Digitalcommons@UNMC Regulation of the Transmembrane Mucin MUC4
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Bioinformatics Approach for Pattern of Myelin-Specific Proteins And
CORE Metadata, citation and similar papers at core.ac.uk Provided by Qazvin University of Medical Sciences Repository Biotech Health Sci. 2016 November; 3(4):e38278. doi: 10.17795/bhs-38278. Published online 2016 August 16. Research Article Bioinformatics Approach for Pattern of Myelin-Specific Proteins and Related Human Disorders Samiie Pouragahi,1,2,3 Mohammad Hossein Sanati,4 Mehdi Sadeghi,2 and Marjan Nassiri-Asl3,* 1Department of Molecular Medicine, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 2Department of Bioinformatics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran 3Department of Pharmacology, Cellular and Molecular Research Center, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 4Department of Molecular Genetics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran *Corresponding author: Marjan Nassiri-Asl, School of Medicine, Qazvin University of Medical Sciences, Qazvin, IR Iran. Tel: +98-2833336001, Fax: +98-2833324971, E-mail: [email protected] Received 2016 April 06; Revised 2016 May 30; Accepted 2016 June 22. Abstract Background: Recent neuroinformatic studies, on the structure-function interaction of proteins, causative agents basis of human disease have implied that dysfunction or defect of different protein classes could be associated with several related diseases. Objectives: The aim of this study was the use of bioinformatics approaches for understanding the structure, function and relation- ship of myelin protein 2 (PMP2), a myelin-basic protein in the basis of neuronal disorders. Methods: A collection of databases for exploiting classification information systematically, including, protein structure, protein family and classification of human disease, based on a new approach was used. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Oral Absorption of Peptides and Nanoparticles Across the Human Intestine: Opportunities, Limitations and Studies in Human Tissues☆
Advanced Drug Delivery Reviews 106 (2016) 256–276 Contents lists available at ScienceDirect Advanced Drug Delivery Reviews journal homepage: www.elsevier.com/locate/addr Oral absorption of peptides and nanoparticles across the human intestine: Opportunities, limitations and studies in human tissues☆ P. Lundquist, P. Artursson ⁎ Department of Pharmacy, Uppsala University, Box 580, SE-752 37 Uppsala, Sweden article info abstract Article history: In this contribution, we review the molecular and physiological barriers to oral delivery of peptides and nanopar- Received 2 May 2016 ticles. We discuss the opportunities and predictivity of various in vitro systems with special emphasis on human Received in revised form 2 July 2016 intestine in Ussing chambers. First, the molecular constraints to peptide absorption are discussed. Then the phys- Accepted 8 July 2016 iological barriers to peptide delivery are examined. These include the gastric and intestinal environment, the Available online 3 August 2016 mucus barrier, tight junctions between epithelial cells, the enterocytes of the intestinal epithelium, and the Keywords: subepithelial tissue. Recent data from human proteome studies are used to provide information about the protein fi Oral drug delivery expression pro les of the different physiological barriers to peptide and nanoparticle absorption. Strategies that Peptide drugs have been employed to increase peptide absorption across each of the barriers are discussed. Special consider- Nanoparticles ation is given to attempts at utilizing endogenous transcytotic pathways. To reliably translate in vitro data on Ussing chamber peptide or nanoparticle permeability to the in vivo situation in a human subject, the in vitro experimental system Peptide permeability needs to realistically capture the central aspects of the mentioned barriers. -
Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo -
Tnfa-Induced Mucin 4 Expression Elicits Trastuzumab Resistance in HER2-Positive Breast Cancer María F
Published OnlineFirst October 3, 2016; DOI: 10.1158/1078-0432.CCR-16-0970 Cancer Therapy: Clinical Clinical Cancer Research TNFa-Induced Mucin 4 Expression Elicits Trastuzumab Resistance in HER2-Positive Breast Cancer María F. Mercogliano1, Mara De Martino1, Leandro Venturutti1, Martín A. Rivas2, Cecilia J. Proietti1, Gloria Inurrigarro3, Isabel Frahm3, Daniel H. Allemand4, Ernesto Gil Deza5, Sandra Ares5, Felipe G. Gercovich5, Pablo Guzman 6, Juan C. Roa6,7, Patricia V. Elizalde1, and Roxana Schillaci1 Abstract Purpose: Although trastuzumab administration improved the Results: TNFa overexpression turned trastuzumab-sensitive outcome of HER2-positive breast cancer patients, resistance cells and tumors into resistant ones. Histopathologic findings events hamper its clinical benefits. We demonstrated that TNFa revealed mucin foci in TNFa-producing tumors. TNFa induced stimulation in vitro induces trastuzumab resistance in HER2- upregulation of MUC4 that reduced trastuzumab binding to its positive breast cancer cell lines. Here, we explored the mechanism epitope and impaired ADCC. Silencing MUC4 enhanced trastu- of TNFa-induced trastuzumab resistance and the therapeutic zumab binding, increased ADCC, and overcame trastuzumab and strategies to overcome it. trastuzumab-emtansine antiproliferative effects in TNFa-overex- Experimental Design: Trastuzumab-sensitive breast cancer pressing cells. Accordingly, administration of TNFa-blocking cells, genetically engineered to stably overexpress TNFa,and antibodies downregulated MUC4 and sensitized de novo trastu- de novo trastuzumab-resistant tumors, were used to evaluate zumab-resistant breast cancer cells and tumors to trastuzumab. In trastuzumab response and TNFa-blocking antibodies effective- HER2-positive breast cancer samples, MUC4 expression was ness respectively. Immunohistochemistry and antibody-depen- found to be an independent predictor of poor disease-free survival dent cell cytotoxicity (ADCC), together with siRNA strategy, (P ¼ 0.008). -
Supplementary Table 1: Adhesion Genes Data Set
Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like, -
A Stealth Cloak for Cancer Cells
BMB Rep. 2021; 54(7): 344-355 BMB www.bmbreports.org Reports Invited Mini Review Mucin in cancer: a stealth cloak for cancer cells Dong-Han Wi1, Jong-Ho Cha2,3 & Youn-Sang Jung1,* 1Department of Life Science, Chung-Ang University, Seoul, 06974, 2Department of Biomedical Sciences, College of Medicine, Inha University, Incheon 22212, 3Department of Biomedical Science, Program in Biomedical Science and Engineering, Graduate school, Inha University, Incheon 22212, Korea Mucins are high molecular-weight epithelial glycoproteins and mucinous colorectal carcinoma (MCC) (3). Since tumor growth are implicated in many physiological processes, including epit- sites induce inhospitable conditions for them to survive, helial cell protection, signaling transduction, and tissue home- mucins are suggested as an oncogenic microenvironment that ostasis. Abnormality of mucus expression and structure contri- avoids hypoxia, acidic, and other biological hurdles. The com- butes to biological properties related to human cancer progress- position and structure of mucins enable them to mimic the ion. Tumor growth sites induce inhospitable conditions. Many surface of tumor cells like the surface of normal epithelial cells kinds of research suggest that mucins provide a microenviron- (4). Additionally, the mucus layer captures growth factors or ment to avoid hypoxia, acidic, and other biological conditions cytokines, contributing to cell growth of the tumor. Alter- that promote cancer progression. Given that the mucus layer natively, these properties interfere with the interaction bet- captures growth factors or cytokines, we propose that mucin ween the immune system and tumor cells. Indeed, a high helps to ameliorate inhospitable conditions in tumor-growing concentration of soluble mucins downregulates the motility sites. -
Mucin Family Genes Are Downregulated in Colorectal
ooggeenneessii iinn ss && rrcc aa MM CC uu tt ff aa Journal ofJournal of oo gg Aziz et al., J Carcinogene Mutagene 2014, S10 ll ee ee aa aa nn nn nn nn ee ee rr rr ss ss uu uu ii ii ss ss oo oo DOI: 4172/2157-2518.S10-009 JJ JJ ISSN: 2157-2518 CarCarcinogenesiscinogenesis & Mutagenesis Research Article Article OpenOpen Access Access Mucin Family Genes are Downregulated in Colorectal Cancer Patients Mohammad Azhar Aziz*, Majed AlOtaibi, Abdulkareem AlAbdulrahman, Mohammed AlDrees and Ibrahim AlAbdulkarim Department of Medical Genomics, KIng Abdullah Intl. Med. Res. Ctr., King Saud Bin Abdul Aziz University for Health Sciences, Riyadh, Saudi Arabia Abstract Mucins are very well known to be associated with different types of cancer. Their role in colorectal cancer has been extensively studied without direct correlation with their change in expression levels. In the present study we employed the human exon array from Affymetrix to provide evidence that mucin family genes are downregulated in colorectal cancer tumor samples. We analyzed 92 samples taken from normal and tumor tissues. All mucin family genes except MUCL1 were downregulated with the fold change value ranging from -3.53 to 1.78 as calculated using AltAnalyze software. Maximum drop in RNA transcripts were observed for MUC2 with a fold change of -3.53. Further, we carried out Integromics analysis to analyze mucin genes using hierarchical clustering. MUC1 and MUC4 were found to be potential biomarkers for human colorectal cancer. Top upstream regulators were identified for mucin genes. Network analyses were carried out to further our understanding about potential mechanisms by which mucins can be involved in causing colorectal cancer. -
Intrauterine Growth Restriction Alters Postnatal Colonic Barrier Maturation in Rats
0031-3998/09/6601-0047 Vol. 66, No. 1, 2009 PEDIATRIC RESEARCH Printed in U.S.A. Copyright © 2009 International Pediatric Research Foundation, Inc. Intrauterine Growth Restriction Alters Postnatal Colonic Barrier Maturation in Rats PASCALE FANC¸ A-BERTHON, CATHERINE MICHEL, ANTHONY PAGNIEZ, MARTINE RIVAL, ISABELLE VAN SEUNINGEN, DOMINIQUE DARMAUN, AND CHRISTINE HOEBLER UMR 1280, Physiologie des Adaptations Nutritionnelles [P.F.-B., C.M., A.P., M.R., D.D., C.H.], INRA, Universite´ de Nantes, Nantes F-44093, France; Inserm, U837 [I.V.S.], Jean-Pierre Aubert Research Center, Lille F-59045, France ABSTRACT: Intrauterine growth restriction (IUGR) is a leading secreted mucins (MUC2) and membrane-bound mucins cause of perinatal mortality and morbidity and increases the risk for (MUC1 and 3) have recently been shown to be involved in necrotizing enterocolitis. We hypothesized that colonic barrier colonic protection (8–10). Trefoil factor family 3 (TFF3) is a disruption could be responsible for intestinal frailty in infants and small peptide exerting multiple biologic effects including the adults born with IUGR. Mucins and trefoil factor family 3 (TFF3) actively contribute to epithelium protection and healing. Our aim modulation of healing, inflammation, and differentiation (11). was to determine whether IUGR affects colonic mucosa matura- TFF3 is, thus, considered essential for epithelial restitution tion. IUGR was induced by dietary protein restriction in pregnant (12). dams. Mucins and Tff3 expression and morphologic maturation of Barrier disruption, involving some of the latter mucosal the colonic mucosa were followed during postnatal development constituents, has been reported in various diseases. Mucin of the offspring. Before weaning, mucin 2 and Tff3 protein levels expression is dramatically altered in inflammatory bowel dis- were reduced in colonic mucosa of rats with IUGR compared with eases and colorectal cancer (13). -
And HPV18-Infected Early Stage Cervical Cancers and Normal
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Virology 331 (2005) 269–291 www.elsevier.com/locate/yviro Gene expression profiles of primary HPV16- and HPV18-infected early stage cervical cancers and normal cervical epithelium: identification of novel candidate molecular markers for cervical cancer diagnosis and therapy Alessandro D. Santina,*, Fenghuang Zhanb, Eliana Bignottia, Eric R. Siegelc, Stefania Cane´ a, Stefania Bellonea, Michela Palmieria, Simone Anfossia, Maria Thomasd, Alexander Burnetta, Helen H. Kaye, Juan J. Romana, Timothy J. O’Briena, Erming Tianb, Martin J. Cannonf, John Shaughnessy Jr.b, Sergio Pecorellig aDivision of Gynecologic Oncology, University of Arkansas for Medical Sciences, Little Rock, AR 72205, USA bMyeloma Institute for Research and Therapy, University of Arkansas for Medical Sciences, Little Rock, AR 72205, USA cDepartment of Biostatistics, University of Arkansas for Medical Sciences, Little Rock, AR 72205, USA dDepartment of Pathology, University of Arkansas for Medical Sciences, Little Rock, AR 72205, USA eDepartment of Obstetrics and Gynecology, University of Arkansas for Medical Sciences, Little Rock, AR 72205, USA fDepartment of Microbiology and Immunology, University of Arkansas, Little Rock, AR 72205, USA gDivision of Gynecologic Oncology, University of Brescia, Brescia, Italy Received 2 July 2004; returned to author for revision 18 August 2004; accepted 9 September 2004 Available online 21 November 2004 Abstract With the goal of identifying genes with a differential pattern of expression between invasive cervical carcinomas (CVX) and normal cervical keratinocytes (NCK), we used oligonucleotide microarrays to interrogate the expression of 14,500 known genes in 11 primary HPV16 and HPV18-infected stage IB–IIA cervical cancers and four primary normal cervical keratinocyte cultures. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Serial Analysis of Gene Expression in Normal P53 Null Mammary Epithelium
Oncogene (2002) 21, 6366 – 6376 ª 2002 Nature Publishing Group All rights reserved 0950 – 9232/02 $25.00 www.nature.com/onc Serial analysis of gene expression in normal p53 null mammary epithelium C Marcelo Aldaz*,1, Yuhui Hu1, Rachael Daniel1, Sally Gaddis1, Frances Kittrell2 and Daniel Medina2 1The University of Texas M.D. Anderson Cancer Center, Department of Carcinogenesis, Smithville, Texas, TX 78957, USA; 2Baylor College of Medicine Department of Molecular and Cellular Biology, Houston, Texas, TX 77030, USA Much evidence has accumulated implicating the p53 gene function although activating mutations were also as of importance in breast carcinogenesis. However, observed. Usually p53 abnormalities associate with much still remains to be uncovered on the specific poorer clinical outcome. This, likely, is the consequence downstream pathways influenced by this important of the known critical roles of p53 in regulating the cell activator/repressor of transcription. This study investi- cycle, apoptosis, DNA repair and maintaining genome gated the effects of a p53 null genotype on the stability (Levine, 1997). The loss of wild type p53 transcriptome of ‘normal’ mouse mammary epithelium function is clearly an important event in breast using a unique in vivo model of preneoplastic transforma- tumorigenesis as documented both in human and murine tion. We used SAGE for the comparative analysis of p53 systems (Donehower et al., 1995; Elledge and Allred, wild type (wt) and null mammary epithelium unexposed 1994). However, the exact mechanisms by which such and exposed to hormonal stimulation. Analysis of the lack of normal gene function leads to cancer formation hormone exposed samples provided a comprehensive view and progression are only beginning to be understood.