New Developments in Goblet Cell Mucus Secretion and Function
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												
												Appendiceal GCC and LAMN Navigating the Alphabet Soup in the Appendix
2018 Park City AP Update Appendiceal GCC and LAMN Navigating the Alphabet Soup in the Appendix Sanjay Kakar, MD University of California, San Francisco Appendiceal tumors Low grade appendiceal mucinous neoplasm • Peritoneal spread, chemotherapy • But not called ‘adenocarcinoma’ Goblet cell carcinoid • Not a neuroendocrine tumor • Staged and treated like adenocarcinoma • But called ‘carcinoid’ Outline • Appendiceal LAMN • Peritoneal involvement by mucinous neoplasms • Goblet cell carcinoid -Terminology -Grading and staging -Important elements for reporting LAMN WHO 2010: Low grade carcinoma • Low grade • ‘Pushing invasion’ LAMN vs. adenoma LAMN Appendiceal adenoma Low grade cytologic atypia Low grade cytologic atypia At minimum, muscularis Muscularis mucosa is mucosa is obliterated intact Can extend through the Confined to lumen wall Appendiceal adenoma: intact muscularis mucosa LAMN: Pushing invasion, obliteration of m mucosa LAMN vs adenocarcinoma LAMN Mucinous adenocarcinoma Low grade High grade Pushing invasion Destructive invasion -No desmoplasia or -Complex growth pattern destructive invasion -Angulated infiltrative glands or single cells -Desmoplasia -Tumor cells floating in mucin WHO 2010 Davison, Mod Pathol 2014 Carr, AJSP 2016 Complex growth pattern Complex growth pattern Angulated infiltrative glands, desmoplasia Tumor cells in extracellular mucin Few floating cells common in LAMN Few floating cells common in LAMN Implications of diagnosis LAMN Mucinous adenocarcinoma LN metastasis Rare Common Hematogenous Rare Can occur spread - 
												
												Bioinformatics Approach for Pattern of Myelin-Specific Proteins And
CORE Metadata, citation and similar papers at core.ac.uk Provided by Qazvin University of Medical Sciences Repository Biotech Health Sci. 2016 November; 3(4):e38278. doi: 10.17795/bhs-38278. Published online 2016 August 16. Research Article Bioinformatics Approach for Pattern of Myelin-Specific Proteins and Related Human Disorders Samiie Pouragahi,1,2,3 Mohammad Hossein Sanati,4 Mehdi Sadeghi,2 and Marjan Nassiri-Asl3,* 1Department of Molecular Medicine, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 2Department of Bioinformatics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran 3Department of Pharmacology, Cellular and Molecular Research Center, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 4Department of Molecular Genetics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran *Corresponding author: Marjan Nassiri-Asl, School of Medicine, Qazvin University of Medical Sciences, Qazvin, IR Iran. Tel: +98-2833336001, Fax: +98-2833324971, E-mail: [email protected] Received 2016 April 06; Revised 2016 May 30; Accepted 2016 June 22. Abstract Background: Recent neuroinformatic studies, on the structure-function interaction of proteins, causative agents basis of human disease have implied that dysfunction or defect of different protein classes could be associated with several related diseases. Objectives: The aim of this study was the use of bioinformatics approaches for understanding the structure, function and relation- ship of myelin protein 2 (PMP2), a myelin-basic protein in the basis of neuronal disorders. Methods: A collection of databases for exploiting classification information systematically, including, protein structure, protein family and classification of human disease, based on a new approach was used. - 
												
												Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. - 
												
												Te2, Part Iii
TERMINOLOGIA EMBRYOLOGICA Second Edition International Embryological Terminology FIPAT The Federative International Programme for Anatomical Terminology A programme of the International Federation of Associations of Anatomists (IFAA) TE2, PART III Contents Caput V: Organogenesis Chapter 5: Organogenesis (continued) Systema respiratorium Respiratory system Systema urinarium Urinary system Systemata genitalia Genital systems Coeloma Coelom Glandulae endocrinae Endocrine glands Systema cardiovasculare Cardiovascular system Systema lymphoideum Lymphoid system Bibliographic Reference Citation: FIPAT. Terminologia Embryologica. 2nd ed. FIPAT.library.dal.ca. Federative International Programme for Anatomical Terminology, February 2017 Published pending approval by the General Assembly at the next Congress of IFAA (2019) Creative Commons License: The publication of Terminologia Embryologica is under a Creative Commons Attribution-NoDerivatives 4.0 International (CC BY-ND 4.0) license The individual terms in this terminology are within the public domain. Statements about terms being part of this international standard terminology should use the above bibliographic reference to cite this terminology. The unaltered PDF files of this terminology may be freely copied and distributed by users. IFAA member societies are authorized to publish translations of this terminology. Authors of other works that might be considered derivative should write to the Chair of FIPAT for permission to publish a derivative work. Caput V: ORGANOGENESIS Chapter 5: ORGANOGENESIS - 
												
												Coffee and Its Effect on Digestion
Expert report Coffee and its effect on digestion By Dr. Carlo La Vecchia, Professor of Medical Statistics and Epidemiology, Dept. of Clinical Sciences and Community Health, Università degli Studi di Milano, Italy. Contents 1 Overview 2 2 Coffee, a diet staple for millions 3 3 What effect can coffee have on the stomach? 4 4 Can coffee trigger heartburn or GORD? 5 5 Is coffee associated with the development of gastric or duodenal ulcers? 6 6 Can coffee help gallbladder or pancreatic function? 7 7 Does coffee consumption have an impact on the lower digestive tract? 8 8 Coffee and gut microbiota — an emerging area of research 9 9 About ISIC 10 10 References 11 www.coffeeandhealth.org May 2020 1 Expert report Coffee and its effect on digestion Overview There have been a number of studies published on coffee and its effect on different areas of digestion; some reporting favourable effects, while other studies report fewer positive effects. This report provides an overview of this body of research, highlighting a number of interesting findings that have emerged to date. Digestion is the breakdown of food and drink, which occurs through the synchronised function of several organs. It is coordinated by the nervous system and a number of different hormones, and can be impacted by a number of external factors. Coffee has been suggested as a trigger for some common digestive complaints from stomach ache and heartburn, through to bowel problems. Research suggests that coffee consumption can stimulate gastric, bile and pancreatic secretions, all of which play important roles in the overall process of digestion1–6. - 
												
												Oral Absorption of Peptides and Nanoparticles Across the Human Intestine: Opportunities, Limitations and Studies in Human Tissues☆
Advanced Drug Delivery Reviews 106 (2016) 256–276 Contents lists available at ScienceDirect Advanced Drug Delivery Reviews journal homepage: www.elsevier.com/locate/addr Oral absorption of peptides and nanoparticles across the human intestine: Opportunities, limitations and studies in human tissues☆ P. Lundquist, P. Artursson ⁎ Department of Pharmacy, Uppsala University, Box 580, SE-752 37 Uppsala, Sweden article info abstract Article history: In this contribution, we review the molecular and physiological barriers to oral delivery of peptides and nanopar- Received 2 May 2016 ticles. We discuss the opportunities and predictivity of various in vitro systems with special emphasis on human Received in revised form 2 July 2016 intestine in Ussing chambers. First, the molecular constraints to peptide absorption are discussed. Then the phys- Accepted 8 July 2016 iological barriers to peptide delivery are examined. These include the gastric and intestinal environment, the Available online 3 August 2016 mucus barrier, tight junctions between epithelial cells, the enterocytes of the intestinal epithelium, and the Keywords: subepithelial tissue. Recent data from human proteome studies are used to provide information about the protein fi Oral drug delivery expression pro les of the different physiological barriers to peptide and nanoparticle absorption. Strategies that Peptide drugs have been employed to increase peptide absorption across each of the barriers are discussed. Special consider- Nanoparticles ation is given to attempts at utilizing endogenous transcytotic pathways. To reliably translate in vitro data on Ussing chamber peptide or nanoparticle permeability to the in vivo situation in a human subject, the in vitro experimental system Peptide permeability needs to realistically capture the central aspects of the mentioned barriers. - 
												
												Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo - 
												
												Associated Lymphoid Tissue in Chickens and Turkeys Andrew Stephen Fix Iowa State University
Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 1990 The trs ucture and function of conjunctiva- associated lymphoid tissue in chickens and turkeys Andrew Stephen Fix Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Animal Sciences Commons, and the Veterinary Medicine Commons Recommended Citation Fix, Andrew Stephen, "The trs ucture and function of conjunctiva-associated lymphoid tissue in chickens and turkeys " (1990). Retrospective Theses and Dissertations. 9496. https://lib.dr.iastate.edu/rtd/9496 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. INFORMATION TO USERS The most advanced technology has been used to photograph and reproduce this manuscript from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. Hie quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. - 
												
												Comparative Anatomy of the Lower Respiratory Tract of the Gray Short-Tailed Opossum (Monodelphis Domestica) and North American Opossum (Didelphis Virginiana)
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 12-2001 Comparative Anatomy of the Lower Respiratory Tract of the Gray Short-tailed Opossum (Monodelphis domestica) and North American Opossum (Didelphis virginiana) Lee Anne Cope University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Animal Sciences Commons Recommended Citation Cope, Lee Anne, "Comparative Anatomy of the Lower Respiratory Tract of the Gray Short-tailed Opossum (Monodelphis domestica) and North American Opossum (Didelphis virginiana). " PhD diss., University of Tennessee, 2001. https://trace.tennessee.edu/utk_graddiss/2046 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Lee Anne Cope entitled "Comparative Anatomy of the Lower Respiratory Tract of the Gray Short-tailed Opossum (Monodelphis domestica) and North American Opossum (Didelphis virginiana)." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the equirr ements for the degree of Doctor of Philosophy, with a major in Animal Science. Robert W. Henry, Major Professor We have read this dissertation and recommend its acceptance: Dr. R.B. Reed, Dr. C. Mendis-Handagama, Dr. J. Schumacher, Dr. S.E. Orosz Accepted for the Council: Carolyn R. - 
												
												Study Guide Medical Terminology by Thea Liza Batan About the Author
Study Guide Medical Terminology By Thea Liza Batan About the Author Thea Liza Batan earned a Master of Science in Nursing Administration in 2007 from Xavier University in Cincinnati, Ohio. She has worked as a staff nurse, nurse instructor, and level department head. She currently works as a simulation coordinator and a free- lance writer specializing in nursing and healthcare. All terms mentioned in this text that are known to be trademarks or service marks have been appropriately capitalized. Use of a term in this text shouldn’t be regarded as affecting the validity of any trademark or service mark. Copyright © 2017 by Penn Foster, Inc. All rights reserved. No part of the material protected by this copyright may be reproduced or utilized in any form or by any means, electronic or mechanical, including photocopying, recording, or by any information storage and retrieval system, without permission in writing from the copyright owner. Requests for permission to make copies of any part of the work should be mailed to Copyright Permissions, Penn Foster, 925 Oak Street, Scranton, Pennsylvania 18515. Printed in the United States of America CONTENTS INSTRUCTIONS 1 READING ASSIGNMENTS 3 LESSON 1: THE FUNDAMENTALS OF MEDICAL TERMINOLOGY 5 LESSON 2: DIAGNOSIS, INTERVENTION, AND HUMAN BODY TERMS 28 LESSON 3: MUSCULOSKELETAL, CIRCULATORY, AND RESPIRATORY SYSTEM TERMS 44 LESSON 4: DIGESTIVE, URINARY, AND REPRODUCTIVE SYSTEM TERMS 69 LESSON 5: INTEGUMENTARY, NERVOUS, AND ENDOCRINE S YSTEM TERMS 96 SELF-CHECK ANSWERS 134 © PENN FOSTER, INC. 2017 MEDICAL TERMINOLOGY PAGE III Contents INSTRUCTIONS INTRODUCTION Welcome to your course on medical terminology. You’re taking this course because you’re most likely interested in pursuing a health and science career, which entails proficiencyincommunicatingwithhealthcareprofessionalssuchasphysicians,nurses, or dentists. - 
												
												Supplementary Table 1: Adhesion Genes Data Set
Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like, - 
												
												Mucin Family Genes Are Downregulated in Colorectal
ooggeenneessii iinn ss && rrcc aa MM CC uu tt ff aa Journal ofJournal of oo gg Aziz et al., J Carcinogene Mutagene 2014, S10 ll ee ee aa aa nn nn nn nn ee ee rr rr ss ss uu uu ii ii ss ss oo oo DOI: 4172/2157-2518.S10-009 JJ JJ ISSN: 2157-2518 CarCarcinogenesiscinogenesis & Mutagenesis Research Article Article OpenOpen Access Access Mucin Family Genes are Downregulated in Colorectal Cancer Patients Mohammad Azhar Aziz*, Majed AlOtaibi, Abdulkareem AlAbdulrahman, Mohammed AlDrees and Ibrahim AlAbdulkarim Department of Medical Genomics, KIng Abdullah Intl. Med. Res. Ctr., King Saud Bin Abdul Aziz University for Health Sciences, Riyadh, Saudi Arabia Abstract Mucins are very well known to be associated with different types of cancer. Their role in colorectal cancer has been extensively studied without direct correlation with their change in expression levels. In the present study we employed the human exon array from Affymetrix to provide evidence that mucin family genes are downregulated in colorectal cancer tumor samples. We analyzed 92 samples taken from normal and tumor tissues. All mucin family genes except MUCL1 were downregulated with the fold change value ranging from -3.53 to 1.78 as calculated using AltAnalyze software. Maximum drop in RNA transcripts were observed for MUC2 with a fold change of -3.53. Further, we carried out Integromics analysis to analyze mucin genes using hierarchical clustering. MUC1 and MUC4 were found to be potential biomarkers for human colorectal cancer. Top upstream regulators were identified for mucin genes. Network analyses were carried out to further our understanding about potential mechanisms by which mucins can be involved in causing colorectal cancer.