P75 Neurotrophin Receptor Expression Is a Characteristic of the Mitotically Quiescent Cancer Stem Cell Population Present in Esophageal Squamous Cell Carcinoma

Total Page:16

File Type:pdf, Size:1020Kb

P75 Neurotrophin Receptor Expression Is a Characteristic of the Mitotically Quiescent Cancer Stem Cell Population Present in Esophageal Squamous Cell Carcinoma INTERNATIONAL JOURNAL OF ONCOLOGY 48: 1943-1954, 2016 p75 neurotrophin receptor expression is a characteristic of the mitotically quiescent cancer stem cell population present in esophageal squamous cell carcinoma TETSUJI YAMAGUCHI1, TOMOYUKI OKUMURA1, Katsuhisa HIRANO1, TORU Watanabe1, Takuya Nagata1, Yutaka SHIMADA2 and KAZUHIRO TSUKADA1 1Department of Surgery and Science, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama City, Toyama 930-0194; 2Department of Nanobio Drug Discovery, Graduate School of Pharmaceutical Sciences, Kyoto University, Sakyo-ku, Kyoto 606-8501, Japan Received December 8, 2015; Accepted January 11, 2016 DOI: 10.3892/ijo.2016.3432 Abstract. Mitotically quiescent cancer stem cells (CSC) are identified and isolated based on their p75NTR expression, hypothesized to exhibit a more aggressive phenotype involving providing researchers with a novel diagnostic and therapeutic greater therapeutic resistance and metastasis. The aim of our target. study was to develop a method for identifying quiescent CSC in esophageal squamous cell carcinoma (ESCC) based on Introduction their expression of the p75 neurotrophin receptor (p75NTR) and other proposed CSC markers, such as CD44 and CD90. Recent studies have demonstrated that some cancer stem Double immunostaining of surgical ESCC specimens cells (CSC) remain in a mitotically quiescent state, which revealed that the mean Ki-67-labeling index of the p75NTR- enhances their chemoresistance and results in a more inva- positive cells was significantly lower than that of the sive and aggressive phenotype (1,2). The p75 neurotrophin p75NTR-negative cells. Real-time PCR analysis of sorted receptor (p75NTR) is expressed in the quiescent basal layer of fractions of ESCC cell lines (KYSE cells) revealed that stem the esophageal epithelium (3,4), and in esophageal squamous cell-related genes (Nanog, p63 and Bmi-1) and epithelial- cell carcinoma (ESCC). It is also expressed in populations of mesenchymal transition (EMT)-related genes (N-cadherin cells that exhibit enhanced colony-forming abilities and xeno- and fibronectin) were expressed at significantly higher levels graft tumorigenicity (5,6). CD44 (7) and CD90 (8) have also in the p75NTR-positive fractions than in the CD44-positive been reported to be markers of populations of esophageal CSC or CD90-positive fractions. In addition, the p75NTR-positive that display enhanced xenograft tumorigenicity and/or meta- fractions exhibited significantly higher colony formation static potential. However, none of these studies investigated in vitro, significantly enhanced tumor formation in mice, the mitotic status of the examined CSC populations. The aim and significantly greater chemoresistance against cisplatin of this study was to develop a method for identifying mitoti- (CDDP) than the CD44-positive or CD90-positive fractions. cally quiescent CSC in ESCC based on their p75NTR, CD44 Furthermore, in both the cultured cells and those from and CD90 expression patterns. the mouse xenograft tumors, the p75NTR-positive/CD44- negative and p75NTR-positive/CD90-negative KYSE Materials and methods cell fractions contained significantly higher proportions of mitotically quiescent cells. These results suggest that Tissue microarray. A total of 56 tumor specimens from the mitotically quiescent CSC population in ESCC can be ESCC patients who had undergone surgery at our hospital from 1990 to 2008 were analyzed using a tissue microarray, as described previously (9). All of the patients underwent R0 resections, and none of them died in hospital. The median follow-up time was 29 months. The subjects included 50 male Correspondence to: Dr Tomoyuki Okumura, Department of Surgery and 6 female patients, and their mean age was 62.8 years. and Science, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, 2630 Sugitani, Toyama City, The patients' TNM stages (ver. 6) were as follows: stage I, Toyama 930-0194, Japan 6 patients; stage IIA, 15 patients; stage IIB, 5 patients; E-mail: [email protected] stage III, 24 patients; and stage IV, 6 patients. All of the M1 cases involved only distant lymph node metastases, which Key words: esophageal cancer, cancer stem cell, p75NTR, CD271, were surgically removed. Thirty-six patients underwent CD44, CD90 postoperative cisplatin-based chemotherapy. The institu- tional review board at the University of Toyama approved this study (#20-57). 1944 YAMAGUCHI et al: Esophageal cancer stem cells Immunohistochemistry. The antibodies used for the immuno- Table I. Polymerase chain reaction primer sequences. histochemical staining were as follows: anti-Ki-67 antibody (dilution 1:100), anti-cytokeratin Oscar in vitro diagnostic anti- Gene Size body (dilution 1:200; Abcam Ltd., Cambridge, UK), anti-human product Forward and reverse primers (5'-3') (bp) CD44 monoclonal antibody (156-3C11; dilution 1:400; Cell Signaling Technology, Beverly, MA, USA), anti-human CD90 Nanog F: ATGCCTCACACGGAGACTGT 83 monoclonal antibody (EPR3132; dilution 1:100), and human R: AAGTGGGTTGTTTGCCTTTG p75NTR monoclonal antibody against p75NGER (NGER5; p63 F: CAGACTTGCCAGATCATCC 220 dilution 1:100) (both from Abcam). The immunostaining was R: CAGCATTGTCAGTTTCTTAGC performed using Envision Plus kits, horseradish peroxidase, Bmi-1 F: CCACCTGATGTGTGTGCTTTG 162 or 3,3'-diaminobenzidine (DAB; Dako Cytomation, Kyoto, Japan) as recommended by the supplier. Counterstaining was R: TTCAGTAGTGGTCTGGTCTTGT performed with Mayer's hematoxylin. Involucrin F: TGTTCCTCCTCCAGTCAATACCC 227 The numbers of p75NTR-, CD44- or CD90-positive cells R: ATTCCTCATGCTGTTCCCAGTGC and all tumor cells were counted in three random fields of each E-cadherin F: GTCTGTCATGGAAGGTGCT 370 section. Then, the proportions of each cell type in each tumor R: TACGACGTTAGCCTCGTTC were calculated. We classified tumors as positive when >5% of the tumor cells were stained. N-cadherin F: AGCCAACCTTAACTGAGGAGT 136 Double staining of Ki-67 (brown)/p75NTR (red) or Ki-67 R: GGCAAGTTGATTGGAGGGATG (brown)/CD44 (red) was performed using Bond III automated Fibronectin F: AGGAAGCCGAGGTTTTAACTG 106 immunostainers (Leica Biosystems). The Ki-67 labeling index R: AGGACGCTCATAAGTGTCACC was defined as the number of tumor cells that exhibited posi- tive nuclear immunostaining divided by the total number of DPD F: TCAAGCACACGACTCTTGGTG 205 tumor cells. R: CATACCATTCCACAAGTCAGACC ERCC-1 F: GCCTCCGCTACCACAACCT 313 Human esophageal cancer cell lines and culture conditions. R: TCTTCTCTTGATGCGGCGA Human ESCC cell lines (KYSE-30, KYSE-140, KYSE-150, GAPDH F: ACCACAGTCCATGCCATCAC 452 KYSE-220, KYSE-510, KYSE-520 and KYSE-790) were estab- R: TCCACCACCCTGTTGCTGTA lished by Shimada et al and cultured in Ham's F12/Roswell Park Memorial Institute (RPMI)-1640 medium (Wako, Osaka, F, forward; R, reverse. Japan) supplemented with 2% fetal calf serum (FCS) (Gibco, Grad Island, NY, USA), according to a previously reported method (10). classified cell lines as positive when >1% of their cells were Analysis of cancer stem cell surface antigens and cell sorting. stained. The surface antigen markers of the samples were analyzed The KYSE-30 cells were sorted into p75NTR-positive/ using a FACSCant II flow cytometer and were sorted using CD44-negative, p75NTR-negative/CD44-positive, and p75NTR- a FACSAria II cell sorter and BD FACSDiva software (both negative/CD44-negative fractions. The KYSE-140 cells were from BD Biosciences, San Jose, CA, USA). Fluorescein sorted into p75NTR-positive/CD90-positive, p75NTR-positive/ isothiocyanate (FITC) or allophycocyanin (APC)-conjugated CD90-negative, p75NTR-negative/CD90-positive and p75NTR- monoclonal mouse anti-human CD44 (clone BD105) and negative/CD90-negative fractions. p75NTR (clone ME20.4-1.H4) antibodies were purchased from Miltenyi Biotec (Bergisch Gladbach, Germany). RNA extraction, cDNA synthesis and real-time PCR. Total RNA FITC-conjugated monoclonal mouse anti-human CD90 was extracted using the TRIzol reagent (Invitrogen, Carlsbad, (clone 5E-10) antibodies were obtained from BD Biosciences. CA, USA). cDNA was synthesized using the PrimeScript First FITC-conjugated antibodies were used to detect CSC surface Strand cDNA synthesis kit (Takara Inc., Kyoto, Japan) and markers. Isotype-matched APC- or FITC-conjugated anti- used for the quantitative polymerase chain reaction (qPCR) bodies (Miltenyi Biotec) were used as controls. Cultured cells analysis. The cDNA samples were amplified in an Mx3000P were washed once with phosphate-buffered saline (PBS) (-), real-time qPCR system (Agilent Technologies, Santa Clara, before being dissociated from the culture plates using 0.25% CA, USA) using SYBR Premix Ex Taq II (Takara Inc.), as trypsin-ethylenediaminetetraacetic acid (Invitrogen, Carlsbad, described previously (11). Each mRNA expression level was CA, USA) and centrifuged. Single cells were resuspended in normalized to that of the reference gene GAPDH. The primer PBS (-) containing 2% FBS, and then the FITC-conjugated sequences are shown in Table I. The expression level of each antibody or the isotype control antibody was added, before mRNA molecule was evaluated using the ΔΔCt method. the cells were incubated at 4˚C for 30 min. After being washed twice with PBS (-) containing 2% FBS, the cells were Cell cycle analysis. The cell cycle analysis was performed using resuspended in PBS (-) containing 2% FBS. The cells were the CycleTest Plus DNA reagent kit (Becton-Dickinson Inc., also stained with 7-aminoactinomycin D (7-AAD; Bio-Rad
Recommended publications
  • A Genetically Modified Dermal Micro-Organ Expressing Erythropoietin
    (19) & (11) EP 2 377 401 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 19.10.2011 Bulletin 2011/42 A01N 63/00 (2006.01) A01N 65/00 (2009.01) C12N 5/00 (2006.01) C12N 5/02 (2006.01) (2010.01) (21) Application number: 11174205.2 C12N 5/071 (22) Date of filing: 29.04.2004 (84) Designated Contracting States: • Bukhman, Mordechay AT BE BG CH CY CZ DE DK EE ES FI FR GB GR 21891 Carmiel (IL) HU IE IT LI LU MC NL PL PT RO SE SI SK TR • Stern, Baruch, S. Designated Extension States: 34366 Haifa (IL) AL HR LT LV MK • Shalhevet, David 36090 Kiryat Tivon (IL) (30) Priority: 01.05.2003 US 466793 P • Shavitt, Menachem, D. 06.08.2003 US 492754 P 20142 D.N. Misgav (IL) • Pearlman, Andrew, L. (62) Document number(s) of the earlier application(s) in 20164 D.N. Miscav (IL) accordance with Art. 76 EPC: • Noam, Shani 04760621.5 / 1 653 807 30900 Zichron Yaakov (IL) • Almon, Einat (71) Applicant: Medgenics, Inc. 23840 Timrat (IL) Palo Alto, CA 94303 (US) (74) Representative: Modiano, Micaela Nadia (72) Inventors: Modiano & Partners • Bellomo, Stephen, F. Thierschstrasse 11 30900 Zichron Yaakov (IL) 80538 München (DE) • Lippin, Itzhak 42920 Moshav Beit Yitzhak (IL) Remarks: • Piva, Guillermo, Alberto This application was filed on 15-07-2011 as a Winston Salem, NC North Carolina 27104 (US) divisional application to the application mentioned • Rosenberg, Lior under INID code 62. 84965 Omer (IL) (54) A genetically modified dermal micro-organ expressing erythropoietin (57) The present invention is directed to a genetically cro-organ
    [Show full text]
  • Differential Gene Expression in Oligodendrocyte Progenitor Cells, Oligodendrocytes and Type II Astrocytes
    Tohoku J. Exp. Med., 2011,Differential 223, 161-176 Gene Expression in OPCs, Oligodendrocytes and Type II Astrocytes 161 Differential Gene Expression in Oligodendrocyte Progenitor Cells, Oligodendrocytes and Type II Astrocytes Jian-Guo Hu,1,2,* Yan-Xia Wang,3,* Jian-Sheng Zhou,2 Chang-Jie Chen,4 Feng-Chao Wang,1 Xing-Wu Li1 and He-Zuo Lü1,2 1Department of Clinical Laboratory Science, The First Affiliated Hospital of Bengbu Medical College, Bengbu, P.R. China 2Anhui Key Laboratory of Tissue Transplantation, Bengbu Medical College, Bengbu, P.R. China 3Department of Neurobiology, Shanghai Jiaotong University School of Medicine, Shanghai, P.R. China 4Department of Laboratory Medicine, Bengbu Medical College, Bengbu, P.R. China Oligodendrocyte precursor cells (OPCs) are bipotential progenitor cells that can differentiate into myelin-forming oligodendrocytes or functionally undetermined type II astrocytes. Transplantation of OPCs is an attractive therapy for demyelinating diseases. However, due to their bipotential differentiation potential, the majority of OPCs differentiate into astrocytes at transplanted sites. It is therefore important to understand the molecular mechanisms that regulate the transition from OPCs to oligodendrocytes or astrocytes. In this study, we isolated OPCs from the spinal cords of rat embryos (16 days old) and induced them to differentiate into oligodendrocytes or type II astrocytes in the absence or presence of 10% fetal bovine serum, respectively. RNAs were extracted from each cell population and hybridized to GeneChip with 28,700 rat genes. Using the criterion of fold change > 4 in the expression level, we identified 83 genes that were up-regulated and 89 genes that were down-regulated in oligodendrocytes, and 92 genes that were up-regulated and 86 that were down-regulated in type II astrocytes compared with OPCs.
    [Show full text]
  • Physiology G Endocrine
    2/28/18 Introduction • Endocrine system works with nervous system to coordinate body functions - Nervous system uses impulses and Endocrine System neurotransmitters - Endocrine system uses hormones • Many cells have receptors for both Chapter 24 neurotransmitters and hormones and can be regulated by both chemicals Copyright © 2016 by Elsevier Inc. All rights reserved. 1 Copyright © 2016 by Elsevier Inc. All rights reserved. 2 Comparing Endocrine and Introduction Nervous System Functions • Exocrine glands: Secrete products into ducts that open into body cavities - Sudoriferous: Secrete sweat - Sebaceous: Secrete oil - Ceruminous: Secrete ear wax • Endocrine glands - Secrete hormones directly into bloodstream - Ductless glands Copyright © 2016 by Elsevier Inc. All rights reserved. 3 Copyright © 2016 by Elsevier Inc. All rights reserved. 4 Major Endocrine Glands Anatomy • Hypothalamus • Pituitary • Pineal • Thyroid • Parathyroids • Adrenals • Pancreatic islets • Ovaries • Testes • Hormones From Koeppen BM: Berne & Levy Physiology, Updated Edition, ed 6, St. Louis, 2010, Mosby. Copyright © 2016 by Elsevier Inc. All rights reserved. 5 Copyright © 2016 by Elsevier Inc. All rights reserved. 6 1 2/28/18 Physiology Hormones and Regulation • Hormone production and secretion • Chemical messengers that regulate the • Regulation of metabolism physiologic activity of other cells • Stress adaptation • Have potential to come in contact with every • Chemical composition and fluid volume cell type regulation - Target cells are chemically compatible with
    [Show full text]
  • The Genetic Program of Pancreatic Beta-Cell Replication in Vivo
    Page 1 of 65 Diabetes The genetic program of pancreatic beta-cell replication in vivo Agnes Klochendler1, Inbal Caspi2, Noa Corem1, Maya Moran3, Oriel Friedlich1, Sharona Elgavish4, Yuval Nevo4, Aharon Helman1, Benjamin Glaser5, Amir Eden3, Shalev Itzkovitz2, Yuval Dor1,* 1Department of Developmental Biology and Cancer Research, The Institute for Medical Research Israel-Canada, The Hebrew University-Hadassah Medical School, Jerusalem 91120, Israel 2Department of Molecular Cell Biology, Weizmann Institute of Science, Rehovot, Israel. 3Department of Cell and Developmental Biology, The Silberman Institute of Life Sciences, The Hebrew University of Jerusalem, Jerusalem 91904, Israel 4Info-CORE, Bioinformatics Unit of the I-CORE Computation Center, The Hebrew University and Hadassah, The Institute for Medical Research Israel- Canada, The Hebrew University-Hadassah Medical School, Jerusalem 91120, Israel 5Endocrinology and Metabolism Service, Department of Internal Medicine, Hadassah-Hebrew University Medical Center, Jerusalem 91120, Israel *Correspondence: [email protected] Running title: The genetic program of pancreatic β-cell replication 1 Diabetes Publish Ahead of Print, published online March 18, 2016 Diabetes Page 2 of 65 Abstract The molecular program underlying infrequent replication of pancreatic beta- cells remains largely inaccessible. Using transgenic mice expressing GFP in cycling cells we sorted live, replicating beta-cells and determined their transcriptome. Replicating beta-cells upregulate hundreds of proliferation- related genes, along with many novel putative cell cycle components. Strikingly, genes involved in beta-cell functions, namely glucose sensing and insulin secretion were repressed. Further studies using single molecule RNA in situ hybridization revealed that in fact, replicating beta-cells double the amount of RNA for most genes, but this upregulation excludes genes involved in beta-cell function.
    [Show full text]
  • Endocrine System
    Chapter 17 *Lecture PowerPoint The Endocrine System *See separate FlexArt PowerPoint slides for all figures and tables preinserted into PowerPoint without notes. Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Introduction • In humans, two systems—the nervous and endocrine—communicate with neurotransmitters and hormones • This chapter is about the endocrine system – Chemical identity – How they are made and transported – How they produce effects on their target cells • The endocrine system is involved in adaptation to stress • There are many pathologies that result from endocrine dysfunctions 17-2 Overview of the Endocrine System • Expected Learning Outcomes – Define hormone and endocrine system. – Name several organs of the endocrine system. – Contrast endocrine with exocrine glands. – Recognize the standard abbreviations for many hormones. – Compare and contrast the nervous and endocrine systems. 17-3 Overview of the Endocrine System • The body has four principal mechanisms of communication between cells – Gap junctions • Pores in cell membrane allow signaling molecules, nutrients, and electrolytes to move from cell to cell – Neurotransmitters • Released from neurons to travel across synaptic cleft to second cell – Paracrine (local) hormones • Secreted into tissue fluids to affect nearby cells – Hormones • Chemical messengers that travel in the bloodstream to other tissues and organs 17-4 Overview of the Endocrine System • Endocrine system—glands, tissues, and cells that secrete hormones
    [Show full text]
  • Fibroblasts from the Human Skin Dermo-Hypodermal Junction Are
    cells Article Fibroblasts from the Human Skin Dermo-Hypodermal Junction are Distinct from Dermal Papillary and Reticular Fibroblasts and from Mesenchymal Stem Cells and Exhibit a Specific Molecular Profile Related to Extracellular Matrix Organization and Modeling Valérie Haydont 1,*, Véronique Neiveyans 1, Philippe Perez 1, Élodie Busson 2, 2 1, 3,4,5,6, , Jean-Jacques Lataillade , Daniel Asselineau y and Nicolas O. Fortunel y * 1 Advanced Research, L’Oréal Research and Innovation, 93600 Aulnay-sous-Bois, France; [email protected] (V.N.); [email protected] (P.P.); [email protected] (D.A.) 2 Department of Medical and Surgical Assistance to the Armed Forces, French Forces Biomedical Research Institute (IRBA), 91223 CEDEX Brétigny sur Orge, France; [email protected] (É.B.); [email protected] (J.-J.L.) 3 Laboratoire de Génomique et Radiobiologie de la Kératinopoïèse, Institut de Biologie François Jacob, CEA/DRF/IRCM, 91000 Evry, France 4 INSERM U967, 92260 Fontenay-aux-Roses, France 5 Université Paris-Diderot, 75013 Paris 7, France 6 Université Paris-Saclay, 78140 Paris 11, France * Correspondence: [email protected] (V.H.); [email protected] (N.O.F.); Tel.: +33-1-48-68-96-00 (V.H.); +33-1-60-87-34-92 or +33-1-60-87-34-98 (N.O.F.) These authors contributed equally to the work. y Received: 15 December 2019; Accepted: 24 January 2020; Published: 5 February 2020 Abstract: Human skin dermis contains fibroblast subpopulations in which characterization is crucial due to their roles in extracellular matrix (ECM) biology.
    [Show full text]
  • Downloaded at Google Indexer on July 22, 2021
    Downloaded by guest on October 1, 2021 Proc. Nati. Acad. Sci. USA Vol. 88, pp. 2603-2607, March 1991 Neurobiology Evidence for thymopoietin and thymopoietin/a-bungarotoxin/ nicotinic receptors within the brain M. QUIK*t, U. BABUf, T. AUDHYA*, AND G. GOLDSTEINt *Department of Pharmacology, McGill University, McIntyre Medical Building, 3655 Drummond Street, Montreal, Quebec H3G 1Y6, Canada; and timmunobiology Research Institute, Route 22 East, P.O. Box 999, Annandale, NJ 08801-0999 Communicated by Edward A. Boyse, December 20, 1990 ABSTRACT Thymopoietin, a polypeptide hormone of the These observations suggested that thymopoietin may repre- thymus that has pleiotropic actions on the immune, endocrine, sent an endogenous ligand for the nicotinic a-BGT-binding and nervous systems, potently interacts with the neuromuscu- site in brain; however, the identification of receptor-specific lar nicotinic acetylcholine receptor. Thymopoietin binds to the binding of radiolabeled thymopoietin to a site in brain that nicotinic a-bungarotoxin (a-BGT) receptor in muscle and, like also recognized a-BGT and nicotinic ligands would substan- a-BGT, inhibits cholinergic transmission at this site. Evidence tially support the above hypothesis. The present studies show is given that radiolabeled thymopoietin similarly binds to a that in brain 125I-thymopoietin binds in a specific manner to nicotinic a-BGT-binding site within the brain and does so with a receptor site that also interacts with nicotinic ligands and the characteristics of a specific receptor ligand. Thus specific a-BGT and, furthermore, that a constituent in brain extracts binding to neuronal membranes was saturable, of high affinity has the immunological reactivity and molecular mass of (Kd = 8 nM), linear with increased tissue concentration, and thymopoietin.
    [Show full text]
  • The Role of Lamin Associated Domains in Global Chromatin Organization and Nuclear Architecture
    THE ROLE OF LAMIN ASSOCIATED DOMAINS IN GLOBAL CHROMATIN ORGANIZATION AND NUCLEAR ARCHITECTURE By Teresa Romeo Luperchio A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland March 2016 © 2016 Teresa Romeo Luperchio All Rights Reserved ABSTRACT Nuclear structure and scaffolding have been implicated in expression and regulation of the genome (Elcock and Bridger 2010; Fedorova and Zink 2008; Ferrai et al. 2010; Li and Reinberg 2011; Austin and Bellini 2010). Discrete domains of chromatin exist within the nuclear volume, and are suggested to be organized by patterns of gene activity (Zhao, Bodnar, and Spector 2009). The nuclear periphery, which consists of the inner nuclear membrane and associated proteins, forms a sub- nuclear compartment that is mostly associated with transcriptionally repressed chromatin and low gene expression (Guelen et al. 2008). Previous studies from our lab and others have shown that repositioning genes to the nuclear periphery is sufficient to induce transcriptional repression (K L Reddy et al. 2008; Finlan et al. 2008). In addition, a number of studies have provided evidence that many tissue types, including muscle, brain and blood, use the nuclear periphery as a compartment during development to regulate expression of lineage specific genes (Meister et al. 2010; Szczerbal, Foster, and Bridger 2009; Yao et al. 2011; Kosak et al. 2002; Peric-Hupkes et al. 2010). These large regions of chromatin that come in molecular contact with the nuclear periphery are called Lamin Associated Domains (LADs). The studies described in this dissertation have furthered our understanding of maintenance and establishment of LADs as well as the relationship of LADs with the epigenome and other factors that influence three-dimensional chromatin structure.
    [Show full text]
  • Immune Cells in Spleen and Mucosa + CD127 Neg Production of IL-17 and IL-22 by CD3 TLR5 Signaling Stimulates the Innate
    Downloaded from http://www.jimmunol.org/ by guest on September 23, 2021 neg is online at: average * The Journal of Immunology , 23 of which you can access for free at: 2010; 185:1177-1185; Prepublished online 21 Immune Cells in Spleen and Mucosa from submission to initial decision + 4 weeks from acceptance to publication TLR5 Signaling Stimulates the Innate Production of IL-17 and IL-22 by CD3 CD127 Laurye Van Maele, Christophe Carnoy, Delphine Cayet, Pascal Songhet, Laure Dumoutier, Isabel Ferrero, Laure Janot, François Erard, Julie Bertout, Hélène Leger, Florent Sebbane, Arndt Benecke, Jean-Christophe Renauld, Wolf-Dietrich Hardt, Bernhard Ryffel and Jean-Claude Sirard June 2010; doi: 10.4049/jimmunol.1000115 http://www.jimmunol.org/content/185/2/1177 J Immunol cites 51 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://www.jimmunol.org/content/185/2/1177.full#ref-list-1 http://www.jimmunol.org/content/suppl/2010/06/21/jimmunol.100011 5.DC1 This article Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2010 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.
    [Show full text]
  • Autocrine IFN Signaling Inducing Profibrotic Fibroblast Responses By
    Downloaded from http://www.jimmunol.org/ by guest on September 23, 2021 Inducing is online at: average * The Journal of Immunology , 11 of which you can access for free at: 2013; 191:2956-2966; Prepublished online 16 from submission to initial decision 4 weeks from acceptance to publication August 2013; doi: 10.4049/jimmunol.1300376 http://www.jimmunol.org/content/191/6/2956 A Synthetic TLR3 Ligand Mitigates Profibrotic Fibroblast Responses by Autocrine IFN Signaling Feng Fang, Kohtaro Ooka, Xiaoyong Sun, Ruchi Shah, Swati Bhattacharyya, Jun Wei and John Varga J Immunol cites 49 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130037 6.DC1 This article http://www.jimmunol.org/content/191/6/2956.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 23, 2021. The Journal of Immunology A Synthetic TLR3 Ligand Mitigates Profibrotic Fibroblast Responses by Inducing Autocrine IFN Signaling Feng Fang,* Kohtaro Ooka,* Xiaoyong Sun,† Ruchi Shah,* Swati Bhattacharyya,* Jun Wei,* and John Varga* Activation of TLR3 by exogenous microbial ligands or endogenous injury-associated ligands leads to production of type I IFN.
    [Show full text]
  • Immune Response of Hepatitis B Vaccine Among Persons with Diabetes a Systematic Review of the Literature
    SYSTEMATIC REVIEW Immune Response of Hepatitis B Vaccine Among Persons With Diabetes A systematic review of the literature 1 SARAH F. SCHILLIE, MD among persons with diabetes show some 2 PHILIP R. SPRADLING, MD 1 heterogeneity compared with adults without TRUDY V. MURPHY, MD diabetes. Differences in diabetes type, man- agement, and glycemic control, as well as vaccine, dosage, administration route, or schedule, may underlie this heterogeneity. n October 2011, the Advisory Com- and other comorbid conditions (6–12). The 2011 ACIP recommendation for hepa- Imittee on Immunization Practices Results of studies of the hepatitis B vac- titis B vaccination for adults with diabetes, an (ACIP) recommended hepatitis B vac- cine among persons with diabetes gener- increasing incidence of diabetes, and the cination for adults with diabetes in the ally follow these patterns (13,14). high prevalence of diabetes among certain United States (1). Serosurvey data from Primary hepatitis B vaccination usu- groups recommended for hepatitis B vacci- the 1999–2010 National Health and Nu- ally consists of 3 (or 4) doses of 10 or nation (e.g., persons with end-stage renal trition Examination Survey found that 20 mg of recombinant hepatitis B surface disease) suggests that a review of vaccine ef- noninstitutionalized adults aged $18 antigen (HBsAg) protein administered in- ficacy among persons with diabetes may be years with diabetes have an increased se- tramuscularly into the deltoid muscle timely. We therefore performed a systematic roprevalence of past or current hepatitis B on a 0-, 1-, and 6-month schedule review of the literatureandsummarizedthe virus (HBV) infection (1).
    [Show full text]
  • Breast Cancer Disparities How Can We Leverage Genomics to Improve Outcomes?
    Breast Cancer Disparities How Can We Leverage Genomics to Improve Outcomes? a b, Melissa B. Davis, PhD , Lisa A. Newman, MD, MPH * KEYWORDS Disparities Genetics Genomics African ancestry KEY POINTS Advances in breast cancer genomics will provide important insights regarding explanations for variations in incidence, as well as disparate outcomes, between African American and white American breast cancer patients. Germline genomics are essential in genetic counseling and risk assessment programs; somatic or tumor-based genomics will be critical in defining prognostic and therapeutic algorithms. It is imperative that the oncology community be prepared to apply these technologies equitably to diverse patient populations. BACKGROUND Disparities in breast cancer risk and outcome related to racial-ethnic identity in the United States have been documented by population-based statistics from the Surveil- lance, Epidemiology, and End Results (SEER) Program over the past several decades. These patterns are further supported by data from a variety of health care systems and oncology programs. Variations in the breast cancer burden of African Americans (AA) women compared with white American (WA) women have been the subject of rigorous study1 because of the magnitude of the observed differences and are the focus of this article. Table 1 summarizes these divergent patterns. Breast cancer mortality rates are higher for AA compared with WA women, and this is at least partly explained by a more advanced stage distribution, with AA women being diagnosed more frequently with larger, node-positive disease. Breast cancer incidence Disclosure: This work was partially supported by Susan G. Komen for the Cure through Komen Scholars Leadership Grant HFHS F11047 (LAN).
    [Show full text]