1 isoforms have the greatest extent of colocalization with the lesions. We have also investigated the distribution of CK1α with different stages of NFTs that follow
AD progression. It was observed that CK1α follows AD progression, establishing the
importance of CK1 isoforms in AD. Correlation of CK1 isoforms with tau pathology led us to investigate the presence of the isoforms in a muscle degenerative disorder, Inclusion
ii Body Myositis (IBM) containing tau inclusions. CK1α was found in the tau inclusions of
IBM, demonstrating the importance of CK1 isoforms in degenerative disorders in general.
Since CK1 is established in both maintenance of the cell and pathogenesis of degenerative diseases, we investigated the regulation and protein substrate recognition of the kinase domain of the enzymes. Using structure and sequence comparison with other conserved protein kinases, we identified and mutated the essential residues involved in regulation and protein substrate recognition. Examination of the mutants with kinase assay revealed that T166 is important for regulation while R183, K222, K229 are important for protein substrate recognition. Thus, these various studies establish the importance of the CK1 family in degenerative disorders.
iii
To my husband Lal Jose
and to my parents,
Joseph K. David and P.V. Poulina
iv ACKNOWLEDGMENTS
I wish to thank my adviser, Dr. Jeff Kuret, for intellectual support, constant guidance, encouragement, enthusiasm and his patience all through my graduate career, which made this thesis possible.
I wish to thank my committee members, Dr. John Oberdick, Dr. Brad Stokes, Dr. Dale
Vandre and Dr. Mike Zhu for stimulating discussions and for providing encouragement.
I am grateful to Dr. Leyla de Toledo-Morrell (Rush Alzheimer's Disease Center, Rush
University, Chicago, Illinois), Dr. Paul D. Coleman (University of Rochester, Rochester,
NY), Dr. Maria Santi (Dept. Pathology, The Ohio State University School of Medicine,
Columbus, OH) and Harvard Brain Bank (Boston, MA) for providing human autopsy
Alzheimer’s disease as well as control brains tissues and Dr. Jerry Mendell (Dept.
Neurology, The Ohio State University School of Medicine, Columbus, OH) for providing human biopsy Inclusion Body Myositis muscle tissue as well as control muscle tissues.
I am greatly thankful to Dr. Dale Vandre (Ohio State University, Columbus, OH) for providing Pin1 antisera, to Dr. Peter Davies, (Albert Einstein College of Medicine, NY)
v for providing Alz-50 antibody and to ICOS corporation (Icos Corporation, Bothell, WA) for providing IC128A antibody.
I am indebted to the staff of campus microscope facility, Dr. Dick Burry, Kathy Wolken and Brian Kemmenoe for their incredible skills and persistence.
I am fortunate to have the opportunity to work with a group of energetic people Carmen
Chirita, Erin Congdon, Guibin Li, Mihaela Necula, Kelly Threm, Haishan Yin and Qi
Zhong.
Finally, it is impossible to have my research career without love and support of my husband and my parents, as well as the encouragement of my family and friends. I am forever indebted to my in-laws: Jose Kokkat and Mary Jose, to my brothers: Davis,
Antony and Thomas, my sister’s family: Lawrence Jacob, Vimala and Amala Lawrence, to my foster family: Stanley and Tanya Mathew, to my Jones group: Swarnali Acharyya,
Rinku Jain, Senthil Meenrajan, and Soja Sekharan. To all of you, Thanks.
.
vi VITA
August 27, 1976...... ….....Born, Chennai, India
1996 B.Sc ...... …..….Stella Maris College,
(Physics) Madras University, India
1998 M.Sc...... Department of Crystallography,
(Biophysics & Crystallography) Madras University, India
2001 M.S ...... Biophysics Program,
(Biophysics) The Ohio State University (OSU), USA
2001-Present...... …...... Doctoral candidate,
(Biophysics) Biophysics Program, OSU, USA
FIELD OF STUDY
Major Field: Biophysics
vii TABLE OF CONTENTS
Page
ABSTRACT...... ……...... ii
DEDICATION...... …....…..… iv
ACKNOWLEDGMENTS...... …...…...... v
VITA...... ……….....vii
LIST OF TABLES...... …..... xii
LIST OF FIGURES...... ….... xiii
LIST OF ABBREVIATIONS……...... …...….. xv
CHAPTERS:
1. Introduction...... …...... …...... …....1
1.1 Alzheimer’s Disease…………...... ……..1
1.1.1 Hypotheses for occurrence of AD lesions...... …..….2
1.1.2 Phosphorylation and tau…………...... …….4
1.2 Casein Kinase 1. ………………...... 7
1.2.1 CK1 in lower eukaryotes…...... ………..7
1.2.2 CK1 in higher eukaryotes…...... ……..8
1.2.3 Conserved residues in CK1...... ………………………..…..10
1.3 Pin1 overview……...... ……...... 11
viii 1.4 Caspase-3……………………………………………………………………..13
1.5 Inclusion Body Myositis……………………………………………………...14
1.6 Immunoshistochemical technique…………………………………………….17
1.7 Epi-Fluorescence/Confocal Microscopy……………………………………...19
2. Vulnerability of lesion affected neurons to the presence of enzymes involved in
Alzheimer’s Disease…………………………………………………………………..…21
2.1 Summary …………………………………...………………………………...21
2.2 Introduction………………………………………………………....………..22
2.3 Materials and methods…………………………………………………….….29
2.3.1 Antibodies……………………………………………………….….29
2.3.2 Fluorophores…………………………………………………….....31
2.3.3 Human Tissue……………………………………………….…..….31
2.3.4 Immunohistochemistry……………………………….………….....35
2.3.5 Analytical Methods…………………………...... ………...... ….36
2.3.6 Statistical analysis…………………………………………… . .….36
2.4 Results. …………………………………………………………………….... 36
2.4.1 Western Blots…………………………………………………..…....36
2.4.2 Histochemistry of control cases………………………………...…...38
2.4.3 CK1 isoforms correlate well with NFTs……………………...…..…38
ix 2.4.4 Pin1 granules might represent new lesion. ………………………...39
2.4.5 Caspase-3 is present in GVB containing neurons more than in NFTs…………………………………………………….…..39 2.4.6 CK1α and different stages of NFTs………………………………....40
2.4.7 GVBs and NFTs do not coexist in the same neuron.…….……….....40
2.4.8 Pre-tangle neurons and GVBs.…….………………………………..41
2.5 Discussion…………………………………………………………..….……..53
3. Casein Kinase 1 α found in the tau inclusions of Inclusion Body Myositis…..…..59
3.1 Summary ………………………………………………………………….….59
3.2 Introduction…………………………………………………….………….….60
3.3 Materials and methods. …………………………………………………..…..63
3.3.1 Patients and controls………….…………………………………….63
3.3.2 Antibodies…………………………………………………………..63
3.3.3 Fluorescence immunohistochemistry…………………………..…...64
3.4 Results …………………………………………………………….………….64
3.4.1 H&E stainings of control and s-IBM muscle fibers………….……..64
3.4.2 Control muscle sections………………………………………….....65
3.4.3 s-IBM muscle………………………………………………..……...65
3.5 Discussion………………………………………………………….………....71
4. Kinetic analysis of Casein Kinase 1 mutants……………………………...... …..74
4.1 Summary ……………………………………………………………………..74 x 4.2 Introduction……………………………………………………………….…..74
4.3 Materials and methods. …………………………………………………..…..78
4.3.1 Chemicals used for protein kinase assays…………….…….…....…78
4.3.2 Site-directed Mutagenesis……………………………….…..….…..78
4.3.3 Expression and Purification…………………………….…..….…...78
4.4 Results …………………………………………………………….……….....80
4.5 Discussion………………………………………………………….…………84
5. Summary……………………...... …...... 86
BIBLIOGRAPHY...... …. 92
xi LIST OF TABLES Table page
2.1 Clinical pathology of cases...... …...... …....……...33
2.2 Number of lesion affected neurons containing GVBs and/or NFTs………………………………………...... ………….....52
2.3: Number of lesion affected neurons containing GVBs and/or pre-tangles...... ………...... 52
3.1 Patient characteristics...... …………..69
4.1 Primers used in creating the mutants ...... ……….….79
4.2 Summary of results obtained from Kinase assay ...... …..……...83
xii
F
LIST OF FIGURES
Figure Page
2.1 Western blots...... ……….……42
2.2 CK1 isoforms and Thiazin red staining of NFTs…...... ……..………...43
2.3 Thiazin red staining of NFTs colocalizing with caspase-3 and Pin1 .…....………44
2.4 Colocalization of CK1α, CK1ε, Pin1 and Caspase-3 immunoreactive neurons with NFT affected neurons …..…...... …...... 45
2.5 CK1α and GVB affected neurons...... …..…….....46
2.6 Pin1 andCaspase-3 with GVB affected neurons…...... …...... …....47
2.7 Colocalization of GVB affected neurons with neurons immunoreactive to CK1α, Pin1 and Caspase-3 enzymes...... ……...... …....………48
2.8 CK1α and different stages of NFTs...... ………………...... …....…...... 49
2.9 Distribution of CK1α immunoreactivity in different stages of NFT formation...... …..…………………………..……...50
2.10 GVB and NFT affected neurons ………………………………………...... ….. 51
3.1 H&E Staining ………………………………………………………………....…..…66
3.2 Fluorescence staining of control muscle fibers …………….……..…..…....…..….66
3.3 s-IBM muscle fiber stained with PHF1………………..………….……....…....…..67
3.4 s-IBM muscle fiber stained with CK1α………...... ……….…………..…....…..…..67
xiii 3.5 CK1α colocalization with tau…………………………….………………....….…...68
3.6 Percentage representations of CK1α and its colocalization with tau in IBM inclusions.....…..…………………………………………………………………..….…..70
4.1 Velocity plot obtained with various CK1 mutants ……...... …….....81
4.2 Lineweaver-Burk Plot obtained from the velocity plot of the CK1 mutants .…..82
xiv
LIST OF ABBREVIATIONS
Aβ Amyloid beta
AD Alzheimer’s Disease
ApoE Apolipoprotein E
APP Amyloid Precursor Protein cAPK cAMP-Dependent Protein Kinase
CDK Cyclin Dependent Kinase
CDK5 Cyclin Dependent Kinase 5
CK1 Casein Kinase 1
CK1α Casein Kinase 1 alpha
CK1β Casein Kinase 1 beta
CK1δ Casein Kinase 1 delta
CK1ε Casein Kinase1 epsilon
CK1γ Casein Kinase 1 gamma
CLSM Confocal Laser Scanning Microscopy
DM Dermatomyositis
xv eNFT Extracellular Neurofibrillary Tangle
ERK Extracellular signal-regulated kinase
FAD Familial Alzheimer’s Disease
GSK3β Glycogen Synthase Kinase 3Beta
GST Glutathione-S-Transferase
GVBs Granulovacuolar Vacuolar Bodies h-IBM Hereditary Inclusion Body Myositis hPER1 Human Period 1 i. r Immunoreactive
IBM Inclusion Body Myositis
IHC Immunohistochemistry iNFT Intraneuronal Neurofibrillary Tangle
MAP Microtubule Associated Protein
NFTs Neurofibrillary Tangles
NPs Neuritic Plaques
NTs Neuropil Threads
PHF Paired Helical Filaments
PIN Peptidyl-prolyl cis/trans Isomerase
PKA Protein Kinase A
xvi PM Polymyositis
PS1 Presenilin 1
PS2 Presenilin 2
SAD Sporadic Alzheimer’s Disease s-IBM Sporadic Inclusion Body Myositis
TTFs Twisted Tubulofilaments
xvii
CHAPTER 1
INTRODUCTION
In many organisms, isoforms of Casein Kinase 1 (CK1) family play a major role in
several of the physiological functions through their phosphorylation effect on proteins. In
humans, the most common neurodegenerative and muscle degenerative disorders are
Alzheimer’s disease (AD) and Inclusion Body Myositis (IBM) respectively. The aetiology for both of these disorders is not known. ‘Casein Kinase1 family in degenerative disorders’ is an effort to gain more insight on CK1 especially in the context of these degenerative diseases.
1.1 Alzheimer’s Disease
AD, the main cause of dementia is a neurodegenerative disorder of the central nervous system [1] affecting more than 4 million people worldwide [2, 3]. Clinically it is characterized by progressive loss of cognitive and functional abilities, associated with various degrees of behavioral disturbances [4] that impair daily living [5]. The
1 devastating economical and emotional impact of AD on patients, families and the society has made AD one of the paramount geriatric syndromes [6]. AD is a heterogeneous age- related disorder of multifactorial origin and may arise as a consequence of point mutations of genes encoding Amyloid Precursor Protein (APP) or other proteins involved in its metabolism (familial AD), or a combination of genetic and non-genetic factors
(sporadic AD) [7]. Brain lesions in both sporadic AD (SAD) and familial AD (FAD) are the same and in the same distribution pattern, albeit in smaller numbers in nondemented older individuals. The onset of dementia is 40-60 years for FAD and usually over 60 years for SAD [8]. Histopathologically, AD is characterized by neuronal loss, presence of neuritic plaques (NPs), neurofibrillary tangles (NFTs) which are intraneuronal accumulation of tau [2, 3] and presence of Granuolovacuolar bodies (GVBs) [9].
1.1.1 Hypotheses for occurrence of AD lesions
Two major hypotheses have been proposed in order to explain the molecular hallmarks of the disease: The ‘amyloid cascade’ hypothesis and the 'neuronal cytoskeletal degeneration' hypothesis [10]. According to the "amyloid cascade hypothesis", the accumulation of Amyloid beta (Aβ) peptides in the brain is a primary event in the pathogenesis of AD while other pathological features are secondary [11]. This hypothesis is supported by genetic studies of the familial forms of AD (FAD) [10]. Studies of autosomal dominant FAD pedigrees have identified three distinct FAD genes: the beta- amyloid precursor protein (beta APP) gene on chromosome 21, the presenilin 1 (PS1) and the presenilin 2 (PS2) genes on chromosome 14 and 1, respectively. Missense mutations
2 in these genes cause abnormal beta APP processing with resultant overproduction of Aβ
42 peptides. Association studies have shown that the epsilon 4 allele of the apolipoprotein
E (ApoE) gene increases risk for AD in a dose-dependent manner in both familial and sporadic forms of AD [12-15]. In addition to variants of the ApoE gene, the risk of developing the more prevalent sporadic form of AD have been shown to increase with age and head trauma [7].
The 'neuronal cytoskeletal degeneration' hypothesis revolves around the observation that in vivo the cytoskeletal changes, including the abnormal phosphorylation state of the microtubule associated protein (MAP) tau may precede the deposition of senile plaques
[10]. This hypothesis is supported by the fact that the degree of dementia observed in AD
correlates better with the extent of neurofibrillary pathology than with the Aß deposits.
Histologically a number of other dementing disorders, such as Pick's disease, progressive supranuclear palsy, corticobasal degeneration, familial frontotemporal dementia and
Parkinsonism linked to chromosome 17 (FTDP-17) are all characterized by various kinds
of filamentous tau protein deposits, mostly in the complete absence of Aß deposits. The discovery of mutations in the tau gene in FTDP-17 has firmly established the relevance of tau pathology for the neurodegenerative process [16-18].
3 1.1.2 Phosphorylation and tau
In normal brain, tau stabilizes the tracks for intracellular traffic by binding to the axonal
microtubules by a tandem repeat region [19, 20]. Tau is a phosphoprotein [21] and is
found phosphorylated [22-24] on all six isoforms formed from differential splicing of the
mRNA [25, 26]. Tau normally contains 2-3 mol of phosphate per mole of the protein,
whereas it contains 5-9 mol of phosphate per mole of the protein in AD brain [24, 27,
28]. In AD, hyperphosphorylated tau forms paired helical filament (PHF) which are
abnormal fibrillar elements each about 22 nm at its widest, periodically reduced to 10 nm
at about every 80 nm [23, 29-33] and has a molecular weight range of 50,000-68,000 on
SDS-PAGE [25, 26].
In Alzheimer’s brain abnormally phosphorylated tau is a biomarker for neurofibrillary
pathology [34-36]. The extent of neurofibrillary changes associated with abnormally
phosphorylated tau protein in the hippocampus and neocortical areas correlate well with
the cognitive impairment in AD [37, 38]. Fibrillar pathology is constituted by NFTs in
neuronal cell bodies, as neuropil threads (NTs) in the dystrophic neurite of the affected
neurons in the neuropil and as dystrophic and degenerating neurites of neuritic (senile)
plaques (NPs), surrounding a dense core or several wisps of extracellular amyloid [39,
40]. Among the fibrillary pathology, the NTs precede the appearance of NFTs that in turn
precede the appearance of NPs [41]. According to the neurofibrillary staging method developed by Braak and Braak, it was postulated that there are six stages, with a seventh
(stage 0) representing the absence of cortical neurofibrillary changes. Stages I and II
4 represent the transentorhinal stage where the neurofibrillary pathology is essentially confined to the transentorhinal and entorhinal cortex and mild involvement of the
CA1/CA2 sections of the hippocampus. Stages III and IV represent the limbic stage which involves severe involvement of the entorhinal areas, moderate tangles in the hippocampus, and spread to the amygdala, thalamus, hypothalamus, and basal forebrain.
The last two stages, V and VI represent the neocortical stage which involves abundant neurofibrillary pathology in the neocortex [42, 43].
The presence of hyperphosphorylated tau epitopes in AD tissue suggested that phosphorylation might play a major role in AD lesion formation. This led to the hypothetical model of PHF formation, which hypothesized that, the kinases and phosphatases present in the cytoskeleton might regulate the interactions between tau and the microtubules. Normally, tau would be transported back to the cell body, ubiquinated and proteolysed. However in AD, factors including heparan along with the dimer formation could form a nucleus of insoluble phosphorylated tau while additional factors like the glycation forms covalent cross-links. This eventually would lead to the formation of insoluble PHFs within the cell. However several issues have been plaguing this hypothesis. Sequence analysis of fetal, adult and PHF tau suggested considerable overlap between AD and adult patterns of phosphorylation. Also studies of tau from intact human, primate and rat brains suggested that most of the AD-specific sites on tau are seen in living neurons while in biopsies from apparently normal human and primate brains showed that there is rapid dephosphorylation of most sites on tau [44].
5 Recent in vitro tau fibrillization studies have clarified that phosphorylation plays two
major role in early stage of the disease. Hyperphosphorylation of tau is speculated 1) to
modulate the tau/microtubule equilibrium and thereby raise intracellular concentrations
of free tau, leading to the formation of amorphous aggregates and assembly competent
intermediates and 2) to stabilize filaments once nucleated, thereby shifting equilibrium
toward the fibrillized state [45]. The phosphorylation mediated changes in
tau/microtubule binding equilibria have been demonstrated for several protein kinases
including Cyclin dependent kinase-5 (CDK5), Glycogen synthase kinase 3β (GSK 3β),
Protein Kinase A (PKA) and CK1 [45-52]. In comparison to the well established PKA,
CDK5 and GSK 3β, CK1 is a relatively new kinase whose phosphorylation ability has
been proposed to play an important role in mediating the changes in the tau/microtubule
equilibria. Due to its phosphotransferase ability, the CK1α, CK1δ and CK1ε isoforms
have been extensively implicated in AD [52-57]. Of these isoforms, only CK1δ has been
quantitatively investigated with the NFTs [9]. The large extent of colocalization between
CK1δ and the fibrillar lesion had resulted in in vivo studies. These studies show that
CK1δ phosphorylates tau directly. To know if the other isoforms CK1α and CK1ε are involved in tau phosphorylation similar to CK1δ, we carried out immunohistochemical investigations on AD and control tissue. In addition to investigating CK1 isoforms in AD, we also investigated Peptidyl cis/trans isomerase 1 (Pin1) and caspase-3 enzymes to compare with the colocalization data obtained with CK1 isoforms with AD lesions.
Chapter 2 deals with these investigations. The following sections give an extensive overview on CK1 followed by a brief overview on Pin1 and caspase-3 enzymes.
6 1.2 Casein Kinase 1
Protein phosphorylation is a significant mechanism in many cellular functions, including
genomic regulation and control of cell proliferation [58]. Protein kinases catalyze
phospho-transfer reactions from ATP to serine, threonine or tyrosine residues in target
substrates and provide key mechanisms for control of cellular signaling processes [59].
CK1 is a cyclic AMP-independent protein kinase (ATP: protein phosphotransferase, EC
2.7.1.37) capable of phosphorylating casein, phosvitin and I-form glycogen synthase [60-
63]. CK1 family of serine/threonine protein kinases is common to all eukaryotes [64] and
play an essential role in cell regulation and disease pathogenesis [65].
1.2.1 CK1 in lower eukaryotes
In lower eukaryotes, CK1 homologues are expressed in many organisms including
Plasmodium falciparum, Trypanosoma cruzi and yeast. The malarial parasite P.
falciparum [66], has the most primitive CK1 enzymes known, containing little sequence
information beyond the minimal catalytic domain [67]. In the intracellular protozoan agent of American trypanosomiasis (Chagas' disease) [68], T. cruzi, has cDNAs for two
CK1 homologues, TcCK1.1 and TcCK1.2 [69]. In budding yeast Saccharomyces
cerevisiae, yeast CK1 homologues are encoded by YCK1, YCK2 [70, 71], YCK3 [72]
and HRR25 [73]. YCK1 and YCK2 genes are required for bud morphogenesis,
cytokinesis, endocytosis and other cellular processes [70, 71, 74-76]. Hrr25p is involved
in regulating diverse events including vesicular trafficking, gene expression, DNA repair
7 and chromosome segregation [77, 78]. Fission yeast Schizosaccharomyces pombe has
CK1 homologs, hhp1 and hhp2 related structurally to the HRR25 gene product of
budding yeast [79] and three highly related CK1 isoforms Cki1, Cki2 and Cki3 [80, 81].
Of these isoforms, Cki1 is involved in regulation of phosphatidylinositol 4,5-
bisphosphate synthesis by phosphorylating and inactivating Phosphatidylinositol (4)P5-
kinase [82] while Cki2, is considered to contribute to the regulation of cell morphology
[83].
1.2.2 CK1 in higher eukaryotes
In higher eukaryotes, a CK1 homolog, dmCK1 is found in fruit fly, Drosophila
melanogaster [84, 85] while seven genetically distinct isoforms CK1α, CK1β, CK1γ1,
CK1γ2, CK1γ3, CK1δ and CK1ε are present in mammals. CK1α contains 337 amino acids and has a calculated molecular mass of 38.8 kDa [86]. Human CK1α gene has been mapped to chromosome 13q13 [87] and has been known to have splice variants α1, α2 and α3 [88, 89]. CK1β, found in bovine thymus has a molecular mass of 38.7 kDa and
78% sequence similarity to CK1α. Among the mammalian isoforms, only CK1β is not present in humans [90]. CK1γ has three isoforms designated as CK1γ1, CK1γ2, and
CK1γ3, with predicted molecular masses of 43 kDa, 45.5 kDa and 49.7 kDa respectively.
Within the protein kinase domain, the proteins are more than 90% identical to each other but only 51-59% identical to other CK1 isoforms within this region [91]. The human genes, hCK1γ1 (CSNK1G1), hCK1γ2 (CSNK1G2) and hCK1γ3 (CSNK1G3) has been mapped to chromosomes 15q22.1-->q22.31[92, 93], 19p13.3 [94] and 5q23 [95]
8 respectively. CK1δ with a molecular mass of 49.1kDa shares 76% identity with CK1α, and 65% identity with HRR25, HHP1 (78%) and its gene has been mapped to chromosome 17q25.2-q25.3 [89]. CK1ε has a molecular mass of 47.3 kDa with its kinase domain 53-98% identical to the kinase domains of other CK1 family members and is most closely related to CK1δ. Human hCK1ε gene has been mapped to chromosome
22q12-13 [96]. In comparison to yeast CK1 homologs, CK1α and CK1β isoforms lack
corresponding isoforms while CK1γ isoforms are most related to the YCK and Cki isoforms and the CK1δ and CK1ε isoforms are most conserved with Hhp1, Hhp2 and
Hrr25 [97].
CK1 is a phosphate directed protein kinase [98] recognizing the consensus sequence
S/T/Y(P)X1-2S/T/Y where S/T/Y(P) is any phosphorylated serine, threonine or tyrosine residue and X is any amino acid [97]. However unlike most protein kinases, they appear to function as constitutively active enzymes [65]. CK1 activity is present in most of the tissues as shown by the analysis of the distribution of CK1 among different rat tissues.
CK1 activity was detected in kidney, spleen, liver, testis, lung, brain, heart, skeletal muscle and adipose tissue. Among different subcellular fractions of rat liver CK1 was detected in cytosol (72.1%), microsome (17.6%), mitochondria (9.6%) and nuclei (0.7%)
[99, 100]. The distribution of CK1 family throughout the subcellular fractions and their relatively broad nature of consensus sequence explains the wide phophorylational control by CK1 as evidenced in SV40 DNA replication, DNA repair, and cell metabolism [101-
120]. In particular, CK1α is involved in membrane trafficking, RNA processing, mitotic spindle formation and cell cycle progression [121-125]. Of the three γ isoforms,
9 CSNK1G2 has been implicated in signaling pathways downstream of receptor tyrosine kinases due to its interaction with Nck, a 47-kDa cytosolic adaptor protein [126]. In interphase cells of various mammalian species, CK1δ specifically interacts with the trans
Golgi network and cytoplasmic, granular particles that associate with microtubules suggesting a role in mitosis [127]. Along with CK1δ, CK1ε is known to phosphorylate p53 [128] and form one of the essential components of the circadian rhythm [129-132] and Wnt (wingless) pathway [133-138].
1.2.3 Conserved residues in CK1
Phosphosphorylation of several substrates both in cellular and pathological milieu necessitates the knowledge of CK1 regulation and protein substrate recognition.
Comparison of crystal structure of Cki1 and CK1 with other protein kinases shows several conserved residues. Threonine (T) 166 is one of the conserved residues, which has been implicated in regulation of the CK1 enzyme. Hence it would be of interest to investigate if T166A mutation will have reduced phosphorylation activity. Based on the crystal structure comparisons, Arginine (R) 183, Lysines (K) 222 and 229 have been predicted to bind to the phosphate moiety of phosphoprotein substrates. Using site- directed mutagenesis we had mutated each of these residues into Alanine. With casein and radioactive labeled ATP as co-substrates we performed kinetic analysis for the CK1 mutants. Chapter 4 is a structure-guided study devoted to the understanding of regulation of CK1 enzyme and its ability to recognize phosphorylated substrates.
10
1.3 Pin1 overview
In addition to the post-translational modification, isomerization has also been shown to
play an important role in maintaining the tau/microtubule equilbria, implying a role for
Peptidyl cis/trans isomerase 1 (Pin 1) [139, 140]. Pin1 is a two-domain protein of 18.4
kDa, consisting of an N-terminal WW domain important for substrate targeting and a C-
terminal catalytic domain, which changes the substrate conformation by catalyzing the
cis/trans isomerization of peptidyl-prolyl imide bonds. A flexible linker of 12 residues
connects the WW and catalytic domain. The Pin1 catalytic domain neither interacts with
protein substrates in vitro, nor performs the essential function of the protein in vivo while
WW domains are needed to recognize and mediate the interactions with most substrates.
Two invariant tryptophans and a high content of proline and hydrophobic aromatic
residues characterize WW domains [141] containing 38 to 40 amino acid residues in a
triple-stranded β-sheet [142]. The WW domain consists of four classes: Three that
recognize short proline-rich motifs and the fourth that recognizes phosphoserine (pSer) or
phosphothreonine (pThr)-proline motifs. The Pin1 WW domain are members of the fourth
group and interact with phospho-Ser/Thr-Pro motifs in several proteins in a
phosphorylation-dependent manner [143-146].
Two models of Pin1 action have been put forward: 1) sequential model and 2) Tag and
Twist model. In the sequential model, the WW domain needs to dissociate in order for the
catalytic domain to bind and isomerize the pS/T-P peptide substrate. However in the “Tag
11 and Twist” model the WW domain anchors Pin1 to an already phosphorylated pS/T-P
motif on another protein, which is part of a multienzyme complex involving a kinase or
phosphatase. The kinase would "tag" the substrate via phosphorylation and Pin1 would
subsequently isomerize or "twist" the pS/T-P imide bond. In this case, the domain
flexibility of Pin1 is crucial for it to function as a generic "twisting" module working
together with a multitude of kinases and phosphatases. The 15N spin relaxation data,
differential chemical shift mapping and residual dipolar coupling data indicate that Pin1 can either behave as two independent domains connected by the flexible linker or as a
single intact domain with some amount of hinge bending motion depending on the
sequence of the bound peptide, suggesting that ‘Tag and Twist model’ might be the
model in which Pin1 action takes place [147-149].
Pin1 is involved in catalyzing the cis to trans conformations of the phosphor (ser/thr)
motifs present on tau. However in contrast to the effect of kinases on tau which can lead
to hyperphosphorylation, Pin1 was shown to have a protective role against filament
formation. Pin1 knockout in mice causes progressive age-dependent neuropathy
characterized by motor and behavioural deficits, tau hyperphosphorylation, tau filament
formation and neuronal degeneration [150]. Several studies involving presence of tau in
AD brains show that the Pin1 is sequestered into NFTs, thereby leaving very few Pin1
granules to have the protective effect [142, 146, 151]. With this background, we investigated the colocalization of Pin1 with AD lesions in Chapter 2.
12
1.4 Caspase-3
In several neurodegenerative diseases including acute neuronal loss or slowly developing
diseases there are at least two major events that contribute to neurodegeneration. One is the loss of neuronal connectivity while the other is cell loss. Studies suggest that degenerating neurons may use multiple execution pathways [152]. The mechanism by which cells die in AD is unknown. The extensive neuron loss occuring in AD brain has
led to the speculation that dysregulation of apoptotic death pathways might be involved
in the disease. In mammalian cells, apoptosis is regulated by a family of cysteine
proteases called caspases. Caspases are cysteine proteases that cleave crucial substrate
proteins exclusively after aspartate residues [153]. Caspases degrade APP, presenilins
(PS1, PS2), tau, and huntingtin, raising questions on their role in neurodegeneration
[154].
Caspase-3, a critical effector of neuronal apoptosis, might be inappropriately activated in
response to amyloid beta (Aβ) exposure in vitro, in animal models of neurodegenerative
diseases and in AD brain itself [155]. Examination of cortical and hippocampal brain
sections from AD patients, as well as 2 animal models of AD, for in situ evidence of
caspase-3 activation revealed that though caspase-3 does not have a significant role in the
widespread neuronal cell death that occurs in AD, it might contribute to the specific loss
of hippocampal neurons involved in learning and memory [156]. Western blots of
caspase protein levels in AD and control brains showed that dysregulation of apoptotic
13 proteins indeed exists in AD brain and support the notion that it may contribute to
neuropathology of AD [153]. Chapter 2 also includes the investigation of caspase-3 with
AD lesions, similar to the CK1 and Pin1 colocalization studies.
1.5 Inclusion Body Myositis
To understand if similar correlation between tau lesions and the kinases are observed, we
had also investigated CK1 kinases in muscle degenerative disease IBM containing
phospho-tau. IBM along with polymyositis (PM) and dermatomyositis (DM) form the major categories of idiopathic inflammatory myopathy [157-159]. These myopathies are
characterized clinically, by muscle weakness and histologically, by inflammatory
infiltrates within the skeletal muscles [160, 161]. Each category retains its characteristic
clinical, immunopathologic, and morphologic features regardless of whether it occurs
separately or in connection with other systemic diseases [162, 163]. Muscle biopsy is
mandatory to confirm the diagnosis of an inflammatory myopathy [164]. Muscle fiber
and capillary damages have been observed in DM while lymphocytes and macrophages
are seen in PM and IBM partially invading non-necrotic fibers. IBM is also characterized
by rimmed vacuoles with membranous whorls, characteristic masses of filaments in the
cytoplasm or nuclei and grouped atrophic fibers [165] and unlike other inflammatory
myopathies, IBM is unresponsive to anti-inflammatory drugs [166].
IBM is a progressive muscle disease leading to severe disability [167] and has both
sporadic as well as familial form of the disease. Sporadic inclusion body myositis (s-
14 IBM) mainly affects elderly individuals [168], more commonly men. Virtually in all cases of s-IBM, the muscle biopsy specimen displays inflammation along with the presence of vacuoles rimmed with basophilic material. Though the number of fibers showing rimmed vacuoles varies between cases, at least one percent of fibers with rimmed vacuoles is commonly observed [169]. These rimmed vacuoles are accompanied by the accumulation of proteins similar to those found in the degenerating neurons of AD
[170]. Hereditary inclusion body myopathies (h-IBM) comprise autosomal recessive and autosomal dominant muscle disorders that have a variable clinical phenotype.
Cytopathological comparison of h-IBM to s-IBM biopsies show similar pathological features but lack of inflammation in h-IBM [171-173]. The gene for one form of h-IBM has been mapped to chromosome 9p1-q1 and might provide a lead for the investigation of s-IBM [174].
The sequential steps of the pathogenic cascade are not understood in either s-IBM or h-
IBM. It has been postulated that their different causes trigger the same upstream aberration leading to a similar downstream cascade of pathologic events, which are ultimately responsible for the characteristic muscle-fiber degeneration. Muscle aging and oxidative stress have been shown to be some of the important factors contributing to the s-IBM specific muscle fiber destruction [175]. An unusual feature of s-IBM is accumulation within its abnormal muscle fibers of several proteins that are characteristic
of AD brain. These include epitopes of ubiquitin, beta-amyloid protein and its precursor protein, phosphorylated tau, alpha-1-antichymotrypsin, apolipoprotein E, and presenilin-1
[170, 172, 176-178]. The accumulation of "Alzheimer-characteristic" proteins in
15 vacuolated muscle fibers, the lack of clear response to corticosteroids and immunosuppressive therapies as well as the increasing number of fibers with vacuoles and amyloid deposits had suggested that s-IBM might primarily be a degenerative disorder with inflammation being a secondary response [179].
One of the main histopathological feature of AD is the accumulation of PHFs as NFTs
[39, 180-182]. Askanas et al have shown that in s-IBM, using the AD established phospho-tau antibodies, filamentous aggregates termed as twisted tubulofilaments (TTFs) were observed. Electron microscopy revealed that TTFs had similar structure to the PHFs observed in AD brain. Use of non-phosphorylated tau antibodies had resulted in the weak staining of the filamentous aggregates. However the intensity of staining was increased when alkaline phosphatase was used before using the non-phosphorylated tau antibodies.
This suggested that the tau seen in s-IBM might be phosphorylated tau and not normal tau [183]. Involvement of CK1 isoforms in tau containing lesions of AD suggested that presence of phosphorylated tau in a lesion would increase the probability of the presence of CK1 enzyme in the same lesion. In order to investigate this hypothesis, we examined the presence of CK1 in non-neural lesions. Chapter 3 is devoted to the examination of
CK1α, CK1δ and CK1ε in tau inclusions of IBM.
16
1.6 Immunohistochemical (IHC) technique
Investigation of colocalizations of enzymes with lesions was done using
Immunohistochemistry. This technique was chosen because the inherent specificity of an
enzyme for its substrate or that of an antibody for its antigen forms the basis for precise
cytochemical localizations [184, 185]. We had used indirect immunofluorescence to
study the presence and colocalization of proteins.
Fluorescence is the property exhibited by substances that absorb light of short wavelength
and emit light of longer wavelength. This phenomenon can be observed with fluorescence microscopes in which arrangements are made for the emitted wavelength to reach the eye while the short wavelength does not. There are two types of immunofluorescence: 1) Direct method: A known antigen in a section of the tissue is
localized by the virtue of its combination with fluorescently labeled molecules of its
antibody and 2) Indirect method: a secondary antibody binds to an already present
primary antibody attached to the antigen. This technique is superior to the direct
technique, since 1) it is not necessary to label and hence reduce the potence of the
valuable primary antiserum and 2) the determinant sites of antigens are multiple,
consequently more than one molecule of fluorescent antibody will be able to attach to
each primary antibody. And hence the indirect immunofluorescene method is versatile
and technically quicker than any other enzymatic procedures [184, 185].
17 The outcome of IHC technique is dependent on several criteria. The most important ones
are:
1) Preservation and immobilization of the chemical substance by appropriate
fixing and processing. In fixing for morphological purposes, only macromolecular protein
framework is retained. However most enzymes are inactivated to some degree by fixation
and in addition some are soluble. Hence we used frozen tissues to overcome the issue of
enzyme degradation. Also by immediately laying the cut section (30 µm, for
Hippocampus tissue and 10 µm for muscle tissue) on the Poly-L-lysine coated glass
slides, we were able to minimize tissue curling.
2) Blocking of non-specific activity. To make sure the interaction observed was
specific, we used primary and secondary deletes to confirm the presence of proteins before proceeding onto the colocalization experiments.
3) Fluorophores used should be small enough to be localized among the cell components while being large enough to be resolved by microscopes. We used secondary antibodies linked to well-established flurophores (Texas Red, FITC, Alexa488 and
Alexa594) and small fluorophore dyes (Thioflavin-S and Thiazin red) [186-188] which have high affinity for beta-pleated protein structures to visualize the NFTs [188].
4) Sensitivity of the histochemical test. We had considered this issue especially
when evaluating the negative results. Negative results might mean that either the material
is absent or insufficient for detection or it could be that an interfering reaction might be
present. It can also mean that the substance has been chemically altered or that the
substance was lost from the tissue during the preparation [184, 185, 189].
18 1.7 Epi-fluorescence /Confocal microscopy
Attentions paid to the above details in immunohistochemistry will help in the
visualization of the proteins present in the tissue. Visualization can be done by using
either epi-fluorescence or confocal microscopy. Conventional epi-fluorescence
microscopy has been widely used for the localization of fluorescent probes at the cellular
and subcellular levels. However, the interpretation of images obtained with classical
fluorescence microscopes suffers from the out-of-focus blur of the fluorescence emission.
The use of conventional microscopes in the multifluorescence analysis of specimens has
severe limitations. They are 1) sequential acquisition or the changes of filter sets can lead
to small variations in the position in the fine magnification of the final image and 2) the
sharpness of the contrast can be altered due to the out-of-focus fluorescence emission of the specimen [190]. Hence we have only used the epi-fluorescence microscopy to
quantitate the presence of proteins at the coarse intracellular level.
For qualitative investigation (example: investigation at the granular level) and for
obtaining high resolution images, confocal microscopy was used. The term “confocal”
refers to the condition where two lenses are arranged to focus on the same point,
therefore, sharing the same foci. In conventional light microscopy, two-dimensional
images of the object are formed in the X and Y planes, generally parallel to the plane of
sectioning. This is also true of confocal microscopy, but each image represents only part
of the thickness of the sample [191] and hence compared to conventional microscopic
techniques, it has the advantages of increased image resolution and the capability for 3-D
19 reconstruction [192, 193]. In confocal laser scanning microscopy (CLSM) a focused laser
beam scans the surface of the specimens and penetrates into the tissue. The intensity of
the remitted light is recorded [194]. Also CLSM is microscopy of optical sections.
Introducing a diaphragm in the beam path cuts off light, which is emitted from regions
other than the focal plane. The result is an optical "slice", which shows more details
because the blurring from out of focus haze disappears [195, 196]. Though CLSM is
technically advanced than epi-fluorescence microscopy, it also has some limitations. Self-
shadowing effects of thick specimens, spherical aberrations due to the sub-optimum use
of the objective lenses and photo-bleaching processes occur due to the instrumental and
experimental factors which can introduce some bias into the acquisition of the data set
[197]. Hence understanding the limitations while using the IHC techniques with either fluorescence/confocal microscopy can yield new information [198] about the structural relationships of the tissues of the normal or disease organism. This would help in gaining insight into how the disease develops [184, 185, 189].
In summary, Chapter 2 investigates the CK1 isoforms, Pin1 and caspase-3 enzymes in lesions of AD hippocampus, Chapter 3 examines the CK1 isoforms in the IBM muscle tissue, Chapter 4 is the crystal structure guided functional study of critical residues for
CK1 kinase activity and Chapter 5 summarizes the results obtained in Chapter 2, 3 and 4.
20
CHAPTER 2
VULNERABILITY OF LESION AFFECTED NEURONS TO THE PRESENCE
OF ENZYMES INVOLVED IN ALZHEIMER’S DISEASE
2.1 Summary
Neurofibrillary tangles (NFTs) and Granulovacuolar degeneration bodies (GVBs) are
pathological lesions in Alzheimer’s disease (AD), which parallel the disease progression.
CK1α and CK1ε isoforms of the CK1 family of phosphotransferases along with Proline directed peptidyl cis/trans Prolyl isomerase-1 (Pin1) and the cysteine protease, Caspase-3,
have been implicated in NFTs and GVBs. Investigation of the extent of colocalization of
these enzymes with each of the lesions in the affected neurons was carried out by double
labeled immunofluorescence studies. It was observed that CK1 isoforms colocalized well
with the lesion affected neurons. Examination of CK1α with different stages of NFT
formation, showed that CK1α colocalized well with pre-tangle stage, the intraneuronal
NFT stage as well as the extraneuronal stage NFTs. Comparison of the distribution of
CK1α, Pin1 and Caspase-3 in lesion affected neurons pointed out to a greater association
of these enzymes to either NFTs or GVBs suggesting an inverse relationship between the 21 presence of these lesions in the same neuron. Examination of colocalization of NFTs and
lesions in the same neuron demonstrated that lesion affected neurons have a very high
propensity to either have only NFT or only GVBs. This implied that the presence of one
lesion tends to exclude the alternative lesion from the same neuron.
2.2 Introduction
AD is histopathologically characterized by the presence of fibrillar pathology and GVBs
[199-203]. The fibrillar pathology is comprised of neuritic plaques (NPs), neurofibrillary
tangles (NFTs) and neuropil threads (NTs) [204]. NFTs constitute the intraneuronal
deposition of filamentous hyperphosphorylated tau, and is found in the cell bodies and
apical dendrites [205-208] in the form of paired helical filaments (PHFs) [209-211].
Elongation of PHFs gradually results in their arrangement into bundles whose core regions are occupied by straight filaments [212]. Electron microscopy examination of
PHFs derived from AD brain as well as that of reassembled fibers, have shown an increase in level of beta-structure from the random coil structure dominated in the
natively unfolded protein [213]. Presence of clear cross-beta structure in tau filaments has
been confirmed by X-ray diffraction and Fourier transform infrared spectroscopy [213,
214]. This enables the use of Thioflavin-S [186] and Thiazin red [187, 188] which have
high affinity for beta-pleated protein structures to visualize the NFTs [188].
Structurally, GVBs consists of cytoplasmic spherical vacuoles 3 to 5 µm in diameter, in
the center of each of which is an argyrophilic hematoxyphilic granule of 0.5 to 1.5 µm
22 wide [215]. GVBs detected by classical Hematoxylin & Eosin staining have been known to correlate with CK1 isoform stained bodies. It has also been shown, that the intrahippocampal distribution of CK1-positive bodies follows the pattern established for
the distribution of GVBs. Electron microscopy of the ultrastructure of granules labeled
with anti-CK1δ monoclonal antibody had demonstrated that CK1-positive granules retain
the ultrastructure of GVBs. It also confirmed that CK1-positive bodies, similar to those
observed in authentic GVBs, have three to five orders of magnitude larger volume than normal intracellular bodies such as endosomes or lysosomes. Based on these criteria CK1
isoforms have been known as biochemical markers for GVBs [9]. Since CK1δ
monoclonal antibody had been used to demonstrate that CK1-positive granules retain the
ultrastructure of GVBs, we defined that punctuate granules visualized by CK1δ immunofluorescence as GVBs for the subsequent investigations.
The mammalian CK1 family consists of CK1α, β, γ1, γ2, γ3, δ and ε derived from seven distinct genes [216]. In AD hippocampus, protein levels of CK1 isoforms CK1α, CK1δ
and CK1ε are elevated 2.4, 33 and 9-fold respectively. Of these isoforms, the extent of
colocalization of CK1δ with fibrillar pathology has been studied. It was observed that
CK1δ stained 90% of Thioflavin-S stained NFTs [9]. The high percentage of colocalization with NFTs implied that CK1δ plays a main role in tau
hyperphosphorylation, which was later confirmed in HEK293 cells [217]. Unlike CK1δ,
which immunostained the cell bodies of pyramidal neurons, CK1ε appeared widespread
in gray matter while CK1α was shown to be widely distributed throughout the temporal
lobe [218]. To determine if these isoforms could play a role in tau hyperphosphorylation
23 similar to CK1δ, we investigated the extent of colocalization of CK1α and CK1ε with the
NFTs.
Depending upon the phosphorylation sites on tau, the conformational changes and cytopathological alterations are expressed as three stages of NFT development [37].
Neurons where the cell soma has regions of diffuse tau staining is known as the Pre- tangle stage [37]. The conformation-dependent antibody, Alz-50 recognizes intramolecular linkages on the tau molecule (5-15 & 312-322) [219-221] present in pre-
tangles, and hence can be used for the identification of pre-tangles. Intraneuronal NFT
(iNFT) is the second stage of cytopathological development of NFTs [37]. iNFTs are
comprised of fibrillar tangles, immunoreactive to the AT8 antibody, which selectively
recognizes phosphorylated Ser (199/202) and phosphorylated Thr (205) of PHF-tau
protein [220, 222]. The final stage is the extraneuronal fibrillary tangle (eNFT) stage
where the neuron dies and the eNFT or the ghost tangle remains [37]. eNFT can be
recognized by SMI 310, a neurofilament antibody which reacts with extraneuronal, but
not with intraneuronal tangles [223-225].
CK1 is one of the candidate kinases involved in tau hyperphosphorylation [226]. To have
a direct effect on tau hyperphosphorylation, the levels of CK1 enzyme should be
upregulated in neurons developing tangles [227]. CK1α, CK1δ, CK1ε has been
histopathologically been implicated in AD lesions, suggesting their proximity to the
physiological relevant site of phosphorylation [9]. Hence it would be of interest to
investigate if these isoforms of CK1 are expressed at different stages of NFT maturation.
24 However due to the limitation of antibody compatibility, we chose a goat monoclonal
antibody against CK1α as the CK1 isoform to investigate if CK1 is present in different
stages of NFTs. We also examined if there was colocalization between the CK1α
immunoreactive neurons and GVB affected neurons visualized by CK1δ.
Tau contains phospho (Ser/Thr)-Pro motifs which can exist in either of two distinct trans
or the cis conformations [150]. There is a slow interconversion between these states
[228]. About 10 to 20 % of the peptides are assumed to be in the cis state [229]. One of
the enzymes involved in the conversion from cis to trans conformation is the peptidyl-
prolyl cis/trans isomerase1 (Pin1) enzyme [230]. Pin1, only recognizes the peptide bond
of the already phosphorylated Ser/Thr-Pro motifs [231] and preferentially isomerizes
proline residues preceded by pSer/Thr–Pro [232] with up to 1300-fold selectivity compared with unphosphorylated peptides [233]. Pin1 is made up of two domains: WW
domain and the isomerase domain[139, 140, 147, 148, 234-236]. The WW domain of
Pin1 recognizes the pThr131-Pro132 [147], pThr212-Pro213, pThr217-Pro218, pThr231-Pro 232
[140] motifs present on phosphorylated tau, making phosphorylated tau an ideal potential
substrate [140, 237]. The isomerization effect of Pin1 is important because protein
phosphatase 2A (PP2A) can dephosphorylate only the trans- peptide of phosphoryltated
tau [228, 238-241]. In vitro binding study has shown that Pin1 restores the ability of
phosphorylated tau to bind to microtubules [242], demonstrating the importance of
association of Pin1 with NFTs.
25 Immunostaining of Pin1 in normal brains showed that Pin1 was present in the nucleus
while in AD brains the Pin1 staining was found both in the nucleus as well as cytoplasm.
Glutathione S-transferase (GST)-Pin1 pull down assay had demonstrated that Pin1 binds
to PHFs purified from AD brains [242]. Using Pin1 antibody and AT8,
immunofluorescence studies have shown that in AD brains some of the Pin1
immunostained neurons colocalized with tangles. However based on the intensity of Pin1
immunostaining, it was said that 96% of the neurons intensely stained with Pin1 did not
have tangles while 71% of tangles having low intensity of staining had NFTs. This had
suggested that decreased presence of Pin1 might result in the formation of NFTs. Pin1
knockout mice, Pin1-/- exhibited progressive age-dependent motor and behavioral deficits while histopathologically 68K form of tau which is hyperphosphorylated and contained
NFT conformations was found in their brains [150]. Other attempts to study the colocalization of Pin1 with NFTs have resulted only in the colocalization of Pin1 granular staining with granular staining of tau antibody, TG3, but not with tangle-like stainings exhibited by TG3. Pin1 was also observed not to colocalize with a similar tau
AT-180 antibody. Hence it was suggested that presence of Pin1 might not be disease specific [234, 243]. Hence using Thioflavin-S for NFTs as well as the Pin1 antisera we had prepared, we investigated the extent of colocalization of Pin1 immunoreactivity with
NFTs.
Earlier investigations of Pin1 in AD brains have shown that Pin1 exhibited granular-like staining similar to the punctuate structures observed as GVBs [234]. Using ubiquitin as marker for GVBs, investigation showed that there was no colocalization of Pin1 granules
26 with ubiquitin stained structures. Hence it was claimed that Pin1 granules might represent
a new type of lesion. It was also observed that C18 antibody raised against C-terminus of
CKIδ stained the Pin1 punctate structures, implying the presence of CKIδ within the granules [243]. Since the specificity of C18 for CKIδ in AD brain homogenates has not been shown before, we examined the specificity of C18 in comparison with previously established CKIδ antibody, IC128A. IC128A had been used previously to characterize
CKIδ granules as GVBs [9]. Hence we investigated if Pin1 granules colocalized with
GVB using CKIδ antibody, IC128A, as the GVB marker.
AD has also been associated with neuronal loss and one mechanism responsible for the extensive neuronal cell loss might be the activation of apoptotic pathways [244-246]. An association with apoptotic processes is a newly emerging concept in AD [247, 248] with tau, Bcl-2, APP, and presenilins as substrates for caspase-3 [249], which is one of the executioner caspases [250]. At residues 22-25, 338-341 and 418-421, tau contains caspase-3 consensus recognition sequences making it a good substrate [251] for the downstream executioner enzyme of apoptosis [252]. It has been observed that Tau
P301L, one of the FDTP-17 tau mutations [253], which binds less avidly to microtubules than wildtype tau in living cells [254], induces caspase-3 activity [255]. This suggested that abnormal expression of tau might indicate the activity of caspase-3, implying the presence of caspase-3 in NFTs. Antibodies recognizing active cleavage products of caspase-3 colocalized within NFTs suggesting the activation of caspase-3 within neurons of the AD brain [250]. Colocalization studies done to examine the colocalization of caspase-3 immunoreactivity using various antibodies to NFTs present in AD brains have
27 so far been unsuccessful. In contrast, attempts to understand the caspase-3
immunoreactivity in AD brains, had always resulted in punctuate granular-like staining of
GVBs [156, 256]. However the granular-like staining has not been confirmed using a
marker for GVBs. Since CK1δ is a good marker for GVBs, we investigated the colocalization of caspase-3 immunoreactivity in GVB affected neurons stained by CK1δ.
In addition, using Thioflavin-S as marker for NFTs, we investigated the colocalization of caspase-3 immunoreactivity with NFTs.
In elderly normal and demented (AD, MID, atypical dementia) brains, the statistically most representative ranking order of predilection for GVB have shown that the CA1 region is the region primarily affected in the hippocampus area [200, 257, 258]. AD shows a positive correlation with severity of both tangle formation and granulovacuolar degeneration [215]. Topographic analysis has shown the rank order for NFT lesions as entorhinal cortex > subiculum > H1 > end-plate > presubiculum > H2, while for GVB containing neurons the rank order is subiculum > H1 > H2 > endplate > entorhinal cortex
> presubiculum. A comparison of these orders indicates that both H1 and the adjacent subiculum are heavily affected by both of these lesions [259]. The occurrence of GVBs and NFTs have been assumed to be in the same neuron since the topographic analysis performed on the distribution of tangles and GVBs in elderly normal and AD brains showed notable similarity in the orders of predilection of these lesions [200, 259, 260].
Recent studies using caspase-3 and AT8 antibodies suggested that AT8-positive neurons had 5.5 times higher risk of containing GVBs [261] while neurons containing Pin1 granules were seen to be devoid of neurofibrillary tangles [243]. Comparison of the 28 colocalization extents of the CK1δ stained GVBs with Thioflavin-S NFTs as well as the pre-tangles visualized using Alz-50 antibody would reveal if the lesions are present within the same neuron. Using these markers, we investigated if both GVB and NFT lesions are present within the same neuron.
2.3 Materials and Methods
2.3.1 Antibodies
IC128A (1.5 µg/ml, Icos Corporation, Bothell, WA) is a monoclonal mouse antibody of the subtype IgG raised against CK1δ. C-18 (0.2 µg/ml, Santa Cruz Biotech, CA) is a goat polyclonal IgG recognizing the C-terminus of CK1δ of human origin. C-19 (0.2 µg/ml,
Santa Cruz Biotech, CA) is a goat polyclonal IgG recognizing the C-terminus of CK1α of human origin. C40250, an anti-CK1ε antibody (2.5 µg/ml, BD Transduction
Laboratories, CA) is a mouse monoclonal IgG generated against human CK1ε. Caspase-3 antibody, C 92-605, is an affinity purified rabbit anti-active Caspase-3 IgG polyclonal
(1:100 dilution, BD Biosciences Pharmingen, San Diego, CA). Alz-50 (0.8 µg/ml, Peter
Davis, Albert Einstein College of Medicine, NY) is a mouse monoclonal antibody of the subtype IgM, selective for conformation dependent tau [262]. Tau antibody, AT8 is a mouse monoclonal IgG antibody (1 µg/ml, Endogen, Woburn, MA). Neurofilament antibody, SMI 310 is a mouse monoclonal IgG1 (1:250 dilution, Sternberger
Monoclonals, Baltimore, MD). We prepared rabbit polyclonal antisera against a
bacterially expressed amino terminal fusion protein between a cellulose binding domain
(CBD) affinity tag and Pin1. The coding sequence of Pin1 (Hugh Campbell, Australian
29 National University, Canberra, Australia) [263] was subcloned into the pET-34b(+) CBD
vector (CBD-Tag TM, Novagen, Inc.), and expression of the fusion protein was induced in
transfected BL21 (DE3) E. coli cells after treatment with 1 mM IPTG. The resulting Pin
1 rabbit antisera were shown to react specifically with both bacterially expressed CBD-
Pin1 and GST-Pin1 fusion proteins (data not present).
Texas Red conjugated AffiniPure Goat Anti-Mouse IgG, Fcγ (1.5 µg/ml, Jackson
Immuno Research Laboratories, Inc., West Grove, PA), Fluorescein (FITC)-conjugated
Affinipure Goat Anti-Mouse IgG Fcγ (1.5 µg/ml, Jackson Immuno Research
Laboratories, Inc., West Grove, PA), Alexa 594 Goat Anti-Mouse IgG (2 ng/ml,
Molecular Probes, Inc., Eugene, Oregon) and Alexa 488 Goat Anti-Mouse IgG (2 ng/ml,
Molecular Probes, Inc., Eugene, Oregon) were used as secondary antibodies with mouse
primary IgG antibodies. Fluorescein (FITC)-conjugated Affinipure Goat Anti-Mouse
IgM (1.5µg/ml, Jackson Immuno Research Laboratories, Inc., West Grove, PA) and
Texas Red conjugated AffiniPure Goat Anti-Mouse IgM (1.5µg/ml, Jackson Immuno
Research Laboratories, Inc., West Grove, PA) were used with primary IgM antibody.
Fluorescein (FITC)-conjugated Affinipure Goat Anti-Rabbit IgG Fcγ (1.5µg/ml, Jackson
Immuno Research Laboratories, Inc., West Grove, PA) and Texas Red conjugated
AffiniPure Goat Anti-Rabbit IgG, Fcγ (1.5µg/ml, Jackson Immuno Research
Laboratories, Inc., West Grove, PA) were used to visualize rabbit IgG primary antibodies. Alexa 594 (2 ng/ml, Molecular Probes, Inc., Eugene, Oregon) and Alexa 488
Donkey Anti-Goat IgG (2 ng/ml, Molecular Probes, Inc., Eugene, Oregon) were used as secondaries with goat IgG primary antibody.
30
2.3.2 Fluorophores
NFTs were stained by Thioflavin-S (0.003% w/v in distilled water, Sigma, St. Louis,
MO) [186, 264, 265] or Thiazin red [38, 266] (also known as Geranine G, 0.003% w/v in distilled water, Tokyo Chemical Industry, Portland, OR). Thioflavin-S is more sensitive than Thiazin red when recognizing oligomeric fibrils with beta-sheet structure [267].
Hence Thioflavin-S was used for the quantification of NFT lesions while Thiazin red was
used in imaging using confocal microscopy. Sudan Black-B (SBB, 0.01% w/v in distilled
water, EM Diagnostics, Gibbstown, NJ) was used to reduce the intensity of lipofuscin
autofluorescence in immunofluorescent labeling [268, 269].
2.3.3 Human Tissue
Free floating 4% paraformaldehyde fixed 40-µm thick AD and control hippocampus sections in cryoprotectant solution (20% glycerol and 2% PBS) were obtained from Rush
Alzheimer's Disease Center (RADC), IL. 4% paraformaldehyde fixed AD and control hippocampus tissue blocks were provided by Dr. Paul Coleman, University of Rochester
Medical Center, NY. Formalin fixed AD samples was provided by Harvard Brain Tissue procurement center, MA and Dr. Maria Santi from the Ohio State University Hospital,
OH. Tissue blocks were sectioned into 25-µm sections. The sections and tissue blocks provided were of the human hippocampus cut at the level of the Geniculate Nucleus. AD cases had a clinical diagnosis of probable AD that was confirmed on neuropathological
31 evaluation in which the Consortium to Establish a Registry for Alzheimer's disease
(CERAD) age-adjusted criteria were met. Control cases were nondemented clinically and failed to fulfill the age-adjusted neuropathological criteria for AD. The clinical pathological reports of individual cases have been tabulated in Table 2.1.
32 Serial Case type Age/Gender Brain PMI(h) Comments Number Weight
1 Control 84F 1200 20.0 Braak stage I, No AD
2 Control 64F 1400 20.0 Braak stage 0, No pathological abnormality
3 Control 75M 1300 8.15 Liver failure
4 Control 57M 1435 7.5 Cardiac failure
5 Control 64M 1400 7.0 N.A
6 Control 70M 1180 8.5 N.A
7 Control 52M 1400 6.5 Myocardial Infarction
8 Vascular 79M 1330 N.A Pure Vascular Dementia (No tangles)
9 AD/Vascular 81M 1200 4.05 Braak stage VI
10 AD/Vascular 81F 1050 N.A Braak stage V-VI
11 AD/Vascular 92F 1020 N.A Braak VI, vascular Involvement
12 AD 79F 1020 4.0 Frontal parietal atrophy
13 AD 61M 1180 5.25 Braak Stage V-VI
14 AD 86F 820 4.5 Slight familial history of dementia, definite AD
15 AD 91M 980 5.0 Senile Cerebral Disease,
Braak stage V-VI, Embolic infract
Table 2.1: Clinical pathology of cases 33 Table 2.1 continued
16 AD 87M 1020 2.5 Senile Cerebral Disease, Severe AD
17 AD 82F 1040 4.0 Senile Cerebral Disease, Severe AD
18 AD 86M 980 3.15 Senile Cerebral Disease, Severe AD
19 AD 82M 1285 6.0 Braak stage V, White matter pallor, frontal, moderate
20 AD 71F 870 6.0 Braak stage V, Arteriosclerosis, white matter, moderate
21 AD 87F 1030 N.A Definite AD
34 2.3.4 Immunohistochemistry
Tissue sections were processed for immunohistochemistry as described [218]. Briefly, the
sections were immunostained with primary antibodies in 1% Non-Fat Dry Milk (NFDM)
overnight at RT. Tris-buffered saline containing 0.1% Triton X-100 (Triton/TBS, pH 7.4)
were used for washes. After the application of secondary antibodies followed by washing,
the sections were then incubated in 0.01% SBB for 10 minutes to quench the
autofluorescence [268, 269]. The sections were then washed in neat TBS and cover
slipped using 80% Tris-buffered glycerol. When the fluorophores Thiazin red or
Thioflavin-S (Thio-S) was used, the sections were incubated with Thiazin red or Thio-S
for 20 minutes and washed with distilled water before SBB staining. For Pin1 antigen
retrieval, the sections were heated in a microwave for thirty seconds in antigen retrieval
TBS buffer (0.9% NaCl, 10mM tris-base, pH 9.0) preheated to boiling [270]. Following
the retrieval procedure, the immunohistochemical processing was done as described
above.
The distribution of the immunostaining for each protein in the CA1 region of Ammon's
horn and subiculum was observed and counted at 20 x magnifications using a Nikon
Eclipse 800 fluorescence microscope having Metamorph Imaging System and a SPOT
digital camera. After each field was observed, the stage coordinates were recorded to ensure a completely non-redundant evaluation. The stage was then moved manually to a
new field using fiduciary landmarks. Confocal images were obtained using a Zeiss LSM
510 Meta Laser Scanning Confocal Microscope fitted with Argon (Ar) and Helium/Neon 35 I (He Ne I) Laser lines. Images were viewed with Zeiss LSM Image Browser Release 3.2
and were processed using Deneba Canvas 9.0 (ACD Systems).
2.3.5 Analytical Methods
The tissue homogenates prepared as described previously [218] were run on a 12% gel.
Total proteins in the brain homogenates were estimated by the method of Bradford and levels of CK1δ, CK1α and Pin1 in tissue homogenates were estimated by Western
analysis as described previously [56].
2.3.6 Statistical analysis
Statistically significant differences between groups were determined using the unpaired
two-tailed Student’s t test, using Prism 4.0 (Graphpad software). Statistical errors are
reported as Standard Error of the mean (S.E.M).
2.4 Results
2.4.1 Western Blots
The affinity-purified rabbit antibody C-19 against CK1α, strongly recognized bands
between 34-38 kDa corresponding to the CK1α splice variant, CK1α2 (Figure: 2.1A)
[271]. IC128A, the CK1δ mouse monoclonal antibody obtained from ICOS corporation,
36 recognized protein bands around 55kDa, the expected apparent molecular weight of
CK1δ [272], in AD brain homogenates (Figure: 2.1B, lane 1). In comparison, rabbit
affinity-purified antibody C-18 to CK1δ only weakly labeled a band around 55kDa, while
strongly labeling a single band with an apparent molecular mass around 31.5 kDa in AD
homogenates (Figure 2.1: B, lane 2). These results strongly support the specificity of the
IC128A antibody for the δ isoform of CK1 and suggest that the C-18 antibody may cross react with other CK1 isoform degradation products or other proteins. Hence the IC128A antibody was chosen as the CK1δ antibody for the immunohistochemical studies. The specificity of anti- CK1ε antibody (C 40250) has been shown previously [9].
The Pin1 rabbit antisera we developed recognized a single band with an apparent molecular mass of 18 kDa in lysates prepared from cultured mammalian cells and brain tissue (data not presented). Similar results were obtained with preparations of human AD brain tissue (Figure: 2.1C). A single 18 kDa Pin1 band was detected in the low speed supernatant of an AD brain homogenate, as well as the high speed supernatant depleted of detergent resistant paired helical filaments (PHFs) (Figure: 2.1C, lane 1 and 3 respectively). The high-speed pellet containing PHFs (Figure: 2.1C, lane 2) showed a prominent band at 18 kDa, but also minor bands of lower molecular weight that may represent proteolytic fragments of Pin1.
37 2.4.2 Controls
Very weak fluorophore/immunostaining was observed in the age-matched control brains.
The primary deletes showed non-specific staining while very little staining was observed with secondary deletes (not shown).
2.4.3 CK1 isoforms correlate well with NFTs
CK1α immunoreactive neurons (Figure: 2.2 B) showed good colocalization with NFTs and were quantified to colocalize with 69.6 ± 4.5 % of the stained NFTs (Figure: 2.4).
Figure 2.2 (D-F) shows representative images of colocalizations observed with CK1ε immunoreactive neurons (E) and NFTs (D). Quantitation of the immunostaining showed that CK1ε immunoreactive neurons were found to colocalize with 84.5 ± 5.2 % neurons containing NFTs (Figure: 2.4). Examination of CK1α immunoreactive neurons with GVB containing neurons (Figure: 2.5 A-C) showed few examples of colocalizations between the two antibodies. Upon quantification it was determined that CK1α immunoreactive neurons colocalized with 28.0 ± 4.5 % of the GVB affected neurons (Figure: 2.7). It was also observed by the comparison of stainings of individual GVBs by CK1δ (Figure: 2.5
D), and CK1α (Figure: 2.5 E), within the same neuron, that a large extent of overlap of immunostaining exists for the two CK1 isoforms in the granules of GVBs (Figure: 2.5 F).
38 2.4.4 Pin1 granules might represent new lesion
Unlike CK1α and CK1ε, investigation of Pin1 immunoreactive neurons with NFTs revealed very little colocalization between Pin1 and NFTs. Figure: 2.3 E is a representation of Pin1 immunoreactive neurons showing GVB-like staining as well as tangle-like staining. Colocalization of Pin1 immunoreactive neurons with NFTs (Figure:
2.3 F) was quantified to be 15.4 ± 2.2 % (Figure: 2.4). To understand the GVB-like staining seen in Figure: 2.3 E, investigation of Pin1 immunostaining with GVB affected neurons were done. Figure: 2.6 (A-C) shows that Pin1 immunoreactive neuron colocalizes with GVB affected lesions. Quantitation of GVB affected lesions and Pin1 immunoreactive neurons showed that the extent of colocalization was 7.2 ± 1.6% (Figure:
2.7). At the granular level of GVBs, an intriguing observation was seen. It was observed that most of the GVB-like stained granules of Pin-1 did not colocalize to a great extent with GVBs stained by CK1δ (Figure: 2.6 A-C).
2.4.5 Caspase-3 more likely to be present in GVB containing neurons than in NFTs
Caspase-3 immunoreactive neurons colocalized with GVB affected neurons (Figure: 2.6
F). Quantitation revealed that 23.4 ± 2.1 % of the GVB affected neurons had caspase-3 immunoreactivity (Figure: 2.7), which is higher than the number of Pin1 immunoreactive neurons containing GVB affected lesions. However only few caspase-3 immunoreactive neurons were colocalized with NFTs. Quantifying the extent of colocalization revealed that 1.8 ± 0.4% caspase-3 immunoreactive neurons colocalized with NFTs (Figure: 2.4).
However when present, extensive colocalization was observed between the caspase-3 immunoreactive neurons and NFTs (Figure: 2.3 C). 39 2.4.6 CK1α and different stages of NFTs
Immunolabeling of neurons by Alz-50 revealed pre-tangle neurons exhibiting diffuse
staining in the cell soma (Figure 2.8 B) as described by Augustinack et al [37]. A high
level of colocalization was observed between the pre-tangle neurons and CK1α
immunoreactive neurons as seen in Figure: 2.8 C. CK1α immunoreactivity was present in
~ 66.1 ± 4.5% of the pre-tangle neurons (Figure: 2.9). AT8 immunostaining revealed the
iNFTs (Figure 2.8 E) and similar to the observation with pre-tangles, the extent of colocalization of CK1α immunoreactive neurons with iNFT was ~ 68.7 ± 3.2% of iNFT neurons (Figure 2.9). eNFTs were visualized by immunostaining with SMI 310 (Figure
2.8 H). As in other stages of NFTs, a high level of colocalization was observed on quantification. It was seen that ~77.5 ± 2.6% of eNFT neurons had CK1α immunoreactivity (Figure 2.9).
2.4.7 GVBs and NFTs do not coexist in the same neuron
To examine if NFTs and GVBs found in AD brain are present in the same neuron, as implied by their intrahippocampal distribution, immunohistochemical examination was done on CA1 regions of neuropathologically confirmed AD hippocampus. The staining obtained showed very little colocalization of lesions within the same neuron (Figure: 2.10
A-C). Quantitation revealed that ~10% of GVB affected neurons have NFTs while only
~6.5% of NFT containing neurons has GVBs (Table 2.2).
40 2.4.8 Pre-tangle neurons and GVBs
Pre-tangle neurons represents the initial stage of formation of NFTs and can be visualized
using Alz-50, a conformation dependent antibody [273]. Immunohistochemical examination to determine if the pre-tangle stage neurons harbored GVBs revealed that similar to NFTs, not many GVBs were present in the pre-tangle containing neurons
(Figure: 2.10 D-F). Results showed that ~9.1% of the GVB affected neurons had pre-
tangles while ~10.6% of pre-tangle affected neurons is likely to have GVB lesions within
them (Table 2.3).
41
AB C
C19 IC128A C18 kDa Pin1 71 CK1δ 41 18 Pin1 CK1α2 30
17
Figure 2.1 Western blots: Western blots showing specificity of commercial antibody detection of CK1α using C-19 antibody (A), comparison of specificity of IC128A against CK1δ (B, Lane 1) and C-18 against CK1δ (B, Lane 2) and detection of a single 18 kDa Pin1 band in the low speed supernatant depleted of detergent resistant paired helical filaments (PHFs) (C, Lane 1), high-speed pellet containing PHFs (C, lane 2) and the high speed supernatant depleted of detergent resistant PHFs (C, Lane 3) of AD brain homogenates.
42
Merged Image
A B C
Thiazin red CK1 α
D E F
Thiazin red CK1 ε
Figure 2.2 CK1 isoforms and Thiazin red staining of NFTs: Fluorescence visualization of NFTs using Thiazin red (A, D), immunofluorescence visualizations of CK1α with anti-CK1α antibody (C-19) linked to Alexa 488 secondary (B) and of CK1ε with anti-CK1ε antibody (C 40250) linked to Alexa 488 secondary (E). Colocalization was observed as yellow in the merged picture (C, F). Scale bar represents 10 µm.
43
Merged Image
A B C
Thiazin red Caspase-3 NFT
B C D E F
Thiazin red Pin1
Pin1
Figure 2.3 Thiazin red staining of NFTs colocalizing with Caspase-3 and Pin1. The NFTs were visualized using Thiazin red (A, D). Immunofluorescence visualizations of Caspase-3 with anti-Caspase-3 polyclonal linked to FITC secondary (B) and of Pin1 with Pin1 antisera linked to Alexa 488 secondary (E). Colocalization was observed as yellow in the merged picture (C, F). Scale bar represents 10 µm.
44 100 s 80
60
40
20 % neurons with affected NFT
0 CK1α CK1ε Pin-1 Caspase-3
Figure 2.4 Colocalization of CK1α, CK1ε, Pin1 and Caspase-3 immunoreactive neurons with NFT affected neurons. The NFT neurons in the AD hippocampus sections were visualized using Thioflavin–S. Along with the NFT staining, the sections were separately stained with anti-CK1α monoclonal antibody (C-19), anti-CK1ε antibody (C 40250), Pin1 antisera, anti-caspase-3 antibody. The NFTs in the CA1 and subiculum of the hippocampus that colocalized with CK1α, CK1ε, Pin1, Caspase-3 immunoreactive neurons were counted as described in Materials and Methods. The highest frequency of colocalization of NFTs was seen for the CK1 isoforms while the lowest was seen for caspase-3. Bars reflect mean ± S.E.M.
45
GVB affected neurons Merged Picture
A B C
CK1 α
D E F
CK1 α
Figure 2.5 CK1α and GVB affected neurons: Immunofluorescence visualization of GVB affected neurons with anti-CK1δ antibody (IC128A) linked to Alexa 488 secondary (A, D) and CK1α with anti-CK1α antibody (C-19) linked to Alexa 594 secondary (B, E) seen at interneuron level (A - C) and at intraneuronal level (E - F). Colocalization was observed as yellow in the merged picture (C, F). Scale bars represent 10 µm.
46
GVB affected neuron Merged Image
A B C
Pin1
D E F
Caspase-3
Figure 2.6 Pin1 and Caspase-3 with GVB affected neurons: Immunofluorescence visualization of GVB affected neurons with anti-CK1δ antibody (IC128A) linked to Alexa 488 secondary (A, D). Visualization of Pin1with Pin1 antisera linked to Alexa 594 secondary (B) and Caspase-3 with Caspase-3 antibody (E) linked to Alexa 594 secondary (B). Colocalization was observed as yellow in the merged picture (C, F). Scale bars represent 10 µm.
47
A C B 40
30
20
10 % GVB affected neurons affected GVB %
0 CK1α Pin-1 Caspase-3
Figure 2.7 Colocalization of GVB affected neurons with neurons immunoreactive to CK1α, Pin1 and Caspase-3 enzymes. GVB affected neurons in AD hippocampus were visualized with anti-CK1δ monoclonal antibody (IC128A). CK1α, Pin1 and caspase-3 were visualized using anti-CK1α monoclonal antibody (C19), Pin1 antisera and anti- Caspase-3 antibody, respectively. Colocalization of the GVB affected neurons and neurons immunopositive for CK1α, Pin1, caspase-3 in the CA1 and the subiculum regions of the hippocampus were counted and quantified as described in Materials and Methods. The highest level of colocalization was observed for CK1α while the lowest colocalization observed was for Pin1 immunostaining. Bars reflect mean ± S.E.M.
48
CK1 α Merged Image
A B C
Pre-Tangle
D E F
i NFT
G H I
e NFTs
Figure 2.8 CK1α and different stages of NFTs: Immunofluorescence visualizations of CK1α with anti-CK1α antibody (C-19) linked to Alexa 594 secondary (A, D, G), pretangle neuron with Alz-50 antibody linked to FITC secondary (B), intraneuronal NFT with AT8 linked to Alexa 488 secondary and extraneuronal tangles with SMI 310 antibody linked to Alexa 488 secondary (I). Colocalization was observed as yellow in the merged picture (C, F, I). Scale bar represents 10 µm. 49
100 α 75
50
25 % of lesion neurons i.r. to CK1
pre-tangles iNFTs eNFTs Type of Tangles
Figure 2.9 Distribution of CK1α immunoreactivity in different stages of NFT formation. CK1α immunopositive neurons were visualized with an anti-CK1α monoclonal antibody (C-19). The pre-tangles, iNFTs and eNFTs were visualized using Alz-50, AT8 and SMI 310 antibodies, respectively. Colocalization of CK1α immunoreactive neurons with pre-tangles and iNFTs and eNFTs in the CA1 and the subiculum region were counted as described in Materials and Methods. Quantification shows that CK1α was present in all stages of NFT formation. Bars reflect mean ± S.E.M.
50
A B C
A B C
D E F
Figure 2.10 GVB and NFT affected neurons. Immunofluorescence visualization of GVB affected neurons with anti-CK1δ antibody (IC128A) linked to Alexa 488 secondary (A). Fluorescence visualization of NFTs stained by Thiazin red (B) and pre-NFTs with conformation dependent antibody, Alz-50 linked to Texas Red secondary (E) in lesion affected neurons. Colocalization was observed as yellow in the merged picture (C, F). Scale bar, 10 µm.
51 Lesion containing Total number of Neurons per case neurons neurons (N=5)
Neurons affected with 1475 295±10 NFTs
Neurons affected with 943 189±9 GVBs
Neurons having both 95 19±3 GVBs and NFTs
`
Table 2.2: Number of lesion affected neurons containing GVBs and/or NFTs
Lesion Total number of Neurons per case containing neurons neurons (N=5)
Neurons affected with pre-Tangles 1085 217±6
Neurons affected with GVBs 251±8 1257 Neurons having both GVBs and pre-tangles 23±2 115
Table 2.3: Number of lesion affected neurons containing GVBs and/or pre-tangles
52
2.5 Discussion
Investigation of colocalization extent of CK1α and CK1ε isoforms with NFTs establishes
that these isoforms are positioned to play a major role in tau hyperphosphorylation.
Approximately 70% of CK1α immunoreactive neurons and ~80% of CK1ε
immunoreactive neurons colocalized with Thioflavin-S NFTs, similar to the previously
observed value for CK1δ, which was ~90% [9]. The high levels of colocalization might
be due to ~2.4, ~33 and ~9 fold increase in levels of CK1α, CK1δ and CK1ε in AD brain
homogenates relative to non-diseased brain homogenates. In normal brain, CK1α, CK1δ
and CK1ε are low-abundant enzymes, ranging from 0.002–0.003% (w/w) of total cellular
protein. Based on the elevated levels of CK1 isoforms and the colocalization of CK1δ
with lesion affected neurons, a hypothetical model had been previously put forward. It
proposes that increases in CK1 isoforms might result in tau hyperphosphorylation, and
eventually results in organelle disassembly, which in turn might cause a physiological elevation of CK1 isoforms, thus resulting in a “pathological feedback loop”. It was also
suggested that the population of neurons affected might dictate whether the product of the
loop is manifested primarily as neurofibrillary or granulovacuolar degeneration [9, 56].
Comparison of neurons with CK1α immunoreactivity with different stages of NFTs
revealed that ~66 % of pre-tangles, ~69 % of iNFTs and ~78% of eNFTs were CK1α
immunopositive. Since the production of nonfunctional tau by its phosphorylation
contributes to a microtubule assembly defect [182], the presence of more than 60% of
pre-tangle neurons containing CK1α immunoreactivity implies that CK1α might be
53 involved in contributing to NFT formation. The presence of CK1α immunoreactivity in all stages of NFTs is in agreement with the presence of CK1α as the copurifying protein with PHFs of AD brains [56]. The apparent increase in CK1α immunoreactivity in later stage eNFTs in comparison to pre-tangle stage neurons seems to confirm the
‘pathological feedback loop’ hypothesis. We were not able to investigate either delta or epsilon isoforms at different stages of NFTs since CK1δ (IC128A) and CK1ε antibodies as well as the early stage and late stage NFT antibodies were all mouse IgGs. This was also the same reason for not being able to investigate the colocalization of CK1ε immunoreactive neurons with CK1δ stained GVBs. Examination of colocalization of
CK1α with GVBs showed that approximately 28% of CK1α immunoreactive neurons contained CK1δ stained GVBs. At the granular level, the CK1α immunostained GVBs mostly colocalized with CK1δ GVBs. Sequence comparison of CK1 isoforms show that within the catalytic domain, CK1δ has 76% sequence similarity with CK1α [216].
However the presence of a long carboxyl terminus of CK1δ with its ability to autophosphorylate might render CK1δ to be differently regulated than CK1α, which has a short carboxyl terminus. This might account for the lower incidence of GVB lesions in
CK1α immunoreactive neurons.
Using C-18 antibody as the CK1δ antibody, it has previously been suggested that Pin1 immunoreactive granules have CK1δ reactivity within the granules of GVBs [274]. We investigated the specificity of C18 antibody using AD brain homogenates. It was observed that in addition to weak staining obtained for CK1δ, C18 also strongly stained a non-specific band of lower molecular weight while IC128A detected only the expected
54 band of CK1δ (Figure 2.1, B). Hence we investigated if Pin1 immunoreactive granules
have CK1δ reactivity using IC128A. It was observed that ~7% Pin1 immunoreactivity
was found to colocalize with neurons containing IC128A stained CK1δ immunoreactive
GVBs. However at the granular level, it was observed that to a large extent, Pin1 granules
did not colocalize with CK1δ immunoreactive GVBs. Since CK1δ has been established
to be a marker for GVBs [9], this observation strongly implies that Pin1 may form a new
lesion as suggested by Holzer et al [243]. Use of Pin1 antisera visualized both granular
staining as well as tangle like staining. It was observed that generally that the granular
staining did not colocalize with NFTs. Examination of colocalization of Pin1
immunoreactivity with NFTs had demonstrated that ~16% of Pin1 immunoreactive
neurons was found colocalized to NFTs. This study clearly shows that Pin1 does
colocalize with NFTs, in contrast to the colocalization studies where no tangle-like
staining was observed with Pin1. This can be attributed to the difference in antibodies
used. Since Pin1 antisera we investigated showed both the granular as well as the NFT
lesions coupled with specific staining seen in the western blot, it can be claimed that this
Pin1 antisera is superior to the A-20 and C-20 commercial antibodies used in other
investigations [243].
Use of CK1δ to investigate the punctuate-like immunostaining of caspase-3 revealed that
the granules of caspase-3 did colocalize with GVBs, in agreement with Su et al [275].
Also ~21 to 25% of caspase-3 immunoreactive neurons contained CK1δ stained GVBs.
This colocalization percentage is similar to the 25% of colocalization obtained by
Jellinger et al [276]. Our investigation shows that less than 2% of Thioflavin-S NFTs had 55 caspase-3 immunoreactivity, in agreement with previous studies using tau antibody to
study the colocalization of caspase-3 with NFTs [256]. Thus our results demonstrates that
caspase-3 immunoreactivity is more likely to be found within GVB affected neurons than
NFT affected neurons.
Comparison of the distribution of CK1α, Pin1 and caspase-3 with the lesion affected
neurons showed that the enzymes predominantly associated with either NFT or the GVB
affected neurons. This suggested that the accumulation of these enzymes in GVBs might
be a protective mechanism of the neurons against developing NFTs. The sequestering of
these proteins in GVBs [261, 277] might result in the non-availability of proteins to
interact with the substrates thus rescuing the neurons during the neurodegenerative process. This implied that GVBs and NFTs should occur in different neurons.
Several studies have attempted to address the presence or absence of tau in lesions and
thereby understand if GVBs and NFTs occur in the same neuron. Tau has been reported
to be a component of GVBs based upon results of immunocytochemical staining obtained
with various tau antibodies [278-281], but these results have been inconsistent [282].
Most recently, Holzer et al [274] were unable to detect any granular staining in AD brain
tissues using a number of different tau antibodies. Many of the antibodies that have been
reported to recognize both tau and GVBs were raised against phosphorylated epitopes
[279]. The failure of most tau specific antibodies to stain GVBs suggests that those tau
reactive antibodies that stain GVBs or other granules in neurons may recognize tau-
related phosphoepitopes that are present on distinct proteins. 56
Supporting the above possibility, Kondratick and Vandré (1996) [283] first showed that
the phosphoepitope specific monoclonal antibody MPM-2 not only reacted with
phosphorylated tau, but also stained both fibrillary and granular lesions in AD brain
tissue. Subsequent studies have shown that formation of MPM-2 epitope may precede the
formation of paired helical filaments in affected neurons [284]. The MPM-2 epitope is
found on many phosphoproteins and is not restricted to recognition of phosphorylated
isoforms of tau. Therefore, MPM-2 staining of AD brain tissue does not necessarily
define the exclusive localization of phosphorylated tau, but likely reflects the distribution
of other phosphoproteins. Additional studies have demonstrated that the MPM-2 epitope
recognized on phosphorylated tau, as well as other MPM-2 reactive phosphoproteins, is
related to the recognition site for the Pin1 [233, 242, 285, 286]. The distribution of MPM-
2 staining observed in AD brain could reflect the distribution of Pin1, since the proline
isomerase binds to many MPM-2 epitope-containing proteins including tau. Thus it
appears that cross-reactivity between phosphoepitopes present on components of granular
structures in AD neurons and tau is likely to be responsible for the majority of the
reported tau staining of GVBs, and it is highly unlikely that tau is a prominent component
of GVBs. In contrast, the immunoreactivity of CK1 isoforms is not mediated by
phosphoepitopes [218]. Thus results obtained by the use of CK1δ as the GVB marker are
more reliable than those of other potential markers such as tau antibodies.
57 Investigation of colocalization of Thioflavin-S NFTs and CK1δ immunostained GVBs shows that for each neuron containing both lesions, there were 10 neurons containing only GVBs and 15 neurons affected by only NFTs (Table 2.2). Similar results were obtained when colocalization between pre-tangle neurons and GVB containing neurons were investigated. For every pre-tangle neuron containing GVB, there were 10 neurons containing only GVBs and 9 neurons being affected only by Pre-tangles (Table 2.3). This suggested that regardless of the stages of neurons examined, GVB affected neurons are
generally not present in association with tangles.
In summary our results demonstrate that the CK1α and CK1ε immunoreactivities
correlates well with NFTs while CK1α correlates well with all stages of NFT formation.
We also substantiated the idea that Pin1 might form a new lesion and confirmed that
typically, GVBs and NFTs are present in different neurons.
58
CHAPTER 3
CASEIN KINASE 1 ALPHA FOUND IN TAU INCLUSIONS OF
INCLUSION BODY MYOSITIS
3.1 Summary
Casein Kinase1 isoforms CK1α, CK1δ and CK1ε have been colocalized to neurofibrillary
lesions containing paired helical filaments (PHFs) in Alzheimer’s disease (AD). Inclusion
Body Myositis (IBM) shares some of pathobiological similarities with AD. Use of well-
characterized AD phospho-tau antibodies had demonstrated that 15-21 nm wide filaments
are composed of hyperphosphorylated tau similar to that of PHFs found in AD. Hence the
associations of CK1 isoforms with tau inclusions were examined in sporadic IBM (s-
IBM) muscle sections. Our results demonstrate that among the CK1 isoforms, CK1α was colocalized to tau lesions.
59 3.2 Introduction
Sporadic inclusion body myositis (s-IBM) and hereditary inclusion body myopathies (h-
IBM) are progressive muscle diseases leading to severe disability [167]. The clinical hallmarks of IBM are atrophy and weakness of the quadriceps and the wrist and finger flexors. Even in the absence of a typical clinical history, diagnosis of IBM can be made exclusively on the basis of muscle biopsy when all of the characteristic histopathological findings are present [287]. s-IBM is histopathologically characterized by vacuolar degeneration of muscle fibers, various degrees of mononuclear cell inflammation, intracellular congophilic and/or filamentous accumulation [288, 289]. In both s-IBM and h-IBM, in association with rimmed vacuoles either [290] 6 to 10 nm intrafiber amyloid
filaments forming the congophilic deposits [291] or larger 15 to 21 nm filaments
immunoreactive to AD phosphorylated-tau antibodies are present [292].
Sporadic AD and s-IBM are both age-related disorders [293, 294]. They share many
pathobiochemical features including accumulation of beta-amyloid [291, 295], presenilin
[296], apolipoprotein E [297-300] and filamentous inclusions [292] made of tau. Tau is
primarily a neuronal protein, but it is becoming increasingly evident that tau is present in
non-neuronal cells. Tau mRNA and immunoblot expression studies in rat tissues have
revealed its presence in cerebral and cerebellar cortex, spinal cord, dorsal root ganglion, skeletal muscle, heart, testis, lung, kidney, stomach, adrenal gland, liver, aorta and spleen
[301]. Studies in bovine testis and pacinar exocrine cell lines have revealed the presence
of tau in spermatid manchettes [302] and in normal as well as tumor pacinar cells [303-
306], respectively. Tau mRNA and the protein levels do not correlate with microtubule
60 (MT) abundance levels except for testis. Electron microscopy investigations of
distribution and arrangement of microtubules (MTs) in skeletal muscle fibers of rat and
mouse diaphragms show that the adult skeletal muscle contained few MTs [307]. Though
normal muscle fiber is known to contain a significant amount of tau,
immunohistochemical procedures were not able to detect the presence of tau in muscle
fiber [308]. Hence it was hypothesized that in tissues expressing low amounts of
microtubules, tau might exist as cytosolic proteins but in degenerating processes, the
disruption of MTs could result in the sequestration and aggregation of protease resistant free tau molecules [301]. In various muscle fiber lesions tau epitopes have been observed
in oculopharyngeal, Becker muscular dystrophy, dermatomyositis, central core disease,
neurogenic atrophy, the recovery phase of an attack of malignant hyperthermia [308],
chloroquine myopathy [309], and IBM [178, 183]. Tau immunoreactivity in muscle fiber
lesions usually colocalized with tubulin [308].
Presence of tau in IBM has been detected using non-phosphorylated antibody. However, a
robust signal was obtained after the muscle tissue was treated with alkaline phosphatase
implying presence of phosphorylated tau. Presence of only phosphorylated tau in IBM might
also indicate that IBM may contain phosphorylated proteins of muscle origin other than tau
[310]. Electron microscopic examination using well-characterized phospho-tau antibodies
reacting in AD revealed that these antibodies immunodecorated only filaments similar to AD
PHFs. PHFs in AD have a widest diameter of 15-22 nm and twist repeat periodicity of 65-80
nm. Ultrastructurally, the filaments in s-IBM have diameter of 15 to 21nm with a twist repeat
periodicity of 45-55 nm and hence called Twisted Tubulofilaments (TTFs). The
61 immunochemical similarity along with the ultrastructural similarity suggested that
hyperphosphorylated tau, which is a characteristic of Alzheimer brain PHFs, could also be a
component of s-IBM TTFs [292]
In AD, tau aggregates into PHFs and loses its ability to maintain the microtubule tracks [20].
Phosphorylation is one of the post-translational mechanisms involved in the elongation of the
filaments (Necula and Kuret, unpublished data). The AD phospho-tau readily self-assembles
in vitro into tangles of PHF/straight filaments under physiological conditions of protein
concentration, pH, ionic strength and reducing conditions, however this self assembly requires
abnormal hyperphosphorylation of tau [311]. Hence phosphorylation of tau has been
considered an important event of PHF formation [38]. Hyperphosphorylation of tau in AD is speculated to be due to protein phosphorylation/dephosphorylation imbalance produced by a
decrease in the activity of protein phosphatases and increase in the activities of tau kinases
[311]. More than 20 phosphorylation sites on tau have been identified [312]. Most of them are
phospho (Ser/Thr)-Pro motifs [150], making tau a good substrate for the Casein Kinase 1
(CK1) family of Ser/Thr kinases [313].
The mammalian CK1 family consisting of CK1 α, β, γ1, γ2, γ3, δ and ε is characterized by
a conserved core kinase domain and variable amino- and carboxyl-terminal tails [314].
CK1 isoforms are involved in diverse cellular processes including cell cycle progression,
membrane trafficking, circadian rhythms, and Wnt signaling [124]. In AD hippocampus,
protein levels of CK1 isoforms CK1α, CK1δ and CK1ε have been elevated 2.4, 33 and 9-
fold respectively. They intensely immunostained NFTs [218], indicating their proximity
62 to hyperphosphorylate tau. Presence of these CK1 isoforms with tau in IBM will provide
an additional evidence for the pathological similarity of AD with IBM. Hence, we
examined the presence of CK1α, CK1δ and CK1ε in s-IBM tau inclusions. Of these isoforms, our investigation clearly demonstrated the presence of CK1α in tau inclusions.
3.3 Materials and methods
3.3.1 Patients and controls
Biopsy samples were obtained from 4 controls and 8 patients diagnosed with s-IBM at the Department of Neurology, The Ohio State University College of Medicine,
Columbus, OH, USA. The diagnosis was made on the basis of their muscle biopsy, in addition to their clinical and other laboratory findings. The patient characteristics are tabulated in Table 3.1. Control and s-IBM biopsy samples were further confirmed by
Hematoxylin and Eosin staining before Immunohistochemical analyses.
3.3.2 Antibodies
PHF1 (Peter Davis, Albert Einstein College of Medicine, NY) is a mouse IgG monoclonal antibody recognizing phosphorylated Ser396 or/and Ser404 in PHFs [315].
IC128A (Icos Corporation, Bothell, WA) is a monoclonal mouse antibody of the subtype
IgG raised against CK1δ [56]. C-19 (Santa Cruz Biotech, CA) is a goat polyclonal IgG
recognizing C-terminus of CK1α of human origin. CK1ε antibody (BD Transduction
Laboratories, CA) is a mouse monoclonal IgG generated from human CK1ε. Secondary
antibody Alexa 488 goat anti–mouse IgG antibody (Molecular Probes, Inc., Eugene,
63 Oregon) was used for the visualization of PFH1, 128A and CK1ε antibodies. Alexa 594
Donkey Anti-Goat IgG (Molecular Probes, Inc., Eugene, Oregon) was used against C-19.
3.3.3 Fluorescence immunohistochemistry
Immunohistochemistry was performed on 10-µm-thick transverse cryostat sections. After
equilibrating to the RT, the sections were fixed in ice cold acetone [316] for 10 minutes
at 4°C and processed as described [310]. Sections were incubated with PHF1 (3 µg/µl),
IC128A (4 µg/µl), C-19 (3 µg/µl), CK1ε (2.5 µg/µl) primary antibodies diluted in the
blocking solution for 16 hrs at RT. Secondary antibodies, Alexa 488 or Alexa 594 IgG (4
µg/ml) were used to visualize the proteins. Slides were viewed using Nikon Eclipse 800
fluorescence research microscope. Confocal images were obtained using Zeiss LSM 510
Meta Laser Scanning Confocal Microscope fitted with Argon (Ar) and Helium/Neon I
(HeNeI) Laser lines. Images were viewed with Zeiss LSM Image Browser Release 3.2 and were processed using Deneba Canvas 9.0 (ACD Systems).
3.4 Results
3.4.1 H&E stainings of control and s-IBM muscle fibers
The H&E stains of controls and IBM was done to confirm the pathology for the cases. s-
IBM sections revealed presence of mononuclear cell infiltrates along with the cell nuclei
(Figure 3.1 B) similar to the s-IBM diagnostic findings [317]. H&E of the control fiber is
shown in comparison (Figure 3.1 A). Both control and s-IBM muscle tissue show small
64 white patches which are freezing artifacts indicative of initial variable freezing conditions of the tissue.
3.4.2 Control muscle sections
None of the control biopsies showed immunoreaction for Tau, CK1α, CK1δ and CK1ε.
Figure 3.2 is a representative image of the control stainings obtained. In this case, it was stained for tau using PHF1 antibody.
3.4.3 s-IBM muscle
Tau inclusions were found in the rimmed vacuoles of the s-IBM muscle sections using
PHF1 antibody (Figure 3.3A) similar to the findings by Askansas et al [292]. Figure 3.4
B represents the staining observed using CK1α antibody. Among the CK1 isoforms,
CK1α, CK1δ and CK1ε, only CK1α was found in the inclusion of the s-IBM sections. No
CK1δ and CK1ε immunoreaction was found in the s- IBM muscle fibers.
By double labeled immunoflourescence some of the tau inclusions were observed to colocalize with CK1α (Figure 3.5). Quantification of the number of muscle fibers having both tau inclusions and CK1α immunoreactivity revealed that on an average 57.5 ± 8.3% of PHF1 immunoreactive tau inclusions had CK1α immunoreactivity (Figure 3.6), ranging from a lowest colocalization percentage of 25.0% to the highest colocalization percentage of 100.0% in one case (Table 3.1). In terms of CK1α, it can be said that all the
CKα1 immunoreactivity was found within tau inclusions.
65 A B
Figure 3.1 H&E Staining. Hematoxylin and Eosin staining of control muscle fibers showing nuclei in blue (A) and s-IBM muscle fibers with the nuclei and mononuclear infiltrates seen in blue (B). Scale bar represents 10 µm.
Figure 3.2 Fluorescence staining of control muscle fibers. Representative of control staining obtained with PHF1.
66 A B C
Figure 3.3 s-IBM muscle fiber stained with PHF1. Tau staining obtained with PHF1 antibody linked to Alexa 488 secondary seen in green channel (A), red channel (B) and as merged image (C). Scale bar represents 10 µm.
A B C
Figure 3.4 s-IBM muscle fiber stained with CK1α. CK1α staining obtained with C-19 antibody linked to Alexa 594 secondary seen in green channel (A), red channel (B) and as merged image (C). Scale bar represents 10 µm.
67 A B C
D E F
Figure 3.5 CK1α colocalization with tau. Two examples of colocalization (A-C) and (D-F). Tau visualized with PHF1 antibody linked to Alexa 488 and CK1α visualized using C19 antibody linked to Alexa 594.Colocalization was seen in yellow in the merged images. Scale bar represents 10 µm.
68
Serial Case type Gender Age Tau Number Inclusions containing CK1α (%)
1) Control F 38 None
2) Control F 40 None
3) Control F 61 None
4) Control M 63 None
5) s-IBM M 66 33
6) s-IBM M 82 50
7) s-IBM M 79 40
8) s-IBM F 65 25
9) s-IBM F 75 50
10) s-IBM M 56 50
11) s-IBM M 77 33
12) s-IBM M 70 100
Table 3.1: Patient characteristics
69
60
50
40
30
20 Inclusions (%)
10
0 CK1α Tau with CK1α
Figure 3.6 Percentage representations of CK1α and its colocalization with tau in IBM inclusions. The IBM muscle fibers were double labeled for CK1α and tau, using anti-CK1α antibody and PHF1 antibody, respectively. In each IBM case, the presence of CK1α as well as its colocalization with tau in inclusions was counted. The graph indicates the average of the total percentages of CK1α and colocalization of CK1α with tau inclusions in IBM muscle fibers. Similar values for both CK1α and colocalization of CK1α with tau indicate that typically, CK1α was present when tau was present in the inclusion. Bars reflect mean ± S.E.M.
70 3.5 Discussion
The etiopathogenesis of IBM is not known and hence the similarity in the presence of abnormal accumulation of proteins found in other diseases might give some insight to
IBM pathogenesis. Though ultrastucture of TTFs have been similar to PHFs in AD, the
TTFs are less abundant in IBM than the PHFs in AD brain. Hence the biochemical analyses of TTFs and their associated proteins in comparison to PHFs have been less feasible [183]. Presence of TTFs similar to PHFs implied that the kinases implicated in
NFT lesions of AD might be found in tau lesions of IBM muscle tissue. Immunochemical investigation in the IBM tissue of the kinases involved in AD would suggest additional pathological similarity between IBM and AD. One of the kinases involved in AD is cyclin dependent kinases (CDK). Examination of CDKs in IBM tissue had revealed that among the CDKs, only CDK5 was shown to colocalize with tau inclusions in IBM [289].
Similarly, our investigation of CK1 isoforms revealed that only CK1α was found in IBM muscles while CK1δ and CK1ε were not observed in the IBM tissue. However unlike
CDK5, which was present throughout the diseased muscle fiber, CK1α was present only within tau inclusions.
Our work demonstrates that CK1α is present in IBM fibers and is colocalized with ~57% of tau containing inclusions. Under normal physiological conditions, CK1α is found to be expressed in the brain, heart, lung, liver, kidney, spleen, testis cells and in all cellular compartments [216, 318]. CK1α being a ser/thr kinase, can interact with a large number of proteins which include those in cytosolic vesicles, the mitotic spindle and structures
71 within the nucleus [69, 252], G-protein coupled receptor (GPCRs) phosphorylation [261], retinoid X receptor (RXR) agonist-induced apoptosis [262], nuclear protein regulator of chromosome condensation 1 (RCC1), high mobility group proteins 1 and 2 (HMG1,
HMG2), Erf, CPI-17, synaptotagmin IX, and centaurin-alpha1 [68]. Hence there is also a possibility that the IBM muscle tissue might have CK1α phosphorylatable proteins, which might have cross-reacted with phospho-tau AT8 antibody.
Under pathological conditions, CK1α has been implicated in both AD as well as
Duchenne Muscular Dystrophy (DMD). In AD brains, CK1α has been shown to be a major constituent of purified tau filaments, comprising as much as 0.32% (wt/wt) of the
PHF preparation [93] and has been shown to colocalize with Neurofibrillary lesions [9].
DMD is a X-linked serious condition characterized by progressive muscle wasting and weakness and death ensues in the late teens or early twenties [263, 264]. The gene responsible has been mapped to band Xp21 [265] and the gene product, named dystrophin, is present in skeletal, cardiac, and smooth muscles as well as brain [266]. In
DMD, CK1α mRNA level was increased in milder phenotype in comparison to the normal control [267]. Presence of CK1α in IBM, a muscular degenerative disease similar to DMD as well as in the neurodegenerative disease like AD implies that CK1α might be one of the major enzymes being affected and/or affecting the disease pathogenesis.
CK1δ is associated with pathological accumulation of tau in several neurodegenerative diseases like pathological hallmarks in AD, Down Syndrome, Progressive Supranuclear
Palsy, Pick's Disease, Parkinson's Disease, Dementia with Lewy bodies, Amyotrophic
72 lateral sclerosis and elderly controls. The colocalization of CK1δ and its apparent
substrate tau had suggested a function for CK1δ in the abnormal processing of tau [94].
Using human embryonic kidney (HEK) 293 cells, it was shown that CK1δ
phosphorylates tau at sites that modulate tau/microtubule binding [89]. Hence it was
surprising when CK1δ was not observed in s-IBM tau inclusions.
The CK1ε kinase domain is 53-98% identical to the kinase domains of other CK1 family
members and is most closely related to CK1δ isoform [38]. Both CK1δ and CK1ε have been implicated in regulating DNA repair and chromosomal segregation [71] and in phosphorylation of human circadian clock proteins period 1 (hPER 1) [268]. Similar to
CK1δ, investigation of presence of CK1ε in tau inclusions in s-IBM was negative. This could be due to the fact that CK1ε contains a highly phosphorylated 123-amino acid carboxyl-terminal extension not present in CK1α and hence is substantially less active than CK1α in phosphorylating a number of substrates [43]. CK1δ and CK1ε are differently regulated than CK1α due to their relatively large homologous carboxyl terminal domains [181, 252]. Thus the absence of CK1δ and CK1ε in tau inclusions might be due to their difference in regulation from CK1α.
Studies with mRNA could confirm the presence of tau as well reveal information regarding the levels of CK1 isoforms present in the s-IBM muscles. In conclusion, presence of CK1α suggests an additional pathological similarity between s-IBM muscle and AD brain, implying the importance of CK1 family in degenerative muscle disease.
73
CHAPTER 4
KINETIC ANALYSIS OF CASEIN KINASE 1 MUTANTS
4.1 Summary
Phosphorylation of substrates by Casein Kinase1 (CK1) family of isoforms has been
implicated in various cellular processes and several diseases. The catalytic domains of the
CK1 isoforms share 50 to 98% sequence similarity with each other. Crystal structure of the truncated catalytic domain has been previously solved. Structure and sequence
comparison with other protein kinases indicated presence of conserved residues
implicated in regulation and protein substrate recognition. Using site-directed
mutagenesis and kinetic analysis we show that residues T166, R183, K222 are important
for kinase activity of CK1 enzyme.
4.2 Introduction
An essential mechanism for regulation of numerous cellular signaling pathways and
metabolic functions is reversible protein phosphorylation on serine, threonine or tyrosine
residues. Protein kinases catalyze phospho-transfer reactions from ATP to serine,
threonine or tyrosine residues in target substrates and provide key mechanisms for control
of cellular signaling processes [119, 319, 320]. Protein-serine/threonine kinases and the
74 protein-tyrosine kinases make up the two main subdivisions within the large superfamily
of eukaryotic protein kinases [321].
One of the most abundant structurally conserved Ser/Thr-specific protein kinases found
in all eukaryotic cell types is CK1 family [322]. In the yeast Saccharomyces cerevisiae,
CK1 is encoded by the genes YCK1, YCK2 [75, 323], YCK3 [72] and HRR25 [73]. In addition to the CK1 homologs hhp1 and hhp2 [79], Schizosaccharomyces pombe also has
three highly related CK1 isoforms Cki1, Cki2 and Cki3 [80, 81]. In higher eukaryotes,
there are seven genetically distinct isoforms: α, β, γ (1,2,3), δ and ε ranging in size from
34 to 49 kDa [64, 88, 89, 91, 96].
CK1 is involved in controlling a wide variety of different cellular events including
nuclear import, cellular response to DNA damage and circadian rhythm [111, 124, 125,
127, 132, 324-329]. In disease conditions, presence of CK1 has been implicated in
Alzheimer's disease, Down syndrome, progressive supranuclear palsy, parkinsonism,
dementia complex of Guam, Pick's disease, pallido-ponto-nigral degeneration,
Parkinson's disease, dementia with Lewy bodies, and amyotrophic lateral sclerosis [57,
218, 330, 331].
CK1 phosphorylates substrates which are generally acidic on the N-terminal side of the
target residue and can utilize phosphorylated amino acids as recognition determinants
[326]. Like other protein kinases, the crystal structure of a truncated variant of protein
kinase CK1, Ckil, [332, 333], shows that the enzyme is bilobal with the active site
75 located in the mouth region of a deep cleft between the lobes. This cleft completely
accommodates the ATP molecule, with the γ-phosphate oriented outwards. The protein substrate-binding site is at the opening of the cleft. Most of the highly conserved residues cluster in this active site, approaching from different parts of both lobes [334].
The conserved residues can be identified by comparison with even a distantly related protein kinase like cAMP-dependent protein kinase (cAPK) and can thus be regarded as strictly conserved in kinases [332]. One such residue is Threonine 166 (T166) in Cki1, which is also present in regulatory phosphorylation sites found in other protein kinases.
Phosphorylation of T161 in Cyclin Dependent Kinase 1 (CDK1) is required for strong cyclin binding and kinase activity in vitro while its dephosphorylation is necessary for cells to exit mitosis [335]. The phosphate group on the corresponding residue, T160 on the regulatory T-loop of Cyclin Dependent Kinase 2 (CDK2) acts as a major organizing center in the CDK2-CyclinA complex. Similarly, T197 is a critical phosphorylation site in cAPK [336]. In vivo analysis of T166 had predicted that T166 would be involved in the regulation [337]. Hence we propose that in Cki1, T166 is an important residue involved in regulation through phosphorylation.
Prior phosphorylation of CK1 substrates is a critical determinant of its protein kinase action implying CK1 might be involved in hierarchal substrate phosphorylation schemes
[338]. The crystal structure revealed the location of 3 residues R183, K229 and G220 (S1 site) poised within the presumptive peptide-binding cleft to mediate interaction with peptide substrates. These three residues, which are conserved throughout the CK1 family,
76 chelate a sulfate ion that cocrystallizes with kinase. S1 site mimics the non-covalent binding of a phosphohydroxyamino acid [339] and hence could be the key mediator of
CK1’s phosphate directed substrate selectivity. Thus our second hypothesis is that R183,
Lys229 along with K222 (residue near G220) are key mediators of protein substrate specificity.
Using the chimera CK1∆298, containing the catalytic domain of Cki1, truncated at position 298 and the C-terminal tether/prenylation domain of YCK2 [340], we
mutagenized the T166, R183, K222, K229 residues to Alanine (A). Additionally, to
eliminate the effect of autophosphorylation, K41 was also mutagenized to Alanine. Since
K41 is a key catalytic residue conserved in all protein kinases [321, 341] the K41A
mutant should be catalytically incompetent. Double mutant K41A/T166A was created to
make the mutant catalytically incompetent as well as unable to accept phosphate from an
exogenous source. Alanine substitution eliminates the side chain beyond the β-carbon.
This mutational approach provides an indication of the essentiality of the side chain for
protein function [342]. Using casein as the exogenous substrate and radioactively labeled
ATP as co-substrate, the mutants were assayed for phosphotransferase activity. The
results indicate that in comparison with the wild type there is a reduction of the
phosphotransferase activities of T166A, R183A, K222A, and K229A mutant enzymes.
77
4.3 Materials and methods
4.3.1 Chemicals used for protein kinase assays:
Equine muscle Adenosine 5’-Triphosphate (Sigma Chemical Co., St. Louis, MO), [γ-32
P]ATP 370MBq/ml (Amersham Biosciences, Piscataway, NJ), 5% casein solution
(Sigma Chemical Co., St. Louis, MO).
4.3.2 Site-directed Mutagenesis:
CK1∆298 cDNA was synthesized as described [340] and isolated in phagemid vector pT7II. It was prepared for mutagenesis by the method of Kunkel et al [343] as described previously [344]. Mutants were confirmed by DNA sequence analysis. Primers used are tabulated in Table 4.1
4.3.3 Expression and Purification:
CK1∆298 was expressed in BL21 (DE3) cells and purified as described for nonfusion
CK1∆298 by Carmel et al [340]. The purity was confirmed by SDS-PAGE followed by
Coomassie Blue staining. Casein kinase activity was assayed as described previously
[340, 345].
78
Mutant Primers
K41A 5’ CATCACTGCGTCTTGGTTCAAATGCAATGGCTACTTGTTG 3’ 3’ CAACAAGTAGCCATTGCATTTGAACCAAGACGCAGTGATG 5’ T166A 5’ TTATCGTGATCCAGTTGCCAAACAGCACATACCTTACC 3’ 3’ GGTAAGGTATGTGCTGTTTGGCAACTGGATCACGATAA 5’ R183A 5’ GAGTATTAATAGACATGTAAGCAGCAGTACCCGAGAGGTTCTTT 3’
3’ AAAGAACCTCTCGGGTACTGCTGCTTACATGTCTATTAATACTC 5’
K222A 5’ GCTTATTGGTGGCAGCCGCCAATCCTTGCCAAGGTAG 3’ 3’ CTACCTTGGCAAGGATTGGCGGCTGCCACCAATAAGC 5’
K2229A 5’CTCGCCAATTCGTTCATATGCTTGCTTATTGGTGGCAGCC3’ 3’GCCTGCCACCAATAAGCAAGCATATGAACGAATTGGCGAG5’
Table 4.1: Primers used in creating the mutants
79
4.4 RESULTS
The kinetic properties of the mutant enzymes were compared with the wild type enzyme
under the conditions previously shown to give maximal activity [340]. The velocity plot
(Figure 4.1) represents the steady-state rate of phosphate incorporation into casein
measured by varying ATP concentration. Curves were the best fit obtained by nonlinear regression analysis of the experimental data. The Vmax and Km were obtained from
double-reciprocal transformations of the Lineweaver-Burk Plot (Figure 4.2).
Comparison of the various Alanine substitutions with the wild type reveals that the most significant effect was observed for R183A mutant in which the Km and the Vmax had decreased to half and 20% times respectively. In comparison with the wild type, Vmax of the K222A mutant decreased to 72% times while its Km increased to about 110% times of the control values. The regulatory T166A mutation showed 10% and 60% decrease in
Km and Vmax values, respectively, as compared to the wild type. The activities of the
K41A single mutant and the K41A/T166A double mutant could not be determined due to the near complete loss of the kinase activity. The results of this kinetic analysis are summarized in Table 4.2.
80 2.0
1.5 WT T166A R183A K222A mol/mg/min)
µ 1.0 Velocity ( Velocity
0.5
0.0 0 50 100 150 200 [ATP] (µM)
Figure 4.1: Velocity plot obtained with various CK1 mutants.
81
8
6
1/WT mol/mg/min)
µ 4 1/T166A 1/R183A 1/K222A 2 1/Velocity (
-0.075 -0.050 -0.025 -0.000 0.025 0.050 0.075 0.100
1/[ATP] (µM)
Figure 4.2: Lineweaver-Burk Plot obtained from the velocity plot of the CK1 mutants.
82
Enzyme Vmax Km (µmol/mg/min) (µm)
CK1∆298 (Wild type) 2.28 ± 0.05 31.34 ± 1.82
CK1∆298 (R183A) 0.34 ± 0.02 15.09 ± 2.59
CK1∆298 (K222A) 1.64 ± 0.09 35.04 ± 4.28
CK1∆298 (T166A) 0.91 ± 0.03 27.85 ± 2.13
CK1∆298 (K41A) Activity not seen Activity not seen CK1∆298 (K41A/T166A) Activity not seen Activity not seen
Table 4.2: Summary of results obtained from Kinase assay
83
4.5 Discussion
The phosphotransfer reaction fundamental to most signaling and regulatory processes in the eukaryotic cell is catalyzed by protein kinases. Hence absolute control of individual protein kinase activity is of utmost importance to signaling fidelity in the cell.
Mechanisms for activity modulation, have been shown by crystal structures [346].
Protein kinases are expected to follow similar phosphotransfer mechanisms due to the conservation of residues associated with catalysis [321, 347]. The basic bilobal structure observed first in the structure of cAPK has become a recurring theme for several protein kinase catalytic domains including Cki1 [333] and CDK2 [332, 348, 349].
The overall architecture of Cki1 resembles the known protein kinases [350] with the catalytic domain of CKI being composed of two lobes with a cleft between them for binding ATP [332]. Similar to T-loop in CDK2 where T160 is present at the apex of the loop, the loop between subdomain VII and VIII (L-9D) in Cki1 crystal structure has T166 at its apex [350]. In CDK2 the charge on the phosphate group, which is on the regulatory
T-loop, is neutralized by three arginine side chains. These arginines help to extend the influence of the phosphate group through a network of hydrogen bonds to both CDK2 and cyclinA. Comparison with the unphosphorylated CDK2-CyclinA complex showed that the T-loop moves by as much as 7 Å, affecting the putative substrate binding site as well as resulting in additional CDK2-CyclinA contacts. This implied that phosphate group thus acts as a major organizing center in the CDK2-CyclinA complex [351].
84 Replacement of T160 with alanine abolished the kinase activity of CDK2, indicating that
phosphorylation at this site (as in CDC2) is required for kinase activity [352].
Sequence alignment has shown that T166 is conserved in all known isoforms [353]. In S.
cerevisiae the chimera containing the catalytic domain of Cki1 and the C-terminal
tether/prenylation domain of YCK2 is fully active. However mutagenesis of T166 to A
resulted in a strong growth-impaired phenotype [345]. Mutation of T166 to A will make
the mutant unable to accept the phosphate from exogenous kinases at the 166th position.
As expected both single and the double mutants, K41A and K41A/T166A had very little kinase activity. Compared to the wild type, T166A had very little change in Km, while
the Vmax had reduced by ~ 60%. This indicated that replacement of T166 with alanine
results in the reduction of kinase activity, implying the importance of T166 in regulation
of the enzyme.
The structure of a truncated variant of CK1 from S. pombe revealed the location of 3 residues R183, K229 and G220 poised within the presumptive peptide binding cleft to mediate interaction with peptide substrate. These three residues are conserved throughout the CK1 family. K222 which is near G220 along with R183 and K229 forms the cluster of basic side chains in the protein substrate binding cleft which might bind the phosphate moiety of phoshphoprotein substrates [339]. Mutagenesis of R183, K222 and K229 into
Ala [340] revealed that R183A had the lowest Vmax among the mutants. K222A had a higher Km value than the wild type while K229A yielded very little protein. The kinase analysis suggested that R183 and K222 play an important role in being the key mediators of protein substrate specificity. 85
CHAPTER 5
SUMMARY
We had set out to investigate if CK1 isoforms play an important role in the degenerative diseases. However not much has been known about the function/regulation of CK1 enzyme itself. Hence by comparing the crystal structure as well as the sequence with other protein kinases, we had analyzed the kinetics of T166, R183, K222 and K229 mutated into alanine. In vivo analysis of T166 had predicted that T166 would be involved in the regulation of the kinase activity [337] while it has been speculated that the R183,
K222 and K229 residues [338] would be involved in mediating the phosphate binding to
protein substrate. Our results show decreased phosphorylational capability of T166A,
R183A and K222A mutants. K229A yielded low amount of protein and hence could not
be analyzed, suggesting that this K229 residue might be essential for CK1 expression.
The kinetic results obtained with T166A, R183A and K222A mutants are also in
agreement with the function of similar residues in another kinase CDK2. The in vitro
kinetic analysis confirmed the previous in vivo observation of T166, indicating that
phosphorylation of T166 is the residue involved in regulation of CK1. However in the
case of R183A, K222A and K229A mutants, further in vivo studies need to be done to
confirm the in vitro results. 86 Our investigations of CK1 isoforms in AD show that both CK1α and CK1ε isoforms correlate to a large extent with the fibrillar lesions in AD similar to CK1δ. This morphological correlation between the lesions and the kinase implies that these isoforms might either play a pathogenic role in the presence of the lesions or be present in the lesion due to the consequence of fibrillization. In vivo studies of CK1δ indicated that
CK1δ directly phosphorylated tau [217]. Since phosphorylation is involved in the elongation of filaments (Necula and Kuret, unpublished data), the role of kinases in the fibrillar pathology might indicate their involvement in the pathological formation of the lesions. For the kinases to be involved in the pathogenesis of lesions, there must be an upregulation of kinases at the pre-tangle stage. Due to antibody compatibility, we had chosen CK1α and investigated the presence of CK1α in different stages of tangle formation. It was seen that CK1α was present in all stages of NFT maturation. This implied that CK1α might be directly or indirectly involved in the formation and maintanence of NFTs. With presence of compatible antibodies, it would be of interest to examine and compare if CK1δ and CK1ε would have similar correlation with different stages of NFTs. We had also investigated if CK1α colocalized to the GVB containing lesions and found that CK1α did colocalize with GVB containing neurons but to a lesser extent than its colocalization with NFTs.
In addition to CK1 isoforms in AD, we had quantitated the colocalization of Pin1 and caspase-3 enzymes with AD lesions. Our quantitational study of Pin1 is the first of its kind, since previous studies had addressed only the intensity of Pin1 in NFTs [146, 150,
87 151]. In comparison to CK1 isoforms, the colocalization of Pin1 with NFTs were lower >
2-fold. Also our investigation of the Pin1 granules, with the well-characterized CK1δ
seems to reveal that the Pin1 granules might form a different lesion. This study
substantiates the claim made by Hozer et al [243] that Pin1 might form a new lesion. The
earlier result as well as our investigation has been based entirely on
immunohistochemical study observed with fluorescence/confocal microscopes. The
GVBs are 5 µm in diameter with a granule of about 1.5 µm diameter within it. Under
ideal conditions for a conventional fluorescence microscope, with visible light, the limit of resolution in the “X-Y” direction is approximately 0.1 to 0.2 microns (100 to 200 nm).
However, conventional epi-fluorescence microscopy even when set up correctly does not
have the same level of resolution as confocal microscopy. The confocal microscope
pushes the level of resolution of the light microscope very close to the theoretical limit of
0.1 microns. Under ideal conditions, the resolution from a confocal microscope image may be up to 1.4X that achievable in conventional microscopy [354]. Due to the limited resolution capability of the fluorescence/confocal microscopes and the saturation of flurophore intensites it is necessary to confirm this result using electron microscopy.
Electron microscopy with its higher resolution (~1 Å) can confirm if Pin1 granules overlap with granules of GVBs or not. The Pin1 granules can be characterized as new lesion if they do not satisfy the four biochemical criteria used to characterize CK1δ as
GVBs [9].
88 We had investigated caspase-3 with the lesions to settle the controversy of the presence
of caspase-3 in NFTs. Our results show that the caspase-3 was also present in NFTs
though not always in the granular form observed in most of the studies [156, 256, 275,
355]. However in agreement with previous studies it was seen that very few caspase-3
affected tangles were present in the brain. In contrast to the NFT colocalization, caspase-
3 colocalized to a greater extent with GVB affected neurons. It is not known at this stage why only few neurons exhibit caspase-3 containing NFTs whereas the majority of
neurons exhibit caspase-3 as granules. We had confirmed that GVBs and NFTs mostly
occur in different neurons. Since the presence of caspase-3 has been observed more in the
granular form, it can be cautiously suggested that the caspase-3 granules might share a
similar pathological pathway as the formation of GVBs. Further investigations aimed at
understanding the downstream and upstream caspases involved might shed more light on
the role of apoptotic pathway in the lesions of AD.
Comparison of the colocalization data of AD lesions obtained showed that CK1α, Pin1
and caspase-3 tended to colocalize more with either NFTs or GVB affected neurons. Our
investigation to observe if NFTs and GVBs are formed in the same neuron showed that it
is highly probable for the lesions to occur in different neurons than in the same neurons.
Though several studies had been done before, they had been done with antibodies for
NFTs. Thioflain-S or Thiazin red (small fluorophore dyes) can visualize more tangles than any single antibody. Our investigation is the first of its kind to address this issue using the small-fluorophore dyes for NFTs and antibody against CK1δ, which has been a well-characterized marker for GVBs. The presence of the lesions in different neurons 89 suggest that there might be little overlap between the pathogenesis of formation of NFTs
and GVBs. Investigation of pre-tangle neurons and GVB affected neurons also gave the
same result. This suggested that independent of occurrence of tangle stages (pre-tangles
or NFTs), most of the GVBs tend to occur in different neurons. Hence it can be inferred
that most neurons affected by NFTs are not affected by GVBs and vice versa suggesting
that NFTs and GVBs formation in AD might mostly occur due to different pathoglogical effectors.
The correlation of presence of CK1 isoforms in fibrillar lesions places them as one of the major players in AD lesion formation along the same lines as Cyclin Dependent Kinase 5 and Glycogen Synthase 3β. The correlation with fibrillar pathology also implied that CK1
isoforms could also be found in diseases containing tau inclusions. Investigations revealed that only CK1α was present in IBM and it was found colocalized to tau
inclusions of IBM. CK1α is the third kinase to be implicated in IBM after extracellular
signal-regulated kinase (ERK) [356] and CDK5 [310]. CK1α is also the second kinase to
be implicated in both AD and IBM. With this result CK1α joins the ranks of well-
established CDK5, which has been implicated in both of these degenerative diseases.
However unlike CDK5, which was present throughout the diseased muscle fiber, CK1α
was present only within tau inclusions. In normal muscle tissue, tau is not found in the
muscle fibers and only phospho-tau has been found in the IBM, giving rise to the
possibility that antibodies to tau could cross-react with phospho-epitope present in the
tissue. Since phosphorylation (Necula and Kuret, unpublished data), helps in stabilizing
the filaments, the presence of tau inclusions in IBM, could be attributed to the action of 90 CK1α and similar action kinases, suggesting a pathogenic role for CK1α which has also
been found in another muscle disorder, DMD [357, 358]. Thus CK1α forms an additional
pathology between AD and IBM. The presence of CK1α in both AD and IBM indicate that CK1α is a candidate kinase in these degenerative diseases. Also the ubiquitous
presence of CK1α in tissues along with the large array of substrates indicates that CK1α
plays a major role in pathogenesis of the diseases. The presence of CK1α is a preliminary
finding and hence should be further verified using tau, CK1α, CK1δ and CK1ε mRNA
studies.
In conclusion our studies indicate that
1) In AD brains
a. CK1α and CK1ε isoforms correlate well with the NFTs,
b. CK1α also correlates well with different stages of NFTs,
c. Pin1 correlates with NFTs in comparison to GVB affected neurons and
might form a new lesion,
d. Caspase-3 correlates with GVB affected neurons than with NFTs
e. NFTs and GVBs in AD occur in different neuron,
2) CK1α is found in the tau inclusions of IBM muscle tissue and
3) The kinetic analysis of mutants confirms the predicted function of the T166, R183
and K222 residues.
91
BIBLIOGRAPHY
1. Parihar, M. and T. Hemnani, Alzheimer's disease pathogenesis and therapeutic
interventions. J. Clin. Neurosci., 2004. 11(5): p. 456-457.
2. Religa, D. and B. Winblad, Therapeutic strategies for Alzheimer's disease based
on new molecular mechanisms. Acta Neurobiol. Exp. (Wars.), 2003. 63(4): p.
393-396.
3. Tsai, L., M. Lee, and J. Cruz, Cdk5, a therapeutic target for Alzheimer's disease?
Biochim. Biophys. Acta., 2004. 1697(1-2): p. 137-142.
4. Pettenati, C., R. Annicchiarico, and C. Caltagirone, Clinical pharmacology of
anti-Alzheimer drugs. Fundam. Clin. Pharmacol., 2003. 17(6): p. 659-672.
5. Zhang, L., F. Zhou, and J. Dani, Cholinergic Drugs for Alzheimer's Disease
Enhance In Vitro Dopamine Release. Mol. Pharmacol., 2004. [Epub ahead of
print].
6. Crentsil, V., The pharmacogenomics of Alzheimer's disease. Ageing Res .Rev.,
2004. 3(2): p. 153-169.
7. Coria, F., I. Rubio, and C. Bayon, Alzheimer's disease, beta-amyloidosis, and
aging. Rev. Neurosci., 1994. 5(4): p. 275-292.
92 8. Harman, D., Alzheimer's disease: role of aging in pathogenesis. Ann. N . Y.
Acad. Sci., 2002. 959: p. 384-395.
9. Ghoshal, N., et al., A new molecular link between the fibrillar and
granulovacuolar lesions of Alzheimer's disease. Am. J. Pathol., 1999. 155(4): p.
1163-1172.
10. De Ferrari GV, I.N., Wnt signaling function in Alzheimer's disease. Brain Res.
Brain Res. Rev., 200. 33(1): p. 1-12.
11. Kowalska, A., Amyloid precursor protein gene mutations responsible for early-
onset autosomal dominant Alzheimer's disease. Folia Neuropathol., 2003. 41(1):
p. 35-40.
12. St George-Hyslop, P., Molecular genetics of Alzheimer's disease. Biol.
Psychiatry., 200. 47(3): p. 183-199.
13. Goate, A., Molecular genetics of Alzheimer's disease. Geriatrics., 1997. 52(Suppl.
2): p. S9-12.
14. Hutton, M., J. Perez-Tur, and J. Hardy, Genetics of Alzheimer's disease. Essays
Biochem., 1998. 33: p. 117-131.
15. Kowalska, A., Genetic basis of neurodegeneration in familial Alzheimer's
disease. Pol. J. Pharmacol., 2004. 56(2): p. 171-178.
16. Crowther RA, G.M., Abnormal tau-containing filaments in neurodegenerative
diseases. J. Struct. Biol., 2000. 130(2-3): p. 271-279.
17. Spillantini, M. and M. Goedert, Tau protein pathology in neurodegenerative
diseases. Trends Neurosci., 1998. 21(10): p. 428-433.
93 18. Gotz, J., Tau and transgenic animal models. Brain Res. Brain Res. Rev., 2001.
35(3): p. 266-286.
19. Goedert, M., M. Spillantini, and R. Crowther, Tau proteins and neurofibrillary
degeneration. Brain Pathol., 1991. 1(4): p. 279-286.
20. Mandelkow, E.M. and E. Mandelkow, Tau in Alzheimer's disease. Trends Cell
Biol., 1998. 8(11): p. 425-427.
21. Lindwall, G. and R. Cole, Phosphorylation affects the ability of tau protein to
promote microtubule assembly. J. Biol. Chem., 1984. 259: p. 5301- 5305.
22. Bancher, C., et al., Accumulation of abnormally phosphorylated tau precedes the
formation of neurofibrillary tangles in Alzheimer's disease. Brain Res., 1989.
477(1-2): p. 90-99.
23. Grundke-Iqbal, I. and K. Iqbal, Neuronal cytoskeleton in the biology of Alzheimer
disease. Prog. Clin. Biol. Res., 1989. 317: p. 745-753.
24. Kopke, E., et al., Microtubule-associated protein tau. Abnormal phosphorylation
of a non-paired helical filament pool in Alzheimer disease. J. Biol. Chem., 1993.
268(32): p. 24374-24384.
25. Goedert, M.a.J., R., Expression of separate isoforms of human tau protein:
correlation with the tau pattern in brain and effects on tubulin polymerization.
EMBO J, 1990. 9: p. 4225-4230.
26. Goedert, M., Spillanti, M.G., Jakes, R., Rutherford, D. and Crowther, R., Multiple
isoforms of human microtubule-associated protein tau: sequences and
localization in neurofibrillary tangles of Alzheimer's disease. Neuron, 1989. 3: p.
519-526.
94 27. Ksiezak-Reding, H., W. Liu, and S. Yen, Phosphate analysis and
dephosphorylation of modified tau associated with paired helical filaments. Brain
Res., 1992. 597: p. 209-219.
28. Iqbal, K., et al., Mechanism of neurofibrillary degeneration. Neurobiology of
Aging, 2000. 21(1): p. 142.
29. Iqbal, K., et al., Chemical relationship of the paired helical filaments of
Alzheimer's dementia to normal human neurofilaments and neurotubules. Brain
Res., 1978. 142(2): p. 321-332.
30. Grundke-Iqbal, I., et al., Microtubule-associated protein tau. A component of
Alzheimer paired helical filaments. J Biol Chem, 1986. 261(13): p. 6084-6089.
31. Iqbal, K., Grundke-Iqbal, I., Smith, A.J., George, L., Tung, Y.-C. and T. and
Zaidi, Identification and localization of a tau peptide to paired helical filaments
of Alzheimer disease. Proc. Natl. Acad. Sci. USA, 1989. 86: p. 5646-5650.
32. Lee, V.M.-Y., Bahn, B.J., Otvos, Jr. L. and Trojanowski, J.Q., A68: a major
subunit of paired helical filaments and derivatized forms of normal Tau. Science,
1991. 251: p. 675-678.
33. Delacourte, A. and A. Defossez, J. Neurol. Sci. Alzheimer's disease: Tau proteins,
the promoting factors of microtubule assembly, are major components of paired
helical filaments., 1986. 76( 2-3): p. 173-186.
34. Alonso, A., I. Grundke-Iqbal, and K. Iqbal, Alzheimer's disease
hyperphosphorylated tau sequesters normal tau into tangles of filaments and
disassembles microtubules. Nat. Med., 1996. 2(7): p. 783-787.
95 35. Shea, T.B., Phospholipids alter tau conformation, phosphorylation, proteolysis,
and association with microtubules: Implication for tau function under normal and
degenerative conditions. Journal of Neuroscience, 1997. 50(1): p. 114 - 122.
36. Goedert, Molecular dissection of the neurofibrillary lesions of Alzheimer's
disease. Arzneimittelforschung., 1995. 45(3A): p. 403-409.
37. Augustinack, J.C., et al., Specific tau phosphorylation sites correlate with severity
of neuronal cytopathology in Alzheimer's disease. Acta Neuropathol (Berl), 2002.
103(1): p. 26-35.
38. Galvan, M., et al., Sequence of neurofibrillary changes in aging and Alzheimer's
disease: A confocal study with phospho-tau antibody, AD2. J. Alzheimers Dis.,
2001. 3(4): p. 417-425.
39. Iqbal, K., et al., Alzheimer paired helical filaments. Restoration of the biological
activity by dephosphorylation. FEBS Lett., 1994. 349(1): p. 104-108.
40. Zaidi, T.B., Christian; Grundke-Iqbal, Inge, Alzheimer paired helical filaments
Restoration of the biological activity by dephosphorylation. FEBS Letters, 1994.
349(1): p. 104-108.
41. Ghoshal, N., et al., Tau conformational changes correspond to impairments of
episodic memory in mild cognitive impairment and Alzheimer's disease. Exp.
Neurol., 2002. 177(2): p. 475-493.
42. Braak, H. and E. Braak, Neuropathological stageing of Alzheimer related
changes. Acta Neuropathol. (Berl), 1991. 82: p. 239-259.
96 43. Riley, K., D. Snowdon, and W. Markesbery, Alzheimer's neurofibrillary
pathology and the spectrum of cognitive function: Findings from the Nun Study.
Annals of Neurology, 2002. 51(5): p. 567 - 577.
44. Billingsley, M. and R. Kincaid, Regulated phosphorylation and
dephosphorylation of tau protein: effects on microtubule interaction, intracellular
trafficking and neurodegeneration. Biochem. J., 1997. 323(Pt 3): p. 577-591.
45. Kuret, J., et al., Pathways of tau fibrillization. BBA review., (in press).
46. Scott, C.W., et al., Phosphorylation of recombinant tau by cAMP-dependent
protein kinase. Identification of phosphorylation sites and effect on microtubule
assembly. J. Biol. Chem., 1993. 268(2): p. 1166-1173.
47. Wagner, U., et al., Cellular phosphorylation of tau by GSK-3 beta influences tau
binding to microtubules and microtubule organisation. J. Cell Sci., 1996. 109(6):
p. 1537-1543.
48. Utton, M.A., et al., Phosphorylation of tau by glycogen synthase kinase 3beta
affects the ability of tau to promote microtubule self-assembly. Biochem. J., 1997.
323(3): p. 741-747.
49. Wada, Y., et al., Microtubule-stimulated phosphorylation of tau at Ser202 and
Thr205 by cdk5 decreases its microtubule nucleation activity. J. Biochem.
(Tokyo), 1998. 124(4): p. 738-746.
50. Patrick, G.N., et al., Conversion of p35 to p25 deregulates Cdk5 activity and
promotes neurodegeneration. Nature, 1999. 402(6762): p. 615-622.
97 51. Evans, D.B., K.B. Rank, and S.K. Sharma, A scintillation proximity assay for
studying inhibitors of human tau protein kinase II/cdk5 using a 96-well format. J.
Biochem. Biophys. Meth., 2002. 50(2-3): p. 151-161.
52. Li, G., H. Yin, and J. Kuret, Casein kinase 1 delta phosphorylates Tau and
disrupts its binding to microtubules. J. Biol. Chem., 2004. 279(16): p. 15938-
15945.
53. Walter J, G.J., Schindzielorz A, Haass C., Proteolytic fragments of the
Alzheimer's disease associated presenilins-1 and -2 are phosphorylated in vivo by
distinct cellular mechanisms. 369. Biochemistry. 1998 Apr 28;37(17):5961-7.
54. Yasojima, K., et al., Casein kinase 1 delta mRNA is upregulated in Alzheimer
disease brain. Brain Res., 2000. 865(1): p. 116-120.
55. Singh TJ, G.-I.I., Iqbal K., Differential phosphorylation of human tau isoforms
containing three repeats by several protein kinases. Arch Biochem Biophys. 1996
Apr 1;328(1):43-50.
56. Kuret, J., et al., Casein kinase 1 is tightly associated with paired-helical filaments
isolated from Alzheimer's disease brain. J. Neurochem., 1997. 69(6): p. 2506-
2515.
57. Schwab, C., et al., Casein kinase 1 delta is associated with pathological
accumulation of tau in several neurodegenerative diseases. Neurobiol. Aging.,
2000. 21(4): p. 503-510.
58. Ahmed, K., Significance of the casein kinase system in cell growth and
proliferation with emphasis on studies of the androgenic regulation of the
prostate. Cell Mol. Biol. Res., 1994. 40(1): p. 1-11.
98 59. Johnson, L., et al., The Eleventh Datta Lecture. The structural basis for substrate
recognition and control by protein kinases. FEBS Lett., 1998. 430(1-2): p. 1-11.
60. Itarte, E., et al., Purification and characterization of two cyclic AMP-independent
casein/glycogen synthase kinases from rat liver cytosol. Biochim Biophys. Acta.,
1981. 658(2): p. 334-347.
61. Kumar, R. and M. Tao, Multiple forms of casein kinase from rabbit erythrocytes.
Biochim. Biophys Acta., 1975. 410(1): p. 87-98.
62. Issinger, O., Purification and properties of a ribosomal casein kinase from rabbit
reticulocytes. Biochem. J., 1977. 165(3): p. 511-518.
63. Pierre, M. and J. Loeb, Purification and characterization of the cytoplasmic
casein kinase I from rat liver. Biochim. Biophys. Acta., 1982. 700(2): p. 221-228.
64. Gross, S., et al., A casein kinase I isoform is required for proper cell cycle
progression in the fertilized mouse oocyte. Cell Sci. . 1997. 110( Pt 24): p. 3083-
3090.
65. Mashhoon, N., et al., Crystal structure of a conformation-selective casein kinase-
1 inhibitor. J. Biol. Chem., 2000. 275(26): p. 20052-20060.
66. Schieck, E., C. Sanchez, and M. Lanzer, Targeting a DBL3gamma domain of the
Plasmodium falciparum erythrocyte membrane protein 1 to the surface of
Saccharomyces cerevisiae. Parasitol. Res., 2004. [Epub ahead of print].
67. Barik, S., R. Taylor, and D. Chakrabarti, Identification, cloning, and mutational
analysis of the casein kinase 1 cDNA of the malaria parasite, Plasmodium
falciparum. Stage-specific expression of the gene. J. Biol. Chem., 1997. 272(42):
p. 26132-26138.
99 68. Ferreira, V., et al., Role of calreticulin from parasites in its interaction with
vertebrate hosts. Mol. Immunol., 2004. 40(17): p. 1279-1291.
69. Spadafora, C., et al., Two casein kinase 1 isoforms are differentially expressed in
Trypanosoma cruzi. Mol. Biochem. Parasitol., 2002. 124(1-2): p. 23-36.
70. Babu, P., et al., Plasma membrane localization of the Yck2p yeast casein kinase 1
isoform requires the C-terminal extension and secretory pathway function. J. Cell
Sci., 2002. 115(Pt 24): p. 4957-4968.
71. Panek, H., et al., Suppressors of YCK-encoded yeast casein kinase 1 deficiency
define the four subunits of a novel clathrin AP-like complex. EMBO J., 1997.
16(14): p. 4194-4204.
72. Wang, X., et al., Prenylated isoforms of yeast casein kinase I, including the novel
Yck3p, suppress the gcs1 blockage of cell proliferation from stationary phase.
Mol. Cell. Biol., 1996. 16(10): p. 5375-5385.
73. DeMaggio, A., et al., The Budding Yeast HRR25 Gene Product is a Casein Kinase
I Isoform. Proc. Natl. Acad. Sci. (USA), 1992. 89(15): p. 7008-7012.
74. Robinson, L., et al., Yeast casein kinase I homologues: an essential gene pair.
Proc. Natl. Acad. Sci. (USA), 1992. 89(1): p. 28-32.
75. Wang, P., et al., Two genes in Saccharomyces cerevisiae encode a membrane-
bound form of casein kinase-1. Mol. Biol. Cell., 1992. 3(3): p. 275-286.
76. Hicke, L., B. Zanolari, and H. Riezman, Cytoplasmic tail phosphorylation of the
alpha-factor receptor is required for its ubiquitination and internalization. J. Cell
Biol., 1998. 141(2): p. 349-358.
100 77. Milne, D., P. Looby, and D. Meek, Catalytic activity of protein kinase CK1 delta
(casein kinase 1delta) is essential for its normal subcellular localization. Exp.
Cell Res., 2001. 263(1): p. 43-54.
78. Murakami, A., K. Kimura, and A. Nakano, The inactive form of a yeast casein
kinase I suppresses the secretory defect of the sec12 mutant. Implication of
negative regulation by the Hrr25 kinase in the vesicle budding from the
endoplasmic reticulum. J. Biol. Chem., 1999. 274(6): p. 3804-3810.
79. Kearney, P., M. Ebert, and J. Kuret, Molecular cloning and sequence analysis of
two novel fission yeast casein kinase-1 isoforms. Biochem Biophys. Res.
Commun., 1994. 203(1): p. 231-236.
80. Kitamura, K. and I. Yamashita, Identification of a novel casein kinase-1 homolog
in fission yeast Schizosaccharomyces pombe. Gene., 1998. 214(1-2): p. 131-137.
81. Hoekstra, M., et al., Budding and fission yeast casein kinase I isoforms have dual-
specificity protein kinase activity. Mol. Biol. Cell., 1994. 5(8): p. 877-886.
82. Vancurova, I., et al., Regulation of phosphatidylinositol 4-phosphate 5-kinase
from Schizosaccharomyces pombe by casein kinase I. Biol Chem., 1999. 274(2):
p. 1147-1155.
83. Wang PC, V.A., Desai A, Carmel G, Kuret J., Cytoplasmic forms of fission yeast
casein kinase-1 associate primarily with the particulate fraction of the cell. 234.
Biol Chem. 1994 Apr 22;269(16):12014-23.
84. Farris, S., A. Abrams, and N. Strausfeld, Development and morphology of Class
II Kenyon cells in the mushroom bodies of the honey bee, Apis mellifera. J. Comp.
Neurol., 2004. 474(3): p. 325-339.
101 85. Santos, J., et al., The casein kinase 1 alpha gene of Drosophila melanogaster is
developmentally regulated and the kinase activity of the protein induced by DNA
damage. J. Cell Sci., 1996. Jul.(109): p. Pt .7.
86. Pulgar, V., et al., The recombinant alpha isoform of protein kinase CK1 from
Xenopus laevis can phosphorylate tyrosine in synthetic substrates. Eur. J.
Biochem., 1996. 242(3): p. 519-528.
87. Tapia, C., et al., Cloning and chromosomal localization of the gene coding for
human protein kinase CK1. FEBS Lett., 1994. 349(2): p. 307-312.
88. Green, C. and G. Bennett, Identification of four alternatively spliced isoforms of
chicken casein kinase I alpha that are all expressed in diverse cell types. Gene,
1998. 216(1): p. 189-195.
89. Kusuda, J., et al., Sequence analysis of the cDNA for the human casein kinase I
delta (CSNK1D) gene and its chromosomal localization. Genomics., 1996. 32(1):
p. 140-143.
90. Rowles, J., et al., Purification of casein kinase I and isolation of cDNAs encoding
multiple casein kinase I-like enzymes. Proc. Natl. Acad. Sci. (USA), 1991. 88(21):
p. 9548-9552.
91. Zhai, L., et al., Casein kinase I gamma subfamily. Molecular cloning, expression,
and characterization of three mammalian isoforms and complementation of
defects in the Saccharomyces cerevisiae YCK genes. J. Biol. Chem., 1995.
270(21): p. 12717-12724.
92. Kusuda, J., et al., Cloning, expression analysis and chromosome mapping of
human casein kinase 1 gamma1 (CSNK1G1): identification of two types of cDNA
102 encoding the kinase protein associated with heterologous carboxy-terminal
sequences. Cytogenet. Cell Genet., 2000. 90(3-4): p. 298-302.
93. Guo, L., et al., Molecular cloning, mapping and characterization of a human
CK1gamma1 gene. Int. J. Mol. Med.. 2002. 10(2): p. 227-230.
94. Kitabayashi, A., et al., Cloning and chromosomal mapping of human casein
kinase I gamma 2 (CSNK1G2). Genomics., 1997. 46(1): p. 133-137.
95. Kusuda, J., et al., Cloning and chromosome mapping of the human casein kinase I
gamma3 gene (CSNK1G3). Cytogenet. Cell Genet., 1998. 83(1-2): p. 101-103.
96. Fish, K., et al., Isolation and characterization of human casein kinase I epsilon
(CKI), a novel member of the CKI gene family. J. Biol. Chem., 1995. 270(25): p.
14875-14883.
97. Gross, S.D. and R.A. Anderson, Casein kinase I: spatial organization and
positioning of a multifunctional protein kinase family. Cell Signal., 1998. 10(10):
p. 699-711.
98. Meggio, F., et al., A synthetic beta-casein phosphopeptide and analogues as
model substrates for casein kinase-1, a ubiquitous, phosphate directed protein
kinase. FEBS Lett., 1991. 283(2): p. 303-306.
99. Singh, T. and K. Huang, Glycogen synthase (casein) kinase-1: tissue distribution
and subcellular localization. FEBS Lett., 1985. 190(1): p. 84-88.
100. Nakajo, S., et al., Tissue distribution of casein kinases. Biochem. Int., 1986.
13(4): p. 701-707.
103 101. Cegielska, A., et al., Autoinhibition of casein kinase I epsilon (CKI epsilon) is
relieved by protein phosphatases and limited proteolysis. J. Biol. Chem., 1998.
273(3): p. 1357-1364.
102. Yu, S. and M. Roth, Casein kinase I regulates membrane binding by ARF GAP1.
Mol. Biol. Cell., 2002. 13(8): p. 2559-2570.
103. Guasch, M., et al., Phosphorylation of rabbit skeletal muscle glycogen synthase
by casein kinase 1: evidence of phosphorylation sites specific for casein kinase 1.
Arch. Biochem. Biophys., 1986. 250(2): p. 294-301.
104. Singh TJ, W.J., Phosphorylation of calcineurin by glycogen synthase (casein)
kinase-1. 48. Biochem Cell Biol. 1987 Oct;65(10):917-21.
105. Nakajo S, N.K., Nakamura Y, Phosphorylation of actin-binding proteins by
casein kinases 1 and 2. 51. Biochem Int. 1987 Aug;15(2):321-7.
106. Tuazon, P., W. Merrick, and J. Traugh, Comparative analysis of phosphorylation
of translational initiation and elongation factors by seven protein kinases. J. Biol.
Chem., 1989. 264(5): p. 2773-2737.
107. Vila J, P.D., Zioncheck TF, Harrison ML, Itarte E, Weber MJ., Phosphorylation
and activation of p40 tyrosine kinase by casein kinase-1. FEBS Lett. 1990 May
7;264(1):21-4.
108. Haas, D. and C. Hagedorn, Casein kinase I phosphorylates the 25-kDa mRNA
cap-binding protein. Arch. Biochem. Biophys., 1991. 284(1): p. 84-89.
109. Umphress, J., et al., Determinants on simian virus 40 large T antigen are
important for recognition and phosphorylation by casein kinase I. Eur. J.
Biochem., 1992. 203(1-2): p. 239-243.
104 110. Link, W., et al., Bovine neurofilament-enriched preparations contain kinase
activity similar to casein kinase I--neurofilament phosphorylation by casein
kinase I (CKI). Neurosci. Lett., 1993. 151(1): p. 89-93.
111. Beyaert, R., et al., Casein kinase-1 phosphorylates the p75 tumor necrosis factor
receptor and negatively regulates tumor necrosis factor signaling for apoptosis. J.
Biol Chem., 1995. 270(40): p. 23293-23299.
112. Wang, C., et al., Identification of the major casein kinase I phosphorylation sites
on erythrocyte band 3. Blood., 1997. 89(8): p. 3019-3024.
113. Cheng HL, L.C., Functional effects of casein kinase I-catalyzed phosphorylation
on lens cell-to-cell coupling. 482. J Membr Biol. 2001 May 1;181(1):21-30.
114. Svenningsson, P., et al., DARPP-32 mediates serotonergic neurotransmission in
the forebrain. Proc. Natl. Acad. Sci. (USA), 2002. 99(5): p. 3188-3193.
115. Svenningsson, P., et al., Involvement of striatal and extrastriatal DARPP-32 in
biochemical and behavioral effects of fluoxetine (Prozac). Proc. Natl. Acad. Sci.
(USA), 2002. 99(5): p. 3182-3187.
116. Pastorino, L., et al., The carboxyl-terminus of BACE contains a sorting signal that
regulates BACE trafficking but not the formation of total A(beta). Mol. Cell
Neurosci., 2002. 19(2): p. 175-185.
117. Desdouits, F., et al., Phosphorylation of DARPP-32, a dopamine- and cAMP-
regulated phosphoprotein, by casein kinase I in vitro and in vivo. Biol. Chem.,
1995. 270(15): p. 8772-8778.
105 118. Cheng, H. and C. Louis, Endogenous casein kinase I catalyzes the
phosphorylation of the lens fiber cell connexin49. Eur. J. Biochem., 1999. 263(1):
p. 276-286.
119. Agostinis, P., et al., The ATP,Mg-dependent protein phosphatase: regulation by
casein kinase-1. FEBS Lett., 1987. 224(2): p. 385-390.
120. Nakaya, K., et al., Phosphorylation of isolated plasma membranes of AH-66
hepatoma ascites cells by casein kinase1. Biochem. Biophys. Res. Commun.,
1986. 138(1): p. 95-101.
121. Tobin, A., et al., Stimulus-dependent phosphorylation of G-protein-coupled
receptors by casein kinase 1alpha. J. Biol. Chem., 1997. 272(33): p. 20844-
20849.
122. Budd, D., J. McDonald, and A. Tobin, Phosphorylation and regulation of a
Gq/11-coupled receptor by casein kinase 1alpha. J. Biol Chem., 2000. 275(26): p.
19667-19675.
123. Okano, M., et al., Biochemical characterization of cholesterol-3-sulfate as the
sole effector for the phosphorylation of HMG1 by casein kinase I in vitro.
Biochem. Biophys. Res. Commun., 2001. 281(5): p. 1325-1330.
124. Dubois, T., et al., Casein kinase I associates with members of the centaurin-alpha
family of phosphatidylinositol 3,4,5-trisphosphate-binding proteins. J. Biol.
Chem., 2001. 276(22): p. 18757-18764.
125. Dubois, T., et al., Identification of casein kinase Ialpha interacting protein
partners. FEBS Lett., 2002. 517(1-3): p. 167-171.
106 126. Lussier, G. and L. Larose, A casein kinase I activity is constitutively associated
with Nck. J Biol. Chem., 1997. 272(5): p. 2688-2694.
127. Behrend, L., et al., Interaction of casein kinase 1 delta (CK1delta) with post-
Golgi structures, microtubules and the spindle apparatus. Eur. J. Cell. Biol.,
2000. 79(4): p. 240-251.
128. Knippschild, U., et al., p53 is phosphorylated in vitro and in vivo by the delta and
epsilon isoforms of casein kinase 1 and enhances the level of casein kinase 1 delta
in response to topoisomerase-directed drugs. Oncogene, 1997. 15(14): p. 1727-
1736.
129. Harms, E., M. Young, and L. Saez, CK1 and GSK3 in the Drosophila and
mammalian circadian clock. Novartis Found Symp.. 2003. 253: p. 267-77.
130. Whitmore, D., et al., A clockwork organ. Biol. Chem., 2000. 381(9-10): p. 793-
800.
131. Shiino, Y., et al., Mutation screening of the human period 2 gene in bipolar
disorder. Neurosci. Lett., 2003. 338(1): p. 82-84.
132. Camacho, F., et al., Human casein kinase Idelta phosphorylation of human
circadian clock proteins period 1 and 2. FEBS Lett., 2001. 489(2-3): p. 159-165.
133. Tepera, S., P. McCrea, and J. Rosen, A beta-catenin survival signal is required for
normal lobular development in the mammary gland. J. Cell Sci., 2003. 116(Pt 6):
p. 1137-1149.
134. Hino, S., et al., Casein kinase I epsilon enhances the binding of Dvl-1 to Frat-1
and is essential for Wnt-3a-induced accumulation of beta-catenin. J. Biol. Chem.,
2003. 278(16): p. 14066-14073.
107 135. Kishida, M., et al., Synergistic activation of the Wnt signaling pathway by Dvl and
casein kinase Iepsilon. J. Biol. Chem., 2001. 276(35): p. 33147-33155.
136. Gao, Z., et al., Casein kinase I phosphorylates and destabilizes the beta-catenin
degradation complex. Proc Natl. Acad. Sci. (USA), 2002. 99(3): p. 1182-1187.
137. Sakanaka, C., T. Sun, and L. Williams, New steps in the Wnt/beta-catenin signal
transduction pathway. Recent. Prog. Horm. Res., 2000. 55(225): p. 236.
138. Kloss, B., et al., The Drosophila clock gene double-time encodes a protein closely
related to human casein kinase Iepsilon. Cell., 1998. 94(1): p. 97-107.
139. Zhou, X.Z., et al., Pin1-dependent prolyl isomerization regulates
dephosphorylation of Cdc25C and tau proteins. Mol Cell, 2000. 6(4): p. 873-883.
140. Smet, C., et al., The peptidyl prolyl cis/trans-isomerase Pin1 recognizes the
phospho-Thr212-Pro213 site on Tau. Biochemistry., 2004. 43(7): p. 2032-2040.
141. Landrieu, I., et al., The Arabidopsis thaliana PIN1At gene encodes a single-
domain phosphorylation-dependent peptidyl prolyl cis/trans isomerase. J. Biol.
Chem., 2000. 275(14): p. 10577-10581.
142. Lu, P.J., et al., Function of WW domains as phosphoserine- or phosphothreonine-
binding modules. Science, 1999. 283(5406): p. 1325-1328.
143. Jacobs, D., et al., Peptide binding induces large scale changes in inter-domain
mobility in human Pin1. J. Biol. Chem., 2003. 278(28): p. 26174-26182.
144. Huang, H., et al., Isolation and characterization of the Pin1/Ess1p homologue in
Schizosaccharomyces pombe. J. Cell Sci., 2001. 114(Pt 20): p. 3779-3788.
145. Schmid, F.X., Protein folding. Prolyl isomerases join the fold. Curr. Biol., 1995.
5: p. 993-994.
108 146. Lu, P.J., et al., The prolyl isomerase Pin1 restores the function of Alzheimer-
associated phosphorylated tau protein. Nature, 1999. 399(6738): p. 784-788.
147. Wintjens, R., et al., 1H NMR study on the binding of Pin1 Trp-Trp domain with
phosphothreonine peptides. J Biol. Chem., 2001. 276(27): p. 25150-25156.
148. Zhou, X.Z., et al., Phosphorylation-dependent prolyl isomerization: a novel
signaling regulatory mechanism. Cell Mol Life Sci, 1999. 56(9-10): p. 788-806.
149. Lu, K., Y. Liou, and X. Zhou, Pinning down proline-directed phosphorylation
signaling. Trends Cell Biol., 2002. 12(4): p. 164-172.
150. Liou, Y.C., et al., Role of the prolyl isomerase Pin1 in protecting against age-
dependent neurodegeneration. Nature., 2003. 424(6948): p. 556-561.
151. Lu, K.P., Y.C. Liou, and I. Vincent, Proline-directed phosphorylation and
isomerization in mitotic regulation and in Alzheimer's Disease. Bioessays, 2003.
25(2): p. 174-181.
152. Nicotera, P., Apoptosis and age-related disorders: role of caspase-dependent and
caspase-independent pathways. Toxicol. Lett., 2002. 127(1-3): p. 189-195.
153. Engidawork, E., et al., Alteration of caspases and apoptosis-related proteins in
brains of patients with Alzheimer's disease. Biochem. Biophys. Res. Commun.,
2001. 281(1): p. 84-93.
154. Marks N, B.M., Recent advances on neuronal caspases in development and
neurodegeneration. Neurochem. Int., 1999. 35(3): p. 195-220.
155. Roth, K., Caspases, apoptosis, and Alzheimer disease: causation, correlation, and
confusion. Brain Res Brain Res Rev., 2001. 60(9): p. 829-838.
109 156. Selznick, L., et al., In situ immunodetection of neuronal caspase-3 activation in
Alzheimer disease. J Neuropathol Exp Neurol., 1999. 58(9): p. 1020-1026.
157. Amato, A. and R. Barohn, Idiopathic inflammatory myopathies. Neurol. Clin.,
1997. 15(3): p. 615-648.
158. Dalakas, M. and R. Hohlfeld, Polymyositis and dermatomyositis. Lancet, 2003.
362(9388): p. 971-982.
159. Plotz, P., et al., Current concepts in the idiopathic inflammatory myopathies:
polymyositis, dermatomyositis, and related disorders. Ann Intern Med., 1989.
111(2): p. 143-157.
160. Kalovidouris, A., Immune aspects of myositis. Curr. Opin. Rheumatol., 1992.
4(6): p. 809-814.
161. Mantegazza, R. and P. Bernasconi, Cellular aspects of myositis. Curr. Opin.
Rheumatol., 1994. 6(6): p. 568-574.
162. Dalakas, M., Muscle biopsy findings in inflammatory myopathies. Rheum. Dis.
Clin. North Am., 2002. 28(4): p. 779-798.
163. Dalakas, M., Clinical, immunopathologic, and therapeutic considerations of
inflammatory myopathies. Clin. Neuropharmacol., 1992. 15(5): p. 327-351.
164. Mastaglia, F., et al., Inflammatory myopathies: clinical, diagnostic and
therapeutic aspects. Muscle Nerve., 2003. 27(4): p. 407-425.
165. Carpenter, S. and G. Karpati, The pathological diagnosis of specific inflammatory
myopathies. Brain Pathol., 1992. 2(1): p. 13-19.
166. Oldfors, A. and I. Fyhr, Inclusion body myositis: genetic factors, aberrant protein
expression, and autoimmunity. Curr Opin Rheumatol., 2001. 13(6): p. 469-475.
110 167. Askanas, V. and W. Engel, Inclusion-body myositis and myopathies: different
etiologies, possibly similar pathogenic mechanisms. Curr. Opin. Neurol., 2002.
15(5): p. 525-531.
168. Oldfors, A. and C. Lindberg, Inclusion body myositis. Curr. Opin. Neurol., 1999.
12(5): p. 527-533.
169. Lotz, B., et al., Inclusion body myositis. Observations in 40 patients. Brain, 1989.
112(Pt. 3): p. 727-747.
170. Vogel, H., Inclusion body myositis--a review. Adv. Anat. Pathol., 1998. 5(3): p.
164-169.
171. Sarkozi, E., V. Askanas, and W. Engel, Abnormal accumulation of prion protein
mRNA in muscle fibers of patients with sporadic inclusion-body myositis and
hereditary inclusion-body myopathy. Am J Pathol., 1994. 145(6): p. 1280-1284.
172. Askanas, V. and W. Engel, New advances in inclusion-body myositis. Curr. Opin.
Rheumatol., 1993. 5(6): p. 732-741.
173. Tome, F. and M. Fardeau, Hereditary inclusion body myopathies. Curr Opin
Neurol., 1998. 11(5): p. 453-459.
174. Garlepp, M., Genetics of the idiopathic inflammatory myopathies. Curr. Opin.
Rheumatol., 1996. 8(6): p. 514-520.
175. Askanas, V. and W. Engel, Sporadic inclusion-body myositis and hereditary
inclusion-body myopathies: current concepts of diagnosis and pathogenesis. Curr
Opin Rheumatol., 1998. 10(6): p. 530-542.
111 176. Askanas V, E.W., Sporadic inclusion-body myositis and its similarities to
Alzheimer disease brain. Recent approaches to diagnosis and pathogenesis, and
relation to aging. Scand J Rheumatol. 1998;27(6):389-405.
177. MC, S., et al., Inclusion body myositis-like phenotype induced by transgenic
overexpression of beta APP in skeletal muscle. Proc. Natl. Acad. Sci. (USA),
2002. 99(9): p. 6334-6339.
178. Askanas, V. and W. Engel, Sporadic inclusion-body myositis and its similarities
to Alzheimer disease brain. Recent approaches to diagnosis and pathogenesis,
and relation to aging. Scand. J. Rheumatol., 1998. 27(6): p. 389-405.
179. Cherin, P., Treatment of inclusion body myositis. Curr. Opin. Rheumatol., 1999.
11(6): p. 456-461.
180. Anderton, B.H., et al., Sites of phosphorylation in tau and factors affecting their
regulation. Biochem Soc Symp, 2001. 67: p. 73-80.
181. Iqbal, K., et al., Chemical relationship of the paired helical filaments of
Alzheimer's dementia to normal human neurofilaments and neurotubules. Brain
Res, 1978. 142(2): p. 321-332.
182. Iqbal, K. and I. Grundke-Iqbal, Ubiquitination and abnormal phosphorylation of
paired helical filaments in Alzheimer's disease. Mol. Neurobiol., 1991. 5(2-4): p.
399-410.
183. Askanas, V., et al., Twisted tubulofilaments of inclusion body myositis muscle
resemble paired helical filaments of Alzheimer brain and contain
hyperphosphorylated tau. Am. J. Pathol., 1994. 144(1): p. 177-187.
112 184. Kiernan, J., Theory and practice. 3rd edition ed. Histological and histochemical
methods.
185. Weiss, L., ed. A textbook of histology. 6th edition ed. Cell and Tissue biology.
186. Sun, A., X. Nguyen, and G. Bing, Comparative analysis of an improved
thioflavin-s stain, Gallyas silver stain, and immunohistochemistry for
neurofibrillary tangle demonstration on the same sections. J. Histochem.
Cytochem., 2002. 50(4): p. 463-472.
187. Garcia-Sierra, F., et al., The extent of neurofibrillary pathology in perforant
pathway neurons is the key determinant of dementia in the very old. Acta
Neuropathol. (Berl). 2000. 100(1): p. 29-35.
188. Mena, R., et al., Monitoring pathological assembly of tau and beta-amyloid
proteins in Alzheimer's disease. Acta Neuropathol. (Berl). 1995. 89(1): p. 50-56.
189. Lamberg, S. and R. Rothstein, Histology and Cytology. Functional medical
laboratory technology: a comprehensive series of manuals. 1978.
190. Demandolx, D. and J. Davoust, Multicolor analysis in confocal
immunofluorescence microscopy. J. Trace Microprobe Tech., 1995. 13(3): p. 217-
225.
191. Rezai, N., Taking the Confusion out of Confocal Microscopy. BioTeach Online
Journal, 2003. 1: p. 75-80.
192. Bay, B., Cytosolic calcium imaging by confocal laser scanning microscopy:
applications in medicine. Singapore Med. J., 1996. 37(4): p. 344-347.
193. Delorme, R., et al., Measurement accuracy in confocal microscopy. J. Microsc.,
1998. 192(Pt 2): p. 151-162.
113 194. Grotz, K., et al., Confocal laser scanning microscopy (CLSM) for validation of
non-destructive histotomography of healthy bone tissue. Mund. Kiefer.
Gesichtschir., 1998. 2(3): p. 141-145.
195. Fink-Puches, R., et al., Confocal laser scanning microscopy: a new optical
microscopic technique for applications in pathology and dermatology. J. Cutan.
Pathol., 1995. 22(3): p. 252-259.
196. Furrer, P., J. Mayer, and R. Gurny, Confocal microscopy as a tool for the
investigation of the anterior part of the eye. J. Ocul. Pharmacol. Ther., 1997.
13(6): p. 559-578.
197. Laurent, M., et al., Power and limits of laser scanning confocal microscopy. Biol.
Cell., 1994. 80(2-3): p. 229-240.
198. Dailey, M., et al., Concepts in imaging and microscopy. Exploring biological
structure and function with confocal microscopy. Biol Bull. 1999 Oct;197(2):115-
22., 1999. 197(2): p. 115-122.
199. Iqbal, K., et al., Chemical relationship of the paired helical filaments of
Alzheimer's dementia to normal human neurofilaments and neurotubules. Brain
Res., 1978. 142(2): p. 321-332.
200. Ball, M.J., Topographic distribution of neurofibrillary tangles and
granulovacuolar degeneration in hippocampal cortex of aging and demented
patients. A quantitative study. Acta. Neuropathol. (Berl.), 1978. 42(2): p. 73-80.
201. Tomlinson, B.E. and D. Kitchener, Granulovacuolar degeneration of
hippocampal pyramidal cells. J. Pathol., 1972. 106(3): p. 165-185.
114 202. Ulrich, J., et al., Cytoskeletal immunohistochemistry of Alzheimer's disease. J.
Neural. Transm. Suppl., 1987. 24: p. 197-204.
203. Woodard, J.S., Clinicopathologic significance of GVD in AD. J. Neuropathol.
Exp. Neurol., 1962. 21: p. 85-91.
204. Braak, H., et al., Occurrence of neuropil threads in the senile human brain and in
Alzheimer's disease: a third location of paired helical filaments outside of
neurofibrillary tangles and neuritic plaques. Neurosci. Lett., 1986. 65(3): p. 351-
355.
205. Scott, C., et al., Phosphorylation of recombinant tau by cAMP-dependent protein
kinase. Identification of phosphorylation sites and effect on microtubule assembly.
J. Biol. Chem., 1993. 268(2): p. 1166-1173.
206. Goedert, M., Tau protein and the neurofibrillary pathology of Alzheimer's
disease. Trends Neurosci, 1993. 16(11): p. 460-465.
207. Hamdane, M., et al., Neurofibrillary degeneration of the Alzheimer-type: an
alternate pathway to neuronal apoptosis? Biochem Pharmacol, 2003. 66(8): p.
1619-25.
208. Kosik, K., C. Joachim, and D. Selkoe, Microtubule-associated protein tau (tau) is
a major antigenic component of paired helical filaments in Alzheimer disease.
Proc. Natl. Acad. Sci. (USA), 1986. 83(11): p. 4044-4048.
209. Grundke-Iqbal, I., et al., Abnormal phosphorylation of the microtubule-associated
protein tau (tau) in Alzheimer cytoskeletal pathology. Proc Natl Acad Sci U S A,
1986. 83(13): p. 4913-4917.
115 210. Wisniewski, H.M., P.A. Merz, and K. Iqbal, Ultrastructure of paired helical
filaments of Alzheimer's neurofibrillary tangle. J Neuropathol Exp Neurol, 1984.
43(6): p. 643-656.
211. Wood, J., et al., Neurofibrillary tangles of Alzheimer disease share antigenic
determinants with the axonal microtubule-associated protein tau (tau). Proc. Natl.
Acad. Sci. (USA), 1986. 83(11): p. 4040-4043.
212. Gomez-Ramos, P. and M. Moran, Ultrastructural aspects of neurofibrillary
tangle formation in aging and Alzheimer's disease. Microsc. Res. Tech., 1998.
43(1): p. 49-58.
213. Barghorn, S., P. Davies, and E. Mandelkow, Tau paired helical filaments from
Alzheimer's disease brain and assembled in vitro are based on beta-structure in
the core domain. Biochemistry., 2004. 43(6): p. 1694-1703.
214. Berriman, J., et al., Tau filaments from human brain and from in vitro assembly of
recombinant protein show cross-beta structure. Proc. Natl. Acad. Sci. (USA),
2003. 100(15): p. 9034-9038.
215. Ball, M.J., Neuronal loss, neurofibrillary tangles and granulovacuolar
degeneration in the hippocampus with ageing and dementia. A quantitative study.
Acta. Neuropathol. (Berl.), 1977. 37(2): p. 111-118.
216. Gross, S. and R. Anderson, Casein kinase I: spatial organization and positioning
of a multifunctional protein kinase family. Cell Signal., 1998. 10(10): p. 699-711.
217. Li, G., H. Yin, and J. Kuret, Casein kinase 1 delta phosphorylates Tau and
disrupts its binding to microtubules. J. Biol .Chem., 2004. [Epub ahead of
print].
116 218. Ghoshal, N., et al., A new molecular link between the fibrillar and
granulovacuolar lesions of Alzheimer's disease. Am. J. Pathol., 1999. 155(4): p.
1163-1172.
219. Carmel, G., et al., Expression, purification, crystallization, and preliminary x-ray
analysis of casein kinase-1 from Schizosaccharomyces pombe. J. Biol. Chem.,
1994. 268(10): p. 7304-7309.
220. Lauckner, J., P. Frey, and C. Geula, Comparative distribution of tau
phosphorylated at Ser262 in pre-tangles and tangles. Neurobiol Aging., 2003.
24(6): p. 767-776.
221. Garcia-Sierra, F., et al., Conformational changes and truncation of tau protein
during tangle evolution in Alzheimer's disease. J. Alzheimers Dis., 2003. 5(2): p.
65-77.
222. Su, J., B. Cummings, and C. Cotman, Early phosphorylation of tau in Alzheimer's
disease occurs at Ser-202 and is preferentially located within neurites.
Neuroreport, 1994. 5(17): p. 2358-2362.
223. Shankar, K., et al., Immunocytochemical characterization of neurofibrillary
tangles in amyotrophic lateral sclerosis and Parkinsonism-Dementia in Guam.
Ann. Neurol., 1989. 25(2): p. 146-151.
224. Shea, T. and M. Beerman, Evidence that the monoclonal antibodies SMI-31 and
SMI-34 recognize different phosphorylation-dependent epitopes of the murine
high molecular mass neurofilament subunit. J. Neuroimmunol., 1993. 44(1): p.
117-121.
117 225. Masliah, E., et al., An antibody against phosphorylated neurofilaments identifies a
subset of damaged association axons in Alzheimer's disease. Am. J. Pathol., 1993.
142(3): p. 871-882.
226. Singh, T., I. Grundke-Iqbal, and K. Iqbal, Phosphorylation of tau protein by
casein kinase-1 converts it to an abnormal Alzheimer-like state. Neurochem.,
1995. 64(3): p. 1420-1423.
227. Pei, J., et al., Accumulation of cyclin-dependent kinase 5 (cdk5) in neurons with
early stages of Alzheimer's disease neurofibrillary degeneration. Brain Res.,
1998. 797(2): p. 267-277.
228. Zhou, X.Z., et al., Pin1-dependent prolyl isomerization regulates
dephosphorylation of Cdc25C and tau proteins. Mol. Cell., 2000. 6(4): p. 873-
883.
229. Daly, N., et al., Role of phosphorylation in the conformation of tau peptides
implicated in Alzheimer's disease. Biochemistry., 2000. 39(30): p. 9039-9046.
230. Fischer, G., T. Tradler, and T. Zarnt, The mode of action of peptidyl prolyl
cis/trans isomerases in vivo: binding vs. catalysis. FEBS Lett., 1998. 426(1): p.
17-20.
231. Schutkowski, M., et al., Role of phosphorylation in determining the backbone
dynamics of the serine/threonine-proline motif and Pin1 substrate recognition.
Biochemistry, 1998. 37(16): p. 5566-5575.
232. Zhou, X.Z., et al., Phosphorylation-dependent prolyl isomerization: a novel
signaling regulatory mechanism. Cell Mol. Life Sci., 1999. 56(9-10): p. 788-806.
118 233. Yaffe, M.B., et al., Sequence-specific and phosphorylation-dependent proline
isomerization: a potential mitotic regulatory mechanism. Science, 1997.
278(5345): p. 1957-1960.
234. Ramakrishnan, P., D.W. Dickson, and P. Davies, Pin1 colocalization with
phosphorylated tau in Alzheimer's disease and other tauopathies. Neurobiol Dis,
2003. 14(2): p. 251-264.
235. Schutkowski, M., et al., Role of phosphorylation in determining the backbone
dynamics of the serine/threonine-proline motif and Pin1 substrate recognition.
Biochemistry, 1998. 37(16): p. 5566-5575.
236. Yaffe, M.B., et al., Sequence-specific and phosphorylation-dependent proline
isomerization: a potential mitotic regulatory mechanism. Science, 1997.
278(5345): p. 1957-1960.
237. Sudol, M., K. Sliwa, and T. Russo, Functions of WW domains in the nucleus.
FEBS Lett., 2001. 490(3): p. 190-195.
238. Drewes G, M.E., Baumann K, Goris J, Merlevede W, Mandelkow E.,
Dephosphorylation of tau protein and Alzheimer paired helical filaments by
calcineurin and phosphatase-2A. FEBS Lett., 1993. 336(3): p. 425-432.
239. Mandelkow EM, B.J., Drewes G, Gustke N, Trinczek B, Mandelkow E., Tau
domains, phosphorylation, and interactions with microtubules. Neurobiol Aging.,
1995. 16(3): p. 362-363.
240. Zhao WQ, F.C., Alkon DL., The serine/threonine phosphatase 2A (PP2A) has
been implicated in the pathogenesis of Alzheimer's disease (AD) due to its
119 important role in regulating dephosphorylation of the microtubule-associated
protein tau. Neurobiol Dis., 2003. 14(3): p. 458-469.
241. Goedert, M., et al., Protein phosphatase 2A is the major enzyme in brain that
dephosphorylates tau protein phosphorylated by proline-directed protein kinases
or cyclic AMP-dependent protein kinase. J. Neurochem., 1995. 65(6): p. 2804-
2807.
242. Lu, P.J., et al., The prolyl isomerase Pin1 restores the function of Alzheimer-
associated phosphorylated tau protein. Nature, 1999. 399(6738): p. 784-8.
243. Holzer, M., et al., Inverse association of Pin1 and tau accumulation in
Alzheimer's disease hippocampus. Acta Neuropathol (Berl), 2002. 104(5): p. 471-
481.
244. Citron, B., et al., Intron-Exon Swapping of Transglutaminase mRNA and
Neuronal Tau Aggregation in Alzheimer's Disease. J. Biol. Chem., 2001. 276(5):
p. 3295-3301.
245. Cotman, C. and A. Anderson, A potential role for apoptosis in neurodegeneration
and Alzheimer's disease. Mol. Neurobiol., 1995. 10(1): p. 19-45.
246. Rohn, T.T., et al., Caspase-9 activation and caspase cleavage of tau in the
Alzheimer's disease brain. Neurobiol Dis, 2002. 11(2): p. 341-354.
247. Smale, G., et al., Evidence for apoptotic cell death in Alzheimer's disease. Exp.
Neurol., 1995. 133(2): p. 225-230.
248. Rohn, T.T., et al., Activation of caspase-8 in the Alzheimer's disease brain.
Neurobiol Dis, 2001. 8(6): p. 1006-1016.
120 249. Su, J.H., et al., Activated caspase-3 expression in Alzheimer's and aged control
brain: correlation with Alzheimer pathology. Brain Res., 2001. 898(2): p. 350-
357.
250. Rohn, T.T., et al., Caspase-9 activation and caspase cleavage of tau in the
Alzheimer's disease brain. Neurobiol. Dis., 2002. 11(2): p. 341-354.
251. Fasulo, L., et al., The neuronal microtubule-associated protein tau is a substrate
for caspase-3 and an effector of apoptosis. J. Neurochem., 2000. 75(2): p. 624-
633.
252. Matikainen, T., et al., Caspase-3 gene knockout defines cell lineage specificity for
programmed cell death signaling in the ovary. Endocrinology., 2001. 142(6): p.
2468-2480.
253. Vogelsberg-Ragaglia, V., et al., Distinct FTDP-17 missense mutations in tau
produce tau aggregates and other pathological phenotypes in transfected CHO
cells. Mol Biol Cell., 2000. 11(12): p. 4093-4104.
254. Nagiec, E., K. Sampson, and I. Abraham, Mutated tau binds less avidly to
microtubules than wildtype tau in living cells. J.Neurosci. Res., 2001. 63(3): p.
268-275.
255. Zhao, Z., et al., A role of P301L tau mutant in anti-apoptotic gene expression, cell
cycle and apoptosis. Mol. Cell Neurosci., 2003. 24(2): p. 367-379.
256. Stadelmann, C., et al., Activation of caspase-3 in single neurons and autophagic
granules of granulovacuolar degeneration in Alzheimer's disease. Evidence for
apoptotic cell death. Am J Pathol, 1999. 155(5): p. 1459-1466.
121 257. Xu, M., et al., Granulovacuolar degeneration in the hippocampal cortex of aging
and demented patients--a quantitative study. Acta. Neuropathol., 1992. 85(1): p.
1-9.
258. Mann, D.M., Granulovacuolar degeneration in pyramidal cells of the
hippocampus. Acta. Neuropathol. (Berl.), 1978. 42(2): p. 149-151.
259. Ball, M.J. and K. Nuttall, Topography of neurofibrillary tangles and
granulovacuoles in hippocampi of patients with Down's syndrome: quantitative
comparison with normal ageing and Alzheimer's disease. Neuropathol. Appl.
Neurobiol., 1981. 7(1): p. 13-20.
260. Ball, M.J. and P. Lo, Granulovacuolar degeneration in the ageing brain and in
dementia. J. Neuropathol. Exp. Neurol., 1977. 36(3): p. 474- 487.
261. Stadelmann, C., et al., Activation of caspase-3 in single neurons and autophagic
granules of granulovacuolar degeneration in Alzheimer's disease. Evidence for
apoptotic cell death. Am. J. Pathol., 1999. 155(5): p. 1459-1466.
262. Carmel, G., et al., The structural basis of monoclonal antibody Alz50's selectivity
for Alzheimer's disease pathology. J. Biol. Chem., 1996. 271(51): p. 32789-
32795.
263. Campbell, H.D., et al., The human PIN1 peptidyl-prolyl cis/trans isomerase gene
maps to human chromosome 19p13 and the closely related PIN1L gene to 1p31.
Genomics, 1997. 44(2): p. 157-162.
264. Durchon, M., Demonstration of acidophilic neurosecretory cells in Crepidula
fornicata Phil. (Mollusca, Gasteropoda, Prosobranchia) using the fluorescent
122 dye, Geranine G. C. R. Acad. Sci. Hebd. Seances Acad. Sci. D., 1976. 282(1): p.
73-76.
265. Cowden, R. and S. Curtis, Cytochemical characterization of the modified Guard
procedure a regressive staining method for demonstrating chromosomal basic
proteins. II. Substitution of dyes for biebrich scarlet. Histochemistry, 1976. 48(2):
p. 93-100.
266. Garcia-Sierra, F., et al., Accumulation of C-terminally truncated tau protein
associated with vulnerability of the perforant pathway in early stages of
neurofibrillary pathology in Alzheimer's disease. J Chem Neuroanat, 2001. 22(1-
2): p. 65-77.
267. LeVine, H.r., Quantification of beta-sheet amyloid fibril structures with thioflavin
T. Methods Enzymol., 1999. 309: p. 274-284.
268. Romijn, H.J., et al., Double immunolabeling of neuropeptides in the human
hypothalamus as analyzed by confocal laser scanning fluorescence microscopy. J.
Histochem. Cytochem., 1999. 47(2): p. 229-236.
269. Schnell, S.A., W.A. Staines, and M.W. Wessendorf, Reduction of lipofuscin-like
autofluorescence in fluorescently labeled tissue. J. Histochem. Cytochem., 1999.
47(6): p. 719-730.
270. Evers, P., H.B. Uylings, and A.J. Suurmeijer, Antigen retrieval in formaldehyde-
fixed human brain tissue. Methods, 1998. 15(2): p. 133-140.
271. Rowles, J., et al., Purification of casein kinase I and isolation of cDNAs encoding
multiple casein kinase I-like enzymes. Proc. Natl. Acad. Sci. USA, 1991. 88(21):
p. 9548-9552.
123 272. Graves, P.R. and P.J. Roach, Role of COOH-terminal phosphorylation in the
regulation of casein kinase I delta. J. Biol. Chem., 1995. 270(37): p. 21689-
21694.
273. Carmel, G., et al., The structural basis of monoclonal antibody Alz50's selectivity
for Alzheimer's disease pathology. J Biol Chem, 1996. 271(51): p. 32789-32795.
274. Holzer, M., et al., Inverse association of Pin1 and tau accumulation in
Alzheimer's disease hippocampus. Acta. Neuropathol. (Berl.), 2002. 104(5): p.
471-481.
275. Su, J.H., et al., Caspase-cleaved amyloid precursor protein and activated
caspase-3 are co-localized in the granules of granulovacuolar degeneration in
Alzheimer's disease and Down's syndrome brain. Acta Neuropathol (Berl), 2002.
104(1): p. 1-6.
276. Jellinger, K.A. and C. Stadelmann, Problems of cell death in neurodegeneration
and Alzheimer's Disease. J Alzheimers Dis, 2001. 3(1): p. 31-40.
277. Okamoto, K., et al., Reexamination of granulovacuolar degeneration. Acta.
Neuropathol., 1991. 82(5): p. 340-345.
278. Bondareff, W., et al., Sequestration of tau by granulovacuolar degeneration in
Alzheimer's disease. Am. J. Pathol., 1991. 139(3): p. 641-647.
279. Dickson, D.W., et al., A monoclonal antibody that recognizes a phosphorylated
epitope in Alzheimer neurofibrillary tangles, neurofilaments and tau proteins
immunostains granulovacuolar degeneration. Acta. Neuropathol., 1987. 73(3): p.
254-258.
124 280. Dickson, D.W., et al., Phosphorylated tau immunoreactivity of granulovacuolar
bodies (GVB) of Alzheimer's disease: localization of two amino terminal tau
epitopes in GVB. Acta. Neuropathol. (Berl.), 1993. 85(5): p. 463-470.
281. Mena, R., Y. Robitaille, and A.C. Cuello, New patterns of intraneuronal
accumulation of the microtubular binding domain of tau in granulovacuolar
degeneration. J. Geriatr. Psychiatry. Neurol., 1992. 5(3): p. 132-141.
282. Mercken, M., et al., Monoclonal antibodies with selective specificity for
Alzheimer Tau are directed against phosphatase-sensitive epitopes. Acta.
Neuropathol. (Berl.), 1992. 84(3): p. 265-272.
283. Kondratick, C.M. and D.D. Vandre, Alzheimer's disease neurofibrillary tangles
contain mitosis-specific phosphoepitopes. J. Neurochem., 1996. 67(6): p. 2405-
2416.
284. Vincent, I., et al., Mitotic phosphoepitopes precede paired helical filaments in
Alzheimer's disease. Neurobiol. Aging, 1998. 19(4): p. 287-296.
285. Lu, K.P., Y.C. Liou, and I. Vincent, Proline-directed phosphorylation and
isomerization in mitotic regulation and in Alzheimer's Disease. Bioessays, 2003.
25(2): p. 174-181.
286. Lu, P.J., et al., Function of WW domains as phosphoserine- or phosphothreonine-
binding modules. Science, 1999. 283(5406): p. 1325-1328.
287. Czaplinski, A., S. Renaud, and P. Fuhr, Inclusion body myositis (IBM) - a review.
Schweiz. Rundsch. Med. Prax., 2003. 92(14): p. 649-654.
288. Askanas, V., W.K. Engel, and R.B. Alvarez, Enhanced detection of congo-red-
positive amyloid deposits in muscle fibers of inclusion body myositis and brain of
125 Alzheimer's disease using fluorescence technique. Neurology, 1993. 43(6): p.
1265-7.
289. Wilczynski, G.M., W.K. Engel, and V. Askanas, Cyclin-dependent kinase 5
colocalizes with phosphorylated tau in human inclusion-body myositis paired-
helical filaments and may play a role in tau phosphorylation. Neurosci Lett, 2000.
293(1): p. 33-6.
290. Griggs, R.C., et al., Inclusion body myositis and myopathies. Ann Neurol, 1995.
38(5): p. 705-13.
291. Mendell, J.R., et al., Amyloid filaments in inclusion body myositis. Novel findings
provide insight into nature of filaments. Arch Neurol, 1991. 48(12): p. 1229-34.
292. Askanas, V., et al., Twisted tubulofilaments of inclusion body myositis muscle
resemble paired helical filaments of Alzheimer brain and contain
hyperphosphorylated tau. Am J Pathol, 1994. 144(1): p. 177-87.
293. Sugarman, M.C., et al., Inclusion body myositis-like phenotype induced by
transgenic overexpression of beta APP in skeletal muscle. Proc Natl Acad Sci U S
A, 2002. 99(9): p. 6334-9.
294. Jaworska-Wilczynska, M., et al., Three lipoprotein receptors and cholesterol in
inclusion-body myositis muscle. Neurology, 2002. 58(3): p. 438-45.
295. Askanas, V., et al., beta-Amyloid protein immunoreactivity in muscle of patients
with inclusion-body myositis. Lancet, 1992. 339(8792): p. 560-1.
296. Askanas, V., et al., Light and electron microscopic immunolocalization of
presenilin 1 in abnormal muscle fibers of patients with sporadic inclusion-body
126 myositis and autosomal-recessive inclusion-body myopathy. Am J Pathol, 1998.
152(4): p. 889-95.
297. Askanas, V., et al., Apolipoprotein E immunoreactive deposits in inclusion-body
muscle diseases. Lancet, 1994. 343(8893): p. 364-365.
298. Garlepp, M.J. and F.L. Mastaglia, Apolipoprotein E and inclusion body myositis.
Ann. Neurol., 1996. 40(6): p. 826-828.
299. Askanas, V., et al., Apolipoprotein E alleles in sporadic inclusion-body myositis
and hereditary inclusion-body myopathy. Ann. Neurol., 1996. 40(2): p. 264-265.
300. Garlepp, M.J., et al., Apolipoprotein E epsilon 4 in inclusion body myositis. Ann.
Neurol., 1995. 38(6): p. 957-959.
301. Gu, Y., F. Oyama, and Y. Ihara, Tau is widely expressed in rat tissues. J.
Neurochem., 1996. 67(3): p. 1235-1244.
302. Ashman, J., et al., Tau, the neuronal heat-stable microtubule-associated protein,
is also present in the cross-linked microtubule network of the testicular spermatid
manchette. Biol. Reprod., 1992. 46(1): p. 120-129.
303. Vanier, M., et al., Expression of specific tau exons in normal and tumoral
pancreatic acinar cells. J. Cell Sci., 1998. 111(( Pt 10)): p. 1419-1432.
304. Michalik, L., M. Vanier, and J. Launay, Microtubule affinity chromatography: a
new technique for isolating microtubule-binding proteins from rat pancreas. Cell
Mol. Biol., 1991. 37(8): p. 805-811.
305. Michalik, L., et al., Biochemical and immunochemical identification of a
microtubule-binding protein from bovine pancreas. Cell Motil. Cytoskeleton.,
1993. 25(4): p. 381-390.
127 306. Neuville, P., et al., In situ localization with digoxigenin-labelled probes of tau-
related mRNAs in the rat pancreas. Histochem. J., 1995. 27(8): p. 565-574.
307. Kano, Y., N. Fujimaki, and H. Ishikawa, The distribution and arrangement of
microtubules in mammalian skeletal muscle fibers. Cell Struct. Funct., 1991.
16(3): p. 251-261.
308. Lubke, U., et al., Microtubule-associated protein tau epitopes are present in fiber
lesions in diverse muscle disorders. Am. J. Pathol., 1994. 145(1): p. 175-188.
309. Murakami, N., et al., Accumulation of tau in autophagic vacuoles in chloroquine
myopathy. J. Neuropathol. Exp. Neurol., 1998. 57(7): p. 664-673.
310. Nakano, S., et al., Aberrant expression of cyclin-dependent kinase 5 in inclusion
body myositis. Neurology, 1999. 53(8): p. 1671-1676.
311. Iqbal, K., et al., Pharmacological targets to inhibit Alzheimer neurofibrillary
degeneration. J. Neural. Transm. Suppl., 2002. 62: p. 309-319.
312. Anderton, B.H., et al., Sites of phosphorylation in tau and factors affecting their
regulation. Biochem. Soc. Symp., 2001. 67: p. 73-80.
313. Singh, T.J., I. Grundke-Iqbal, and K. Iqbal, Phosphorylation of tau protein by
casein kinase-1 converts it to an abnormal Alzheimer-like state. J. Neurochem.,
1995. 64(3): p. 1420-1423.
314. Gross, S.D. and A.R. A., Casein kinase I: spatial organization and positioning of
a multifunctional protein kinase family. Cell Signal., 1998. 10(10): p. 699-711.
315. Otvos, L.J., et al., Monoclonal antibody PHF-1 recognizes tau protein
phosphorylated at serine residues 396 and 404. J. Neurosci. Res., 1994. 39(6): p.
669-673.
128 316. van der Meulen, M.F., et al., Rimmed vacuoles and the added value of SMI-31
staining in diagnosing sporadic inclusion body myositis. Neuromuscul. Disord.,
2001. 11(5): p. 447-451.
317. Dahlbom, K., C. Lindberg, and A. Oldfors, Inclusion body myositis:
morphological clues to correct diagnosis. Neuromuscul. Disord., 2002. 12(9): p.
853-857.
318. Zhang, J., et al., Casein kinase I alpha and alpha L: alternative splicing-
generated kinases exhibit different catalytic properties. Biochemistry., 1996.
35(50): p. 16319-16327.
319. Johnson LN, L.E., Noble ME, Owen DJ., The Eleventh Datta Lecture. The
structural basis for substrate recognition and control by protein kinases. FEBS
Lett. 1998 Jun 23;430(1-2):1-11.
320. Johnson, L., M. Noble, and D. Owen, Active and inactive protein kinases:
structural basis for regulation. Cell, 1996. 85(2): p. 149-158.
321. Hanks, S. and T. Hunter, Protein kinases 6. The eukaryotic protein kinase
superfamily: kinase (catalytic) domain structure and classification. FASEB J.,
1995. 9(8): p. 576-596.
322. Robinson, L., et al., The Yck2 yeast casein kinase 1 isoform shows cell cycle-
specific localization to sites of polarized growth and is required for proper septin
organization. Mol. Biol. Cell., 1999. 10(4): p. 1077-1092.
323. Robinson LC, M.M., Garrett S, Culbertson MR., Casein kinase I-like protein
kinases encoded by YCK1 and YCK2 are required for yeast morphogenesis. Mol
Cell Biol. 1993 May;13(5):2870-81.
129 324. Higashimoto, Y., et al., Human p53 Is Phosphorylated on Serines 6 and 9 in
Response to DNA Damage-inducing Agents. J. Biol. Chem., 2000. 275(30): p.
23199-23203.
325. Zhu, J., et al., Intramolecular masking of nuclear import signal on NF-AT4 by
casein kinase I and MEKK1. Cell, 1998. 93(5): p. 851-861.
326. Dumaz, N., D. Milne, and D. Meek, Protein kinase CK1 is a p53-threonine 18
kinase which requires prior phosphorylation of serine 15. FEBS Lett., 1999.
463(3): p. 312-316.
327. Brockman, J. and R. Anderson, Casein kinase I is regulated by
phosphatidylinositol 4,5-bisphosphate in native membranes. J. Biol. Chem., 1991.
266(4): p. 2508-2512.
328. Brockman, J., et al., Cell cycle-dependent localization of casein kinase I to mitotic
spindles. Proc. Natl. Acad. Sci. (USA), 1992. 89(20): p. 9454-9458.
329. Shaw, G., et al., Characterization of additional casein kinase I sites in the C-
terminal "tail" region of chicken and rat neurofilament-M. J. Neurochem., 1997.
69(4): p. 1729-1737.
330. Walter, J., et al., Phosphorylation regulates intracellular trafficking of beta-
secretase. J. Biol. Chem., 2001. 276(18): p. 14634-14641.
331. Okochi, M., et al., Constitutive phosphorylation of the Parkinson's disease
associated alpha-synuclein. J.Biol. Chem., 2000. 275(1): p. 390-397.
332. Longenecker, K., P. Roach, and T. Hurley, Three-dimensional structure of
mammalian casein kinase I: molecular basis for phosphate recognition. J. Mol.
Biol., 1996. 257(3): p. 618-631.
130 333. Xu, R., et al., Crystal structure of casein kinase-1, a phosphate-directed protein
kinase. The EMBO Journal, 1995. 14: p. 1015-1023.
334. Bossemeyer, D., Protein kinases--structure and function. FEBS Lett., 1995.
369(1): p. 57-61.
335. Marcote, M., M. Pagano, and G. Draetta, cdc2 protein kinase: structure-function
relationships. Ciba Found. Symp., 1992. 170: p. 30-41.
336. Zheng, J., et al., Crystal structures of the myristylated catalytic subunit of cAMP-
dependent protein kinase reveal open and closed conformations. Protein Sci.,
1993. 2(10): p. 1559-1573.
337. Vancura, A., et al., Isolation and properties of YCK2, a Saccharomyces cerevisiae
homolog of casein kinase-1. Arch. Biochem. Biophys., 1993. 305(1): p. 47-53.
338. Flotow, H., et al., Phosphate groups as substrate determinants for casein kinase I
action. J. Biol. Chem., 1990. 265(24): p. 14264-14269.
339. Xu, R., et al., Structural basis for selectivity of the isoquinoline sulfonamide
family of protein kinase inhibitors. Proc. Natl. Acad. Sci. (USA), 1996. 93(13): p.
6308-6313.
340. Carmel, G., et al., Expression, purification, crystallization, and preliminary x-ray
analysis of casein kinase-1 from Schizosaccharomyces pombe. J. Biol. Chem.,
1994. 269(10): p. 7304-7309.
341. Hanks, S. and A. Quinn, Protein kinase catalytic domain sequence database:
identification of conserved features of primary structure and classification of
family members. Methods Enzymol., 1991. 200: p. 38-62.
131 342. Wang, S., et al., Phylogeny of mRNA capping enzymes. Biochemistry, 1997. 94: p.
9573-9578.
343. Kunkel, T., J. Roberts, and R. Zakour, Rapid and efficient site-specific
mutagenesis without phenotypic selection. Methods Enzymol., 1987. 154: p. 367-
382.
344. Kuret, J., et al., Mutagenesis of the regulatory subunit of yeast cAMP-dependent
protein kinase. Isolation of site-directed mutants with altered binding affinity for
catalytic subunit. J. Biol. Chem., 1988. 263(19): p. 9149-9154.
345. Vancura, A., et al., A prenylation motif is required for plasma membrane
localization and biochemical function of casein kinase I in budding yeast. J. Biol.
Chem., 1994. 269(30): p. 19271-19278.
346. Engh, R. and D. Bossemeyer, Structural aspects of protein kinase control-role of
conformational flexibility. Pharmacol. Ther., 2002. 93(2-3): p. 99-111.
347. Madhusudan, et al., cAMP-dependent protein kinase: crystallographic insights
into substrate recognition and phosphotransfer. Protein Sci., 1994. 3(2): p. 176-
187.
348. De Bondt, H., et al., Crystal structure of cyclin-dependent kinase 2. Nature, 1993.
363(6430): p. 595-602.
349. Jeffrey, P., et al., Mechanism of CDK activation revealed by the structure of a
cyclinA-CDK2 complex. Nature. 1995 ;376():, 1995. 376(6538): p. 313-320.
350. Bossemeyer, D., Protein kinases-structure and function. FEBS Lett., 1995.
369(1): p. 57-61.
132 351. Russo, A., P. Jeffrey, and N. Pavletich, Structural basis of cyclin-dependent
kinase activation by phosphorylation. Nat. Struct. Biol., 1996. 3(8): p. 696-700.
352. Gu, Y., J. Rosenblatt, and D. Morgan, Cell cycle regulation of CDK2 activity by
phosphorylation of Thr160 and Tyr15. EMBO J., 1992. 11(11): p. 3995-4005.
353. Wang, P., et al., Cytoplasmic forms of fission yeast casein kinase-1 associate
primarily with the particulate fraction of the cell. J. Biol. Chem., 1994. 269(16):
p. 12014-12023.
354. Rezai, N., Taking the confusion out of confocal microscopy. Biotech. Journal,
2003. 1: p. 75-80.
355. Su, J.H., et al., Activated caspase-3 expression in Alzheimer's and aged control
brain: correlation with Alzheimer pathology. Brain Res, 2001. 898(2): p. 350-
357.
356. Nakano, S., et al., Inclusion body myositis: expression of extracellular signal-
regulated kinase and its substrate. Neurology., 2001. 56(1): p. 87-93.
357. Moser, H., Duchenne muscular dystrophy: pathogenetic aspects and genetic
prevention. Hum. Genet., 1984. 66(1): p. 17-40.
358. Sifringer, M., et al., Identification of transcripts from a subtraction library which
might be responsible for the mild phenotype in an intrafamilially variable course
of Duchenne muscular dystrophy. Hum. Genet., 2004. 114(2): p. 149-156.
133