DOCSLIB.ORG

Mass Spectrometry-Based Proteomics Analysis of Bioactive Proteins in EMD That Modulate Adhesion of Gingival Fibroblast to Improve Bio-Integration of Dental Implants

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Western University Scholarship@Western Electronic Thesis and Dissertation Repository 3-28-2019 3:00 PM Mass Spectrometry-Based Proteomics Analysis Of Bioactive Proteins In EMD That Modulate Adhesion Of Gingival Fibroblast To Improve Bio-Integration Of Dental Implants David Zuanazzi Machado Jr The University of Western Ontario Supervisor Siqueira, Walter L. The University of Western Ontario Graduate Program in Biochemistry A thesis submitted in partial fulfillment of the equirr ements for the degree in Doctor of Philosophy © David Zuanazzi Machado Jr 2019 Follow this and additional works at: https://ir.lib.uwo.ca/etd Part of the Biochemistry Commons, Dental Materials Commons, Oral Biology and Oral Pathology Commons, and the Periodontics and Periodontology Commons Recommended Citation Zuanazzi Machado, David Jr, "Mass Spectrometry-Based Proteomics Analysis Of Bioactive Proteins In EMD That Modulate Adhesion Of Gingival Fibroblast To Improve Bio-Integration Of Dental Implants" (2019). Electronic Thesis and Dissertation Repository. 6064. https://ir.lib.uwo.ca/etd/6064 This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected]. i ABSTRACT Titanium (Ti) implants are used in dental practice to replace damaged or lost teeth. For effective treatment, the dental implant needs to integrate with the surrounding hard and soft tissues on the implant site. Despite improvements in bone-implant integration that have been achieved through surface modifications, the integration with the soft tissues is still deficient. The oral mucosa that embraces the transmucosal component of the implant only contacts the surface without making a strong attachment with the connective tissue. The lack of attachment offers no protection against bacterial invasion that can lead to local infection and implant loss. Among different modification applied to Ti surfaces, coating the surface with specific proteins is a new area in biomedical research aiming to improve implant biointegration. To this end, proteins that comprise the enamel matrix derivative (EMD) would be good candidates to be used as surface coatings. EMD is a rich protein mixture used as a biomaterial to promotes tissue regeneration by modulating many cells, including gingival fibroblasts, the most abundant cell type of oral connective tissue. However, many proteins containing in EMD are yet to be identified. Considering that surface features are important to modulate protein adsorption, we worked with the hypothesis that we could use the characteristics of different Ti surfaces in a surface-affinity approach to creating unique coatings with EMD. Therefore, it would allow us to identify bioactive proteins within EMD that could be further used as a coating on the implant to promote adhesion of gingival fibroblast to the surface, improving the implant biointegration. Since it is not well-established whether the surface attracts or binds specific proteins from complex mixtures, saliva was used as a ii model in combination with mass spectrometry to investigate surface specificity for protein binding of three different Ti surfaces (PT, SLA, and SLActive). By applying this approach, we showed that the Ti surfaces had a low specificity for protein binding due to high similarity on the pellicle composition despite differences in characteristics between surfaces. The lack of binding specificity led us to explore the EMD composition utilizing another strategy. Through the MudPIT methodology, we fractionated EMD in 32 fractions to characterize its proteome. We identified 2000 proteins through tandem mass spectrometry (MS/MS) including novel proteins that are associated with EMD biological activity, i.e. biomineralization, wound healing and biological adhesion. The obtained EMD fractions were then applied to human gingival fibroblast (HGF) to evaluate their capability to promote cell adhesion on a coated surface. The adhesion assay indicated that two EMD fraction (F23 and F24), which contained the adhesion proteins fibrillin-1 and tenascin C, showed a significantly higher response than native EMD and other EMD fractions. Overall, the work presented herein indicated the need for more studies on surface-proteins interaction given the low surface specificity presented by each Ti surface. Also, this thesis provided an in-depth insight on the complexity of EMD protein composition, including the identification of novel proteins that are related to EMD biological activity such as the adhesion of gingival fibroblasts. Key Words: Dental implants, titanium, size exclusion chromatography, mass spectrometry, proteomics, peptides, gene ontology, fibroblasts, cell adhesion. iii DEDICATION First and foremost, I would like to dedicate this thesis to God and to my beautiful family that always provided me with endless encouragement and support during my academic endeavors. To my lovely wife Maura whose everyday-presence and unconditional love have inspired me to be a better husband and father. Without you, I would never be the person I am today. To my amazing children, Giovanna and Enzo, who have shaped my heart with their hugs, kisses, and words. Holding you in my arms is always breathtaking. Secondly, I would like to thank my parents who raised me with love, values, and discipline. Words are not enough to demonstrate my gratitude for supporting my decision throughout my life, particularly the hardest ones. To my sister Rebeca, thank you for our never-ending friendship and your presence in my life. Thank you all for your companionship during this chapter of my life. Surely, without you, none of this would be possible. iv ACKNOWLEDGEMENT First, I would like to express my sincere gratitude to my supervisor Dr. Walter Siqueira for his continuous support during my Ph.D. study. Thank you for your guidance during my development as a scientist and for providing inspiration and encouragement to continue working on dental research. Also, I want to say a big thanks to the past and present members of the Siqueira lab for the time spent together whether working in the lab or drinking coffee. Every one of you has contributed in many different ways during these five years we shared. Cindy, thank you for always being available to assist me with the mass spectrometer and for providing useful insights during our conversations. You have been a real helper. Thank you to all member of the Junop lab. I genuinely appreciate the support I have received, especially Dr. Murray Junop for generously opening his lab to process my samples and Chris Brown for his patience while showing me how to operate the FPLC system properly. Likewise, I want to extend my gratitude to Dr. Douglas Hamilton and members of the Hamilton Lab for the warm welcome and incredible support while I was using the cell culture room. Thank you, Georgia, Adam, JT, Sarah, and Karrie, for providing the fibroblasts and space and time to culture the cells. At last but not least, I want to thank Dr. Andrew Leask and members of Leask Lab for useful insights and for make yourselves available when needed and for providing the PrestoBlue reagent that was critical to finish my work. v TABLE OF CONTENTS ABSTRACT ......................................................................................................... i DEDICATION …………………………………………………………………………. iii ACKNOWLEDGEMENT ..…………..................................................................... iv TABLE OF CONTENTS ...................................................................................... v LIST OF TABLES ................................................................................................ ix LIST OF FIGURES ............................................................................................. x LIST OF APPENDICES ..................................................................................... xii LIST OF ABBREVIATIONS …………………………………………..................... xiii Chapter 1 Introduction .................................................................................. 1 1.1 Titanium Dental implant ......................................................................... 1 1.2 Osseointegration ................................................................................... 3 1.3 Titanium Surfaces …….......................................................................... 4 1.4 Biomimetic Technology .…..................................................................... 7 1.5 Enamel Matrix Derivative (EMD) ........................................................... 8 1.5.1 Influence of EMD in hard and soft tissues ………...............………. 9 1.6 Mass spectrometry-based proteomics .…........................................... 12 1.6.1 Top-down approach ………………………….………….…...……... 15 1.6.2 Bottom-up approach …………………………...……….…....……... 15 1.6.2.1 Protein/peptides Separation Methods ……….………..…... 16 1.6.2.2 Ionization and proteins identification …..….…………..…... 17 1.7 Thesis rationale ................................................................................... 18 1.8 Scope of thesis .................................................................................... 19 1.9 References ……................................................................................... 22 vi Chapter 2 Salivary Pellicle Proteome Formed onto Three Different Titanium Surfaces ……………………………………………………….
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Dog Coat Colour Genetics: a Review Date Published Online: 31/08/2020; 1,2 1 1 3 Rashid Saif *, Ali Iftekhar , Fatima Asif , Mohammad Suliman Alghanem

    Dog Coat Colour Genetics: a Review Date Published Online: 31/08/2020; 1,2 1 1 3 Rashid Saif *, Ali Iftekhar , Fatima Asif , Mohammad Suliman Alghanem

    www.als-journal.com/ ISSN 2310-5380/ August 2020 Review Article Advancements in Life Sciences – International Quarterly Journal of Biological Sciences ARTICLE INFO Open Access Date Received: 02/05/2020; Date Revised: 20/08/2020; Dog Coat Colour Genetics: A Review Date Published Online: 31/08/2020; 1,2 1 1 3 Rashid Saif *, Ali Iftekhar , Fatima Asif , Mohammad Suliman Alghanem Authors’ Affiliation: 1. Institute of Abstract Biotechnology, Gulab Devi Educational anis lupus familiaris is one of the most beloved pet species with hundreds of world-wide recognized Complex, Lahore - Pakistan breeds, which can be differentiated from each other by specific morphological, behavioral and adoptive 2. Decode Genomics, traits. Morphological characteristics of dog breeds get more attention which can be defined mostly by 323-D, Town II, coat color and its texture, and considered to be incredibly lucrative traits in this valued species. Although Punjab University C Employees Housing the genetic foundation of coat color has been well stated in the literature, but still very little is known about the Scheme, Lahore - growth pattern, hair length and curly coat trait genes. Skin pigmentation is determined by eumelanin and Pakistan 3. Department of pheomelanin switching phenomenon which is under the control of Melanocortin 1 Receptor and Agouti Signaling Biology, Tabuk Protein genes. Genetic variations in the genes involved in pigmentation pathway provide basic understanding of University - Kingdom melanocortin physiology and evolutionary adaptation of this trait. So in this review, we highlighted, gathered and of Saudi Arabia comprehend the genetic mutations, associated and likely to be associated variants in the genes involved in the coat color and texture trait along with their phenotypes.
  • Universidade Estadual De Campinas Instituto De Biologia

    Universidade Estadual De Campinas Instituto De Biologia

    UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA CAMPINAS 2016 1 VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA Dissertação apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do Título de Mestra em Biologia Funcional e Molecular na área de concentração de Bioquímica. Dissertation presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Master in Functional and Molecular Biology, in the area of Biochemistry. ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA DISSERTAÇÃO DEFENDIDA PELA ALUNA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA E ORIENTADA PELO DANIEL MARTINS-DE-SOUZA. Orientador: Daniel Martins-de-Souza CAMPINAS 2016 2 Agência(s) de fomento e nº(s) de processo(s): CNPq, 151787/2F2014-0 Ficha catalográfica Universidade Estadual de Campinas Biblioteca do Instituto de Biologia Mara Janaina de Oliveira - CRB 8/6972 Saia-Cereda, Verônica Aparecida Monteiro, 1988- Sa21p O proteoma do corpo caloso da esquizofrenia / Verônica Aparecida Monteiro Saia Cereda. – Campinas, SP : [s.n.], 2016. Orientador: Daniel Martins de Souza. Dissertação (mestrado) – Universidade Estadual de Campinas, Instituto de Biologia. 1. Esquizofrenia. 2. Espectrometria de massas. 3. Corpo caloso.
  • Transcriptional Regulation of RKIP in Prostate Cancer Progression

    Transcriptional Regulation of RKIP in Prostate Cancer Progression

    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Sciences Transcriptional Regulation of RKIP in Prostate Cancer Progression Submitted by: Sandra Marie Beach In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Sciences Examination Committee Major Advisor: Kam Yeung, Ph.D. Academic William Maltese, Ph.D. Advisory Committee: Sonia Najjar, Ph.D. Han-Fei Ding, M.D., Ph.D. Manohar Ratnam, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: May 16, 2007 Transcriptional Regulation of RKIP in Prostate Cancer Progression Sandra Beach University of Toledo ACKNOWLDEGMENTS I thank my major advisor, Dr. Kam Yeung, for the opportunity to pursue my degree in his laboratory. I am also indebted to my advisory committee members past and present, Drs. Sonia Najjar, Han-Fei Ding, Manohar Ratnam, James Trempe, and Douglas Pittman for generously and judiciously guiding my studies and sharing reagents and equipment. I owe extended thanks to Dr. William Maltese as a committee member and chairman of my department for supporting my degree progress. The entire Department of Biochemistry and Cancer Biology has been most kind and helpful to me. Drs. Roy Collaco and Hong-Juan Cui have shared their excellent technical and practical advice with me throughout my studies. I thank members of the Yeung laboratory, Dr. Sungdae Park, Hui Hui Tang, Miranda Yeung for their support and collegiality. The data mining studies herein would not have been possible without the helpful advice of Dr. Robert Trumbly. I am also grateful for the exceptional assistance and shared microarray data of Dr.
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas

    Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas

    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
  • Mass Spectrometry-Based Proteomics Techniques and Their Application in Ovarian Cancer Research Agata Swiatly, Szymon Plewa, Jan Matysiak and Zenon J

    Mass Spectrometry-Based Proteomics Techniques and Their Application in Ovarian Cancer Research Agata Swiatly, Szymon Plewa, Jan Matysiak and Zenon J

    Swiatly et al. Journal of Ovarian Research (2018) 11:88 https://doi.org/10.1186/s13048-018-0460-6 REVIEW Open Access Mass spectrometry-based proteomics techniques and their application in ovarian cancer research Agata Swiatly, Szymon Plewa, Jan Matysiak and Zenon J. Kokot* Abstract Ovarian cancer has emerged as one of the leading cause of gynecological malignancies. So far, the measurement of CA125 and HE4 concentrations in blood and transvaginal ultrasound examination are essential ovarian cancer diagnostic methods. However, their sensitivity and specificity are still not sufficient to detect disease at the early stage. Moreover, applied treatment may appear to be ineffective due to drug-resistance. Because of a high mortality rate of ovarian cancer, there is a pressing need to develop innovative strategies leading to a full understanding of complicated molecular pathways related to cancerogenesis. Recent studies have shown the great potential of clinical proteomics in the characterization of many diseases, including ovarian cancer. Therefore, in this review, we summarized achievements of proteomics in ovarian cancer management. Since the development of mass spectrometry has caused a breakthrough in systems biology, we decided to focus on studies based on this technique. According to PubMed engine, in the years 2008–2010 the number of studies concerning OC proteomics was increasing, and since 2010 it has reached a plateau. Proteomics as a rapidly evolving branch of science may be essential in novel biomarkers discovery, therapy decisions, progression predication, monitoring of drug response or resistance. Despite the fact that proteomics has many to offer, we also discussed some limitations occur in ovarian cancer studies.
  • University of Leicester, Msc Medical Statistics, Thesis, Wilmar

    University of Leicester, Msc Medical Statistics, Thesis, Wilmar

    Thesis MSc in Medical Statistics Department of Health Sciences University of Leicester, United Kingdom Application of Bayesian hierarchical generalized linear models using weakly informative prior distributions to identify rare genetic variant effects on blood pressure Wilmar Igl March 2015 Summary Background Currently rare genetic variants are discussed as a source of \missing heritability" of complex traits. Bayesian hierarchical models were proposed as an efficient method for the estimation and aggregation of conditional effects of rare variants. Here, such models are applied to identify rare variant effects on blood pressure. Methods Empirical data provided by the Genetic Analysis Workshop 19 (2014) included 1,851 Mexican-American individuals with diastolic blood pressure (DBP), systolic blood pressure (SBP), hypertension (HTN) and 461,868 variants from whole- exome sequencing of odd-numbered chromosomes. Bayesian hierarchical generalized linear models using weakly informative prior distributions were applied. Results Associations of rare variants chr1:204214013 (estimate = 39.6, Credible In- terval (CrI) 95% = [25.3, 53.9], Bayesian p = 6:8 × 10−8) in the PLEKHA6 gene and chr11:118518698 (estimate = 32.2, CrI95% = [20.6, 43.9], Bayesian p = 7:0 × 10−8) in the PHLEDB1 gene were identified. Joint effects of grouped rare variants on DBP in 23 genes (Bayesian p = [8:8 × 10−14, 9:3 × 10−8]) and on SBP in 21 genes (Bayesian p = [8:6 × 10−12, 7:8 × 10−8]) in pathways related to hemostasis, sodi- um/calcium transport, ciliary activity, and others were found. No association with hypertension was detected. Conclusions Bayesian hierarchical generalized linear models with weakly informa- tive priors can successfully be applied in exome-wide genetic association analyses of rare variants.
  • Tnfa-Induced Mucin 4 Expression Elicits Trastuzumab Resistance in HER2-Positive Breast Cancer María F

    Tnfa-Induced Mucin 4 Expression Elicits Trastuzumab Resistance in HER2-Positive Breast Cancer María F

    Published OnlineFirst October 3, 2016; DOI: 10.1158/1078-0432.CCR-16-0970 Cancer Therapy: Clinical Clinical Cancer Research TNFa-Induced Mucin 4 Expression Elicits Trastuzumab Resistance in HER2-Positive Breast Cancer María F. Mercogliano1, Mara De Martino1, Leandro Venturutti1, Martín A. Rivas2, Cecilia J. Proietti1, Gloria Inurrigarro3, Isabel Frahm3, Daniel H. Allemand4, Ernesto Gil Deza5, Sandra Ares5, Felipe G. Gercovich5, Pablo Guzman 6, Juan C. Roa6,7, Patricia V. Elizalde1, and Roxana Schillaci1 Abstract Purpose: Although trastuzumab administration improved the Results: TNFa overexpression turned trastuzumab-sensitive outcome of HER2-positive breast cancer patients, resistance cells and tumors into resistant ones. Histopathologic findings events hamper its clinical benefits. We demonstrated that TNFa revealed mucin foci in TNFa-producing tumors. TNFa induced stimulation in vitro induces trastuzumab resistance in HER2- upregulation of MUC4 that reduced trastuzumab binding to its positive breast cancer cell lines. Here, we explored the mechanism epitope and impaired ADCC. Silencing MUC4 enhanced trastu- of TNFa-induced trastuzumab resistance and the therapeutic zumab binding, increased ADCC, and overcame trastuzumab and strategies to overcome it. trastuzumab-emtansine antiproliferative effects in TNFa-overex- Experimental Design: Trastuzumab-sensitive breast cancer pressing cells. Accordingly, administration of TNFa-blocking cells, genetically engineered to stably overexpress TNFa,and antibodies downregulated MUC4 and sensitized de novo trastu- de novo trastuzumab-resistant tumors, were used to evaluate zumab-resistant breast cancer cells and tumors to trastuzumab. In trastuzumab response and TNFa-blocking antibodies effective- HER2-positive breast cancer samples, MUC4 expression was ness respectively. Immunohistochemistry and antibody-depen- found to be an independent predictor of poor disease-free survival dent cell cytotoxicity (ADCC), together with siRNA strategy, (P ¼ 0.008).
  • De Novo, Systemic, Deleterious Amino Acid Substitutions Are Common in Large Cytoskeleton‑Related Protein Coding Regions

    De Novo, Systemic, Deleterious Amino Acid Substitutions Are Common in Large Cytoskeleton‑Related Protein Coding Regions

    BIOMEDICAL REPORTS 6: 211-216, 2017 De novo, systemic, deleterious amino acid substitutions are common in large cytoskeleton‑related protein coding regions REBECCA J. STOLL1, GRACE R. THOMPSON1, MOHAMMAD D. SAMY1 and GEORGE BLANCK1,2 1Department of Molecular Medicine, Morsani College of Medicine, University of South Florida; 2Immunology Program, H. Lee Moffitt Cancer Center and Research Institute, Tampa, FL 33612, USA Received June 13, 2016; Accepted October 31, 2016 DOI: 10.3892/br.2016.826 Abstract. Human mutagenesis is largely random, thus large Introduction coding regions, simply on the basis of probability, represent relatively large mutagenesis targets. Thus, we considered Genetic damage is largely random and therefore tends to the possibility that large cytoskeletal-protein related coding affect the larger, functional regions of the human genome regions (CPCRs), including extra-cellular matrix (ECM) more frequently than the smaller regions (1). For example, coding regions, would have systemic nucleotide variants that a systematic study has revealed that cancer fusion genes, on are not present in common SNP databases. Presumably, such average, are statistically, significantly larger than other human variants arose recently in development or in recent, preceding genes (2,3). The large introns of potential cancer fusion genes generations. Using matched breast cancer and blood-derived presumably allow for many different productive recombina- normal datasets from the cancer genome atlas, CPCR single tion opportunities, i.e., many recombinations that would allow nucleotide variants (SNVs) not present in the All SNPs(142) for exon juxtaposition and the generation of hybrid proteins. or 1000 Genomes databases were identified. Using the Protein Smaller cancer fusion genes tend to be associated with the rare Variation Effect Analyzer internet-based tool, it was discov- types of cancer, for example EWS RNA binding protein 1 in ered that apparent, systemic mutations (not shared among Ewing's sarcoma.
  • Towards Relating the Evolution of the Gene Repertoire in Mammals to Tissue Specialisation

    Towards Relating the Evolution of the Gene Repertoire in Mammals to Tissue Specialisation

    Towards Relating the Evolution of the Gene Repertoire in Mammals to Tissue Specialisation Shiri Freilich Wolfson College This dissertation is submitted to the University of Cambridge for the degree of Doctor of Philosophy 21 December 2006 To Leon, who was the wind blowing in my sails, in the deep blue sea of this journey of ours. This Thesis is the result of my own work and includes nothing which is the outcome of work done in collaboration except where specifically indicated in the text. This Thesis does not exceed the specified length limit of 300 pages as defined by the Biology Degree Committee. This Thesis has been typeset in 12pt font according to the specifications defined by the Board of Graduate Studies and the Biology Degree Committee. 3 Summary: Towards Relating the Evolution of the Gene Repertoire in Mammals to Tissue Specialisation The sequencing efforts of recent years have provided a rich source of data for investigating how gene content determines similarity and uniqueness in a species’ phenotype. Work described in this PhD Thesis attempts to relate innovations in the gene repertoire along the mammalian lineage to the most obvious phenotypic characteristic of animals: the appearance of highly differentiated tissue types. Several different approaches, outlined below, have been followed to address some aspects of this problem. Initially, a comprehensive study of the pattern of expansion of the complement of enzymes in various species was performed in order to obtain a better view of the principles underlying the expansion of the gene repertoire in mammals. Although several studies have described a tendency toward an increase in sequence redundancy in mammals, not much is known about the way such sequence redundancy reflects functional redundancy.
  • Antigen-Specific Memory CD4 T Cells Coordinated Changes in DNA

    Antigen-Specific Memory CD4 T Cells Coordinated Changes in DNA

    Downloaded from http://www.jimmunol.org/ by guest on September 24, 2021 is online at: average * The Journal of Immunology The Journal of Immunology published online 18 March 2013 from submission to initial decision 4 weeks from acceptance to publication http://www.jimmunol.org/content/early/2013/03/17/jimmun ol.1202267 Coordinated Changes in DNA Methylation in Antigen-Specific Memory CD4 T Cells Shin-ichi Hashimoto, Katsumi Ogoshi, Atsushi Sasaki, Jun Abe, Wei Qu, Yoichiro Nakatani, Budrul Ahsan, Kenshiro Oshima, Francis H. W. Shand, Akio Ametani, Yutaka Suzuki, Shuichi Kaneko, Takashi Wada, Masahira Hattori, Sumio Sugano, Shinichi Morishita and Kouji Matsushima J Immunol Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Author Choice option Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Freely available online through http://www.jimmunol.org/content/suppl/2013/03/18/jimmunol.120226 7.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material Permissions Email Alerts Subscription Author Choice Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 24, 2021. Published March 18, 2013, doi:10.4049/jimmunol.1202267 The Journal of Immunology Coordinated Changes in DNA Methylation in Antigen-Specific Memory CD4 T Cells Shin-ichi Hashimoto,*,†,‡ Katsumi Ogoshi,* Atsushi Sasaki,† Jun Abe,* Wei Qu,† Yoichiro Nakatani,† Budrul Ahsan,x Kenshiro Oshima,† Francis H.
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant

    Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant

    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,